JP3098353B2 - Production of foreign genes and their products in plant cells - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an RNA replication enzyme (RNA replicate) of an RNA plant virus such as brom mosaic virus (hereinafter referred to as BMV) by a genetic engineering technique.
e) a method for producing a substance useful in the fields of agriculture and medicine in a plant cell by mass-producing a foreign gene and its product in a plant cell that produces the gene, or a transformed plant expressing a useful trait. About producing. The present invention also relates to a plant transformation vector, a recombinant RNA production vector, and a transformed plant cell.

[0002]

2. Description of the Related Art As a technique for producing a useful polypeptide in a plant cell, or a method for providing a plant with a useful trait such as plant virus resistance, a foreign gene is introduced into a plant genome using a Ti plasmid transformation system and expressed. A method of causing the growth and a method using a plant virus multiplication system are being developed. Tobacco mosaic virus (TMV)
It has been known that the amount of coat protein produced is at most 0.01% of the total plant protein when the coat protein gene is introduced into a plant genome using a Ti plasmid transformation system (Beachy et al.). , (1990) Annu.Re.
v. Phytopath. 28: 451-474). In this method, the production amount of the foreign gene product depends on the promoter activity that regulates the transcription amount, and it is necessary to search for a promoter that imparts stronger transcription activity. on the other hand,
TMV produces virus particles of up to 2 g / kg of heavy fresh leaf in a host plant, but utilizes a plant virus propagation system in which the gene portion of the TMV coat protein is replaced with a foreign gene of a target substance and inoculated into the host plant. In the case of the method, the production amount of the target substance was about 1 mg / kg of fresh heavy leaves (Taka
Matsu, et al., (1987) EMBO J. 6: 307
-311). As a problem of TMV, TMV is encoded by three types of genes overlapping with one type of single-stranded RNA.
It is thought that the control mechanism of MV replication is affected. Therefore, the virus genome has several single-stranded R
Utilization of plant viruses dispersed in NA is also being studied.

As an example, the bromovirus group (bro
MoMV group) and BMV hosting many plants belonging to the Poaceae family. The BMV genome is composed of three types of (+) single-stranded RNAs, and are referred to as RNAs 1, 2, and 3 in descending order of molecular weight. In addition, BMV contains a subgenomic RNA called R
NA4 also exists. These RNAs are approximately 26 nm in diameter.
RNA1 and RNA2 alone in the spherical particles of
A3 and A4 are both implicated (Lane et al., (197)
4) Adv. Virus Res. 19: 151-22
0). The advantage of using BMV is that only replication enzymes are required for replication because of the large amount of growth in infected plant cells and the fact that the genome is divided.
Neither the 3a protein, which is the product of E. coli, nor the coat protein, which is the product of RNA4, is involved in virus replication. Therefore, the replacement of the foreign gene with the coat protein gene is less likely to affect the viral replication control mechanism.

[0004] The nucleotide sequence of the entire BMV genome has been elucidated (Ahlquist et al., (1984) J. Mol. B.
iol. 172: 369-383), and RNA1 has a total length of 3
234 bases encode the 1a protein (molecular weight 109 kilodalton (KD)), and RNA2 encodes 2865 bases in total length 2865 protein (molecular weight 94KD).
And 2a proteins are considered subunits of RNA replication enzymes. In plant cells, the (+)-strand BMV RNA is converted from the (+)-strand to (-)
It is believed that the strand is synthesized, and then the (+) strand is synthesized in large quantities using the synthesized (-) strand as a template. on the other hand,
RNA3 has a total length of 2134 bases and 3a protein (molecular weight: 34
It encodes two gene products, KD) and a coat protein (molecular weight 20 KD), but only the 5 '3a protein is directly translated from RNA3. RNA4 has a total length of 876 bases and has the same sequence as the coat protein gene portion of RNA3, and becomes mRNA of the coat protein. RNA4 is synthesized from RNA3 in host cells (Ahlquist).
(1981) J. Am. Mol. Biol. 153: 23
-38).

[0005] The mechanism is that the RNA3 (+) strand
A strand is synthesized, and RNA4 (+)
It was revealed that the chain was synthesized (Mi
Iller et al., (1985) Nature 313: 6.
8-70). Ahlquist et al. Removed bark protoplasts with RNA1 and 2 together with recombinant RNA3 in which most of the coat protein gene had been removed from RNA3 and chloramphenicol acetyltransferase (CAT) gene was introduced into that portion.
T was successfully expressed, but CA at the plant level
It was not available for T gene expression (Ahlquis
et al., (1986) Science 231: 1294.
-1297). As described above, BMV, cucube
r Mosaic virus (hereinafter referred to as CMV), a
In the case of vectorization of a virus whose viral genome represented by ifalfa Mosaic virus (hereinafter referred to as AMV) is divided into four RNA strands, BMV is best studied. A method for producing a foreign gene in a protoplast by inoculating a plant protoplast with a mixture of the recombinant RNA 3 and RNA 1 and 2 substituted with
There is a problem that the infection efficiency is low and the recombinant virus RNA cannot be systemically infected, and the expression level in individual cells is small. At the same time, it cannot be used to obtain genetically transformed plants.

[0006] Furthermore, viral RNA is transferred in vitro.
Production in an o manner is a major drawback in industrialization in terms of cost. To overcome these problems, the following method was developed (Mori et al., (199)
2) J. Gen. Virol. 73: 169-17
2). It is composed of genomic RNA cDNA of RNA plant virus including BMV, and viral genomic RNAcD.
A recombinant cDNA in which the NA coat protein gene is replaced with a foreign gene is constructed and modified so that it can be expressed as viral RNA in plant cells. By using a genetic engineering technique such as introduction into a plant genome by a direct DNA introduction method such as that described above, viral RNA replication enzymes are produced in all cells and recombinant RNA containing the foreign gene is replicated. MRNA is expressed in large amounts, and foreign genes and their products are mass-produced. In this case, the virus RN
When A multiplies in large quantities, it causes a symptom on the plant and adversely affects the growth of the plant. Therefore, it is considered that the growth of viral RNA other than the foreign gene is not necessarily required.
In the case of NA, for example, BMV, RNA1 and 2 lack the ability to proliferate, leaving only translation ability, so that only the 1a and 2a proteins (BMV RNA replication enzymes) are translated.
Methods for remodeling the viral genome have also been developed (Mori et al., (1992), J. Gen. Viro).
l. 73: 169-172).

[0007] In the case of BMV as an example, 1a, 2a, 3a or a coat protein gene portion can be considered as a replacement site for a foreign gene for producing a target protein which is not a fusion protein. It is known that BMV also produces a 19 KD coat protein (CP2) in addition to the 20 KD original coat protein (CP1) depending on the strain (Sacher and Ahlquist, (1)
989) J. Virology 63: 4545-45
52), The present inventors have studied the BMV gene to provide a more excellent production method, and as a result, have completed the present invention.

[0008]

SUMMARY OF THE INVENTION RNA of plant virus
Replication enzyme gene cDNA, and recombinant virus genomic RNAc in which coat protein gene and foreign gene are replaced
DNA and each separately introduced into the plant genome, or
The recombinant virus genome R is added to the plant cell in which the cDNA of the RNA replication gene of the plant virus is introduced into the plant genome.
There is a long-awaited need for a method of inoculating RNA synthesized from NAcDNA and expressing the foreign gene in plant cells in a large amount and efficiently producing the foreign gene and its product.

[0009]

Means for Solving the Problems The present invention introduces an RNA replication enzyme gene of an RNA plant virus into a plant genome,
A method of synthesizing a large amount of mRNA of a desired foreign gene by a viral RNA replication enzyme produced in a plant cell and producing a large amount of a polypeptide which is a gene product thereof, or a method of producing a polypeptide or an antigen which affects plant traits Provided is a method for producing a plant having a useful trait by mass-producing sense RNA in a plant cell, and more specifically, the original translation initiation of the cDNA of the RNA replication enzyme gene of the RNA plant virus and the cDNA of the coat protein gene. By introducing into the plant genome a recombinant virus genomic RNA cDNA (hereinafter, referred to as a recombinant virus genomic RNA cDNA) in which the ATG downstream of the codon (the first ATG counted from the 5 ′ end) is replaced with a desired foreign gene after the ATG. Or cDN of RNA replication enzyme gene of plant virus A method for producing a foreign gene or a product thereof in a plant cell by inoculating a plant cell having A introduced into the plant genome with RNA synthesized from a recombinant virus genomic RNA cDNA.

Hereinafter, the present invention will be described in detail. The present inventors introduced foreign genes into almost all conceivable sites in the plant virus genome, and compared the amounts of foreign gene products produced. As a result, surprisingly, when the ATG downstream of the original translation initiation codon (the first ATG counted from the 5 'end) of the cDNA of the coat protein gene is replaced with the desired foreign gene, the foreign gene product It was revealed that unexpected high efficiency production was performed. The present invention is based on that finding.

(1) RNA Plant Virus The RNA plant virus used in the present invention preferably has a virus genome composed of several (+)-strand RNAs. More preferably, BMV, CM
V, AMV. Genomic RNA cDNAs containing the RNA replication enzyme genes of these viruses are introduced into the plant genome. A genomic RNA cDNA containing a coat protein gene incorporating a foreign gene is introduced into a plant genome or inoculated as RNA synthesized in vitro . In the case of BMV, CMV, and AMV, the genome is divided into four types of RNA (FIG. 1) and is the virus that is most easily handled in the present invention. In other viruses, RNA replication enzyme gene and coat protein gene
The present invention is applicable as long as each of them can be independently incorporated into a plant genome.

Taking BMV, CMV, and AMV as examples, in the present invention, the portions to be remodeled to be introduced into the plant genome are RNAs 1, 2, and 3, and the remodeled RNAs
Of the three, the part that is replaced by the desired foreign gene is the part of the coat protein gene at the 3 'end. Plants into which the viral genome is introduced include, but are not limited to, tobacco, soybean, cucumber, potato, rice, wheat, barley, corn, and the like.

The above-mentioned plant viruses have different host plants. For example, BMV hosts many plants belonging to the Poaceae family, but inoculation of tobacco plants with viral particles or viral RNA does not allow BMV to grow in plants, so tobacco is considered a host for BMV. Absent. However, it has been reported that when BMV particles or RNA are inoculated into tobacco protoplasts, viral RNA is replicated in cells and production of coat protein occurs (Maekawa et al., (1985) Ann. Phyto.
path. Soc. Japan 51: 227-23
0). This suggests that if the viral gene can be expressed in plant cells, there is no need to be trapped in the conventional virus-host relationship. Therefore, even when a viral gene is introduced into a plant genome according to the present invention, a plant to which the present invention is applied can be selected without being bound by the conventional concept of virus and host. Plant cells are a concept including protoplasts.

(2) Construction of Plant Transformation Vector Virus RNA is extracted from virus particles using a method known as an RNA extraction method, such as a guanidine method, a hot phenol method, or a sodium lauryl sulfate (SDS) phenol method. In the case of BMV, CMV, and AMV, the genome is composed of several types of RNA, and fractionated and purified as RNAs 1, 2, and 3 by agarose gel electrophoresis. Construction of a complementary DNA (cDNA) of each RNA can be carried out using a conventional gene manipulation technique (Ahlq
uist et al., (1984) J. Am. Mol. Biol. 17
2: 369-383; Mori et al., (1991) J. Am. G
en. Virol. 72: 243-246).

In the present invention, in the case of genomic RNA containing an RNA replication gene, for example, BMV, CMV and AMV, RNA1 and RNA2 are: i) a promoter that functions in a plant, ii) cDNA of RNA1 or 2, iii) a plant. Each is introduced into a plant genome as a DNA molecule comprising a functional terminator. In transformed plant cells into which such a DNA molecule has been introduced, RNA1 and 2
Is transcribed to produce 1a and 2a proteins. RNA
After the envelope protein gene region of the cDNA of No. 3 is recombined with a desired foreign gene to construct a recombinant RNA3 cDNA, i) a promoter that functions in a plant, ii) a recombinant RNA3 cDNA, iii) a terminator that functions in a plant Are introduced into the genome of a plant in which the above-mentioned 1a and 2a proteins are produced. Alternatively, the recombinant RNA3 produced in vitro by the transcription vector is inoculated into plant cells producing the above-mentioned 1a and 2a proteins.

