JP2992632B1 - Method for sequentially cutting out DNA fragments and method for analyzing DNA using the same - Google Patents

Abstract

Kind Code: A1 Abstract: A method for cutting out a useful DNA fragment used for analyzing a base sequence of DNA, and a method for using the method
Provided are a method for determining a base sequence of NA and a DNA sequencing apparatus using the method. The method includes the steps of (1) binding an adapter having a recognition sequence for a restriction enzyme to the other free end of a sample DNA having one end immobilized thereon, and (2) cutting the sample DNA with the restriction enzyme. A method for cutting out a DNA fragment, wherein the operation including the steps (1) and (2) is a unit cycle, and the cycle is repeated.
A method for sequentially cutting out DNA fragments.

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] [0001] The present invention relates to a DNA base sequence.
Of useful DNA fragments used for analyzing DNA
Method for determining the base sequence of DNA using the method
And a DNA sequencing device using said sequencing method
Related. [0002] The method for cutting out a DNA fragment of the present invention comprises the steps of:
Useful as a sample preparation method for base sequence analysis of NA,
In addition, the nucleotide sequencing method of the present invention is particularly useful for long-chain DNA.
It can be used effectively. From another point of view, the present invention relates to I
Type, IIs and III recognition sites on DNA
For new uses of restriction enzymes with different cleavage sites
There is also. [0003] 2. Description of the Related Art In recent years, techniques relating to DNA sequencing have been developed.
The exhibition is remarkable, and many species, from microorganisms to humans,
The nucleotide sequence of a large genomic DNA is being determined
You. Analysis of genomic sequence is 40-150 kb large claw
Sequencing is the main focus of DNA
Efficiency of column determination is required. Efficient DNA sequencing
The challenge in this case is two steps: (i)
It has a length of about 500 bp to 1 kb from the type clone
Prepare hundreds of subclones "Preparation of DNA fragment for analysis"
Step ", and (ii) DNA salts of those subclones.
Effectiveness of the “base sequence sequencing process” to determine the base sequence
It is efficiency. In particular, for the former template DNA for sequencing
The preparation process requires a high level of technician skill and a huge amount of time and effort.
It costs. Conventionally, the base sequence of DNA used has been determined.
Generally, there are three general methods:
Shotgun method, primer walk method, nested data
ND method. [0005] In the shotgun method, sample DNA is supersonic
Cut randomly using waves, restriction enzymes, etc.
DNA fragments are prepared by the
Determine the sequence and use the resulting sequence overlap to sample
This is a method for determining the base sequence of whole DNA (T. Mani
atis et al.,: Molecular Cloning, Cold Spring Harbo
r Lanoratory Press, 13, 21-33 (1989), etc.). [0006] The primer walk method uses a sample DNA
Are determined in order from the end. This one
First, the base sequence of the terminal region of the sample DNA is determined.
From the determined nucleotide sequence,
Select the primer sequence, and then base it again from that point.
Rows are determined by the dideoxy method (Sanger method)
(T. Maniatis et al.,: Molecular Cloning, Cold Spri
ng Harbor Lanoratory Press, 13, 14-20 (1989)
See)). The nested deletion method (ND) is
Decompose the terminal region of the sample DNA with an enzyme
DNA fragments having different lengths are prepared, and the other end of the fragment is prepared.
After aligning the starting point, in order of length, the starting point and the opposite part
This is a method for determining the base sequence from the end (T. Maniatis e
t al.,: Molecular Cloning, Cold Spring Harbor Lano
ratory Press, 13, 34-41 (1989), etc.)). [0008] Of these nucleotide sequencing methods, the best
The method used is the shotgun method. But,
This method uses a large number of randomly cut DNA fragments.
Determining the entire sequence of the sample DNA based on the overlapping part of the pieces
Therefore, redundant analysis of the same sequence
High seas, which takes time and effort, and
Serious problems such as large misreads caused by return arrays
Contains. Primer walk method and nested data
The disadvantage of this shotgun method is that the translation method (ND method)
Was developed in order to overcome the
This is an efficient method for performing base sequencing. But
However, the primer walk method is used for each base sequence analysis.
It is necessary to design appropriate primers
The nested deletion method is a nested deletion reaction
Need to prepare continuous length subclones
All of them involve a problem that complicated operations are required. Further, any of the above three conventional methods is
Also include transformation into E. coli, especially
The shotgun method is a method for preparing DNA fragments for analysis.
Roning process (preparation of subclone by E. coli culture)
), Which is time-consuming and unsuitable for automation
There was a drawback. [0011] SUMMARY OF THE INVENTION The present invention relates to such a situation.
In particular, in DNA sequencing, (i)
DNA fragment preparation process "
Things. That is, the present invention provides an efficient base sequence
DNA samples useful for achieving the determination (analysis DNA
Fragment)). In addition
Akira describes an efficient DN using the above DNA sample preparation method.
A DNA sequencing method and DNA sequencing equipment
The purpose is to provide. The method of the present invention has the following advantages: 1) High redundancy
-2) Occurrence of misreading due to repeated arrangement, 3)
Sequential preparation of lymer 4) Nested deletion
Conventional methods for DNA sequencing, such as the labor required for reactions
At the same time. In addition, the present invention
The method includes the automation of the preparation of DNA samples for analysis and DNA sequencing.
