JP3241555B2 - Amplification and detection of target nucleic acid sequences using thermostable enzymes - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for amplifying a specific nucleic acid sequence and RNA of a specific nucleic acid sequence obtained by the amplification method.
The present invention relates to a method for detecting a nucleic acid sequence of interest from a copy or a DNA copy, and a reagent kit used for the method.

[0002]

2. Description of the Related Art Methods for diagnosing diseases by detecting genes such as DNA or RNA have been developed for detecting bacteria, viruses and the like. In some kinds of specimens, a sufficient amount of nucleic acid exists for direct detection, but it is difficult to directly detect the target gene when the target gene is extremely small or the abundance ratio is very small. Conventionally, the number of target genes has been increased by a cell culture method or a bacterial culture method, but these methods have a drawback that they require a long time.

As another method of amplifying a target nucleic acid, a polymerase chain reaction (PCR; Japanese Patent Publication No. 4-67957) is known. In this method, the degree of amplification of the target nucleic acid is adjusted by the number of cycles. The amplification factor is theoretically determined by 2 ⁿ (n is the number of cycles). It took 25 to 30 cycles to actually amplify the target nucleic acid to a detectable amount.

[0004] Further, as another nucleic acid amplification method, replicated RN
An A-based amplification system is known (JP-A-2-5864).
JP-A-2-500565, JP-A-2-50153
No. 2). In these methods, a primer used for synthesizing double-stranded DNA from a target nucleic acid contains a promoter sequence of a DNA-dependent RNA polymerase, so that the synthesized double-stranded DNA is synthesized following double-stranded DNA synthesis.
Using NA as a template, RNA corresponding to the target nucleic acid is synthesized by a DNA-dependent RNA polymerase. further,
A DNA / RNA strand is synthesized from the synthesized RNA by an RNA-dependent DNA polymerase, and the DNA strand is separated to obtain a single-stranded DNA. As a method for separating DNA, a method using heat denaturation (JP-A-2-500565, JP-A-2-501532) and a method using ribonuclease H (JP-A-2-5864) are known. The single-stranded DNA thus obtained and the primers are used to generate a double-stranded DNA containing a DNA-dependent RNA polymerase promoter sequence.
Perform NA synthesis and perform RNA transcription reaction. According to this method, tens to thousands of molecules of RNA can be transcribed and amplified from one molecule of double-stranded nucleic acid by the DNA-dependent RNA polymerase, and the amplification efficiency per cycle is higher than that of the PCR method. When ribonuclease H is used, P
The temperature cycle required for the CR method is unnecessary, and amplification can be performed more easily.

[0005]

The amplification efficiency of a replication RNA-based amplification system is high, but the conventional enzymes used in the reaction system, ie, RNA-dependent DNA polymerase, DNA-dependent RNA polymerase, and DNA-dependent DNA polymerase have low thermal stability. Since the temperature is low, the temperature at the time of the amplification reaction cannot be increased, non-specific hybridization between the template nucleic acid and the primer cannot be avoided, and a decrease in specificity becomes a problem. In addition, instability during supply and storage of the enzyme as a reagent becomes a serious problem, and requires frozen storage or refrigerated storage. Furthermore, in the amplification method not using ribonuclease H, heat denaturation is used for denaturation of double-stranded nucleic acid. However, since the enzyme is unstable, it is necessary to sequentially add a group of enzymes each time heating is performed. An object of the present invention is to provide a method for solving the instability during nonspecific hybridization, supply of an enzyme reagent, and storage due to nonspecific hybridization.

[0006]

SUMMARY OF THE INVENTION One aspect of the present invention provides
A method for increasing the copy number of a target nucleic acid sequence at a substantially constant temperature in a reaction medium, comprising the following steps: a method for amplifying a target nucleic acid sequence using a thermostable enzyme. Step 1: The single-stranded first template RNA obtained by denaturing the target nucleic acid as necessary has a sequence sufficiently complementary to the nucleic acid sequence (RNA) of the first template and a promoter sequence at the 5 ′ end thereof The first primer is hybridized and extended with a thermostable RNA-dependent DNA polymerase to obtain a first primer extension (DNA) that is a second template complementary to the first template RNA; Step 2: RNA / DNA hybrid Step 3: Separating the second template DNA from the first template RNA to obtain a single-stranded second template nucleic acid (DNA) by a thermostable ribonuclease H that specifically decomposes only the RNA of step 3; A second primer having a nucleic acid sequence complementary to the nucleic acid sequence (DNA) of the second template is hybridized to the two template DNA, and the resulting DNA is subjected to heat-resistant DNA-dependent DNA polymerase. To obtain a second primer extension (DNA) complementary to the second template DNA, thus producing a double-stranded DNA intermediate having a functionally operable promoter sequence upstream of the target nucleic acid sequence; (Where the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 'end of the first primer is the 3' end of the second primer on the complementary strand Step 4: The target nucleic acid sequence (first template RN) is converted from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence.
A) generating a single-stranded third template RNA having a sequence complementary to A); Step 5: hybridizing the second primer to the single-stranded third template RNA, and using a heat-resistant RNA-dependent DNA polymerase Elongation to obtain a second primer extension (DNA), which is a fourth template complementary to the third template RNA; Step 6: With heat-resistant ribonuclease H, which specifically degrades only RNA of the RNA / DNA hybrid, Separating the fourth template DNA from the third template RNA to obtain a single-stranded second template nucleic acid (DNA); Step 7: allowing the first primer to hybridize to the single-stranded fourth template DNA, First primer extension (DNA) that is extended by a sex DNA-dependent DNA polymerase and is complementary to the fourth template DNA and complementary to the promoter sequence of the first primer Obtaining a fourth template DNA extension, thus producing a double-stranded DNA intermediate having a functional promoter sequence upstream of the target nucleic acid sequence; wherein the nucleic acid sequence of the first or second primer is Is sufficiently complementary or homologous to the target nucleic acid sequence, the 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand) Step 8: Recognizing the promoter sequence The target nucleic acid sequence (first template RN) from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of
A) increasing the copy of the single-stranded third template RNA having a sequence complementary to A); and step 9: repeating steps 5 to 8 as many times as necessary using the RNA copy.

[0007] Another aspect of the present invention is a method for increasing the copy number of a target nucleic acid sequence in a reaction medium, comprising the following steps: Amplification of a target nucleic acid sequence using a thermostable enzyme. Is the law. Step 1: a first primer having a sequence sufficiently complementary to the nucleic acid sequence of the first template and a promoter sequence at the 5′-terminal side of the single-stranded first template DNA obtained by denaturing the target nucleic acid as necessary And heat resistance D
Extended by NA-dependent DNA polymerase, the first template D
Obtain a first primer extension (DNA) that is a second template complementary to NA; Step 2: separating the second template DNA from the first template DNA to obtain a single-stranded second template nucleic acid (DNA) Step 3: a second primer having a nucleic acid sequence (DNA) complementary to the nucleic acid sequence (DNA) of the second template is hybridized to the single-stranded second template DNA, and is extended by a heat-resistant DNA-dependent DNA polymerase. And obtaining a second primer extension (DNA) complementary to the second template DNA, thus producing a double-stranded DNA intermediate having a functionally operable promoter sequence upstream of the target nucleic acid sequence; The nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is located at the 3 ′ end of the second primer on the complementary strand. Vignetting are) Step 4: using a thermostable DNA-dependent RNA polymerase which can recognize said promoter sequence, wherein said target nucleic acid sequence from a double-stranded DNA intermediate (first mold DN
A) increasing the copy of the single-stranded third template RNA having a sequence complementary to A); Step 5: hybridizing the second primer to the single-stranded third template RNA to obtain a thermostable RNA-dependent DNA Extending with a polymerase to obtain a second primer extension (DNA) that is a fourth template complementary to the third template RNA; Step 6: heat-resistant ribonuclease H that specifically degrades only RNA of RNA / DNA hybrid Separating the fourth template DNA from the third template RNA to obtain a single-stranded fourth template nucleic acid (DNA); Step 7: allowing the first primer to hybridize to the single-stranded fourth template DNA, The first primer extension (DNA), which is extended by a thermostable DNA-dependent DNA polymerase and is complementary to the fourth template DNA, and the promoter sequence of the first primer The resulting complement specific fourth template DNA elongation product,
This produces a double-stranded DNA intermediate having a functional promoter sequence upstream of the target nucleic acid sequence; wherein the nucleic acid sequence of the first or second primer is sufficiently complementary to the target nucleic acid sequence. The 3 ′ end of the first primer is directed to the 3 ′ end of the second primer on the complementary strand) Step 8: Using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence Using the RNA copy to increase the copy of the single-stranded third template RNA having a sequence complementary to the target nucleic acid sequence from the double-stranded DNA intermediate; and Steps 5 to 8 are repeated as many times as necessary.