I) a promoter that functions in plants, ii)
Plant virus RNA replication enzyme gene cDNA, eg, cD of RNA1, 2 or recombinant virus genomic RNA
Examples of transformation vectors used for introducing a DNA molecule consisting of a terminator that functions in plants, such as a cDNA of NA, such as RNA3, and iii) into a plant genome include, for example, the first type (pBICBR vector) shown in FIG. There are two types of vectors of the second type (pBICBMR vectors) (Mori et al., (1992) J. Ge.
n. Virol. 73: 169-172). Both types of vectors retain the complete 1a or 2a translation region, while the first type vector retains the complete untranslated region cDNA at the 5 'and 3' ends of the viral RNA. In contrast, the second type vector has a complete 5'-terminal untranslated region cDNA, but has a deletion in the nucleotide portion cDNA corresponding to the 3'-terminal untranslated region. The 5'-terminal untranslated region of the viral RNA is essential for translation ability and the synthesis of the (+) strand from the (-) strand, and the 3'-terminal untranslated region is required for the synthesis of the (-) strand from the (+) strand. Required. Therefore, deletion of the 3'-terminal untranslated region leads to loss of synthesis of the (+) strand to the (-) strand, resulting in loss of viral RNA growth ability, but does not affect translation ability.

When the full-length cDNA of the viral RNA is introduced into the plant genome using the first type vector, the transcript produced in the introduced cells is propagated and translated in the same manner as the wild-type viral RNA. . On the other hand, when the 3'-terminal deletion cDNA of the viral RNA is introduced into the plant genome using the second type vector, the transcript produced does not grow in the introduced cells, but the translation is performed and only the translation product is produced. . Large amounts of viral RNA are thought to cause disease symptoms on plants and adversely affect plant growth. To solve such problems, the second type vector may be used.

[0018] The promoter and terminator functional in plants include cauliflower mosaic virus (cau).
lifeflow Mosaic Virus, hereafter C
aMV) There is a terminator functional in plant cells represented by the 35S promoter and the CaMV terminator. Mutant BMV RNA strain having an extra 7 base sequence at the 5 'end does not have infectivity (Jand)
a, et al., (1987) Virology 158: 259.
-262), the transcriptional start point of the cDNA must be the 5 'end of the viral RNA in order to impart the translation ability to the nuclear transcript of the full-length cDNA of the viral RNA introduced into the plant cells. Must match exactly. When the CaMV 35S promoter was used, Mo
ri et al. (Mori et al., (1991) J. Gen.
Virol. 72: 243-246) to introduce the full-length cDNA of the viral RNA immediately downstream of the transcription start site (FIG. 3).

The portion that can be replaced by the desired foreign gene includes the first translation initiation codon of the 1a protein, the 2a protein, the 3a protein and the coat protein gene, or the translation initiation codon at the first and subsequent positions of the coat protein gene; For example, the second part, the third part, and the like. In order to introduce a desired foreign gene into these sites, the translation initiation codon (ATG) of the gene to be replaced and the translation initiation codon of the foreign gene can be replaced by the method of Kunkel et al.
kel et al., (1987) Methods in Enzy.
154: 367-382).
An iI cleavage site was introduced, and after cleavage with NsiI, T4D
By removing the single-stranded portion with NA polymerase and blunt-ending and then binding, the foreign gene can be replaced (in frame) without changing the translational reading frame (FIG. 4).

(3) Preparation of Transformant with Plant Transformation Vector Agrobacterium tumefaciens (Agroba)
Plant transformation method using C. terium tumefaciens is a leaf disk method (Horsch).
Et al. (1985) Science 227: 1229-.
1231) is most commonly used. The Ti plasmid has a vir region.
The T-DNA region in the plasmid was tumefaci
ens into the host cell genome (Nester
Et al., (1984) Ann. Rev .. Plant Phys
siol. 35: 387-413). As a gene transfer method using a Ti plasmid, a binary vector method is currently widely used. This converts the Ti plasmid to T
Ti plasmid with DNA deleted vir region and T plasmid
-Used by dividing into binary vectors containing DNA. What is a binary vector? tumefac
It is a vector that can be propagated in both E. coli and E. coli. DNA composed of a promoter, cDNA of viral RNA, and terminator is T-
The vector is incorporated into the DNA region to construct a transformation vector.

Such a transformation vector is called T-DN.
A.A carrying the Ti plasmid with the vir region deleted of A. tumefaciens cells; t
Inoculation of host plants with umefaciens will result in vir
By the action of the area, the DN composed of the combination
A T-DNA region containing A can be introduced into the host genome.
Other known methods for gene transfer, ie, electroporation into protoplasts,
) method, liposome fusion, microinjection, particle gun to plant tissue
(Legun) or a method analogous thereto can also be used to introduce the DNA having the above structure into plant cells.

For selection of transformants, agents such as kanamycin, hygromycin, phosphonotricin and the like can be used. The transformant is cultured in an appropriate medium to perform callus formation, callus growth and, if necessary, somatic embryo differentiation or organ differentiation, and then regenerated into a plant in a plant regeneration medium supplemented with plant hormones. be able to. When the present invention is used for dicotyledonous plants, the target plants are legumes (alfalfa, soybean, clover, etc.), Apiaceae (carrot, celery, etc.), Brassicaceae (cabbage, radish, rapeseed, etc.), eggplant Family (potatoes, tobacco, tomatoes, etc.). When used for monocotyledonous plants, A.I. Although a technique using Tumefaciens cannot be used, electroporation to protoplasts,
It can be introduced using liposome fusion, microinjection, or particle gun into plant tissue, and the target plants include Gramineae (rice, wheat, barley, corn, etc.).

Using the type 1 or type 2 vector,
As a method for obtaining a transformed cell in which the cDNAs of NA1 and 2 have been introduced into the genome, a cross between a transformed plant in which the RNA1 cDNA has been introduced and a transformed plant in which the RNA2 cDNA has been introduced is performed. A plant expressing the protein is selected. Alternatively, RNA1cDN provided with separate drug resistance markers for selection
Transforming the same plant with the vector incorporating A and the vector incorporating RNA2 cDNA,
Using the electroporation method, co-t
It can be created by a method such as performing transformation. Expression of the 1a and 2a proteins is confirmed by inoculation of RNA3 into protoplasts obtained from plants and the presence of coat proteins by Western blotting.
Furthermore, in order to obtain a pure plant having both cDNAs of RNA1 and 2 homologous in the plant genome, the transformed plant expressing the 1a and 2a proteins is rapidly cultured (anthe).
r culture) to obtain a pure diploid by doubling the chromosome of a pollen-derived haploid plant,
Transformed plants expressing the 1a and 2a proteins may be selected by the method described above.

(4) Construction of Recombinant Virus Genomic RNA Transcription Vector In the present invention, the DNA encoding the desired polypeptide to be produced was recombined into a transcription vector for in vitro production of a transcript. Thereafter, RNA may be produced by the recombinant transcription vector. To synthesize viral RNA in vitro, a DNA-dependent RNA polymerase can be used. DNA
Dependent RNA polymerases include T7 RNA polymerase,
SP6 RNA polymerase and E. coli RNA polymerase are commercially available. Preferably, the nucleotide sequence of the promoter region and the transcription start site are precisely known, and T7 RNA polymerase having high transcription activity (Dunn et al., (1983) J. Mol. Viol. 1).
66: 477-535). The structure of the nucleic acid at the 5 'end of the viral RNA has a very important function in the replication and translation of the viral RNA,
When an extra nucleotide sequence is added to the 5 'end, viral RN
The biological activity of A has been reported to decrease dramatically (Jan
da et al., (1987) Virology 158: 25.
9-262). Therefore, in order to synthesize in vitro a viral RNA having the same base sequence at the 5 ′ end as the wild type, it is preferable that transcription be accurately started from the 5 ′ end of the cDNA. Taking BMV as an example, BMVRN
A3 transcription vector pBTF3 has been constructed (Mo
ri et al., (1991) J. Am. Gen. Virol. 72:
243-246) (FIG. 5).

A pBTF3 vector is used as a material for constructing a recombinant BMV RNA3 transcription vector. The pBTF3 vector contains the T7 promoter and BM
VRNA3 cDNA and pUC, a vector of Escherichia coli
And a vector gene. The translation initiation codon in the coat protein gene portion of the above vector has a K
A NsiI cleavage site was provided by the method of Unkel et al.
Replaced with cI restriction enzyme cleavage site, NsiI / SacI
Fragment is removed and NsiI / SacI containing foreign gene
By incorporating the fragment, a foreign gene can be introduced without changing the reading frame. In the production of a transcript, the recombinant pBTF3 vector is cut with EcoRI to form a linear DNA and used as a template. Recombinant R by system
Mass production of NA3.

(5) Expression of Foreign Gene in Protoplasts of Transformants Producing RNA Replication Enzyme RNA replication genes, for example, cD of both RNA1 and RNA2
RN with biological activity in transformed cells into which NA has been introduced
A replication enzymes, such as the 1a and 2a proteins, are expressed in all cells (Mori et al., (1992) J. Gen. V.
irol. 73: 169-172). That is, in such a transformed cell, the viral genome can be expressed by the transcription and translation machinery of the plant. First, the RNA replication enzyme gene, for example, both cD of RNA1 and RNA2
A recombinant virus genomic RNA, for example, cDNA of recombinant RNA3, is introduced into a transformed plant genome into which NA has been introduced using a transformation vector, and the recombinant RNA3 is transcribed by a plant transcription mechanism. Recombinant viral genomic RNA, eg, recombinant RNA3, is replicated by RNA replication enzymes produced therein, eg, 1a and 2a proteins, and recombinant RNA4 as a subgenome is also synthesized in large quantities and introduced foreign RNA. Genes and products will be mass-produced. Or RN
When recombinant RNA3 is inoculated into transformed plant cells into which both cDNAs of A1 and 2 have been introduced, the recombinant RNA3 is replicated and a large amount of recombinant RNA4, which is a subgenome, is also synthesized.

The recombinant virus genomic RNA cDNA in the genome of the transformed plant, for example, the cDNA of RNA3, can be confirmed by Southern blotting, and the replication of recombinant RNA3 and the synthesis of recombinant RNA4 can be confirmed by Northern blotting. Production of the gene product can be confirmed by Western blotting using an anti-IFN antibody, for example, when a human-derived γ-interferon (hereinafter referred to as IFN) gene has been introduced. When β-glucuronidase (hereinafter referred to as GUS) is used as a foreign gene, generally used fluorescence spectroscopy (Gu
s gene fusion system use
r's manual).

It has already been confirmed that, for example, when a foreign gene is β-gluglonidase in a transformed plant cell in which RNA1 cDNA, RNA2 cDNA, or recombinant RNA3 cDNA has been introduced into the genome, β-gluglonidase is produced. (US patent application Ser. No. 07/66316).
No. 4). Therefore, comparison of gene expression efficiency for determining a foreign gene replacement site was performed using RNA1 cDNA, RNA1
2cDNA and recombinant RNAc with foreign gene substitution
I) RNA1 cDNA and RNA2cD
Inoculating the synthesized recombinant RNA into a protoplast of a recombinant plant in which NA has been introduced into the genome, or i.
i) Simultaneous inoculation of the synthesized RNA1, RNA2 and recombinant RNA into plant protoplasts can be performed simply, accurately and reproducibly. This is because, when a recombinant RNA cDNA is introduced into a plant genome, the amount of the recombinant RNA transcribed in a cell differs depending on the site of introduction and the number of introduction in the genome. As the inoculation method, a known method such as a polycation method, a polyethylene glycol method, or an electroporation method is used.

BMV produces 1a, 2a, 3a and coat proteins. Further, depending on the strain, a 19 KD hull protein (CP2) in addition to a 20 KD original hull protein (CP1)
It is also known to produce. (Sacher an
d Ahlquist, (1989) J. Am. Virol.
63: 4545-4552). The present inventor has proposed that BMV, A
Using the TCC66 strain, 1a protein, 2a protein, 3a
A portion from the first translation initiation codon of the protein and the coat protein gene, or a portion from the first and subsequent translation start codons of the coat protein gene is converted to a foreign gene such as I
As a result of replacing F2 or GUS and examining the relationship between the foreign gene replacement site and the amount of the foreign gene product, it was surprisingly found that the replacement of CP2 with the foreign gene dramatically increased the amount of the foreign gene produced. . For this reason, the present inventor is not bound by theory, but is not limited to the nucleotides from the 5'-terminal untranslated region of the above-mentioned coat protein gene cDNA to the second translation initiation codon in the coat protein structural gene. I think the sequence of the parts is important.