Constant automation and, as a result, the base sequence of long-chain DNA
It contributes to simple and quick analysis of columns. [0013] Means for Solving the Problems The present inventors have solved the above problems.
I was studying day and night to solve the problem,
Use restriction enzymes that have different properties from the cleavage site.
Can cut DNA fragments from the ends of DNA
Is found, and the restriction enzyme is added to the DNA end to be further cleaved.
Specific adapter having a recognition sequence
By repeating the above steps, a predetermined
Able to cut out DNA fragments having base length
Was found. In addition, the method includes a sequencing step
By combining them, even long-chain DNA can be effective.
Confirmed that it was possible to determine the base sequence efficiently
As a result, the present invention was developed. That is, the present invention provides a recognition site and a cleavage site.
Using a restriction enzyme having properties different from
DNA fragments are sequentially cut out from one end of NA
Is the way. Specifically, the present invention provides (1) fixing one end
To the other free end of the sampled DNA
Add an adapter with a recognition sequence for the restriction enzyme to be used.
And (2) the restriction on the immobilized sample DNA
Enzyme is actuated, and a certain chain is determined from the recognition sequence in the adapter.
To cut a specific site on a sample DNA that is long away
The step of cutting the DNA fragment containing the adapter.
This is a method for cutting out DNA fragments. The method further comprises the steps of:
Continue to use the stripped immobilized sample DNA
(1) Adapter addition step and (2) Restriction enzyme treatment
The operations including the process steps can be performed repeatedly.
From the free end (free end) of the sample DNA
The DNA fragments that make up the full length can be cut out in order.
it can. Therefore, the present invention provides a DNA fragment comprising the above steps.
Is a sequential cutting method. The method of the present invention is automated
It is possible. Therefore, the present invention relates to the above DNA fragment.
Centrifugal separation hand that can perform the sequential cutting method
Steps, pipetting means, temperature control means, sun
Solid support for pull DNA fixation, reaction solution storage container, washing solution collection
Cyclic reaction with container and product container
It also relates to equipment. The DNA fragment thus cut out is amplified.
Without sequencing or amplification
Thus, the full-length nucleotide sequence of the sample DNA is determined.
be able to. Therefore, the present invention provides the above-described DNA excision.
And then the base of the excised DNA fragment
A method for analyzing DNA comprising a step of analyzing a sequence.
And a reagent kit used in the DNA analysis method and
The present invention also relates to a DNA analyzer using a DNA analysis method. The base sequence, nucleic acid and the like in the present specification
The abbreviations of the symbols are defined in IUPAC and IUB, "Salt
For the preparation of specifications etc. including the base sequence or amino acid sequence
Guidelines ”(Japan Patent Office) and customs in the field
The symbols shall be followed. In addition, the genetic engineering used in the present invention
Technology and its specific operations are
Method and method recommended by the manufacturer or distributor of the reagent
(J. Sambrook, E.F.Fritsch and T. Mani
alis, "Molecular Cloning, A Laboratory Manual," Co
ld Spring Harbor Univ. Press, New York, 1988
See). [0020] DESCRIPTION OF THE PREFERRED EMBODIMENTS Restriction enzymes used in the present invention
In the element, the recognition site and the cleavage site on DNA are different.
As long as it has such a cutting style.
Not restricted. Preferably, it recognizes a specific nucleotide sequence and
It is a restriction enzyme that cuts a site away from the sequence by a certain length.
More preferably, the DNA is cleaved to give a 3 'end or 5'
Generate double-stranded DNA fragments with cohesive ends protruding
The resulting restriction enzyme. Examples of such a restriction enzyme include a type I restriction enzyme,
Examples include type IIs restriction enzyme and type III restriction enzyme.
But preferably with a type III restriction enzyme and a type IIs restriction enzyme.
is there. Type III restriction enzymes usually have 4 to 6 bases.
Base sequence is recognized, and then a certain chain length (usually 4 to 25
Has a cleavage mode of cutting away sites
ing. For example, EcoP15I has
Is the longest distance currently known,
It has a cutting mode represented by the above formula. [0023] Embedded image [Where (N)_{twenty five}And (N ')₂₇Is
Any combination of nucleotides A, T, G or C respectively
Nucleotides having 25 bp and 27 bp comprising
Shows the array of codes. N 'is the complementary nucleotide to N
Is. ] Such a remote cleavage enzyme of about 25 bp includes other
EcoPI, Hinel, HinfIII, NgoM
X and StylTI can be exemplified. Examples of the IIs type restriction enzyme include, for example,
Fokl having a close-cut type of cutting mode as follows:
Can be mentioned. [0026] Embedded image [Where (N)₉And (N ')₁₃Is
Any set of four nucleotides of A, T, G or C respectively
Nucleotide having 9 bp and 13 bp consisting of combinations
2 shows a tide sequence. N 'is a complementary nucleotide to N.
It is a tide. ] In addition, as a restriction enzyme having a proximity cleavage type
Are BseRI, BsgI, BsmFI, BspMI,
MboII, MnII, PleI, SfaNIEco571
And the like. These restriction enzymes are commercially available.