[0008] Still another embodiment of the present invention relates to a single-stranded RNA or a double-stranded DNA which is an amplification product obtained by the above-described amplification method.
Alternatively, after performing a denaturation treatment on the DNA / RNA hybrid if necessary, the labeled probe is hybridized,
A method for detecting a target nucleic acid sequence, comprising detecting a label of a hybridized labeled probe or a label of a non-hybridized labeled probe.

[0009] Still another embodiment of the present invention is a kit for amplifying a specific nucleic acid sequence. One embodiment of such a kit is a kit for amplifying a specific nucleic acid sequence, which has (a) a sequence sufficiently complementary to the nucleic acid sequence of the first template and a promoter sequence at the 5 'end thereof. A first primer, (b) a second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template, (c) thermostable ribonuclease H, (d) thermostable RNA-dependent DNA polymerase, (e) thermostable DNA-dependent RNA polymerase, (f) thermostable DNA-dependent DNA polymerase,
(G) ribonucleoside triphosphate and (h)
And deoxyribonucleoside triphosphate,
However, the nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is located at the 3 ′ end of the second primer on the complementary strand. It is a kit aimed at.

Another embodiment of the kit is a kit for amplifying a specific nucleic acid sequence, which comprises: (a) a sequence sufficiently complementary to the nucleic acid sequence of the first template; 'A first primer having a promoter sequence on the terminal side, (b) a second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template, (c) thermostable ribonuclease H, (d) thermostable DNA-dependent RNA polymerase,
(E) a thermostable DNA-dependent DNA polymerase having an RNA-dependent DNA polymerase activity, (f) ribonucleoside triphosphate and (g) deoxyribonucleoside triphosphate, provided that the nucleic acid sequence of the first primer or the second primer is a target. A kit that is sufficiently complementary or homologous to a nucleic acid sequence with the 3 'end of the first primer directed to the 3' end of the second primer on the complementary strand.

[0011] Further, another embodiment of the kit is a kit for amplifying a specific nucleic acid sequence, comprising:
A first primer having a sequence sufficiently complementary to the nucleic acid sequence of the first template and a promoter sequence at the 5 ′ end thereof, and (b) a first primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template. Two primers, (c) thermostable DNA-dependent RNA polymerase, (d) thermostable D having RNA-dependent DNA polymerase activity and ribonuclease H activity
NA-dependent DNA polymerase, (e) ribonucleoside triphosphate and (f) deoxyribonucleoside triphosphate, provided that the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence. Wherein the 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand.

Still another embodiment of the kit is a kit for amplifying a specific nucleic acid sequence, which comprises: (a) a sequence sufficiently complementary to the nucleic acid sequence of the first template and its 5 ′
A first primer having a promoter sequence on the terminal side,
(B) a second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template and a promoter sequence at the 5 ′ end thereof, (c) thermostable ribonuclease H, (d) thermostable RNA-dependent DNA polymerase, (E) Heat resistant DN
A-dependent RNA polymerase, (f) thermostable DNA-dependent D
NA polymerase, (g) ribonucleoside triphosphate and (h) deoxyribonucleoside triphosphate, provided that the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence. A kit in which the 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand.

Still another embodiment of the kit is a kit for amplifying a specific nucleic acid sequence, which comprises: (a) a sequence sufficiently complementary to the nucleic acid sequence of the first template and 5 ′ thereof. A first primer having a promoter sequence on the terminal side, (b) a nucleic acid sequence complementary to the nucleic acid sequence of the second template and a second primer having a promoter sequence on the 5′-terminal side thereof, and (c) a thermostable ribonuclease H ,
(D) thermostable DNA-dependent RNA polymerase, (e) R
Thermostable DN having NA-dependent DNA polymerase H activity
A-dependent DNA polymerase, (f) ribonucleoside triphosphate and (g) deoxyribonucleoside triphosphate, provided that the sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence. Yes, a kit in which the 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand.

[0014] Another embodiment of the kit of the present invention is a kit for amplifying a specific nucleic acid sequence, comprising:
A first primer having a sequence sufficiently complementary to the nucleic acid sequence of the first template and a promoter sequence at the 5 'end thereof, and (b) a nucleic acid sequence complementary to the nucleic acid sequence of the second template and its 5 'A second primer having a promoter sequence on the terminal side, (c) a thermostable DNA-dependent RNA polymerase, (d) a thermostable DNA-dependent D having RNA-dependent DNA polymerase activity and nuclease H activity
NA polymerase, (e) ribonucleoside triphosphate and (f) deoxyribonucleoside triphosphate, provided that the sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence; The 3 'end of the first primer is a kit directed to the 3' end of the second primer on the complementary strand.

The target nucleic acid of the present invention may be DNA or RN.
A may be used. In the case of a double-stranded structure or a single-stranded structure having a higher-order structure, it is subjected to an amplification reaction in advance as a single-stranded structure by heating, denaturing treatment with an acid, an alkali, or the like. When the target nucleic acid is DNA, the amplification method of the present invention may be carried out after conversion into RNA by a conventionally known method.

The first primer used in the present invention has a nucleic acid sequence sufficiently complementary to the nucleic acid sequence of the first template, which is the target nucleic acid sequence, and a promoter sequence at the 5 'end thereof. The 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand. Also,
The second primer in the present invention has a nucleic acid sequence complementary to the nucleic acid sequence of the second template, and is sufficiently homologous to the target nucleic acid sequence. The second primer may have a promoter sequence at its 5 'end if necessary in addition to the nucleic acid sequence complementary to the nucleic acid sequence of the second template. When the second primer has a promoter sequence, the promoters of the first primer and the second primer may be different or the same. If different, a plurality of heat-resistant DNA-dependent RNA polymerases acting on respective promoters are used if necessary. A type of thermostable DNA-dependent RNA depending on the type of promoter
It is also possible to select such that the two types of promoters function together by a polymerase. Amplification efficiency can be further improved by providing both the first primer and the second primer with a promoter function.

The setting of the promoter sequence varies depending on the target nucleic acid to be amplified, and when performing amplification in a state of high specificity, it is preferable to set the Tm of the primer to 50 to 70 ° C. When performing amplification at temperatures below this,
It is necessary to carefully examine the primer sequence to maintain the specificity, and the nucleic acid sequence to be amplified cannot be freely selected.

The promoter sequence used in the present invention is not particularly limited, but must be a sequence that functions so that a thermostable DNA-dependent RNA polymerase acts. Examples of such a promoter sequence include, for example, the DNA-dependent RNA polymerase of Thermus thermophilus (Thermus thermphilus); 3 '5'-CTAGCCTCAGGGCTTCCATGGGTGCTATACT-3'5'-CTTGACCCCGCAGGCCTCGAGGGCTTACCT-3'is known. Generally, the promoter sequence has a spacer sequence extending to the replication origin that follows. For example, in the case of CTTGACAAAAAGGAGGGGGATTGATAGCAT, the following GGCTTT is known. It is also possible to consider the spacer sequence up to these replication origins, and further the sequence of the part that initiates replication, as a promoter.In fact, it is also known that the efficiency of transcription and replication is higher when this sequence is included. I have.
Therefore, the efficiency of transcription amplification can be increased by designing a primer with a promoter containing this sequence portion. In the present invention, amplification can be performed even with a primer in which a sequence containing a spacer sequence up to the replication start point is linked to the 5 'end of the primer.