This sequence is 5'GTATTTAATGT
CGACTTCAGGAACTGGTAAGATG (SEQ ID NO: 1). That is, BMV
The nucleotide sequence around the first translation initiation codon from the nucleotide portion corresponding to the 5 'end untranslated region of the ATCC66 coat protein gene cDNA is inappropriate for translation, and the nucleotide sequence around the second translation initiation codon is It is a structure suitable for translation, and the fact that translation is performed from the second translation initiation codon is based on the CP2 of ATCC66.
There is a possibility that the ability to translate from is improved. Further, the present invention is an epoch-making invention having an excellent effect that by exchanging CP2 of ATCC66 with a foreign gene, a target foreign gene product which is not a fusion protein with a coat protein is produced in large quantities. .

From this, according to the present invention, even if other plant RNA viruses are used, the coat protein gene cDNA
At the nucleotide portion corresponding to the 5'-terminal untranslated region of
The method of Kunkel et al. (Kunkel et al., (1987)
Methods in Enzymology 15
4: 367-382) to perform a genetic manipulation such as deletion or substitution by site-directed mutation or the like to render the nucleotide sequence around the first translation initiation codon inappropriate for translation and to cause the second translation initiation codon By performing a genetic manipulation to make the surrounding nucleotide sequence suitable for translation and modifying it so that translation is performed from the second translation initiation codon, it is possible to dramatically increase the production of the target gene product. Can do it. Also,
It is also possible to artificially create an ATG site downstream of the original translation start point and start translation from the artificially created ATG site.

[0032] Recombinant RNA is a coat protein (Allison) required when the virus is transferred throughout the plant.
Et al., (1990) Proc. Natl. Acad. Sc
i. USA 87: 1820-1824) Since the gene portion is removed, it is impossible to express the foreign gene in the whole plant by the inoculation method. In the present invention, RN
A method has been adopted in which a recombinant RNA cDNA is further introduced into a recombinant plant in which the cDNA of the A-replicating enzyme gene has been introduced into the plant genome, and the foreign gene is expressed in the recombinant plant. It becomes possible to do.

According to the method of the present invention, a viral RNA replication enzyme encoded by the genome of an RNA plant virus is introduced into a plant genome, the RNA replication enzyme is produced by a plant transcription / translation mechanism, and the desired gene is expressed in plant cells. mR
Since NA is synthesized in a large amount, the translation ability is further enhanced, and the gene product can be efficiently produced, the industrial use value is extremely large. In the method of the present invention, the foreign gene is replaced with a coat protein gene of viral genomic RNA, then incorporated into a plant transformation vector, introduced into the plant genome, and transcribed as recombinant RNA in plant cells, or Since the plant is inoculated as a recombinant RNA synthesized in vitro by being incorporated into a recombinant transcription vector, it is extremely efficient compared to in vitro synthesizing all the viral genomic RNA and inoculating the plant. Usage. Also, BMV AT
As in CC66, the nucleotide sequence from the 5'-terminal untranslated region to the second translation initiation codon in the coat protein gene was determined by the method of Kunkel et al. (Kunkel et al., (19)
87) Methods in Enzymology
154: 367-382), by making a modification such as deletion or substitution by site-directed mutation, etc., and replacing the part to be replaced with the foreign gene by the second translation initiation codon of the coat protein gene, Since a target foreign gene product is produced dramatically instead of a fusion protein of the above, further industrial use value is increasing.

Various genes can be considered as the gene to be introduced into the recombinant virus genomic RNA, for example, the recombinant RNA3. For example, genes such as agriculturally useful proteins, functional proteins, and pharmaceutical proteins such as interferons can be introduced. In this case, it is possible to introduce those in which an active protein cannot be obtained by a method using bacteria, for example, those in which the provision of a sugar chain structure is important for the activity of the protein. Furthermore, this method can be an extremely effective means if a toxic protein that kills cells in animal cells or bacteria is not toxic to plant cells. Further, when used for crop breeding, higher trait expression can be obtained since the amount of foreign gene mRNA produced is larger than in the conventional method of incorporating several copies of a foreign gene into a plant genome. For example, if the foreign gene is a viral coat protein gene, it leads to breeding of a virus-resistant plant, and if the cowpea trypsin inhibitor gene, it leads to breeding of a broad-spectrum insect-resistant plant. Furthermore, by incorporating antisense RNA complementary to endogenous RNA and synthesizing a large amount of antisense RNA in plant cells, translation of endogenous RNA can be suppressed, and expression of plant genes can be regulated. It is possible.

[0035]

The present invention will be described in more detail with reference to the following Examples, which should not be construed as limiting the invention. Embodiment 1 FIG. Construction of BMV RNA Transcription Vector and Plant Transformation Vector Preparation of cDNA for BMV RNA 1, 2, and 3 BMV used ATCC66 strain. Barley (Hordeum vulgare L. cultivar: Goune four stones) was used for virus propagation, and a known fractional centrifugation method (Oku
No. et al., (1978) J. Mol. Gen. Viol. 38: 4
09-418)), the phenol extraction was repeated 3-4 times in the presence of bentonite and SDS using purified BMV, and ethyl ether treatment and ethanol precipitation were performed to obtain RNA.

The obtained RNA solution was subjected to a separation method using standard low melting point agarose electrophoresis (Sambrook).
Et al., (1989) Molecular Cloning.
2nd, CSH Laboratory), R
NA1, 2, and 3 were obtained, respectively. From each of the obtained RNAs, a known method (Ahlquist et al., (1984))
J. Mol. Biol. 172: 369-383) to prepare full-length cDNAs of RNAs 1, 2 and 3.
Those cloned into the UC vector are pBB
1, 2, and 3. pBB1, 2 and 3 are full-length c
SnMV is added to the site corresponding to the BMV RNA 5 'end of DNA.
It has an aBI site and an EcoRI site immediately downstream of the 3 'end.

B. Construction of BMV RNA transcription vector and in vitro synthesis of infectious RNA B-1 BMV RNA transcription vector (pBTF1, 2
And 3) Construction In order to synthesize BMV RNA in vitro,
DNA-dependent RNA polymerase is essential. DNA
Dependent RNA polymerases include T7 RNA polymerase,
Although SP6 RNA polymerase and Escherichia coli RNA polymerase and the like are commercially available, in this experiment, since the nucleotide sequence of the promoter region and the transcription start site were precisely clarified and had high transcription activity, T7 RNA polymerase (Dunn et al., (1983) J. Mol.
iol. 166: 477-535)
A tro BMV RNA synthesis system was established. Virus R
The structure of the nucleic acid at the 5 'end of NA has a very important function in the replication and translation of viral RNA, etc.
It has been reported that the biological activity of viral RNA is drastically reduced when an extra nucleotide sequence is added to the terminal (Janda).
Et al., (1987) Virology 158: 259-.
262). Therefore, in order to synthesize in vitro a viral RNA having the same base sequence at the 5 ′ end as that of the wild type, transcription must be accurately started from the 5 ′ end of the cDNA. Therefore, the transcription start point was blunt-ended and B
To introduce the full length cDNA of MV RNA, T7
We attempted to introduce a restriction enzyme recognition site into the transcription start site of the promoter.

B-1-1 Synthesis of T7 promoter DNA synthesizer (Applied Biosystem)
Oligonucleotide 5 'pd (CTAGATGCAT) consisting of two 31 bases using s company model 381A)
ATAGTGAGTCGGTATTAATTTA) (SEQ ID NO: 2) and 5'pd (AGCTTAAAATTAAT)
ACCGACTCACTATATGCAT) (SEQ ID NO:
3) was synthesized. After completion of the synthesis, the solution was purified by high performance liquid chromatography according to a conventional method, and the collected oligonucleotide solution was neutralized by adding 1/200 volume of 2N HCl, and then NENSORB20 (manufactured by Du Pont)
For desalting.

First, 2 ml of methanol (for high performance liquid chromatography, manufactured by Nacalai Tesque) and 2 ml of A
Solution (0.1 M Tris-HCl, 10 mM Triet
hyamine (TEA), 1 mM Na ₂ -EDT
A), pH 7.7), the column was equilibrated. Next, TE was added to the sample at a rate of 1.4 μg / ml.
What added A was added to the column, and it was made to adsorb | suck. 6-9m
After washing the column with 1 L of solution A and 3 ml of ion-exchanged water, oligonucleotides were eluted with 400 μl of 50% ethanol (special grade, manufactured by Nacalai Tesque). The eluted oligonucleotide solution was dried under reduced pressure by an evaporator and then dissolved in ion-exchanged water to prepare a 1 μg / ml oligonucleotide solution. The 5 'and 3' ends of these synthetic oligonucleotides were phosphorylated. That is, 1 μl of oligonucleotide (1 μg / ml),
20 μl of 10 mM ATP, 20 μl of 10 × kinase solution (500 mM Tris-HCl, pH 7.5, 1
A reaction solution containing 00 mM MgCl ₂ , 100 mM dithiothreitol (DTT), 4 μl of T4 polynucleotide kinase (4 units / μl, manufactured by Takara Shuzo) and 155 μl of ion-exchanged water was allowed to react at 37 ° C. for 1 hour. Was phosphorylated. After the reaction, 65
The enzyme was inactivated by heat treatment at 10 ° C. for 10 minutes.

The reaction solution was subjected to phenol treatment twice, phenol / chloroform treatment once, chloroform treatment once and ethyl ether treatment three times, and then placed under reduced pressure for 30 to 40 minutes to remove ethyl ether mixed in the reaction solution. Removed completely. The reaction solution was added to a NENSORB20 column, and the phosphorylated oligonucleotide was purified by the same method as described above.
The solution was dissolved in distilled water so as to obtain a ml, and subjected to subsequent operations. These synthetic oligonucleotides were annealed to synthesize a T7 promoter. This promoter sequence has a HindIII site at the 5 ′ end and an XbaI site at the 3 ′ end in addition to the consensus sequence of the T7 promoter.
Has an siI site.

B-1-2 Introduction of BMV RNA full-length cDNA into transcription vector pUCT (FIG. 5) Synthetic T7 promoter was ligated with HindIII / pUC19.
The vector was introduced into the XbaI site to construct a transcription vector pUCT. pUCT is treated with NsiI and T4 DNA polymerase to remove bases up to the (+1) position of the T7 promoter and form a blunt end at the (-1) base pair. SnaBI / Ec containing full-length BMV RNA cDNA of each of pBB1, pBB2 and pBB3
oRI fragment and E after NsiI and T4 polymerase treatment
Ligation was performed with the large fragment of pUCT that had been subjected to the coRI treatment to construct transcription vectors pBTF1, 2, and 3 of BMV RNA1, 2, and 3, respectively.

B-2 In Vitro of Infectious RNA
oSynthesis (Fig. 5) RNA immediately downstream of the transcription start point of T7 promoter
Each full-length cDNA of 1, 2, and 3 is introduced,
Furthermore, the DNA of each of the transcription vectors pBTF1, 2, and 3 having an EcoRI site immediately downstream of the full-length cDNA was subjected to cesium chloride centrifugation (Sambrook).
Et al., (1989) Molecular Cloning.
(2nd, CSH Laboratory). After cutting 3 μg of each purified DNA with EcoRI, it was treated with phenol / chloroform to give 20 μg.
Was precipitated using ethanol as a carrier.

16.8 μl of distilled water, 1
0 μl of 5 × transfer buffer (200 mM, Tris-HCl
(PH 7.5), 30 mM MgCl2, 10 mM S
permidine, 50 mM NaCl), 5 μl of 100 mM, DTT, 1.8 μl of DNase / RNa
se-free bovine serum albumin (2.8 mg / ml),
2.5 μl of RNasin (40 unit / ml),
2.5 μl 10 mM ATP, 2.5 μl 10 mM
UTP, 2.5 μl of 10 mM CTP, 0.4 μl
Of 10 mM GTP and 5 μl of 5 mM cap analog (m7GpppG), mix gently, and add 1 μl
Was added and reacted at 37 ° C. One hour later, 2 µl of 10 mM GTP and 1 µl of T7 polymerase were further added, and reacted at 37 ° C for 1 hour.
Then, 1.3 μl of DNase (1 unit / ml)
Was added thereto and reacted at 37 ° C. for 1 hour to decompose the template DNA. This reaction solution was treated with phenol / chloroform and chloroform once each, and 20 μg of tRNA was treated.
Was precipitated with ethanol as a carrier, and suspended in 10 μl of distilled water.