It can be obtained commercially. The adapter used in the present invention is basically
Recognition of the above restriction enzymes used for excision of DNA fragments
Any double-stranded DNA having a sequence may be used. Such adapt
To the free end of the sample DNA of interest.
Then, by allowing the restriction enzyme to act,
The enzyme recognizes the recognition sequence in the adapter and
Cleave the base sequence on the sample DNA separated by a constant chain length.
As a result, a double-stranded DN of a predetermined length can be obtained from the sample DNA.
The A fragment is preferably ligated to the 3 'terminal or 5' terminal.
Cut in the state of having an attached end with the adapter
Be sent out. [0030] Preferably, the adapter is adapted for recognition of a restriction enzyme.
In addition to the recognition sequence, either the 3 'end or the 5' end
Can be designed to have protruding ends. Heel
The number of bases at the protruding end depends on the restriction enzyme used for excision.
The number of bases n at the cohesive end of the DNA fragment
Can be. For example, as a restriction enzyme, the aforementioned EcoP1
When using 5I or Fokl, from its cleavage mode,
Two each (27-25 (N'-N) = 2 (n)) or
Are four (13-9 (N'-N) = 4 (n)) protruding ends
Can be employed. In addition,
The base sequence of the protruding end is not particularly limited, and A, T,
Any sequence consisting of any nucleotide of G or C
be able to. As an adapter sample used in the reaction system
Indicates that all bases (A, T,
Adapter having a base sequence consisting of a combination of G, C)
Mixture (ie, 4ⁿMixed with street adapter
Compound) is used. By using such a mixture
Of DNA fragments generated by cutting out sample DNA
Regardless of the base sequence at the terminal end, any salt
Protrusion of specific adapter in the mixture relative to the base sequence
Addition (ligation) of the ends by complementary binding
Can be. This allows sample DNA to be treated with restriction enzymes
After cutting out the DNA fragment, the DNA fragment was
Remaining support with adhesive ends created by cutting the piece
The adapter is repeatedly bound to the sample DNA.
As a result, from the end of the sample DNA
It is possible to cut DNA fragments of a predetermined length repeatedly.
It becomes possible. For example, a restriction enzyme represented by the above formula (1)
In the case of using EcoP15I having the cleavage mode
Then, more preferably, the adapter is as shown below
Can be designed. [0033] Embedded image Here, X₁X_TwoIndicates the protruding end described above.
You. DNA breakage caused by EcoP15I cleavage
Since the number of bases at the cohesive end of the piece is 2, X₁X_TwoBase sequence
Are 16 combinations (4^TwoStreet). this
Adapter sample contains all kinds of protruding ends
A mixture of 16 adapters is used. Further, the adapter comprises a recognition sequence and a protruding end.
In addition to the end, opposite the protruding end (ie, sample DN
An arbitrary number m of any base sequence (hereinafter referred to as the opposite side to bond with A)
Below, referred to as an additional sequence). This
This is because restriction enzymes often have difficulty recognizing end sequences.
In order to prevent this, efficient extraction of DNA fragments
Adopted for The number m of bases in the additional sequence is limited
Since it differs depending on the type of enzyme, it is appropriately determined according to the enzyme.
Can be Such additions are found in many type II restriction enzymes.
The number m of bases in the sequence has been examined, for example, under normal conditions.
Salt of additional sequence necessary to cut 90% or more in 2 hours
The radix m is 8 bp for NotI, 2 bp for PstI,
In BstXI, it is 8 bp. Type III and IIs restriction enzymes
Is not limited, but similarly, 2 to 20 bp,
Preferably, the number of bases is about 6 to 8 bp. Addition
The base sequence of the sequence is not particularly restricted so long as it is suitable for the above purpose.
The base sequence is not limited, and can be any base sequence. As an additional sequence, a sequence ply
The sequence of the mer can also be employed. For example, in the present invention
Subsequent to the excision of the DNA fragment by
When sequencing DNA fragments, M13FW, M
4. Sequence ply such as M13REV, T3, T7
Sequence of mer (Bio-Catalog, 1997/1998 edition, Takara Shu
) Is adopted as an additional sequence of the adapter.
Extract one oligonucleotide of the extracted DNA fragment
The Sanger reaction (dideoxy)
And the like. Ma
In this case, the downstream region of the sequencing primer
Any base sequence (hereinafter also referred to as a spacer sequence)
May be added. This is a
Difficulty starting reading immediately downstream of the immer
In view of the above, the spacer sequence is usually 10 to 10.
Any salt having 50 bp, preferably 15-20 bp
Base sequences can be mentioned. The adapter is connected to its end (sump).
Side opposite to the side that binds DNA) preferably an adapter
May have a label for immobilization at the end of the additional sequence of
Good. Thereby, it was cut out by restriction enzyme treatment.
The DNA fragment containing the adapter is labeled with the adapter.
Can be immobilized on any stationary phase such as a column
Becomes As a result, the cut DNA fragment and the remaining
Easily separated from sample DNA and cut out
DNA fragments can be subjected to sequencing in an immobilized state.
it can. Oligonucleotides may be used as immobilization labels.