Other promoter sequences include the following. 5'-CTTGACGCCGCCCAGGGCGGGCCTCTACCCT-3 '5'-TTTGAGGGCCTGGGGCAGTACCTCTTCT-3'5'-TTTGTAAAGTGCTTTATTTCACAAAACT-3'5'-TTTCACAAAACTGTCCCTCCCCCCGGGTTAGACT-3'5'-3'-CTTGACAAAAAGGAGGGGGATTGATAGCAT-3'5'-CGTGAGGGCCACGGCGAGCGCGCCTAGGGGT-3'5'-CTAGTCCAAGGGAAAGTATAGCCCAAGGTACACT-3'5'-CTTGACGTGAAACTTGAAGACCACCATCATCAA-3'5'-TTCGCGCCCATCGCCTCGGCCTCGGCCTCCGCCTGCCTCTCGGCCTGCCTCGGCCTCCGCCTCGGCCTCGGCCTCCCGGCCTGCCTCGGCTCC -CTAGCCTCAGGGCTTCCATGGGTGCTATACT-3 '5'-CTTGACAAAaaggagggggattgatagcat-3'5'-CTTGACCCCGCAGGCCTCGAGGGCTTACCT-3'5'-CTTGACACCGCAGGCCTAGAGGGCTTACCT-3'5'-CTTGACACCGCAGGCCTCGAGGGCTATCCTGGCT-GGCTGATC-GGCTGATCCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG-3CT CTTGACACCCCAGGCCTCGAGGGGTATCCT-3 '5'-GTTTACAAAATCCCCGCCCCCGTCCTAGCCT-3'5'-CTTGCCAATCCGCCCCTTAGAGTGTACCATAGCGA-3'5'-GTTGACCATCTTCCTCCTTGGCCTTATCCT-3'5'-GTTGACGGGACGGGTAGCTGACTCTCTCT TATGGTAACAT-3 '5'-CTTGACGGGGAGGAGGCAACGGGGTAAAAC-3'

In general, phage promoters have high specificity, but promoters of other organisms may not always be high in specificity. The term “high specificity” as used herein means that a promoter sequence capable of acting on a promoter-dependent DNA-dependent RNA polymerase has its DNA
It means that one or more dependent RNA polymerases are very low and that the activity as a promoter is very low. Therefore, even if various promoters are present in the sample nucleic acid to be detected, the DNA-dependent RN which specifically depends on the promoters without any problem.
A shows that A polymerase can act.

On the other hand, in bacteria and other organisms, DNA-dependent R
It is known that there is not always one type of promoter sequence on which NA polymerase acts, and there are a plurality of types of promoter sequences. Some bacteria and fungi have high commonality. Therefore, it is conceivable that the sample nucleic acid to be detected may contain a promoter sequence on which the DNA-dependent RNA polymerase to be used acts.

In the present invention, as a result of studying in consideration of such points, the reaction at 50 to 70 ° C. at which a heat-resistant DNA-dependent RNA polymerase can act does not result in the expression of a non-specific promoter function. Highly specific amplification and detection are possible. In the present invention, the double-stranded DNA intermediate having a promoter sequence operable upstream of the target nucleic acid sequence means the double-stranded DNA intermediate (FIG. 1 or FIG. 3) in step 3 or step 7, By the action of thermostable DNA-dependent RNA polymerase, DNA
Has a function of initiating the synthesis of RNA using as a template. RNA produced by the function of the promoter is:
It has a sequence complementary to the target RNA.

The term “thermostable enzyme” as used in the present invention means that an enzyme reaction can be carried out at 50 to 70 ° C. in order to specifically carry out hybridization, and 90 to 9 wherein heat denaturation of nucleic acid is carried out.
It refers to an enzyme with little deactivation even at 5 ° C. for about 10 seconds to 10 minutes. In addition, such enzymes are generally sufficiently stable even under refrigerated storage or room temperature storage, and in many cases, there is no need for frozen storage, and the stability during supply and storage is also good.

As the thermostable RNA-dependent DNA polymerase (also referred to as thermostable reverse transcriptase), the DNA-dependent DNA polymerase derived from Thermus thermophilus or Thermus aquaticus has the activity. It has been known. Examples of the thermostable DNA-dependent RNA polymerase (also referred to as thermostable RNA polymerase) include Thermos thermophilus (T.
hermus thermophilus). The thermostable DNA-dependent RNA polymerase can recognize a promoter sequence.

Examples of the thermostable DNA-dependent DNA polymerase (also referred to as thermostable DNA polymerase) include Thermus thermophilus and Thermus thermophilus.
Aquaticus (Thermus aquaticus), Pyrococcus
Phyrococcus furiosus, Thermococcus
And litoralis (Thermococcus litorakis) and those derived from Thermus flavus. Examples of the thermostable ribonuclease H include enzymes derived from Thermus therophilus, and other enzymes can be used as long as they meet the thermostability of the present invention.

In general, RNA-dependent DNA polymerases have a DNA-dependent DNA polymerase activity, and DNA-dependent DNA polymerases derived from Thermus thermophilus and Thermus aquaticus have RNA-dependent DNA polymerase activities.
It is known that a dependent DNA polymerase activity exists, and it is also possible to use one kind of DNA polymerase having both activities in common.

We have also found that a thermostable DNA-dependent DNA polymerase derived from Thermos thermophilus has the activity of thermostable ribonuclease H (Japanese Patent Application No. 6-258190). Therefore, by using a thermostable DNA-dependent DNA polymerase derived from Thermos thermophilus, one substance (enzyme) can be used instead of thermostable RNA-dependent DNA polymerase and thermostable ribonuclease H.
This makes it possible to utilize three types of enzyme activities.

As the thermostable enzyme used in the present invention, thermostable RNA-dependent DNA polymerase, thermostable ribonuclease H and thermostable DNA-dependent DNA polymerase are preferably one enzyme. Such an enzyme is preferably an enzyme derived from Thermos thermophilus having the following physicochemical properties. (1) catalyze the next reaction. DNA is synthesized using RNA as a template. It acts specifically and endogenously only on RNA / DNA double-stranded RNA to produce a DNA single strand. DNA is synthesized using the DNA as a template. (2) Molecular weight: 85,000 to 95,000 (3) Thermal stability: After treatment at 75 ° C. for 2 hours, activity of 50% or more is maintained. (4) Optimum pH: about 7.5 to 9.3 The production of the above enzyme is described in Japanese Patent Application No. 6-258190. For example, it is obtained by culturing Thermos thermophilus HB8 (ATCC 27634) which is a thermophilic bacterium and collecting the thermostable ribonuclease H having the above physicochemical properties from the culture.

In step 1 of the method of the present invention, a first primer is hybridized to a single-stranded first template nucleic acid which has been denatured as required, and a heat-resistant RNA-dependent DNA polymerase and / or a heat-resistant RNA-dependent DNA polymerase are added in the presence of deoxyribonucleoside triphosphate. Alternatively, it is extended by a thermostable DNA-dependent DNA polymerase to obtain a first primer extension product which is a second template complementary to the first template nucleic acid. When the first template is RNA, the first primer extension is heat-resistant RN.
A-dependent DNA polymerase, heat-resistant DNA-dependent DNA polymerase when the first template is DNA, and heat-resistant DNA-dependent DNA polymerase and heat-resistant RNA-dependent DNA polymerase when the target nucleic acid sequence contains DNA and RNA. Thus, a DNA extension product is obtained (FIG. 1, FIG. 2, step 1).