B synthesized in vitro by the method described above
The transcripts of each of the MV RNA 1, 2 and 3 cDNAs were mixed, and an equal volume of 2 × inoculation buffer (100 m
M, Tris-phosphate (pH 8.0), 500 mM Na
Cl, 10 mM EDTA, 1% (W / V) bentonite) was added to obtain an inoculum. Carborundum (600 mesh) was lightly sprinkled on barley leaves as a systemically infected host, and 5 to 10 μl of inoculated droplets were spread and inoculated. Immediately after inoculation, the carborundum on the leaves was washed away with tap water. Approximately 2 weeks at 25 ° C. in a growth chamber (8,000
0LUX), the transcripts of the transcription vectors pBTF1, 2 and 3 were confirmed to be infectious because they developed systemic infection symptoms.

C. Construction of Plant Transformation Vector Introduction of Restriction Enzyme Recognition Site into Transcription Start Site of C-1 CaMV 35S Promoter Full length of BMV RNA between promoter and terminator recognized by DNA-dependent RNA polymerase present in plant cells An attempt was made to introduce cDNA. As the promoter, a CaMV 35S promoter was used in consideration of the fact that the transcription amount was large and the transcription start point and the nucleotide sequence of the promoter region were clarified. In addition, the mutant BMV RNA strain having an extra 7 base sequence at the 5 ′ end does not have infectivity (Jan.
da et al., (1987) Virology 158: 25.
9-262), in order to make the nuclear transcript of the full-length cDNA of BMV RNA introduced into plant cells have a growth ability, the transcription start site of the cDNA must be 5′-terminal of BMV RNA. Need to match exactly. Therefore, in order to introduce the full length cDNA of BMV RNA immediately downstream of the transcription start site, a recognition site for a restriction enzyme was introduced into the transcription start site of the 35S promoter of CaMV by site-directed mutagenesis.

C-2 Site-directed mutagenesis (FIG. 3) CaMV CM stored in Plant Pathology Laboratory, Faculty of Agriculture, Kyoto University
The 35S promoter region of the 1841 strain (7016-74)
34) is a polylinker sequence derived from pUC18 and CaM
V CM1841 strain 35S terminator region (74
36-7606) was used immediately before pCAM35.
To prepare single-stranded DNA of the 35S promoter region, the PstI / EcoRI fragment of pCAM35 was
118 at the PstI / EcoRI site and pCAM
35 EP was constructed. E. coli MV1 with pCAM35EP
184 strain was transformed and helper phage M13K07 was used.
Was used to prepare single-stranded DNA.

In order to introduce a StuI site into the transcription start site, a complementary 25-base oligonucleotide 5 ′ pd (GTAGGCCTCTCCAAATGAAA) except for three mismatches was added to the transcription start site of the prepared single-stranded DNA.
ATGAAC) (SEQ ID NO: 4) was synthesized and prepared by the method described in B-1-1. 1 μl of single-stranded DNA (20
μg / μl), 1 μl of synthetic oligonucleotide (2 μl
g / μl), 20 μl of 10 × annealing buffer (2
00 mM, Tris-HCl (pH 7.5), 100 mM
MgCl ₂ , 500 mM NaCl, 10 mM DT
T) 178 μl of distilled water was placed in a 1.5 ml Eppendorf tube, treated at 62 ° C. for 15 minutes, then cooled slowly at room temperature for 7 minutes, and the single-stranded DNA was annealed with the synthetic oligonucleotide. . After slow cooling, 40 μl of Klenow
Buffer (100 mM, Tris-HCl (pH 7.5),
50 mM MgCl ₂ , 50 mM DTT), 20 μl
DNTP solution (dATP, dCTP, dGTP, dT
TP 2 mM each), 10 μl of Klenow Fr
agarment (4 units / ml) and 130 μl of distilled water, perform an enzyme reaction at 22 ° C. for 5 hours, and use complementary oligonucleotides as primers for complementary DNA.
The chain was synthesized.

After the reaction, phenol treatment and phenol /
After chloroform treatment and ethyl ether treatment, ethanol precipitation was performed to obtain a double-stranded DNA precipitate. This double-stranded DNA was digested with PvuII, treated with phenol / chloroform, and precipitated with ethanol. 1.5 μl of a loading buffer (0.89 M tris-borate, 2 mM EDTA, 0.2% (W /
V)) Bromophenol blue, 0.2% (W / V) xylene cyanol) and 432 μl of formaldehyde were mixed, heat-treated at 95 ° C. for 5 minutes, and quenched in ice.

This sample was loaded on a 3.5% polyacrylamide 7M urea gel (15 cm × 15 cm, thickness 2 mm, slot width 1 cm), electrophoresed at 200 V for 2 hours, and single-stranded DNA synthesized by the primer was separated. . After staining the gel with ethidium bromide (0.5 μg / ml), the gel was washed three times with about 30 ml of ion-exchanged water to remove excess ethidium bromide and urea. The target band was excised under UV irradiation, and the gel was fragmented through a 1 ml syringe (TERMO). The fragmented gel was mixed with 7 ml of elution buffer (500 mM ammonium acetate, 10 mM magnesium acetate, 1 mM EDT).
A, 0.1% SDS) and left overnight at 37 ° C.
After centrifugation at 5000 × g for 30 minutes, the supernatant was subjected to phenol treatment twice, phenol / chloroform treatment once, chloroform treatment once and ethyl ether treatment three times. After concentrating this solution 4-fold with 2-butanol,
Two volumes of ethanol and 10 μl of tRNA (2 mg /
ml), and a precipitate of single-stranded DNA was obtained by ethanol precipitation, and dissolved in 30 μl of distilled water.

5 μl of the recovered single-stranded DNA (0.2 μl
g / μl), 1.5 μl of M13 reverse primer (50 ng / μl, M13 primer RV, Takara Shuzo), 1 μl of annealing buffer (100 mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ ,
500 mM NaCl), 1.5 μl of TE buffer (1
0 mM Tris-HCl (pH 8.0), 1 mM EDT
A) and 1 μl of KlenowFragment (4u
nit / μl) to synthesize a double-stranded DNA fragment,
A StuI site was introduced at the start of transcription. Synthesized 35S
A fragment of the promoter region cut with EcoRI was introduced into the EcoRI / SmaI site of pUC18 to construct pCaP35 containing the modified 35S promoter region. By cutting pCaP35 with StuI, the transcription start site can be made blunt-end, and BMV RN
A full-length cDNA of A can be introduced just downstream of the transcription start site.

C-3 Plant Transformation Vector (pB
Construction of ICBR series) (Fig. 6) The full-length cDNA of BMV RNA was introduced into the plant genome, and the transcript synthesized in the introduced cells was converted to wild-type virus R
A vector for producing a transformed plant having the same translation and growth ability as NA was constructed. Agrobacterium binary vector pBIN19 for plant transformation (Bev
et al., (1984) Nucl. Acids Res.
12: 8711-8721) of EcoRI / HindI.
In the II site, the CaMV 35S promoter, pUC18
The plasmid into which the derived polylinker site and CaMV terminator have been introduced is pBIC35. pBIC
35 was digested with EcoRI, blunt-ended by T4 DNA polymerase treatment, a SalI linker was added, and then digested with SalI and self-ligated.
PBICT (-E) lacking the 35S promoter was constructed. Next, pBICT (-E) cut with SmaI
Was further subjected to self-ligation after addition of an EcoRI linker to construct pBICTE in which the SmaI site was changed to an EcoRI site.

On the other hand, StuI was introduced into the transcription start site of the 35S promoter of CaMV by site-directed mutagenesis.
PCa containing a modified 35S promoter into which a site has been introduced
After p35 was cut with EcoRI, both ends were blunt-ended by treatment with T4 DNA polymerase, SalI linkers were added to both ends, and cut with SalI and BamHI to obtain D35 containing the modified 35S promoter.
An NA fragment was obtained. This fragment was ligated with SalI /
It was introduced into the BamHI site to construct pBICP35. Next, the SnaBI of pBB1, pBB2 and pBB3 containing the full-length cDNA fragments of BMV RNA1, 2 and 3
/ EcoRI fragments were converted to StuI of pBICP35, respectively.
/ EcoRI site, introduced into plant transformation vector p
BICBRs 1, 2 and 3 were constructed, respectively (FIG. 6).

C-4 Plant Transformation Vector (pB
(ICBMR series) (Fig. 7 and Fig. 9) BMV RNA 3'-terminal deleted cDNA in plant genome
Was introduced to construct a vector for producing a transformant in which a transcript synthesized by the transfected cell has translation ability but does not have proliferation ability like wild-type virus RNA. BMV R
After pBB1 containing the full-length cDNA of NA1 was digested with XhoI, it was treated with T4 DNA polymerase, both ends were blunt-ended, and an EcoRI linker was added.
After the RI cutting, self-ligation was performed. As a result, Xh of the 3 'untranslated region of the RNA1 cDNA was
pBB1 (-) with a deletion of about 200 bases downstream from oI
3) was obtained. The SnaBI / EcoRI fragment containing the pBB1 (-3) RNA1 cDNA was
The vector was introduced into the tuI / EcoRI site to construct a plant transformation vector pBICBMR1 (FIG. 7).

After pBB2 containing the full-length cDNA of BMV RNA2 was digested with PstI and HindIII,
The NA fragment was introduced into the PstI / HindIII site of pUC18 to obtain pBB2 (-H) containing cDNA in which the untranslated region at the 3 ′ end of RNA2 was deleted. pBB2 (-
H) was digested with HindIII, treated with T4 DNA polymerase, both ends were blunt-ended, an EcoRI linker was added, and EcoRI was cut, followed by self ligation. As a result, pBB2 (-3) having a deletion of about 200 bases downstream from HindIII in the untranslated region at the 3 'end of RNA2 was obtained. A SnaBI / EcoRI fragment containing the pBB2 (-3) RNA2 cDNA was introduced into the StuI / EcoRI site of pBICP35 to construct a plant transformation vector pBICBMR2 (FIG. 8).

After cutting pBB3 containing the full-length cDNA of BMV RNA3 with PstI and HindIII,
The NA fragment was introduced into the PstI / HindIII site of pUC18 to obtain pBB3 (-H) containing cDNA in which the untranslated region at the 3 ′ end of RNA3 was deleted. pBB3 (-
H) was digested with HindIII, treated with T4 DNA polymerase, both ends were blunt-ended, an EcoRI linker was added, and EcoRI was cut, followed by self ligation. As a result, pBB3 (-3) having a deletion of about 200 bases downstream from HindIII in the untranslated region at the 3 'end of RNA3 was obtained. The SnaBI / EcoRI fragment containing the pBB3 (-3) RNA3 cDNA was introduced into the StuI / EcoRI site of pBICP35 to construct a plant transformation vector pBICBMR3 (FIG. 9).

Embodiment 2 FIG. Expression of each introduced BMV genome in transformed plant cells A. Introduction of Plant Transformation Vector into Tumefaciens One NB agar medium (0.8% Nutrient B)
E. coli DH5α strain (containing the pBICBR or pBICBMR vector), E. coli HB101 strain (containing the helper plasmid pRK2013), and A. roth, 1.5% Bacto Agar). tume
faciens LBA4404 strain (containing the Ti plasmid lacking the T-DNA region),
The cells were cultured at 30 ° C. for 2 days. After culturing, 3
The seed bacteria were mixed and further cultured at 30 ° C. for 2 days. 5
Bacteria mixed and cultured on an AB agar medium (Table 1) containing 0 μg / ml kanamycin were streaked and cultured at 30 ° C. for 2 days to obtain a single colony. This colony contains A. tumefacien
sLBA4404 strain.