What is commonly used for immobilization of is widely used, for example,
Biotin, digoxigenin, aminohexanol, etc.
(TOYOBO Biochemicals For Life
Science 97/98 version catalog etc.). For example, immobilized labels
When biotin is used, avidin was immobilized
Immobilized by biotin-avidin bond using stationary phase
Can be Although the present invention is not particularly limited, it is usually 2 to
DNA having a base length of 20 kb was used as a starting material.
It can be used as sample DNA. More specifically
Has a base length of 2 to 10 kb for a restriction enzyme that recognizes 6 bases.
Sample DNA. Preferably 4-6
This is a sample DNA having a base length of about kb. Ma
In addition, the method of the present invention provides a DN having such a long base length.
It is characterized in that it can be applied to A, but of course
Targets with a base length of 2 kb or less
it can. The sample DNA was used for excision in advance.
A restriction map by treating with restriction enzymes
It is preferable to confirm. The sample DNA was inserted into a vector and
Amplification by PCR using vector primers
And can be prepared by In this case, use for amplification
Labeled primer for immobilization as primer
Immobilized at one end of sample DNA by using
Labeling can be attached. Specifically,
Sense primer and unlabeled complementary primer
Combined and amplified by PCR to fix to the upstream end
It is possible to prepare sample DNA with
And conversely labeled with unlabeled sense strand primer
PCR amplification using a combination of complementary primers
Therefore, a sample DNA having an immobilized label at the downstream end
Can be prepared. The label for immobilization is not particularly limited.
However, for example, biotin, digoxigenin as described above,
Aminohexanol, etc.
See). Preferably it is biotin. Such a label for immobilization
The sample DNA can be easily loaded on the solid phase
Can be immobilized on the body. The solid phase carrier is not limited, but
Tex beads, magnetic beads, CPG columns, synthetic trees
Fats (polystyrene derivatives, etc.)
You. Specifically, biotin is used as a label for immobilization.
Avidin is introduced and immobilized on the surface of the solid support
Digoxigenin as a label
In this case, the antibody is immobilized and aminohexanol is further added.
When used, silanol groups or carboxyl groups
It is used after being immobilized on a carrier. Also limited to solid phase carriers in advance
Nucleic acid having an enzyme digestion end (blunt end or sticky end)
Otide is bound and the sample DNA is ligated.
It is also possible to use a method of binding using
it can. The sample DNA has one end on a solid support.
The immobilized state is subjected to the excision reaction of the present invention.
At this time, the sample DNA is internally cut
If it does not have a restriction enzyme recognition site,
The upstream end (5 'end) (or downstream end (3' end))
Immobilized on a solid phase carrier,
From the 3 'end which is the free end of DNA
(Or from the 5 'end to the 3' direction)
Pieces are being cut. Also, sample DNA is cut inside.
Possesses one recognition site for the restriction enzyme used for
For example, when the upstream end (5 'end) of the sample DNA
The sample whose end is immobilized on a carrier and the downstream of the sample DNA
Two types of samples, one with the end (3 'end) immobilized on a carrier
Prepare samples, digest each sample with the restriction enzyme and play
The separated DNA fragment is removed, and the upstream region of the sample DNA is removed.
(Upstream from the enzyme cleavage site)
Sample (sample A) and downstream region of sample DNA
DNA fragment corresponding to the region (downstream from the enzyme cleavage site)
Two are obtained with the immobilized sample (sample B). these
The excision reaction of the present invention was performed on each of two samples.
For sample A, the downstream to upstream (3 'to 5' direction)
For sample B, from upstream to downstream (5 '
DNA fragment is cut in the 3 ′ direction).
That the excision reaction of the present invention was performed on the sample DNA
And bases containing all base sequences of the sample DNA
A sample for sequence analysis can be prepared. On the other hand, two or more restrictions on the sample DNA
If there is an enzyme recognition site, 3
One or more DNA fragments result. At this time, both cut out
For DNA fragments other than the ends, the label for immobilization described above
In the amplification method using primers, immobilized labels can be added.
It cannot be fixed because it is not
It will be difficult. Cleavage by creating the restriction map described above
Checking the formula is a measure to avoid such inconvenience in advance.
In the present invention, the sample is prepared by such preparation.
Search for suitable restriction enzymes for DNA excision
Is desirable. Alternatively, two or more yeasts
If there is a recognition site, insert the sample DNA into the vector.
At the stage of insertion, the fragment on the end side is
Steps to eliminate by digestion / self-ligation
You can do it too. [0047] Cut out by the cutting method of the present invention.
DNA fragment (double-stranded) is an adapter with an immobilized label
If it is prepared using
Wash the precipitate obtained by centrifugation and submit it for sequence analysis.
Can be Also use adapter without immobilized label
If prepared using a spin column (MERmaid SP
IN, manufactured by Funakoshi) and subjected to sequence analysis.
Can be. Sequential cutting of DNA fragments by the method of the present invention
However, it can be conveniently performed in a cyclic reactor.