When the first template is RNA, steps 2 to 9 are performed as follows (FIG. 1). In step 2, RNA /
The second template DNA is separated from the first template RNA by a thermostable ribonuclease H that specifically degrades only the RNA of the DNA hybrid to form a single-stranded second template nucleic acid (DN
Obtain A). In step 3, the single-stranded second template DNA is
A second primer having a nucleic acid sequence complementary to the nucleic acid sequence (DNA) of the second template is hybridized and heat-resistant DN
A-dependent DNA polymerase to extend the second template DN
A second primer extension (DNA) complementary to A is obtained, and thus a double-stranded DNA having a target nucleic acid sequence bound to a functional promoter sequence upstream of the target nucleic acid sequence
Produce an intermediate. Here, the nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is located at the 3 ′ end of the second primer on the complementary strand. Pointed. In step 4, the target nucleic acid sequence (first template R) is converted from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence.
A single-stranded third template RNA having a sequence complementary to NA) is generated. In step 5, the single-stranded third template RNA is
The second primer is hybridized and heat-resistant RN
It is extended by A-dependent DNA polymerase to obtain a second primer extension (DNA) which is a fourth template complementary to the third template RNA. In Step 6, the fourth template DNA is converted from the third template RNA by using a thermostable ribonuclease H that specifically degrades only RNA of the RNA / DNA hybrid.
To obtain a single-stranded second template nucleic acid (DNA). In step 7, the first primer is hybridized to a single-stranded fourth template DNA, extended by a heat-resistant DNA-dependent DNA polymerase, and a first primer extension product (DNA) complementary to the fourth template DNA and A fourth template DNA extension complementary to the promoter sequence of the first primer is obtained, thus producing a double-stranded DNA intermediate having the target nucleic acid sequence linked to the upstream operable promoter sequence. Here, the nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is 3 ′ of the second primer on the complementary strand. Pointed to the end. In step 8, the target nucleic acid sequence (first template RN) is converted from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence.
The copy of the single-stranded third template RNA having a sequence complementary to A) is increased. In step 9, the above steps 5 to 8 are repeated as necessary by using the RNA copy as necessary.

When the first template is DNA, steps 2 to 9 are performed as follows (FIG. 2). In step 2, the second template DNA is separated from the first template DNA to obtain a single-stranded second template nucleic acid (DNA). In step 3, a second primer having a nucleic acid sequence (DNA) complementary to the nucleic acid sequence (DNA) of the second template is hybridized to the single-stranded second template DNA, and extended by a heat-resistant DNA-dependent DNA polymerase. Then, a second primer extension (DNA) complementary to the second template DNA is obtained, and thus a double-stranded DNA intermediate having a promoter sequence upstream of the target nucleic acid sequence is generated. Here, the nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is located at the 3 ′ end of the second primer on the complementary strand. Pointed. In step 4,
Heat-resistant D capable of recognizing the promoter sequence
Using NA-dependent RNA polymerase, the double-stranded DN
A copy of the single-stranded third template RNA having a sequence complementary to the target nucleic acid sequence (first template) is increased from the A intermediate. In step 5, the second primer is hybridized to a single-stranded third template RNA, and the heat-resistant RNA-dependent D
A second primer extension (DN), which is a fourth template complementary to the third template RNA after being extended by NA polymerase
Obtain A). In step 6, the fourth template DNA is separated from the third template RNA by a thermostable ribonuclease H that specifically degrades only the RNA of the RNA / DNA hybrid to obtain a single-stranded second template nucleic acid (DNA). In step 7, the first primer is hybridized to the single-stranded fourth template DNA, extended by a thermostable DNA-dependent DNA polymerase, and the fourth template DN complementary to the fourth template DNA.
A extension and thus a double stranded DN having a target nucleic acid sequence linked to an upstream operable promoter sequence
Produce A intermediate. Here, the nucleic acid sequence of the first primer or the second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is 3 ′ of the second primer on the complementary strand. Pointed to the end. In step 8, a single-stranded DNA having a sequence complementary to the target nucleic acid sequence (first template) is converted from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence. Third template RN
Increase the copy of A. In step 9, the above steps 5 to 8 are repeated as necessary by using the RNA copy as necessary.

When a plurality of thermostable enzyme groups are used in the method of the present invention, these enzyme groups are not deactivated even during heat denaturation, and there is no need to sequentially add enzymes. In conventional nucleic acid amplification methods, ordinary enzymes act at room temperature, but cannot be used at high temperatures because these enzymes are unstable. On the other hand, to maintain the specificity of the primer, the reaction temperature is preferably higher. Therefore, in order to maintain the specificity of the primer at a relatively low temperature, it is necessary to greatly restrict the primer sequence, and it is necessary to increase the stringency at a low temperature by adding an organic solvent such as dimethylformamide. It is necessary and not preferable.

The oligonucleotides serving as the first primer and the second primer are, for example, ABI (Applied Bi
osystems Inc.) using a DNA synthesizer model 391 by the phosphoramidite method. Other synthesis methods include the phosphoric acid triester method, the H-phosphonate method, and the thiophosphite method. It may also be isolated from biological sources, for example from restriction endonuclease digests. There is no particular limitation on the length and structure of the nucleic acid as long as it is set to function as a primer. Generally, the primer portion is 6 to 50, preferably 10 to 30 nucleotides. It is also possible to provide a spacer between the promoter region and the portion of the promoter sequence that hybridizes with the target nucleic acid, but this spacer is generally from 0 to 100, preferably from 0 to 20 nucleotides.

The concentrations of the first primer and the second primer are generally 10 to 50,000 nM, preferably 10 to 50 000 nM, respectively.
It is 0 to 500 nM. The concentration of ribonucleoside triphosphate and deoxyribonucleoside triphosphate is generally 10 to 10,000 μM dNTP, 10 to 100 rNTP.
00 μM, preferably dNTP 100-2000 μM, rNTP 100-40
00 μM. The concentration ratio of ribonucleoside triphosphate and deoxyribonucleoside triphosphate is generally 1/10 to 2/1, preferably 1/2 to 3/4.
It is.

As the thermostable RNA-dependent DNA polymerase, Thermus thermophilu
s), It is known that the thermostable DNA-dependent RNA polymerase of Thermus aquaticus has its activity, and the RNA-dominant DNA polymerase activity is expressed by selecting the type and amount of divalent metal ions. It is known to However, it is not easy to simultaneously express RNA-dependent DNA polymerase and DNA-dependent DNA polymerase activities, and the present inventors have conducted intensive studies on the conditions for maximizing the expression of the two enzyme activities. The ratio is from 1: 1 to 4: 1, preferably 1.
It has been found that a condition of 5: 1 to 3: 1 is preferable. And D
The type and amount of divalent metal ions are also important for NA-dependent RNA polymerase, and in order to maximize the activity of these three ions, the ratio of Mg ions to Mn ions should be 1: 1 to
4: 1, preferably 1.5: 1 to 3: 1 and dNTP: rNTP = 1: 10
~ 10: 1, preferably 1: 2 to 3.5.

Although thermostable enzymes have been known, it has not been known to use a plurality of thermostable enzymes in combination as in the present invention. Further, a nucleic acid amplification reaction does not occur simply by combining heat-resistant enzymes, and it is not easy to achieve higher amplification efficiency by cycling.

In the present invention, the reaction time depends on the nucleic acid sequence to be amplified,
It varies depending on various conditions such as the primer sequence, Tm, and the amount of enzyme, and the reaction time for one cycle is about 5 to 300 minutes, preferably 20 to 120 minutes. Although there is a concept of a so-called cycle, the number of cycles is not shown because the operation is performed at a substantially constant temperature. These conditions are set in consideration of amplification efficiency, amplification amount, and reaction time.
Even when the target nucleic acid is single-stranded, it often has a higher-order structure, and the reaction solution can be raised to 90 to 95 ° C. at the start of the reaction. Also in this case, since there is substantially no deterioration of the enzyme, it is possible to perform a heat treatment after preparing a reaction solution, which is an excellent method from the viewpoint of simplicity and prevention of contamination. During the reaction, amplification can be performed only by maintaining the reaction solution at a constant temperature of 50 to 70 ° C., and the reaction can be easily performed without requiring special equipment.