B. A. Tobacco tumefacien
inoculation and selection of transformants Tobacco for inoculation (Nicotiana tabacum)
cv. Petit Habana SR1)
A sterilized plant derived from a seed subjected to a sterilization treatment was used. 1.5m
About 100 μl of tobacco seeds were placed in a 1-liter Eppendorf tube, and the tobacco seeds were washed with 1 ml of 70% ethanol. Next, 1.5 ml of 20% antiformin was added and 4
While stirring for 1 second every minute, bring to room temperature for 20 minutes.
The mixture was allowed to stand for 5 minutes and sterilized with seeds. After sterilization, 3 with sterile water
Wash the seeds four times, and put in a plastic Petri dish (Seibusha, diameter 90 mm, depth 20 m) containing LS1 medium (Table 2)
m), and grown at 8,000 lux at 26 ° C.
The seedlings that grew to about 1 cm were transplanted into a biopot (Nippon Medical Chemical Co., Ltd.) containing LS8 medium (Table 2). tumefacie
ns inoculation. A. holding a transformation vector
Tumefaciens was shake-cultured in an AB liquid medium containing 50 μg / ml kanamycin at 30 ° C. for 2 days (12
0 revolutions / minute).

All subsequent operations were performed aseptically. Aseptically cultured tobacco leaves were cut out to 1 cm × 1 cm. The cells were immersed in a Tumefaciens culture solution for 1 minute. The leaf pieces were placed on a previously sterilized peter towel to remove excess bacterial fluid and placed on LS1 medium (Table 2) with the leaf pieces facing up. 26 ° C, 4
After culturing for 8 to 72 hours, tumefacien
Transfer to LS1 broth containing 500 μg / ml carbenicillin at 26 ° C., 7
The cells were cultured in 00lux for 2 days. After culturing, place the leaf pieces on a previously sterilized Peter towel,
The liquid medium was removed and transferred to an LS4 medium (Table 2) containing 150 μg / ml kanamycin and 100 μg / ml carbenicillin, and incubated at 8,000 lux at 26 ° C. for about 2 hours.
Cultured for 3 weeks.

The sprouted 5-10 mm shoots were cut from the calli with a sterilized scalpel, and the M containing 100 μg / ml kanamycin and 150 μg / ml carbenicillin.
SR medium (525 μg / ml naphthalene acetic acid and 100
(LS plate medium containing 6 g / ml of 6-benzyladenine and using Gelangum instead of agar). Two weeks later, the seedlings grown to a total body size of about 5 cm were raised in a flowerpot having a diameter of 12 cm, covered with a transparent plastic box, acclimated for several days, and then grown in a growth chamber.

Transformation vectors pBICBR1, pB
Kanamycin resistant transgenic tobacco with ICBR2 and pBICBR3 were designated BR1, BR2 and BR, respectively.
3. Also, the transformation vectors pBICBMR1, pB
Kanamycin resistant transgenic tobacco plants with ICBMR2 and pBICBMR3 were named BMR1, BMR2 and BMR3, respectively.

C. Expression analysis of each of BMV gene products introduced into tobacco As a method for examining whether or not each of the introduced BMV genes is expressed in a transformed plant showing kanamycin resistance, analysis of the expression of the introduced 1a gene is performed by the following method. The protoplasts prepared from transgenic tobacco were inoculated with a mixture of RNA2 and 3, and the expression of the 2a gene was analyzed by inoculating a mixture of RNA1 and 3. RNAs 1, 2, and 3 were synthesized in vitro from pBTFs 1, 2, and 3 by the method described in Example 1B.中 で In cells expressing the viral RNA replication enzymes 1a and 2a proteins, RNA4 that is the mRNA of the coat protein is transcribed from the inoculated RNA3, and BM is introduced into the cells.
It is thought that V coat protein accumulates. It is believed that the coat protein is not translated directly from RNA3, but rather is translated by RNA replication enzyme of BMV through RNA4 transcribed from (-) strand RNA3 (M
iller et al., (1985) Nature 313: 6.
8-70) By detecting the expression of the coat protein, it is possible to indirectly detect the expression of the RNA replication enzyme or 1a and 2a proteins which are subunits of the enzyme. Therefore, the expression of the coat protein was analyzed by Western blotting using an anti-BMV antibody.

C-1 Preparation of Protoplasts For the preparation of protoplasts, fourth to fifth tobacco leaves having a leaf length of 15 to 20 cm were used. Peel off the back epidermis of the cut tobacco leaf, and add 0.5% mannitol solution (pH 5.0 with KOH) containing 1% cellulase Onozuka R-10 (Kinki Yakult) and 0.05% macerozyme (Kinki Yakult) in 100 ml Kolben. 6-5.8), and the mixture was shaken gently every 15 minutes and treated at 26 ° C. for 2 hours. The undegraded tissue contained in the obtained protoplast suspension was separated by filtration with 4-6 layers of gauze, transferred to a 50 ml glass centrifuge tube, and centrifuged at 100 × g for 2 minutes to collect protoplasts. The centrifugal washing with 5M mannitol solution was repeated twice.

C-2 BMV to tobacco protoplasts
Inoculation of RNA The protoplasts suspended in 0.5 M mannitol were transferred to 4-6 10 ml polypropylene culture tubes (Nissui Pharmaceutical # 06480), and the protoplasts were collected by centrifugation at 100 × g for 2 minutes, and the supernatant was removed. did. T solution containing 2-10 μg of BMV RNA and 10 μg of tRNA in protoplasts (0.5 M mannitol, 40 mM
After adding 0.7 ml of CaCl ₂ ) and mixing well, immediately add 0.7 ml of a PEG solution (40% PEG 4000, 0.5 M mannitol, 40 mM CaCl ₂ ),
Mix gently upside down and shake slowly on ice for 30 minutes.

Thereafter, about 8 ml of the T solution was added, and the mixture was turned upside down, gently mixed, and allowed to stand on ice for 30 minutes. 10
After collecting the protoplasts by centrifugation at 0Xg for 2 minutes, High-
pH, High-Ca ²⁺ buffer (0.7 M mannitol, 50 mM, CaCl ₂ , 50 mM glycine, pH 8.
Centrifugal washing according to 5) was repeated three times. Protoplasts were added to 3 ml of 0.7i medium (0.2 mM KH2PO4,
_{1mM KNO3,1mM MgSO 4 · 7H 2 O} , 10
mM CaCl ₂ .2H ₂ O, 0.1 μM KI, 0.1 mM
01 μM CuSO ₄ .5H ₂ O, 0.7 M mannitol, 2500 unit / ml mycostatin, 20
0 μg / ml chloramphenicol, pH 6.5) and cultured at 26 ° C. for 48 hours.

Preparation of C-3 Antibody and Western Blot Analysis Anti-BMV serum was purified by the ammonium sulfate method, and γ
-A globulin fraction was obtained. Acetone powder was prepared from tobacco protoplasts and reacted with the purified anti-BMV antibody described above to remove antibodies that nonspecifically bind to plant components. After the protein extracted from the protoplasts inoculated with BMVRNA was subjected to SDS-polyacrylamide gel electrophoresis, the separated protein was subjected to the method of Towbin et al. (Towbin et al., (1979) Pro. Natl. A.
cad. Sci. ScL USA 76: 4350-4354).
Electrically by the membrane (Imbilon-
P, manufactured by Millipore). After transcription, a purified anti-BMV antibody diluted 1/400 as a primary antibody, and an anti-rabbit IgG labeled with alkaline phosphatase as a secondary antibody
-Using goat IgG, BMV coat protein was detected by a color reaction using NBT-BCIP as a substrate.

C-4 Analysis of the Transduced Gene Products in BR1 and 2 Plant Cells Protoplasts prepared from BR1 plants were inoculated with RNA2 + 3 synthesized in vitro and RNA1 + 2 + 3 as a positive control. 48 hours after inoculation,
Relative evaluation of coat proteins synthesized in the transformed plants was performed by Western blot analysis. Assuming that the average value of the expression level of the coat protein gene in the positive control was 100%, the detection was as follows.

平均 Average value of coat protein expression──── １ BR1 plant RNA1 + 2 + 3 inoculation 100 BR1 plant Mock (pseudo) inoculation 0 BR1 plant RNA1 + 3 Inoculation zone 0 BR1 plant RNA2 + 3 inoculation zone 110 ────────────────────────────────────

In the RNA 2 + 3 inoculated group, the same degree of coat protein was detected as in the RNA 1 + 2 + 3 inoculated group. Even when only RNA2 and RNA3 are inoculated without inoculating RNA1,
Since the same level of coat protein was synthesized in protoplasts as when RNA1 + 2 + 3 was inoculated, it was considered that the complete 1a protein was expressed in all cells in the BR1 plant. When protoplasts prepared from BR2 plants were inoculated with RNA1 + 3, coat proteins were detected as follows.

平均 Average value of coat protein expression──── ──────────────────────────────── BR2 plant RNA1 + 2 + 3 inoculation zone 100 BR2 plant Mock inoculation zone 0 BR2 plant RNA2 + 3 inoculation zone 0 BR2 plant RNA1 + 3 inoculation area 98 ────────────────────────────────────

When RNA1 + 3 alone was inoculated without RNA2, the same amount of coat protein was synthesized in protoplasts as when RNA1 + 2 + 3 was inoculated. It was considered that the protein was expressed.

C-5 Analysis of Transduced Gene Products in BMR1 and 2 Plant Cells Protoplasts prepared from BMR1 and 2
RNA synthesized in vitro was inoculated. Forty-eight hours after inoculation, coat proteins in protoplasts were detected by Western blotting.

平均 Average value of coat protein expression────接種 BMR1 plant RNA1 + 2 + 3 inoculation 100 BMR1 plant Mock inoculation 0 BMR1 plant RNA2 + 3 inoculation 105 BMR1 plant RNA1 + 3 inoculation zone 0 BMR2 plant RNA1 + 2 + 3 inoculation zone 100 BMR2 plant Mock inoculation zone 0 BMR2 plant RNA2 + 3 inoculation zone 0 BMR2 plant RNA1 + 3 inoculation zone 90 ──────────────────── ────────────────

As a result, using the pBICBMR vector having a deletion only in the 3′-terminal untranslated region, the c
When protoplasts prepared from BMR1 into which DNA was introduced were inoculated with RNA2 + 3, RNA1 + 2 + 3
The same degree of coat protein was detected as in the case of inoculation with E. coli, and the coat protein was also detected when BMR2 was inoculated with RNA1 + 3. In BMR1 or BMR2, c of RNA1 or RNA2 introduced into the plant genome
Since the transcript of DNA has no replication ability, it indicates that all 1a or 2a proteins required for virus replication could be relied on for transcription and translation from the plant genome. In addition, it became clear that each gene of the virus could be independent of the complex regulatory mechanism of the virus and could depend on the transcription and translation mechanisms of the plant.

Production of Tobacco Plant Producing C-6 BMV RNA Replication Enzyme BR1 and BR2 plants, and BMR1 and BMR2 plants were crossed. In the crossing method, the pollen parental BR1 plant during flowering was picked up with forceps and pollinated on the pistil of the emasculated mother R2 plant, and the seeds were harvested about 4 weeks later. Crossing of BMR1 and BMR2 plants was performed in the same manner. The collected seeds were germinated on a kanamycin-containing (50 μg / ml) LS1 medium, and kanamycin-resistant tobacco was selected. Plants in which both RNA1 and RNA2 cDNAs were introduced into the genome were 1a and 2a
RNA to its protoplasts to produce proteins
The coat protein can be produced by three inoculations. [Example 2] Tobacco plants producing the coat protein were selected from kanamycin-resistant tobacco plants in the same manner as in C-4 and C-5. BR1 obtained by the method described above
The F1 plant of the plant and the BR2 plant is a BR (1 + 2) plant, B
F1 plant of MR1 plant and BMR2 plant was replaced with BMR (1+
2) It was named plant. These are plants in which both the RNA1 and RNA2 cDNAs have been introduced into the genome, and produce 1a and 2a proteins.

Next, the BR (1 + 2) plant and the BMR (1
+2) To obtain a pure diploid of the plant, Imamura
(Imamura et al., (1982) Plan
t Cell Physiol. 23: 713-71
6), the culture (another culture)
e) was performed, and when the second leaf of the obtained haploid seedling emerged, the tip of the germ was treated with a 0.2% colchicine aqueous solution. A plant which appears to be a doubled plant was selected and [Example 2] C
Individuals producing the coat protein were selected in the same manner as in -4 and 5 to obtain pure diploids. Pure diploids obtained from BR (1 + 2) and BMR (1 + 2) plants were named BRP (1 + 2) plant and BMRP (1 + 2) plant, respectively.

Embodiment 3 FIG. Production of IFN BMV ATCC66 strain was used as an RNA plant virus, and human-derived γ-interferon (IFN) gene was used as a desired foreign gene. The characteristics of the IFN gene include a gene derived from an animal, in which a sugar chain is added after translation, and the N- and C-terminals are processed (cut). IFN gene is about 50
At 0 bp, it encodes a protein of about 170 amino acids, and when this gene is expressed in animal cells, three types of components are detected by glycosylation and processing of both ends (Gr
ay et al., (1982) Nature 295: 503-
505).