Wear. Such a reaction apparatus includes at least centrifugal separation means,
Petting means, temperature control means, sample D
Solid support for NA fixation, reaction liquid storage container, washing liquid storage container
And a product storage container. The present invention
It also provides a click reactor. In addition, above
The various means are used, for example, in an automatic plasmid purification device or the like.
Are commonly used in the industry, such as
Adopted. Further, the present invention provides a method for cutting out a DNA fragment of the present invention.
DNA fragments sequentially cut out using the
Then, subsequently, a method of determining its base sequence,
Thus, it is possible to determine the entire base sequence of the sample DNA.
it can. Specifically, (1) a sample with one end immobilized
Has a recognition sequence for a restriction enzyme at the other free end of DNA
A step of binding an adapter, (2)
Cutting the sample DNA, and (3) cutting in the above step.
D including the step of analyzing the base sequence of the DNA fragment
NA analysis method, including steps (1), (2) and (3)
The operation should be repeated as a unit cycle.
With this, even long-chain DNA of about 20 kb can be easily
The nucleotide sequence can be determined. The present invention is also applicable to such a DNA sequencing method.
The present invention also relates to a DNA analyzer. The DNA analysis device
At least several reaction vessels and reagents in each reaction vessel
Or means for supplying sample DNA, and sample DNA
Means for binding an adapter to the
Separation of digested DNA fragments by means of treatment with restriction enzymes
And the base sequence of the separated oligonucleotide
Is analyzed. Here is the base sequence analysis
Steps include mass spectrometry and the application of DNA array chips.
It can be suitably mentioned. The present invention also relates to the DNA analysis method of the present invention or
Also relates to the reagent kit used for the DNA analyzer.
The reagent kit includes a recognition site on DNA and a cleavage site described above.
Restriction enzymes with different positions, and the aforementioned sequences
Additional sequence with primer sequence, restriction enzyme recognition sequence
And a protruding end, which is generated by a restriction enzyme.
The same number of bases n as the cohesive end of the DNA fragment
Base sequence is all combinations of all bases (A, T, G, C)
4 consisting ofⁿAn adapter consisting of a mixture of different adapters
It contains at least a adapter sample. In addition,
The reagent kit described above contains other components, such as
It may have a buffer or the like for the application. [0052] BRIEF DESCRIPTION OF THE DRAWINGS FIG.
This will be described in detail. However, these examples are
This is only one aspect of the present invention, and the present invention does not
It is not limited. [0053]Example 1  Restriction enzyme: Use of BspMI FIG. 1 shows a method for cutting out a DNA fragment in this embodiment.
Is shown. Note that for convenience of explanation,
The first sample DNA to be extracted is sample D
NA (1), DNA for analysis was cut by restriction enzyme treatment.
The second sample DNA from which the pieces have been removed is
(2) (hereinafter, similarly, sample DNA (3),
(4) and (5). ). (A) Restrictions used for cutting out DNA fragments
BspMI was chosen as the enzyme. The restriction enzyme is shown in FIG.
Recognize sequence (11) as shown in
Cleave the DNA. As sample DNA (1), Spirulina
Phytoene synthase gene (DDBJ acces)
sion number AB001284)
Was. Specifically, the sample DNA (1)Spir ulina
platensis Genomic DNA of M-135 strain (by Sau3A)
ΛZAPII phage vector genome live
Synechococcus PCC7952 by the existing method from the rally
Made from the conserved sequence of the phytoene synthase gene
Screening the library using the probe DNA
(DIG-High Prime DNA Labeling & Detection Key
: Boehringer Myheim)
Separation of phage vector from loan and PCR method
It was prepared as follows. (B) T3 labeled with biotin at the 5 'end
Primer (sense strand primer: Sawaddy Technology
-) And unlabeled T7 primer (complementary primer)
Using the previous phage clone as a template
PCR (TAKARA Ex Taq. DNA polymerase 5U / 100μ
1), and spin column (SP-400, Pharmacia)
Purified. PCR was performed at 94 ° C for 30 seconds and at 55 ° C for 3 seconds.
30 minute cycles of 5 minutes at 72 ° C
Therefore, it was implemented. The sample DNA obtained in this way is
Treptavidin coated tube (Boehringer Manha
Im) and bind. On the other hand, the 5 'end is biotin
Labeled with T7 primer (complementary strand primer)
No T3 primer (sense strand primer) was used
From the PCR, transfer the product to another streptavidin coat
Immobilize in a tube. Next, these two types of immobilized samples D
NA (1) is digested with the restriction enzyme BspMI and free
And the sample DN immobilized with the T3 primer
A (The sample DNA upstream of the enzyme cleavage site is immobilized.
Sample: hereinafter referred to as sample DNA (A1)
U. ) And sample DN immobilized with T7 primer
A (Sample DNA downstream of enzyme cleavage site is immobilized
Sample: hereinafter referred to as sample DNA (B1)
U. ) Were prepared respectively (FIG. 1, step 0). (C) Sample DNA bound to a solid support
(A1) or on the free end side of the sample DNA (B1),
Consists of a known sequence containing the recognition sequence of the restriction enzyme BspMI
Adapter (12) is attached by ligation
(Step 1). Specifically, sample DNA (A1) or
The adapter containing the sample DNA (B1)
-Add and mix the sample and use T4 DNA ligase
Ligation reaction (incubation for 2 hours at 16 ° C)
Do). The adapter (12) used here is shown in FIG.