The nucleic acid amplified by the amplification method of the present invention can be detected as required. Detection of the amplified nucleic acid can be performed by measuring RNA copy, measuring double-stranded DNA having a promoter sequence,
/ RNA hybrids can also be measured. These can be detected by a general measuring method. At the time of extension reaction or transcription reaction by nucleic acid polymerase, a label such as ³² P or biotinylated nucleotide is used as a ribooxynucleoside triphosphate or deoxyribonucleoside triphosphate to be added, and a label is incorporated into the amplification product. Measure the label. In addition, a method for measuring the label in the amplification product using a labeled primer,
There is a method of detecting an amplified nucleic acid using a labeled probe. Specific detection methods include fractionation by electrophoresis, Southern blot, Northern blot, dot blot, slot blot, and sandwich hybridization. It is also possible to obtain the concentration in the test sample by performing a quantitative measurement. Further, it is possible to improve the quantitativeness by a method using an internal standard (Japanese Patent Application Laid-Open No. 62-205800).

In the detection method using a labeled primer or a labeled probe, a known labeling substance such as a radioisotope, an enzyme, a fluorescent substance, or a luminescent substance can be used as a labeling substance. Further, the reagents used in the present invention can be made into the respective reagent kits as described above according to a method known per se, and the form, concentration, etc. of the reagents are not particularly limited.

[0040]

Thus, according to the present invention, an RNA-dependent DNA polymerase required for a replication RNA-based amplification system,
DNA-dependent DNA polymerase, DNA-dependent RNA polymerase, and ribonuclease H are all heat-resistant enzymes, and the amplification reaction of the target nucleic acid must be performed at a sufficiently high temperature so that non-specific hybridization between the nucleic acid template and the primer does not occur. Can be done. As a result, non-specific amplification does not occur, and highly specific amplification becomes possible. Further, the thermostable enzyme is stable not only at a low temperature but also at a normal temperature. There is almost no decrease in the activity at the time of supply and at the time of storage, and the instability can be eliminated. Furthermore, even when denaturation is performed by heating without using ribonuclease H, the use of a thermostable enzyme prevents inactivation of a group of enzymes and enables amplification without successively adding enzymes.

[0041]

The present invention will be described below in more detail by way of examples and comparative examples. In Examples, RNA-dependent DNA polymerase was replaced with reverse transcriptase, DNA-dependent DNA.
DNA polymerase and ribonuclease H
RNase H, DNA-dependent RNA polymerase for RNA polymerase
Call it rase. Reference Example 1 Synthesis of Various Oligonucleotides Using ABI DNA Synthesizer Model 391, various oligonucleotides having the following sequences were synthesized by the phosphoramidite method. The procedure was performed on a 0.2 μM scale according to the manual of ABI. Deprotection of the oligonucleotide was carried out with aqueous ammonia at 55 ° C. for 15 to 18 hours. Purification was carried out on a reverse phase column using HPLC manufactured by Hitachi, Ltd. Oligonucleotide having a promoter region (1): This oligonucleotide is a promoter region linked by a linker, 3 of the Vibrio parahaemolyticus thermotolerant hemolytic toxin (VP-TDH) gene.
It consists of a region complementary to the 13th to 326th nucleotide sequence (SEQ ID NO: 1 in the Sequence Listing). Oligonucleotide (2): 179 to 20 of VP-TDH gene
Second homologous oligonucleotide (24mer) (SEQ ID NO: 2 in the Sequence Listing). Oligonucleotide (3): 254 to 27 of VP-TDH gene
Seventh complementary oligonucleotide (24mer) (SEQ ID NO: 3 in the Sequence Listing). The phosphate group at the 5 'end is labeled with ³² P.

Example 1 Amplification Reaction Using Oligonucleotide (1) Having Promoter Region and Oligonucleotide (2) Amplification reaction of Vibrio parahaemolyticus genome using oligonucleotide (1) and oligonucleotide (2) of Reference Example 1. Was performed to obtain a large number of RNAs. The reaction conditions are shown below. Reaction solution 50 μl 10 mM Tris-HCl pH8.3 50 mM KCl 6 mM MgCl ₂ 3 mM MnCl ₂ 0.6 mM dNTP 1 mM rNTP 20 pmol Oligonucleotide (1) 20 pmol Oligonucleotide (2) Tth-DNApolymerase (Toyobo Co., Ltd.) 60 units Tth-RNApolymerase ( 2.5 units Tth-RNase H (manufactured by Toyobo) 2 units Reaction: 93 ° C, 3 minutes 65 ° C, 60 minutes

Example 2 Measurement of Synthesized RNA The RNA synthesized in Example 1 was diluted, and dot-blotted on a nylon membrane, GeneScreen plus (manufactured by DuPont), 50 μl each. As a control, the VP genomic nucleic acid was
μl dot blot was performed. Nylon membrane is 6 × SSC (1
× SSC means 0.15M NaCl, 0.015M sodium citrate (p
H7.0)) 5 × Danehart solution (1 × Denhart solution means 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), 1 mM
EDTA, 10 μg of boiled salmon semen DNA (average 500
Base) at 60 ° C for 1 hour in 100 µl of a solution containing
(3) was added thereto, followed by hybridization at 55 ° C. for 1 hour. 6 at 55 ℃
After thoroughly washing the nylon membrane in × SSC, it was dried.
An X-ray film (New AIF RX manufactured by Fuji Photo Kogyo) was adhered and exposed at -80 ° C for 24 hours. About ¹⁰⁶ times the RNA than the sensitivity to the genomic nucleic acid in the control of the VP was quantitatively synthesized RNA of the film had been synthesized. As a result, it was shown that the amplification method of the present invention was effective.

Example 3 Example from RNA template Amplification reaction using oligonucleotide (1) and oligonucleotide (2) each having a promoter region The oligonucleotide (1) and the oligonucleotide (2) of Reference Example 1 were used for enteritis. An amplification reaction of Vibrio mRNA was performed to obtain a large number of RNAs. The reaction conditions are shown below. Reaction solution 50 μl 10 mM Tris-HCl pH8.3 50 mM KCl 6 mM MgCl ₂ 3 mM MnCl ₂ 0.6 mM dNTP 1 mM rNTP 20 pmol Oligonucleotide (1) 20 pmol Oligonucleotide (2) Tth-DNApolymerase (Toyobo Co., Ltd.) 60 units Tth-RNApolymerase ( 2.5 units Tth-RNase H (manufactured by Toyobo) 2 units Reaction: 65 ° C, 60 minutes

Example 4 Measurement of Synthesized RNA The RNA synthesized in Example 3 was diluted, and the amount of synthesized RNA was quantified from the sensitivity of the film in the same manner as in Example 2. 10 ⁷ times of RNA have been synthesized. As a result, it was shown that the amplification method of the present invention was effective.

Example 5 Using Two Enzymes Amplification Reaction Using Oligonucleotide (1) and Oligonucleotide (2) Having Promoter Region Using the oligonucleotide (1) and the oligonucleotide (2) of Reference Example 1, enteritis was performed. An amplification reaction of the Vibrio genome was performed to obtain a large number of RNAs. The reaction conditions are shown below. Reaction solution 50 μl 10 mM Tris-HCl pH8.3 50 mM KCl 6 mM MgCl ₂ 3 mM MnCl ₂ 0.6 mM dNTP 1 mM rNTP 20 pmol Oligonucleotide (1) 20 pmol Oligonucleotide (2) Tth-DNA polymerase (Reference Example 4) 60 units Tth-RNA polymerase ( 2.5 units Reaction: 95 ℃, after 3 minutes,
Repeat 60 ° C, 20 minutes 70 ° C, 20 minutes 4 times.

Example 6 Measurement of Synthesized RNA The RNA synthesized in Example 5 was diluted, and the amount of the synthesized RNA was quantified from the sensitivity of the film in the same manner as in Example 2. 10 ⁶ times of RNA have been synthesized. As a result, it was shown that this amplification method was effective.