A. Construction of BMV-IFN chimeric RNA transcription vector (FIGS. 10 to 15) For construction of BMV-IFN chimeric RNA transcription vector,
Plasmid pBTF1, in which the full-length cDNAs of BMV RNA1, 2, and 3 were inserted downstream of the T7 promoter,
2 and 3 (FIG. 5) were used, respectively. 1a, 2a and 2
To replace the viral genes respectively encoding the coat protein genes (CP1 and 2) of the species with the IFN gene, an NsiI site was added at the start codon of the BMV cDNA and IFN gene according to the method of Kunkel et al.
I, et al., (1987) Methods in Enzymo.
(log 154: 367-382) (FIG. 4).

The following oligonucleotides were used to perform site-directed mutagenesis by the method [Example 1] B-1-
Synthesized according to the method of Example 1. The 1a protein gene in pBTF1 contains 5′pd (GTTTTTCACCAAC
AAAAATGCATAGTTCTATCGATTTG
C) (SEQ ID NO: 5), 5 'pd (ACCAAGATGCATTTC
GAAAACC) (SEQ ID NO: 6) and 5 'pd (GTTCCCGAT)
GCATAACATAGTTT) (SEQ ID NO: 7), p
The CP1 gene in BTF3 contains 5′pd (GTAT
TTAATGCACTACTTCAGGAAC) (SEQ ID NO: 8), the CP2 gene in pBTF3 contains 5'p
d (TGGTAAGATGCACGCGCGCAGC)
(SEQ ID NO: 9), the IFN gene in pMKC (assigned from Daiichi Pharmaceutical Co., Ltd.) has 5 'pd (TCTCTC
GGAATGCATGCATGAAATATAC) (SEQ ID NO: 10) was used.

Using these, pBTF1a, pBTF2
a, pBTF3a, pBTFpCP1, pBTFpCP
2 and pUCpIFN (Nsi) were constructed respectively. In addition, the oligonucleotide 5′pd (CCCAGT) immediately downstream of the stop codon of pUCpIFN (Nsi)
AATGGAGCTCCTGCCTGC) (SEQ ID NO:
11) to introduce a SacI site and use pUCIFN
(Nsi) was constructed.

After pBTF3a was digested with ClaI and StuI, blunt ends were performed by treatment with T4 DNA polymerase, a SacI linker was added, and further, after SacI digestion, self-ligation was performed. The resulting plasmid pBTF3a1 has lost the subgenomic RNA promoter and the ClaI site has been replaced by a SacI site. After pBTF3a was digested with SacI and StuI, blunt ends were performed by T4 DNA polymerase treatment, and self ligation was performed. The resulting plasmid pBTF3a2 has lost the NsiI site. After pBTF3a2 was digested with ClaI, it was blunt-ended with T4 DNA polymerase, and a SacI linker was added. Furthermore, after SacI digestion, self ligation was performed. In the resulting plasmid pBTF3a3, the ClaI site has been replaced by a SacI site.

PBTFpCP1 and pBTFpCP2
Was cut with StuI, and a SacI linker was added. Furthermore, self-ligation was performed after cutting SacI. The resulting plasmids pBTFCP1 and pBTFC
In P2, the StuI site has been replaced by a SacI site. pBTF2a, pBTF3a1, pBTF3a3,
pBTFCP1 and pBTFCP2 were converted to NsiI and Sa
The large fragment (fragment containing the plasmid) obtained by digestion with cI and pUCIFN (Nsi) were
And the IFN gene fragment obtained by cutting with SacI was ligated, and pBTF2apIFN,
pBTF3a1pIFN, pBTF3a3pIFN, p
BTFCP1pIFN and pBTFCP2pIFN were constructed.

PBTF1a was converted to NruI (blunt end cut).
And NsiI. The obtained large fragment and pUCI
FN (Nsi) is digested with SacI, blunt-ended with T4 DNA polymerase treatment, and then ligated with the IFN gene fragment obtained by NsiI digestion.
apIFN was constructed. pBTF1apIFN, pBT
F2apIFN, pBTF3a1pIFN, pBTF3
a3pIFN, pBTFCP1pIFN and pBTFC
P2pIFN was digested with NsiI, blunt-ended by T4 DNA polymerase treatment, and self-ligated to obtain pBTF1aIFN, pBTF2aIF.
N, pBTF3a1IFN, pBTF3a3IFN, p
BTFCP1IFN and pBTFCP2IFN were constructed. pBTF3a3IFN was replaced with BglII and EcoRI.
Large fragment obtained by cleavage with pBTF3
Was ligated with BglII and EcoRI to obtain a small fragment, which was ligated into pBTF3a4IF.
N was constructed. After cutting pBTF3a4 with BssHI, T
After blunting by 4 DNA polymerase treatment, self-ligation was performed. In the resulting plasmid pBTF3a5IFN, a frameshift has been introduced into the BMV coat protein gene.

B. In vitro of infectious BMV RNA
o Synthesis and inoculation into tobacco protoplasts Full-length cDNAs of BMV RNA 1, 2, and 3 respectively
Plasmid pBTF1,2 and 3 for transcription or B
Plasmid pBTF1 for transcription of MV-IFN chimeric RNA
aIFN, pBTF2aIFN, pBTF3a1IF
N, pBTF3a4INF, pBTF3a5INF, p
From BTFCP1IFN and pBTFCP2IFN,
[Example 1] Infectious BMVRN according to the method of B-2
In vitro synthesis of A was performed. As a result, BMV
RNA1, 2, 3 and 7 BMV-IFN chimeric RNs
A was obtained. The obtained BMV-IFN chimeric RNA was used for F1aIFN, F2aIFN, and F3a1IF, respectively.
N, FNF3a3IFN, F3a4IFN, F3a5I
FN, FCP1IFN and FCP2IFN (FIG. 16)
I named it.

Each BMV-IFN chimeric RNA and the control wild-type BMV RNA 3 were mixed with RNAs 1 and 2, respectively, and inoculated into tobacco protoplasts according to the method of Example 2C.

C. Replication of BMV-IFN chimeric RNA Each BMV-IFN chimeric RNA and control wild-type BMV
RNA3 was mixed with RNA1 and 2, respectively, and inoculated into tobacco protoplasts. 48 hours after inoculation, total RNA was prepared from tobacco protoplasts, and Northern blotting was performed using the 3 ′ terminal sequence portion common to all BMV RNA as a probe, and relative evaluation of chimeric RNA replication and subgenomic RNA synthesis in each experimental section was performed. Performed by Northern blotting. Assuming that the replication of the chimeric RNA and the synthesis of the subgenomic RNA in the wild type BMVRNA3, which is a positive control, is 100%,
The following were detected:

<< Replication of Chimeric RNA Synthesis of Subgenomic RNA >> ───────────────────────────────── F1aIFN1-F2aIFN1-F3a1IFN1-F3a4IFN 60 60 F3a5IFN 80 80 FCP1IFN 40 20 FCP2 IFN 40 20 RNA3 100 100 ────────────────────────────────────

As a result, F3a4IFN, F3a5IF
N, only FCP1IFN and FCP2IFN replicate,
In addition, subgenomic RNA was also synthesized. FCP1IFN
Alternatively, subgenomic RN synthesized from FCP2IFN
A: 20 of RNA4 synthesized from wild-type RNA3
%. On the other hand, F3a4IFN or F3a5
The amount of RNA transcribed from IFN is based on RNA3
There was no significant difference from the amount of RNA4 transcribed from E. coli.
In addition, the amount of total RNA in protoplasts was quantified,
When compared with the amount of subgenomic RNA synthesized from FCP2IFN, RNA synthesized from FCP2IFN
Was approximately 1% of the total RNA.

D. Analysis of IFN production in protoplasts inoculated with BMV-IFN chimeric RNA Each of the above-described BMV-IFN chimeric RNAs and control wild-type BMV RNA3 were mixed with RNAs 1 and 2, respectively, and inoculated into tobacco protoplasts. 48 hours after inoculation, total proteins were extracted from tobacco protoplasts, and the amount of IFN produced in each experimental section was measured by Western blotting analysis using an anti-IFN antibody. IFN in the experimental group using FCP2IFN showing the highest IFN production
Assuming that the average value of the production amount was 100%, detection was performed as follows.

<< IFN Production Amount >> F1aIFN 0 F2aIFN 0 F3a1IFN 0 F3a4IFN 15 F3a5IFN 15 FCP1IFN 15 FCP2IFN 100 ────────────────────────────

As a result, F3a4IFN, F3a5IF
Only in the experimental section using N, FCP1IFN and FCP2IFN, three components of IFN were produced, which are thought to be due to glycosylation and processing of both ends. Among them, the highest level of IFN in the section using FCP2IFN
Was produced, and the relative amount of IFN production in other experimental groups was calculated with the amount of IFN production in this experimental group taken as 100. F3a4IFN, F3a5IFN and FCP
In the section using 1 IFN, about 15 FCP2 IFN
% IFN was produced.

On the other hand, in the group using FCP1IFN, anti-I
Approximately 10% by fluorescent immunostaining using FN antibody
It was revealed that IFN was produced in the protoplasts. The absolute amount of IFN was measured by comparison with a control using commercially available IFN (JCR).
About 50 pg per cell infected with IFN;
This represented approximately 5% of the total protein in the cells. That is, IFN production was at a level comparable to that of the coat protein. From the above results, when the second translation initiation codon and subsequent portions of the CP gene were replaced with the IFN gene, protein production was 6 times or more as compared with the case where the normal method of replacing the first translation initiation codon and after was used. I found that it was capable.

E. Construction of BMV-IFN chimeric RNA4 and wild-type RNA4 transcription vector in which CP2 gene was replaced with IFN gene and in vitro RNA transcription (FIG. 17) As described above, three types of in vivo translation products of IFN were obtained by post-translational modification. FC
In P2IFN, it was not clear whether the translation started from the first translation initiation codon or the second translation initiation codon of IFN. Therefore,
In order to eliminate the effects of post-translational modifications, in vitro
o An attempt was made to use a protein translation system. Also, BM
V RNA3 does not have the coat protein translation ability, and the coat protein is translated from RNA4 synthesized from RNA3 in infected cells. Therefore, the CP2 gene in RNA4
BMV-IFN chimeric RNA that replaces the FN gene and has IFN translation ability in an in vitro protein translation system
4 was attempted to be prepared.

Plasmid pBB3 is a BMV full-length cDN
It has A3 and its cDNA is excised from the plasmid as a SnaBI-EcoRI fragment. Plasmid pU
CT7 carries the T7 promoter sequence and an NsiI site. Oligonucleotide 5'pd (GTATTT
AATG) (SEQ ID NO: 12) and 5′pd (TCGA
(CATTAAATAC) (SEQ ID NO: 13), and the obtained fragment was cloned into SBBl-Eco of pBB3.
It was introduced at the RI site to construct pBB4.

PBB4 has a SnaBI cleavage site at a site corresponding to the 5 'end of BMV cDNA4. pUCT7
Was digested with NsiI, blunt-ended by T4 DNA polymerase treatment, and digested with EcoRI. Further, the obtained DNA was ligated with a SnaBI-EcoRI fragment (BMV cDNA4 insert) of pBB4,
pBTF4 was constructed. pBTF4 was replaced with SalI and Ec
The large fragment obtained by cutting with oRI was ligated with pBTFCP2I
FN was ligated with a small fragment obtained by digesting with SalI and EcoRI to construct pBTFsCP2IFN. FsCP2IFN, a BMV-IFN chimeric RNA4 in which RNA was transcribed from these plasmids in vitro according to the method of B-2 and wild-type BMV RNA4 and CP2 were replaced with the IFN gene.
I got

F. BM with CP2 replaced by IFN gene
Analysis of protein translated from V-IFN chimeric RNA4 in vitro Wild-type BMVRNA4 and FsCP2IFN were converted to wheat germ extract in vitro protein translation system (Amersham)
In addition, the protein was translated in vitro, and after SDS polyacrylamide gel electrophoresis, the translation products were compared and analyzed by fluorography. As a result, the amount of IFN translated from the second ATG was
Was found to be approximately 50 times the amount of IFN translated from. On the other hand, almost the same amount of CP
1 and CP2 were translated. From the above results, when CP2 was replaced with a foreign gene, protein translation started from the second translation initiation codon, that is, the translation initiation codon of the foreign gene, and the true foreign gene product was not a fusion with the coat protein but a high level. The translation was found to be efficient.