As shown in FIG. 3, a) sequencing primer, b)
A pacer sequence, c) a restriction enzyme BspMI recognition sequence, and
d) Consisting of four base protruding ends
You. Here, d) the protruding end (X₁X_TwoX_ThreeX_Four)
The base sequence employed is any salt of A, T, C, G
An array composed of combinations of groups (4^FourStreet
That is, 256 patterns). Follow
Then, as an adapter sample, d) the base sequence at the protruding end
256 adapters are created for each row,
Things are used. Includes all combinations of such bases
Nucleotide sequence (X₁X_TwoX_ThreeX_Four) Having as a protruding end
By using the putter sample (mixture), the sample
Free DNA (A1) or sample DNA (B1)
Depending on the base sequence of the cohesive end, a sequence complementary to the sequence
Can be bound. The sample DNA used in this example was
Owned one restriction enzyme recognition site.
For sample DNA with no single site, for immobilization
5'-end by amplifying with labeled primer
An immobilized label is attached to either the end or the 3 'end, and
Using this, it is bound to a solid support, and the protruding end is 1 base T
(X₁= T) for the first cut using an adapter
The reaction can be carried out. Sample DNA (A1) or sample DN
Adapters for each of A (B1)
After washing, BspMI digestion is performed (37 ° C.,
2 hour incubation) (Step 2). Then,
DNA containing adapter from sample DNA (A1)
Fragment (a) is again adapted from sample DNA (B1).
The DNA fragment (b) containing the fragment is cleaved. The obtained DNA fragments (a) and (b)
And subjected to the desired sequence analysis. For example, specifically
Cycle seek using the obtained sample as a template
Perform an Ens reaction and perform capillary electrophoresis
The sequence can be determined by a sensor. In this embodiment
, A capillary electrophoresis automatic sequencer
(ABI PRISM 310 gnetic Analizer)
For the resequencing reaction, the FITC lane complementary to the 3 'end was used.
Bell Primer M4 (TAKARA) and Thermo Sequenase
 Fluorecent labelled primer cycle sequencing kit
(Manufactured by Amersham) and PCR was performed using Thermal Cycler.
(TP2000 TAKARA) and recommended by the manufacturer
Determine the nucleotide sequence of the oligonucleotide using the conditions
Was. As a result, as shown in FIG.
(A) The base sequence of the long-chain oligonucleotide is 5'g
atcatat- (adapter sequence excluding protruding ends)
3 'and the long-chain oligonucleotide of the DNA fragment (b).
The nucleotide sequence of otide is 3 '(adapter excluding protruding end)
-Sequence) tagagc5 '. On the other hand, DNA fragment (a) or (b)
The released immobilized sample DNA (2) (sample DNA
(A) and (B), respectively, the immobilized sample
(A2) or (B2). ), The ada
Using the putter sample, the above steps 1 and 2
It is repeated (see FIG. 1). As mentioned earlier, the adapter
All base sequences (X₁X_TwoX_ThreeX_Four) With the protruding end
By using the adapter mixed sample
Any of the standardized sample DNA (A2) or (B2)
Base sequence (X₁X_TwoX
_ThreeX_Four) Can be attached. That is, in this case, the adhesive end 3'cta
The sample DNA (A2) having g5 '
₁X_TwoX_ThreeX_Four= Ctag is also the adapter
A sample DNA having a terminating end 5'ctcg3 '(B
2) has a protruding end X₁X_TwoX_ThreeX_Four= Ada with gagc
The puters bind by a ligation reaction. Washing
After digestion with BspMI, each sample DNA
DNA fragment containing adapter from (A2) or (B2)
Piece (a2) or (b2) was cut and thus obtained
The DNA fragment is used for analysis and determination of the base sequence as described above.
Is done. In addition, actually, the adapter of the cut DNA fragment is used.
Sequencing was performed using the fixed sequence of the
As shown in FIG. 5, the sample DNA (A
In 1), the sequence of the lower complementary strand is determined in the 5 '→ 3' direction.
Thus, the sample DNA (B1) is
The arrangement will be determined in the 5 '→ 3' direction. As a result, the DNA fragment (a2) or (b
The base sequence of the sample DNA determined in 2) is as follows:
Was on the street a2: 5'gatcgcag3 ' b2: 5'ctcggaag3 ' Similarly, sample DNAs (3), (4) and
Repeat steps 1 and 2 for (5) and (5)
The resulting DNA fragments a3, b3, a4, b
Starting from 4, a5 and b5, the base sequence of the sample DNA a3: 5'gcaggtca3 ' b3: 5'gaagggtt3 ' a4: 5'gtcaacgt3 ' b4: 5'ggttgaat3 ' a5: 5'acgtatgg3 ' b5: 5'gaatatcc3 ' I was able to decide. From these results, the sample DNA (1)
As shown in FIG. 5, the nucleotide sequence of 5′-ccat acgt tgac
 ctgc gatc atat ctcg gaag ggtt gaat atcc-3 '
did it. [0069]Example 2  Restriction enzyme: EcoP15I
for Restriction enzyme Ec having the cleavage mode shown in the above formula (1)
Sample DNA whose base sequence is unknown using oP15I
Was analyzed. Specifically, first, as in the first embodiment,
ZAPII clone was unlabeled with biotin-labeled T3 primer
Amplified by PCR using T7 primers
PCR product on solid support streptavidin coat tube
Immobilized on a tube. In addition, the biotin label
PCR with T7 primer and unlabeled T3 primer
Immobilize product in another streptavidin-coated tube
did. Next, the two kinds of immobilized DNAs were
To remove free DNA. For convenience of explanation
Above, the former immobilized sample DNA was converted to sample DNA (A
1) The latter immobilized DNA is referred to as sample DNA (B1).