Reference Example 2 Synthesis of Various Oligonucleotides Using ABI DNA synthesizer Model 391, various oligonucleotides having the following sequences were synthesized by the phosphoramidite method. The procedure was performed on a 0.2 μM scale according to the manual of ABI. Deprotection of the oligonucleotide was carried out with aqueous ammonia at 55 ° C. for 15 to 18 hours. Purification was carried out on a reverse phase column using HPLC manufactured by Hitachi, Ltd. Oligonucleotide having a promoter region (1): This oligonucleotide is a promoter region linked by a linker, 3 of the Vibrio parahaemolyticus thermotolerant hemolytic toxin (VP-TDH) gene.
It consists of a region complementary to the 13th to 326th nucleotide sequence (SEQ ID NO: 1 in the Sequence Listing). Oligonucleotide (3): 254 to 27 of VP-TDH gene
Seventh complementary oligonucleotide (24mer) (SEQ ID NO: 3 in the Sequence Listing). The phosphate group at the 5 'end is labeled with ³² P. Oligonucleotide (4): This oligonucleotide is a promoter region linked by a linker, 179 of the VP-TDH gene.
It consists of an oligonucleotide region that is homologous from the 2nd to the 202nd (SEQ ID NO: 4 in the Sequence Listing).

Example 7 Amplification Reaction Using Oligonucleotide (1) Having Promoter Region and Oligonucleotide (4) Amplification Reaction of Vibrio parahaemolyticus Genome Using Oligonucleotide (1) and Oligonucleotide (4) of Reference Example 2 Was performed to obtain a large number of RNAs. The reaction conditions are shown below. Reaction solution 50 μl 10 mM Tris-HCl pH8.3 50 mM KCl 6 mM MgCl ₂ 3 mM MnCl ₂ 0.6 mM dNTP 1 mM rNTP 20 pmol Oligonucleotide (1) 20 pmol Oligonucleotide (4) Tth-DNApolymerase (Toyobo Co., Ltd.) 60 units Tth-RNApolymerase ( 2.5 units Tth-RNase H (manufactured by Toyobo) 2 units Reaction: 93 ° C, 3 minutes 65 ° C, 60 minutes

Example 8 Measurement of Synthesized RNA The RNA synthesized in Example 7 was diluted, and the amount of synthetic RNA was quantified from the light sensitivity of the film in the same manner as in Example 2. about 10 ⁹ times of RNA have been synthesized. As a result, it was shown that the amplification method of the present invention was effective.

Reference Example 3 Ribonuclease H activity exhibited by DNA-dependent DNA polymerase Using the mRNA of Example 3 as a template, an oligonucleotide (T
DP-2) (SEQ ID NO: 5) as reverse transcriptase
SSII (super script II: M-MLV reverse transcriptase
A cDNA / RNA hybrid was synthesized using a DNA polymerase (BRL) which had lost its ribonuclease activity. Next, E. coli ribonuclease H and Tth DNA polymerase (manufactured by Toyobo Co., Ltd.) were added to decompose the RNA to form a single-stranded cDNA, and a probe hybridized to the cDNA was hybridized. Hybridization was carried out using a Toyobo ALP-labeled probe (product number PRB004) according to the instructions. The detection was quantified using a colorimeter described in JP-A-2-27099. The probe did not react with the hybrid double strand of SSII alone, but the probe with E. coli ribonuclease H and Tth DNA polymerase added reacted without denaturation, proving that the probe was single-stranded. This indicated that Tth DNA polymerase had ribonuclease H activity.

The reaction conditions and operation are described in detail below. Reaction conditions Template RNA: Vibrio parahaemolyticus TDH toxin gene mRNA Primer: Oligonucleotide (TDP-2) Reaction solution: 10 mM Tris HCl pH 8.3 75 mM KCl 6 mM MgCl ₂ 0.4 / 1.0 mM d / rNTP 100 units SSII Procedure: Table 1 below Was carried out according to

[0053]

[Table 1] Results: The results are shown in Table 2. Tth DNA polymerase 6
0 units of ribonuclease activity showed about half the activity of 1.5 units of E. coli ribonuclease.

[0054]

[Table 2] ΔE value: a value reflecting the color of the spot and the pigment concentration. No unit.

Reference Example 4 Preparation of ribonuclease H derived from thermophilic bacterium Thermus thermophilus 1.0% polypeptone, 0.5% yeast extract, NaCl
100 ml of a medium (pH 7.5) containing 0.2%
The mixture was transferred to a ml Sakaguchi flask, autoclaved at 121 ° C. for 15 minutes, and then cooled at room temperature. There thermophilic bacteria Thermos thermophilus HB8 (ATCC2763
4) was inoculated with one platinum loop and cultured with shaking at 70 ° C. for 24 hours. Next, 6 L of a medium having the same composition was transferred to a 10 L jar fermenter, sterilized in an autoclave at 121 ° C. for 15 minutes, allowed to cool, and inoculated with 100 ml of a culture solution cultured in the flask described above. Aeration rate 2 L / min, number of stirring 4
Incubation was performed for 10 hours at a condition of 00 rotation / minute and a temperature of 70 ° C.

6 liters of the culture solution is collected by centrifugation (8000 rpm / 10 minutes), and the mixture is added to a K-phosphate buffer pH 7.5 containing 10 mM 2-mercaptoethanol and 5% glycerol (hereinafter referred to as buffer A). Suspended. 2 with an ultrasonic crusher (Marikai Electric, 19KHz)
The cells were treated for 0 minutes, centrifuged again to remove cell debris, and the supernatant was recovered.

After the supernatant was salted out with ammonium sulfate,
Dialysis was performed against buffer A. This solution is subjected to DEAE-Sepharose CL-6B (Pharmacia) column chromatography equilibrated with buffer A and adsorbed. After washing the column with buffer A,
When eluted with buffer A containing M NaCl,
Ribonuclease H was added to the 0-0.5M NaCl elution fraction.
Activity was obtained. The active fraction was dialyzed against buffer A.
This solution is subjected to column chromatography on phosphocellulose P-11 (Whatman) equilibrated with buffer A to be adsorbed. After washing the column with buffer A, buffer A containing 0 to 1.0 M NaCl
As a result, ribonuclease H activity was obtained in the fraction eluted with 0 to 0.5 M NaCl. The active fraction was dialyzed against buffer A. Further, this solution is subjected to native DNA cellulose (manufactured by Pharmacia) column chromatography equilibrated with buffer A to be adsorbed. After washing the column with buffer A, 0 to 1.0 MN
When eluted with buffer A containing aCl,
Ribonuclease H activity was obtained in the fraction eluted with 0.5 M NaCl. The active fraction was treated with 10 mM Tris-HCl (pH
7.5), 300 mM KCl, 1 mM DTT, 0.
Dialysis was performed against 1 mM EDTA, 10% glycerol. Further, this solution was added to 10 mM Tris-HCl (pH
7.5), 300 mM KCl, 1 mM DTT, 0.1
It was dialyzed against ml EDTA and 50% glycerol to obtain an enzyme preparation. In addition, the thermostable ribonuclease H activity was measured by the following method. First, reagents A, B, C and D having the following composition were prepared. (Reagent) A. 100 mM Tris-HCl (pH
8.3) 750 mM potassium chloride 60 mM magnesium chloride 30 mM manganese chloride 104 cpm / 2 μl poly A / poly dT ^* C. B. 20% trichloroacetic acid (2 mM pyrophosphate) 10 μg / μl BSA

^* Method for Preparing Substrate Poly A / Poly dT Labeled with [ ³ H] Poly A (Pharmacia: Code 27 # 4110-0)
1) 100 mg was dissolved in 10 ml of sterilized water. Poly dT (Pharmacia: Code 27-7834-01)
Five units were dissolved in 200 μl of TE buffer. ^[3 H] poly A (Amersham Corporation: Code TRK.4
80 10 μCi) to 50 μl of the previously prepared poly A solution
Was dissolved. In order to prepare a substrate for 50 samples, an equivalent amount of 500,000 cpm of [ ³ H] poly A + poly A prepared here was taken out, and 20 μl (1
9 pmol / μl). A 5-fold concentration of annealing buffer (50 mM Hepes-KOH [pH
8.0], 20 μl of 500 mM KCl) and sterilized water to make 100 μl. This solution is heated at 65 ° C for 10
After heating for minutes, the mixture was cooled at room temperature to obtain a substrate solution.