G. Example 2 Replication of BMV-IFN Chimeric RNA in Plant Cells Expressing BMVRNA Replication Enzyme
Since 1 and 2 were transcribed in cells, protoplasts were prepared from plants in which BMV RNA replication enzymes 1a and 2a proteins were produced in cells but BMV RNA 1 and 2 were not replicated. Each BMV-IFN chimeric RNA and control wild type B were added to the obtained protoplasts.
After inoculating MVRNA3 with each of RNA1 and RNA2, total RNA was prepared and 3 ′ common to all BMVRNA was prepared.
Northern blotting was performed using the terminal sequence as a probe, and the replication of the chimeric RNA and the synthesis of subgenomic RNA in each experimental section were compared with those of the wild-type strain BMVRNA3.

<< Replication of Chimeric RNA Synthesis of Subgenomic RNA >> Ｆ F1aIFN 1 -F2aIFN 1 -F3a1IFN 1 -F3a4IFN 20 80 F3a5IFN 10 40 FCP1IFN 50 20 FCP2 IFN 50 20 RNA3 100 100 ────────────────────────────────────

As a result, F1aIFN, F2aIFN and F3a1IFN hardly replicated,
4IFN, F3a5IFN, FCP1IFN and FCP
2IFN replicated with relatively high efficiency, which was inferior to that when using wild-type RNA3, and the results were almost the same as in [Example 3] C. . Therefore, [Example 3] AF
All the results obtained up to this point were found to be effective even when a transformed plant was used.

Example 4 Production of GUS The BMV ATCC66 strain was used as an RNA plant virus, and the β-glucuronidase gene (GUS) was used as a desired foreign gene. The GUS gene is frequently used as a reporter gene because of the ease and sensitivity of enzyme activity measurement. The size of the gene is about three times that of the BMV coat protein gene.

A. Construction of BMV-GUS chimeric RNA transcription vector, in vitro RNA transcription and inoculation into tobacco protoplasts By the same method as in the construction of the BMV-IFN chimeric RNA transcription vector, the 1a, 2a, 3a, CP1 and CP2 genes were replaced with the GUS gene. Was replaced with Plasmid p
GUS in BI101 (Clontech Laboratory)
The start and stop codons in the gene include NsiI and S
The acI site was ligated to each oligonucleotide 5 ′ pd (G
TGGTCAGTCATGCATGTTTCGTA)
(SEQ ID NO: 14) and 5′pd (AATGAATCA
AGAGCTCTCCTGGGCG) (SEQ ID NO: 15)
To construct pUCGUS (Nsi).

Transcription vector pBTF1aGUS, pBT
F2aGUS, pBTF3a1GUS, pBTF3a4
GUS, pBTF3a5GUS, pBTFCP1IFN
And pBTFCP2IFN to pUCIFN (Nsi)
Using pUCGUS (Nsi) in place of the above, it was constructed in the same manner as in the construction of the BMV-IFN chimeric RNA transcription vector described in [Example 3] A.

From the obtained plasmid, [Example 1] B
RNA was transcribed in vitro according to the method of Example-2, and the obtained seven kinds of RNAs were used for F1aGUS and F1aGUS, respectively.
2aGUS, F3a1GUS, F3a4GUS, F3a
They were named 5GUS, FCP1GUS and FCP2GUS (FIG. 16). Each BMV-GUS chimeric RNA and control wild-type BMV RNA3 were mixed with RNA1 + 2, respectively, and inoculated to tobacco protoplasts according to the method of [Example 2] C.

B. Replication of BMV-GUS chimeric RNA Each BMV-GUS chimeric RNA was transferred to RNA1, 2
RNA from tobacco protoplasts inoculated with
Was prepared, and Northern blotting was performed using the 3 ′ terminal sequence portion common to all BMV RNAs as a probe to compare the replication of chimeric RNA and the synthesis of subgenomic RNA in each experimental section. However, the replication of these chimeric RNAs was much lower than that of wild-type BMV RNA, and comparison with wild-type RNA was impossible. Therefore, Northern blotting was performed using a probe specific to the GUS gene. FCP2GUS showing highest chimeric RNA replication and subgenomic RNA synthesis
The average value of the RNA in the experimental plot using
When it was set to 00%, it was detected as follows.複製 Replication of chimeric RNA Synthesis of subgenomic RNA ────── Ｆ F1aGUS0-F2aGUS0-F3a1GUS0-F3a4GUS100-F3a5GUS50-FCP1GUS100 100 FCP2GUS100 100 ────────────────────────────────────

As a result, F3a4GUS, F3a5GU
Only S, FCP1GUS and FCP2GUS duplicate,
In addition, subgenomic RNA was also detected in FCP1GUS and FCP2GUS.

C. Analysis of GUS production and GUS activity in protoplasts inoculated with BMV-GUS chimeric RNA
Tobacco protoplasts were inoculated by mixing with No. 1 and No. 2. 48 hours after inoculation, total proteins were extracted from tobacco protoplasts, and the amount of GUS production in each experimental group was compared by Western blotting using an anti-GUS antibody.
GUS activity was measured using the following method. First, the method of Jefferson et al. (Jefferson
(1987) EMBO J. et al. 6: 3901-390
According to 7), a protoplast extract was prepared. GU
The S activity level was determined by comparing the enzymatic conversion of the substrate 4-methylumbelliferyl glucuronide to 4-methylumbelliferone with long-wave ultraviolet light compared to the activity of the standard GUS. GUS in the experimental plot using FCP2IFN showing the highest GUS production and GUS activity
When the average value of the production amount and GUS activity is 100%,
It was detected as follows.

Ｇ GUS production amount GUS activity ────── Ｆ F1aGUS 0 3 F2aGUS 0 3 F3a1GUS 03 F3a4GUS 20 30 F3a5GUS 10 15 FCP1GUS 0 3 FCP2GUS 100 100 ────────────────────────────────────

As a result of Western blotting, F3a4
GUS was produced only in the experimental plots using GUS, F3a5GUS and FCP2GUS.
The highest level of GUS production was observed in the section using P2GUS. However, in the ward using FCP1GUS,
GUS was not detected by Western blotting. Therefore, as a result of measuring the GUS activity in each experimental section, the section using FCP2GUS showed FCP1GU.
Subgenomic RNA at the same level as compared to the section using S
Despite the amount of synthesis ([Example 4] B), it was revealed that about 30-fold GUS was produced.

From the above results, when a protein having a relatively large molecular weight such as GUS was produced, the protein production ability was improved by substitution with the CP2 gene instead of the CP1 gene, compared with IFN. .

Example 5 Production of Plant Expressing Total Genomic RNA of BMV Production of Plant Expressing BMVRNA3 [Example 2] PBICBR3 (FIG. 6) according to the method of A. Tumfaciens, [Example 2] According to the method of A. tumefa
Ciens (pBICBR3) was inoculated and transformants were selected. Expression of RNA3 integrated into the plant genome was confirmed by inoculation of RNA1 + 2 into protoplasts obtained from the transformed plant described in [Example 2] C and Western blotting using an anti-BMV antibody. In plants in which the expression of RNA3 has been confirmed by Western blotting, subgenomic RNA4 is synthesized from RNA3 transcribed from the plant genome by BMV RNA replication enzyme, and the coat protein is translated from this subgenomic RNA4. [Example 2] From a plant in which the expression of RNA3 was confirmed,
A pure diploid expressing NA3 was selected and named BRP3 plant.

B. Example 2 Introduction of BMVRNA3 cDNA into Genome of Tobacco Plant Expressing BMVRNA Replication Enzyme Example 2
BRP (1 + 2) plant and BRP to introduce DNA
Crossing of three plants, a BMRP (1 + 2) plant and a BRP3 plant, was performed. Each of the obtained F1 plants was BR
P (1 + 2 + 3) plants and BMRP (1 + 2 + 3) plants were named. [Example 2] Anti-B of C-3
The expression level of the coat protein gene was compared by Western blotting using an MV antibody. BRP (1 + 2 + 3)
Assuming that the average value of the expression level of the coat protein in the plant was 100%, the detection was as follows.

平均 Average value of coat protein────── Ｂ BRP (1 + 2) plant 0 BRP (1 + 2 + 3) plant 100 BMRP (1 + 2) plant 0 BMRP ( 1 + 2 + 3) Plant 130────────────────────────────────────

Therefore, in BRP (1 + 2 + 3) plants and BMRP (1 + 2 + 3) plants, B
There is no need to introduce MVRNA, and the production of RNA replication enzyme by viral RNA transcribed from the plant genome,
It was found that the replication cycle of the virus, which is the synthesis of subgenomic RNA by replication enzymes and the production of coat proteins, proceeds.

Example 6 Expression of IFN Gene Introduced into Genome of Tobacco Plant Expressing BMV RNA Replication Enzyme Construction of Plant Transformation Vector pBICIFN Introducing BMV-IFN Chimeric RNA3 cDNA (FIG. 1)
8) BMV-IFN in which CP2 gene is replaced with IFN gene
A vector pBICIFN for introducing the chimeric RNA3 cDNA into the plant genome was constructed. pBTFCP2I
XbaI / FN (FIG. 15) containing the IFN gene
The EcoRI fragment was cut out and transformed with the transformation vector pBIC.
Inserted into the portion of the RNA3 cDNA of BR3 (FIG. 6) where the site between the XbaI site and the EcoRI site was removed,
ICIFN was constructed.

B. Production of Plant Expressing BMV-IFN Chimeric RNA 3 [Example 2] According to the method of p.
Tumfaciens, [Example 2] According to the method of A. Tumefaciens was inoculated and a transformant was selected. Confirmation of the expression of the BMV-IFN chimeric RNA3 integrated into the plant genome was confirmed in [Example 2] C.I. Inoculation of RNA1 + 2 into protoplasts obtained from the transformed plants described in
This was performed by Western blotting using an antibody.
In a plant in which the expression of chimeric RNA3 was confirmed by Western blotting, chimeric subgenomic RNA4 was synthesized by BMVRNA replicase from chimeric RNA3 transcribed from the plant genome, and IFN was translated from this chimeric subgenomic RNA4. [Example 2] A pure diploid expressing the BMV-IFN chimeric RNA3 was selected from the plants in which the expression of BMV-IFN grain RNA 3 was confirmed by Western blotting by the rapid culturing method of C-6, and named BRP3IFN plant. Was.

C. BMV-IFN chimeric RNA3cD to tobacco plant genome expressing BMV RNA replication enzyme
Introduction of NA [Example 2] In order to introduce BMV-IFN chimeric RNA3 cDNA into the genome of BRP (1 + 2) plant and BMRP (1 + 2) plant created in C-6, BRP (1+
2) Crossing was performed between the plant and the BRP3IFN plant, and between the BMRP (1 + 2) plant and the BRP3IFN plant. Each of the obtained F1 plants was subjected to BRP (1 + 2 + 3IFN).
The plant was named BMRP (1 + 2 + 3IFN) plant.
Both plants were grown and [Example 2] The expression levels of IFN were compared by Western blotting using an anti-IFN antibody of C-3. I in BRP (1 + 2 + 3IFN) plants
When the average value of the expression level of FN was set to 100%, detection was performed as follows.

{Average IFN Value} ───────────────────────────── BRP (1 + 2) plant 0 BRP (1 + 2 + 3IFN) plant 100 BMRP (1 + 2) plant 0 BMRP (1 + 2 + 3IFN) ) Plant 130────────────────────────────────────

BRP (1 + 2 + 3IFN) plants and BM
RP (1 + 2 + 3IFN) Chimeric RNA in which IFN expression of plant is synthesized as a subgenome from chimeric RNA3
To confirm that it was translated from 4,
RP (1 + 2 + 3IFN) plants and BMRP (1 + 2 +
3IFN) plants were used for Northern blot analysis. Purified total RNA (20 μg) from each tobacco leaf was separated by agarose electrophoresis, transferred to a nylon membrane, and pUCIFN containing the IFN gene.
The NsiI / SacI fragment of (NsiI) was examined as a probe. As a result, chimeric RNA3 and chimeric RNA4
A band corresponding to. BRP (1 + 2 + 3IF
N) Chimeric RNA3 replication amount and chimeric R in plants
When the amount of synthesis of NA4 was 100%, detection was performed as follows.