Name. As an adapter, a) a sequence plug
Imer, b) spacer sequence, c) restriction enzyme BspMI
Recognition sequence, and d) a protruding end consisting of 2 bases (X₁X_Two)
6 having the sequence described in FIG.
Was. Here, the protruding end sequence is X₁X_TwoAbout 4^TwoStreet
Since there are 16 kinds of balls, each has a protruding end
Prepare 16 types of adapters and mix the mixture
-A sample was prepared. Next, the sample DNA (A1) or
(B1), the adapter sample was added, and T4DN
Ligation reaction using A ligase (16 ° C, 2 hours
Between the sample DNAs (A
The protruding end (X) complementary to the sticky end of (1) or (B1)₁
X_Two) Is connected to the end of the sample DNA.
Joined to the end. Next, the obtained sample DNA is washed.
And digested with EcoP15I (37 ° C for 2 hours).
Incubation), sample DNA (A1) or (B
Cut DNA fragment (a1) or (b1) from 1), respectively.
Refused. The obtained sample was used as a template in the same manner as in Example 1.
Perform a cycle sequence reaction as
Perform sequencing using an automated electrophoresis sequencer
Can be. Specifically, an adapter for a cut DNA fragment
The sequence is determined using the fixed sequence of the
Therefore, as shown in FIG. 7, the sample DNA (A1)
The sequence of the upper positive chain is determined in the 5 '→ 3' direction.
In the sample DNA (B1), the sequence of the lower complementary strand is
The direction is determined in the 5 '→ 3' direction. Determined from DNA fragment (a1) or (b1)
The base sequence of the sample DNA obtained is as follows.
Was. [0074] a1: 5 'tcccaccgtcccagcgacccgatagca 3' b1: 5'gactgatgtctttggcggttatgggta3 ' On the other hand, the DNA fragment (a1) or (b1) was cut out.
Immobilized sample DNA (2) (sample DNA (A)
And (B), respectively, the immobilized sample (A2)
Or (B2). ) About the above mentioned adapter again
-Perform ligation reaction by adding sample,
Attach a specific adapter having a complementary sequence at the
Was. After washing, this is treated with EcoP15I to
(A2) or (B2) sample, DNA fragment (a
2) or (b2) was recovered. Such a DNA fragment (a
2) base of sample DNA determined from (b2)
The sequence was as follows: [0075] a2: 5'caatataaattcaactcatcaaaggta3 ' b2: 5'tactgctgaaccggatctgagtgttcc3 ' As a result, the base sequence of the sample DNA (1) 5'-ggaacactcagatccggttcagcagtacccataaccgccaaagaca
tcagtcccaccgtcccagcgacccgatagcaatataaattcaactcatca
aaggta-3 ' It was decided. [0076] As described above, an efficient DNA sequencing technique is
Technology industry development and basic biological research
Is very important for With conventional DNA sequencing technology
Is a large clone that serves as template DNA for sequencing.
It takes a lot of time and effort to prepare a clone,
It was difficult to mobilize. How to cut out the DNA fragment of the present invention
The method repeats the same restriction enzyme and the same adapter
By using, a predetermined
DNA fragments having base length can be cut out sequentially
Is the way. Therefore, it is suitable for automation,
And oligonucleotides using a DNA chip or mass spectrometer
By combining Otide sequencing technology, several k
b to several tens kb, preferably about 10 kb, more preferably
Automatically analyzes the base sequence of long-chain DNA of 4 to 6 kb
It is possible to do. Therefore, according to the present invention,
This makes DNA analysis easier and faster.
Thus, the efficiency of the DNA analysis operation can be improved. Only
The present invention provides a DNA sequence for genetic diagnosis and criminal investigation.
Not only can it be applied to all base fields,
Large-scale human genomic DNA
Widely applicable to quenching and the like. [0077] [Sequence list] <110> Takeo Satou: Director general, Agency of Industrial Science & Techno logy <120> Method for sequential cleavage of DNA and method for analysis of DN A using the same <130> 113M0181 <160> 6 <210> 1 <211> 44 <212> DNA <213> Spirulina <400> 1 ccatacgttg acctgcgatc atatctcgga agggttgaat atcc 44 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <400> 2 tcccaccgtc ccagcgaccc gatagca 27 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <400> 3 gactgatgtc tttggcggtt atgggta 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <400> 4 caatataaat tcaactcatc aaaggta 27 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <400> 5 tactgctgaa ccggatctga gtgttcc 27 <210> 6 <211> 102 <212> DNA <213> Spirulina <400> 6 ggaacactca gatccggttc agcagtaccc ataaccgcca aagacatcag tcccaccgtc 60 ccagcgaccc gatagcaata taaattcaac tcatcaaagg ta 102

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing a flowchart of Embodiment 1 of the present invention. FIG. 2 is a view showing a cleavage mode of a restriction enzyme BspMI used in Example 1. FIG. 3 is a view showing a base sequence of an adapter used in Example 1. FIG. 4A shows a sample DN in Example 1.