Next, 2.5 μl of reagent A and 2 μl of reagent B
And 19.5 μl of sterile water are added to the microtube,
After stirring, 1 μl of the enzyme was added and reacted at 60 ° C. for 20 minutes. Thereafter, the mixture was cooled on ice, and 25 µl of reagent D and 50 µl of reagent C were used.
and stirred. After further ice-cooling for 10 minutes, the acid-insoluble fraction was separated by centrifugation (12,000 rotations, 10 minutes). 50 μl of the acid-soluble fraction of the supernatant was collected,
The free [ ³ H] was measured using a liquid scintillation counter (manufactured by Packard). One unit of enzyme activity is
Under these conditions, the amount of the enzyme that released 1 μmol of the acid-soluble substance per minute was determined.

(1) Molecular weight The above enzyme preparation was electrophoresed simultaneously with a known molecular weight marker by SDS-PAGE. From comparison with known molecular weight markers, the molecular weight was estimated to be about 85,000-95,000 (FIG. 3).

(2) Thermostability The above enzyme preparation was treated at pH 8.0 at 60 ° C. to 90 ° C. for 2 hours, and its residual activity was measured. 50% or more of the residual activity after the heat treatment was observed even after the reaction at 75 ° C. for 2 hours (FIG. 4).

(3) Optimum pH The above enzyme preparation is allowed to act at pH 7.5 to pH 9.5,
The optimum pH was determined. The pH was adjusted by changing the pH of the reagent A. As a result, the optimum pH is pH 7.5 to
It was around 9.3 (FIG. 5). (4) DNA-dependent DNA polymerase This enzyme, in addition to ribonuclease H activity,
It had NA polymerase activity, which was about 5 times or more the activity 1. The definition of DNA-dependent DNA polymerase activity is defined as ssDN under the condition of measuring the activity at 70 ° C.
Using A / primer as a substrate, the amount of the enzyme that incorporates 10 nmol of dTNP into the acid-insoluble precipitate in 30 minutes was defined as 1 unit.

(5) RNA-dependent DNA polymerase (reverse transcriptase) activity In addition to ribonuclease H activity, this enzyme
It had NA polymerase (reverse transcriptase) activity and its activity was about 0.1 or less against ribonuclease H1. RNA-dependent DNA polymerase (reverse transcriptase)
The activity is defined as 10 nmol d / 30 minutes using poly (A) oligo (dT) as a substrate under the condition of activity measurement at 70 ° C.
The amount of the enzyme that incorporates TTP into the acid-insoluble precipitate was defined as one unit.

[0064]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 64 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics Characteristic symbol: Promoter Position: 1..30 Characterized method: S Other characteristics: Promoter sequence Location: 31..40 Characterized method: S Other characteristics: Spacer sequence containing origin of replication Location: 41 .. 64 Other features: 313 to 326 of the Vibrio parahaemolyticus TDH gene
It has a sequence complementary to the th sequence. Array CTTGACAAAA AGGAGGGGGA TTGATAGCAT GGCTTTTCTG GACACCGCTG CCATTGTATA GTCT 64

SEQ ID NO: 2 Sequence length: 24 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics Location: 1..24, etc. Features: Vibrio parahaemolyticus TDH gene from 179 to 202
It has a sequence homologous to the second sequence. Sequence CTGACTTTTG GACAAACCGT AATG 24

SEQ ID NO: 3 Sequence length: 24 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence characteristics Location: 1..24, etc. Features: Vibrio parahaemolyticus TDH gene 254 to 277
It has a sequence complementary to the th sequence. Sequence CAGGTACTAA ATGGTTGACA TCCT 24

SEQ ID NO: 4 Sequence length: 64 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence characteristics Location: 1..30 Characteristics Determined method: S Other characteristics: Promoter sequence Location: 31..40 Characterized method: S Other characteristics: Spacer including origin of replication Location: 41..64 Other characteristics: Vibrio parahaemolyticus TDH 179 to 202 of the gene
It has a sequence homologous to the second sequence. Sequence CTTGACAAAA AGGAGGGGGA TTGATAGCAT GGCTTTTCTG CTGACTTTTG GACAAACCGT AATG 64

SEQ ID NO: 5 Sequence length: 22 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics Location: 1..22 Others Features: 483 to 504 of Vibrio parahaemolyticus TDH gene
It has a sequence complementary to the th sequence. Sequence ACTACCACTC TCATATGCTT CT 22

[Brief description of the drawings]

FIG. 1 is a process chart of the amplification method of the present invention when a target nucleic acid is RNA.

FIG. 2 is a process chart of the amplification method of the present invention when the target nucleic acid is DNA.

FIG. 3 is a view showing an SDS-PAGE electrophoresis pattern of ribonuclease H derived from Thermus thermophilus.

FIG. 4 is a graph showing thermostability of ribonuclease H from Thermos thermophilus.

FIG. 5 is a graph showing the optimum pH of ribonuclease H derived from Thermos thermophilus.

────────────────────────────────────────────────── ─── Continuation of the front page (56) References Tokuhyo Hei 4-507197 (JP, A) International Publication 92/8800 (WO, A1) Biochemistry, 30 (1991) p. 7661-7666 (58) Fields surveyed (Int. Cl. ⁷ , DB name) C12Q 1/68 C12N 15/09 ZNA BIOSIS (DIALOG) MEDLINE (STN)

Claims (12)