<< Synthesis of Chimeric RNA3 Replication of Chimeric RNA4 >> ───────────────────────────────── BRP (1 + 2) plant 0 0 BRP (1 + 2 + 3 IFN) plant 100 100 BMRP (1 + 2) ) Plant 00 BMRP (1 + 2 + 3IFN) plant 120 130 ────────────────────────────────────

Therefore, BRP (1 + 2 + 3IFN)
In plants and BMRP (1 + 2 + 3IFN) plants, there is no need to introduce BMVRNA and a chimeric BMVRNA containing a foreign gene from the outside. It was found that the expression of the foreign gene was performed.

AB medium (Table 1) 溶液 Solution 1 K ₂ HPO ₄ 12g NaH ₂ PO ₄ 4g solution _{2 NH 4 Cl 4g MgSO 4 ·} 7H 2 O 1.2g KCl 0.6g CaCl 2 0.6g FeSO 4 · 7H 2 O 10mg solution 3 Glucose 20g ──────── ────────────────────────────

LS medium (Table 2) Preparation method of LS medium (per 200 ml) ──── Stock 1 K ₂ HPO ₄ 12 g NaH ₂ PO ₄ 4 g Stock 2 NH ₄ Cl 4 g MgSO ₄ .7H ₂ O 1.2 g KCl 0.6 g Stock 3 CaCl ₂ .2H ₂ O 8.8 g Stock 4 Na ₂ -EDTA 0.666 g stock _{5 H 2 BO 3 0.124g MnSO 4} · 4H 2 O 0.172g ZnSO 4 · 4H 2 O 0.446g KI 0.017g Na 2 MoO 4 · 2H 2 O 0.005g stock 5 ' CuSO ₄ .5H ₂ O 0.05 g CoCl ₂ .6H ₂ O 0.005 g Stock 6 Thiamine-HCl 0.008 g Myo-inositol 2.0 g Stock 7 Naphthalene acetic acid (NAA) 0.042 g Stock 8 6-benzyladenylina (BAP) 0.004 g Stock 9 6-benzyladenylina (BAP) 0.1 g Stock 10 Myo-inositol 2.0 g Glycine 0.04 g Pridoxin-hydrochloride 0.01 g Nicotinic Acid 0.01g Thiamine-hydrochloric acid 0.02g ────────────────────────────────────

BAP was first 30 ml of 0.1N HCl
(Water bath) and then add water to make 200 ml. Preparation of LS medium (1 liter) Add 2 ml of stock 5 'to 200 ml of new stock 5 and use it hereafter. 2. Stocks 1,2,3,4,5,6 are added 10ml each. 3. Add hormone stock according to the table below. 4. Add 30g of shrink and add 1 with ion-exchanged water.
ml. 5. The pH is adjusted to 5.8 to 6.2 with NaOH or KOH.
Adjust to 6. Add 0.8-1% agar and autoclave in a culture pot. 7. After heating to 50-60 ° C, shake the pot lightly.
Leave at room temperature to solidify.

When an antibiotic is added, the temperature should be 50-60 ° C.
After that, filter-sterilized antibiotics are added.

Hormone concentration (in the case of tobacco) (per 1 ml) ──────────────────────────────────── Stock 7 Stock 8 Stock 9 用 For callus (LS1) 10ml 10ml-For germination (LS4) 0.5ml-10ml For oscillation (LS7) 2.5ml 5ml-For young plants (LS8)---─────────────────────────────── ─────

[Sequence list]

 SEQ ID NO: 1 Sequence length: 34 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Genomic RNA cDNA sequence GTATTTAATG TCGACTTCAG GAACTGGTAA GATG Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid synthetic oligonucleotide sequence CTAGATGCAT ATAGTGAGTC GTATTAATTT A SEQ ID NO: 3 Sequence length: 31 Sequence type: nucleic acid : Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence AGCTTAAATT AATACGACTC ACTATATGCA T SEQ ID NO: 4 Sequence length: 25 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Type Sequence type: Other nucleic acid Synthetic oligonucleotide sequence GTAGGCCTCT CCAAATGAAA TGAAC SEQ ID NO: 5 Sequence length: 38 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Type: Other nucleic acid Synthetic oligonucleotide sequence GTTTTTCACC AACAAAATGC ATAGTTCTAT CGATTTGC SEQ ID NO: 6 Sequence length: 22 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide Sequence CACCAAGATG CATTCGAAAA CC SEQ ID NO: 7 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence GTTCCCGATG CATAACATAG TTT SEQ ID NO: 8 Sequence Length: 24 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence GTATTTAATG CATACTTCAG GAAC SEQ ID NO: 9 Sequence length: 22 Sequence type: Number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid synthetic oligonucleotide sequence TGGTAAGATG CACGCGCGCA GC SEQ ID NO: 10 Sequence length: 28 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence TCTCTCGGAA TGCATGCATG AAATATAC SEQ ID NO: 11 Sequence length: 24 Sequence type: Nucleic acid strand number : Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence CCCAGTAATG GAGCTCCTGC CTGC SEQ ID NO: 12 Sequence length: 10 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence GTATTTAATG SEQ ID NO: 13 Sequence length: 14 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence TCGACATTAA ATAC SEQ ID NO: 14 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence GTGGTCAGTC ATGCATGTTA CGTA SEQ ID NO: 15 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic oligonucleotide sequence AATGAATCAA GAGCTCTCCT GGCG

[Brief description of the drawings]

FIG. 1 shows the gene expression mode of BMV.

FIG. 2 is a vector for transforming BMV genes into tobacco.

FIG. 3. CaMV3 by site-directed mutagenesis
Restriction enzyme site (St) to the transcription start site of 5S promoter
Introduction of u1).

FIG. 4 shows a method for replacing a BMV gene with a foreign gene.

FIG. 5: Introduction of full-length BMV RNA cDNA into a transcription vector (pUCT) and in vitro BMV RNA synthesis using T7 RNA polymerase.

FIG. 6 shows construction of a transformation vector pBICBR1-3 into which full-length BMV RNA cDNA has been introduced.

FIG. 7 is a plant transformation vector pBICB into which BMV RNA cDNA having a deletion in a nucleotide portion corresponding to the untranslated region at the 3 ′ end of BMV RNA has been introduced.
Construction of MR1.

FIG. 8 is a plant transformation vector pBICB into which BMV RNA cDNA having a deletion in a nucleotide portion corresponding to the untranslated region at the 3 ′ end of BMV RNA has been introduced.
Construction of MR2.

FIG. 9 is a plant transformation vector pBICB into which BMV RNA cDNA having a deletion in a nucleotide portion corresponding to the untranslated region at the 3 ′ end of BMV RNA has been introduced.
Construction of MR3.

FIG. 10 shows the construction of pBTF1aIFN.

FIG. 11 shows the construction of pBTF2aIFN.

FIG. 12 shows the construction of pBTF3aIFN.

FIG. 13. pBTF3a4IFN and pBTF3a5
4 shows the construction of IFN.

FIG. 14 shows the construction of pBTFCP1IFN.

FIG. 15 shows the construction of pBTFCP2IFN.

FIG. 16: BMV-IFN chimeric RNA and BMV-
The schematic diagram of GUS chimeric RNA is shown.

FIG. 17 shows the construction of pBTFsCP2IFN.

FIG. 18 shows the construction of a plant transformation vector pBICIFN into which BMV-IFN chimeric RNA3 has been introduced.

──────────────────────────────────────────────────続 き Continued on the front page (58) Field surveyed (Int. Cl. ⁷ , DB name) C12P 21/00 A01H 5/00 C12N 5/00 C12N 15/00 BIOSIS (DIALOG) WPI (DIALOG)

Claims (24)

(57) [Claims] 1. Bloom Mosaic Virus
CDNA of RNA replication enzyme gene of (BMV), and B
A recombinant virus genomic RNA cDNA (hereinafter, recombinant) in which the ATG downstream of the original translation initiation codon (the first ATG counted from the 5 'end) of the cDNA of the MV coat protein gene is replaced with a desired foreign gene. A somatic virus genomic RNA cDNA) into a plant genome to produce a foreign gene or a product thereof in a plant cell. 2. Brome Mosaic Virus
(AMV downstream of the original translation initiation codon of the cDNA of the BMV coat protein gene (the first ATG counted from the 5 'end)) Recombinant virus genomic RNAcD with the following replaced with the desired foreign gene
A method for producing a foreign gene or a product thereof in a plant cell by inoculating RNA synthesized from NA. 3. The cDNA of the coat protein gene described above.
3. The method according to claim 1, wherein the second and subsequent ATGs are replaced with a desired foreign gene. 4. A virus genome RNAcDN containing the above-mentioned RNA replication enzyme gene cDNA and coat protein gene.
A is a cDNA having a deletion at the nucleotide portion corresponding to the full-length or 3'-terminal untranslated region of the viral RNA
The method according to claim 1, 2 or 3, wherein 5. The method according to claim 1, wherein the RNA replication enzyme gene and the coat protein gene are present on different single-stranded (+) RNAs. 6. The 5 ′ of the above-mentioned coat protein gene cDNA.
By performing genetic manipulation such as deletion or substitution on the nucleotide portion corresponding to the terminal untranslated region, 1
A recombinant wherein the nucleotide sequence around the second translation initiation codon is inappropriate for translation, and the nucleotide sequence around the second ATG has a structure suitable for translation, and is modified so that translation is performed from the second ATG. Virus genome R
The method according to claim 1, 2 or 3, wherein NA cDNA is used. 7. The method of claim 6, wherein said second ATG is artificially created. 8. The 5 ′ of the above-mentioned coat protein gene cDNA.
The sequence of the nucleotide portion from the terminal untranslated region to the second ATG in the coat protein structural gene is 5'GTATTTA
The method according to claim 6, which is ATGTCGA CTTCAGGAACTGGTAAGATG (SEQ ID NO: 1). 9. A virus genome RNAcDN containing the above RNA replication gene cDNA and coat protein gene.
A is a cDNA having a deletion at the nucleotide portion corresponding to the full-length or 3'-terminal untranslated region of the viral RNA
The method according to any one of claims 6 to 8, wherein 10. The method according to claim 6, wherein the RNA replication enzyme gene and the coat protein gene are present on different single-stranded (+) RNAs. 11. A promoter functioning in a plant cell, B
A recombinant virus genomic RNA cDNA in which the ATG downstream of the original translation initiation codon (the first ATG counted from the 5 'end) of the cDNA of the MV coat protein gene is replaced with a desired foreign gene , Promoter
Virus genomic RNAcD located downstream of
NA and the recombinant viral genomic RNA cDNA
And a DNA molecule containing a terminator that functions in a plant located downstream . 12. The DN according to claim 11, wherein the cDNA is a full-length cDNA or a cDNA having a missing arrow in a nucleotide portion corresponding to a 3 ′ untranslated region of a viral RNA.
A molecule. 13. A transformation vector having the DNA molecule according to claim 11 for use in the method according to claim 1 or 2. 14. A transformed plant cell comprising the DNA molecule according to claim 11 in a plant genome. 15. Rice, maize and dicotyledonous plants obtained by redifferentiating the cell according to claim 14. 16. A dicotyledonous plant obtained by redifferentiating the cell according to claim 14. 17. A plant virus B having a deletion in a promoter functioning in a plant cell, a full length or a nucleotide portion corresponding to a 3 ′ terminal untranslated region of viral RNA.
MV RNA replication enzyme gene cDNA ,
RNA replication enzyme of BMV located downstream of the promoter
Gene cDNA and RNA replication enzyme gene c of BMV
Further D of DNA molecules and claim 12, wherein comprises a terminator that functions in plants located downstream of the DNA
A transformed plant cell containing an NA molecule in the plant genome. 18. A rice, maize and dicotyledonous plant obtained by redifferentiating the cell according to claim 16. 19. A dicotyledonous plant obtained by redifferentiating the cell according to claim 16. 20. The DNA molecule according to claim 11, wherein said virus is BMV. 21. A transformed plant cell comprising the DNA molecule according to claim 18 in a plant genome. 22. Rice, corn and dicotyledonous plants obtained by redifferentiating the cell according to claim 19. 23. A dicot plant obtained by redifferentiating the cell according to claim 19. 24. The method according to claim 6, wherein the desired foreign gene is interferon.