A (D) obtained by cutting A (A) with a restriction enzyme
FIG. 3 shows the nucleotide sequence of NA fragment (a), and FIG.
DN obtained by cutting (B) with a restriction enzyme
It is a figure which shows the base sequence of A fragment (b). FIG. 5 is a diagram showing a base sequence site determined in five cycles including Step 1 and Step 2 and a part of the sequence in Example 1. FIG. 6 is a view showing a base sequence of an adapter used in Example 2. FIG. 7 is a view showing a base sequence site determined in two cycles of Step 1 and Step 2 and a part of the sequence in Example 2.

────────────────────────────────────────────────── ─── Continuation of the front page (56) References JP-A-6-113896 (JP, A) JP-A-2-92300 (JP, A) (58) Fields investigated (Int.Cl. ⁶ , DB name) C12Q 1/68 WPI (DIALOG)

Claims (1)

(57) Claims: (1) A recognition site on DNA is cleaved at the other free end of a double-stranded sample DNA having one end immobilized.
A method for cutting out a DNA fragment, comprising: ligation of an adapter having a recognition sequence for a restriction enzyme having a different site , and (2) cutting the sample DNA with the restriction enzyme. 2. A method for successively cutting out DNA fragments, wherein the operation including the steps (1) and (2) according to claim 1 is defined as a unit cycle and the cycle is repeated. 3. An adapter having an additional sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number of bases as the number of bases of a cohesive end of a DNA fragment generated by the restriction enzyme. The method according to claim 1, wherein the method comprises a salt tomb array. 4. The method according to claim 3 , wherein the additional sequence of the adapter has a sequence primer sequence. 5. A two adapter further comprises a label for immobilization
The method according to any one of claims 1 to 4 , which is a single-stranded DNA . 6. A DNA fragment according to claim 2, comprising a centrifugal separation means, a pipetting means, a temperature control means, a solid support for immobilizing a sample DNA, a reaction liquid storage container, a washing liquid storage container and a product storage container. Cyclic reactor used in the method. 7. The step (1) is an adapter having an additional sequence, a recognition sequence for a restriction enzyme and an overhanging end, wherein the overhanging end has the same number of bases n as the cohesive end of the DNA fragment generated by the restriction enzyme. And its base sequence is composed of all bases (A,
T, G, and C).
The method according to any one of claims 2 to 5 , wherein the method is performed by blending a mixture of ⁿ kinds of adapters into a sample DNA sample. (1) A recognition site on DNA is cleaved at the other free end of a double-stranded sample DNA having one end immobilized.
Ligation of an adapter having a recognition sequence for a restriction enzyme having a different site , (2) cutting the sample DNA with the restriction enzyme, and (3) analyzing the base sequence of the DNA fragment cut out in the step. A method for analyzing DNA, comprising the steps of: 9. The method according to claim 8 , wherein (1), (2) and (3).
A method for analyzing DNA, wherein the operation including the step of (1) is defined as a unit cycle and the cycle is repeated. 10. An adapter having an additional sequence having a sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end corresponds to the number of bases of the cohesive end of a DNA fragment generated by the restriction enzyme. 9. The method according to claim 8 , which comprises a base sequence having the same number of bases.
Is the method described in 9 . 11. The step (1) is an additional sequence having a sequence primer sequence, a restriction enzyme recognition sequence and an adapter having a protruding end, wherein the protruding end is the same as the cohesive end of a DNA fragment generated by the restriction enzyme. claims carried out in having a base number n, by blending the base sequence full nucleotide (a, T, G, C ) a mixture of adapters 4 ⁿ types of all the combinations of the sample DNA in the sample 9. The method according to 9 . 12. The D according to claim 8, wherein
A reagent kit used for the NA analysis method, wherein at least a recognition site and a cleavage site on DNA are different from each other;
And an additional sequence having a sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number n of bases as the cohesive end of a DNA fragment generated by the restriction enzyme, and the base sequence is entirely Bases (A, T,
A reagent kit comprising an adapter sample consisting of a mixture of 4 ⁿ types of adapters consisting of all combinations of G and C). 13. The D according to claim 8, wherein
A DNA analyzer using the NA analysis method. 14. At least a plurality of reaction vessels, means for supplying a reagent or sample DNA to each reaction vessel, means for connecting an adapter to the sample DNA, and sample D
14. The DN according to claim 13 , further comprising means for treating NA with a restriction enzyme, means for separating a cleaved DNA fragment, and means for analyzing the base sequence of the separated oligonucleotide.
A analyzer.