(57) [Claims] 1. A method for increasing the copy number of a target nucleic acid sequence at a substantially constant temperature in a reaction medium, comprising the steps of: RNA-dependent DNA polymerase, heat resistance
Ribonuclease H and thermostable DNA-dependent DNA poly
A method for amplifying a target nucleic acid sequence, comprising using one thermostable enzyme as a merase . Step 1: The single-stranded first template RNA obtained by denaturing the target nucleic acid as necessary has a sequence sufficiently complementary to the nucleic acid sequence (RNA) of the first template and a promoter sequence at the 5 ′ end thereof The first primer is hybridized and extended with a thermostable RNA-dependent DNA polymerase to obtain a first primer extension (DNA) that is a second template complementary to the first template RNA; Step 2: RNA / DNA hybrid Step 3: Separating the second template DNA from the first template RNA to obtain a single-stranded second template nucleic acid (DNA) by a thermostable ribonuclease H that specifically decomposes only the RNA of step 3; A second primer having a nucleic acid sequence complementary to the nucleic acid sequence (DNA) of the second template is hybridized to the two template DNA, and the resulting DNA is subjected to heat-resistant DNA-dependent DNA polymerase. To obtain a second primer extension (DNA) complementary to the second template DNA, thus producing a double-stranded DNA intermediate having a functionally operable promoter sequence upstream of the target nucleic acid sequence; (Where the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 'end of the first primer is the 3' end of the second primer on the complementary strand Step 4: The target nucleic acid sequence (first template RN) is converted from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence.
A) generating a single-stranded third template RNA having a sequence complementary to A); Step 5: hybridizing the second primer to the single-stranded third template RNA, and using a heat-resistant RNA-dependent DNA polymerase Elongation to obtain a second primer extension (DNA), which is a fourth template complementary to the third template RNA; Step 6: With heat-resistant ribonuclease H, which specifically degrades only RNA of the RNA / DNA hybrid, Separating the fourth template DNA from the third template RNA to obtain a single-stranded second template nucleic acid (DNA); Step 7: allowing the first primer to hybridize to the single-stranded fourth template DNA, First primer extension (DNA) that is extended by a sex DNA-dependent DNA polymerase and is complementary to the fourth template DNA and complementary to the promoter sequence of the first primer Obtaining a fourth template DNA extension, thus producing a double-stranded DNA intermediate having a functionally operable promoter sequence upstream of the target nucleic acid sequence (where the nucleic acid sequence of the first or second primer is Is sufficiently complementary or homologous to the target nucleic acid sequence, the 3 'end of the first primer is directed to the 3' end of the second primer on the complementary strand) Step 8: Recognizing the promoter sequence The target nucleic acid sequence (first template RN) from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of
A) increasing the copy of the single-stranded third template RNA having a sequence complementary to A); and step 9: repeating steps 5 to 8 as many times as necessary using the RNA copy. 2. A method of increasing the copy number of the target nucleic acid sequence in a reaction medium, comprising the following steps in the amplification method of a target nucleic acid sequence using thermostable enzymes, Yi thermostable RNA
DNA polymerase, thermostable ribonuclease H and
And heat-resistant DNA-dependent DNA polymerase
A method for amplifying a target nucleic acid sequence, comprising using a thermostable enzyme . Step 1: a first primer having a sequence sufficiently complementary to the nucleic acid sequence of the first template and a promoter sequence at the 5′-terminal side of the single-stranded first template DNA obtained by denaturing the target nucleic acid as necessary And heat resistance D
Extended by NA-dependent DNA polymerase, the first template D
Obtain a first primer extension (DNA) that is a second template complementary to NA; Step 2: separating the second template DNA from the first template DNA to obtain a single-stranded second template nucleic acid (DNA) Step 3: a second primer having a nucleic acid sequence (DNA) complementary to the nucleic acid sequence (DNA) of the second template is hybridized to the single-stranded second template DNA,
Extension with NA polymerase to obtain a second primer extension (DNA) complementary to the second template DNA, thus producing a double-stranded DNA intermediate having a functional promoter sequence upstream of the target nucleic acid sequence (Where the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 ′ end of the first primer is 3 ′ of the second primer on the complementary strand. Step 4: Directing the target nucleic acid sequence (first template DN) from the double-stranded DNA intermediate using a heat-resistant DNA-dependent RNA polymerase capable of recognizing the promoter sequence
A) increasing the copy of the single-stranded third template RNA having a sequence complementary to A); Step 5: hybridizing the second primer to the single-stranded third template RNA to obtain a thermostable RNA-dependent DNA Extending with a polymerase to obtain a second primer extension (DNA) that is a fourth template complementary to the third template RNA; Step 6: heat-resistant ribonuclease H that specifically degrades only RNA of RNA / DNA hybrid Separating the fourth template DNA from the third template RNA to obtain a single-stranded fourth template nucleic acid (DNA); Step 7: allowing the first primer to hybridize to the single-stranded fourth template DNA, The first primer extension (DNA), which is extended by a thermostable DNA-dependent DNA polymerase and is complementary to the fourth template DNA, and the promoter sequence of the first primer The resulting complement specific fourth template DNA elongation product,
Thus, a double-stranded DNA intermediate having a functional promoter sequence upstream of the target nucleic acid sequence is generated;
(Where the nucleic acid sequence of the first or second primer is sufficiently complementary or homologous to the target nucleic acid sequence, and the 3 'end of the first primer is the 3' end of the second primer on the complementary strand Step 8: a single-stranded DNA having a sequence complementary to the target nucleic acid sequence from the double-stranded DNA intermediate using a thermostable DNA-dependent RNA polymerase capable of recognizing the promoter sequence. Step 9: increasing the number of copies of the template RNA; and step 9: repeating steps 5 to 8 as many times as necessary using the RNA copy. 3. The method for amplifying a target nucleic acid sequence using a thermostable enzyme according to claim 1 or 2, wherein steps 1 to 9 are carried out without successive addition of reagents. 4. The heat resistance according to any one of claims 1 to 3, wherein the second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template has a promoter sequence on the 5 'end side. A method for amplifying a target nucleic acid sequence using an enzyme. 5. A thermostable RNA-dependent DNA polymerase,
Thermophilic ribonuclease H and thermostable DNA-dependent DNA
A method for amplifying a target nucleic acid sequence using a thermostable enzyme according to any one of claims 1 to 4, wherein an enzyme derived from Thermos thermophilus having the following physicochemical properties is used as a polymerase. (1) catalyze the next reaction. DNA is synthesized using RNA as a template. RNA /
It acts specifically and endogenously only on DNA double-stranded RNA to generate a DNA single strand. DNA is synthesized using the DNA as a template. (2) Molecular weight: 85,000 to 95,000 (3) Thermal stability: After treatment at 75 ° C. for 2 hours, 50% or more activity is maintained. (4) Optimum pH: about 7.5 to 9.3 6. A single-stranded RNA or a double-stranded DN which is an amplification product of the target nucleic acid sequence according to any one of claims 1 to 5.
A or a DNA / RNA hybrid, if necessary, after denaturation treatment, followed by hybridization of a labeled probe, and detection of a label of a hybridized labeled probe or a label of a non-hybridized labeled probe. Detection method. 7. A kit for amplifying a specific nucleic acid sequence, comprising: (a) a first sequence having a sequence sufficiently complementary to a nucleic acid sequence of a first template and a promoter sequence at the 5 ′ end thereof; A primer, (b) a second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template, (c) a thermostable DNA-dependent DNA polymerase having RNA-dependent DNA polymerase activity and ribonuclease H activity, (d) A thermostable DNA-dependent RNA polymerase, (e) ribonucleoside triphosphate and (f) deoxyribonucleoside triphosphate, wherein the nucleic acid sequence of the first primer or the second primer is sufficiently complementary to the target nucleic acid sequence or Homologous, the 3 'end of the first primer is the 3' end of the second primer on the complementary strand Kit that is directed. 8. A kit for amplifying a specific nucleic acid sequence, comprising: (a) a first nucleic acid sequence having a sequence sufficiently complementary to a nucleic acid sequence of a first template and a promoter sequence at the 5 ′ end thereof; A primer, (b) a second primer having a nucleic acid sequence complementary to the nucleic acid sequence of the second template and a promoter sequence at the 5 'end thereof, (c) having an RNA-dependent DNA polymerase activity and a nuclease H activity A thermostable DNA-dependent DNA polymerase, (d) a thermostable DNA-dependent RNA polymerase, (e) ribonucleoside triphosphate and (f) deoxyribonucleoside triphosphate, wherein the sequence of the first primer or the second primer is a target nucleic acid. The sequence is sufficiently complementary or homologous to the sequence, and the 3 ′ end of the first primer is Kits directed to the 3 'end of the second primer on complementary strands. 9. A thermostable DNA-dependent DN having RNA-dependent DNA polymerase activity and nuclease H activity.
The kit for amplifying a specific nucleic acid sequence according to any one of claims 7 to 8, wherein the A polymerase is an enzyme derived from Thermus thermophilus having the following physicochemical properties. (1) catalyze the next reaction. DNA is synthesized using RNA as a template. RNA /
It acts specifically and endogenously only on DNA double-stranded RNA to generate a DNA single strand. DNA is synthesized using the DNA as a template. (2) Molecular weight: 85,000 to 95,000 (3) Thermal stability: After treatment at 75 ° C. for 2 hours, 50% or more activity is maintained. (4) Optimum pH: about 7.5 to 9.3 10. The kit for amplifying a nucleic acid sequence according to claim 7, further comprising a potassium ion, a magnesium ion and a manganese ion. 11. The ratio of magnesium ion to manganese ion is from 1: 1 to 4: 1, and the ratio of deoxyribonucleoside triphosphate (dNTP) to ribonucleoside triphosphate (rTNP) is from 1:10 to 1: 1.
The kit for amplifying a nucleic acid sequence according to claim 10, wherein the ratio is 0: 1. 12. A kit for detecting a specific nucleic acid sequence, wherein the kit for amplifying a nucleic acid sequence according to any one of claims 7 to 10 further comprises a detection probe.