JP2000069980A - Sequential cutting of dna fragment and analysis of dna by using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To analyze a base sequence of a DNA by binding an adapter having a recognition sequence of a restriction enzyme at the other free terminal of a sample DNA having one immobilized terminal, and sequentially cutting the DNA by the restriction enzyme to cut out DNA fragments. SOLUTION: An adapter having a recognition sequence of a type III or type IIs restriction enzyme is bound to the other free terminal of a sample DNA immobilized at the one terminal, and the sample DNA is cut out by the restriction enzyme. The DNA fragments are cut out by repeating a unit cycle of the before cutting out operation of the DNA fragment, and the base sequence of the sample DNA is analyzed. The adapter has an addition sequence having a sequence primer sequence, a recognition sequence of the restriction enzyme, and a protruding terminal, and the protruding terminal, and is composed of a base sequence having the number of the bases same as the number of the bases of an adhesive terminal of the DNA fragment caused by the restriction enzyme.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for extracting a DNA fragment useful for analyzing a DNA base sequence, a method for determining a DNA base sequence using the method, and a method for determining the base sequence. The present invention relates to a DNA sequencing device used.

[0002] The DNA fragment excision method of the present invention comprises the steps of:
Useful as a sample preparation method for base sequence analysis of NA,
Further, the nucleotide sequence determination method of the present invention can be effectively used particularly for long-chain DNA. From another point of view, the present invention relates to I
The present invention also relates to a novel use of restriction enzymes having different recognition sites and cleavage sites on DNA, such as type IIs, type IIs and type III.

[0003]

2. Description of the Related Art In recent years, techniques for DNA sequencing have been remarkably developed, and base sequences of many kinds of large genomic DNAs from microorganisms to humans are being determined. Analysis of genomic sequences focuses on sequencing of large clones of 40 to 150 kb, and therefore, efficiency of DNA sequencing is necessarily required. The challenges in increasing the efficiency of DNA sequencing are two steps: (i) "preparing a DNA fragment for analysis" in which hundreds of subclones having a length of about 500 bp to 1 kb are prepared from a large clone; And (ii) the efficiency of the “base sequence sequencing step” for determining the base sequence of the DNA of these subclones. In particular, the former step of preparing a template DNA for sequencing requires a high level of skill and a great deal of time and effort by an engineer.

Conventionally, there are roughly three methods for determining the nucleotide sequence of DNA, namely, a shotgun method, a primer walk method, and a nested deletion (ND) method.

[0005] In the shotgun method, sample DNA is randomly cut using ultrasonic waves or restriction enzymes, etc., DNA fragments are prepared by a subcloning method, the base sequence of each fragment is determined, and the overlapping portion of the obtained sequence is determined. Is a method of determining the base sequence of the entire sample DNA using T. (T. Mani
atis et al.,: Molecular Cloning, Cold Spring Harbo
r Lanoratory Press, 13, 21-33 (1989), etc.).

[0006] The primer walk method uses a sample DNA
Are determined in order from the end. In this method, first, the base sequence of the terminal region of the sample DNA is determined, then the primer sequence following the next region is selected from the determined base sequence, and then the base sequence is again used as a starting point for the dideoxy method (Sanger method). (T. Maniatis et al.,: Molecular Cloning, Cold Spri
ng Harbor Lanoratory Press, 13, 14-20 (1989), etc.)).

The nested deletion method (ND) is
The end region of the sample DNA is decomposed with an enzyme to prepare DNA fragments having slightly different lengths, and the starting points of the other ends of the fragments are aligned, and then, in order of length, from the starting point and the opposite end. This is a method for determining the base sequence (T. Maniatis e
t al.,: Molecular Cloning, Cold Spring Harbor Lano
ratory Press, 13, 34-41 (1989), etc.)).

[0008] Among these nucleotide sequence determination methods, the most frequently used method is the shotgun method. But,
In this method, since the entire sequence of the sample DNA is determined by relying on the overlapping portion of a large number of DNA fragments that have been randomly cut out, the same sequence is analyzed in duplicate, so that the redundancy is high, and therefore time and labor are required. And serious problems such as large-scale misreading caused by repeated sequences.

The primer walk method and the nested deletion method (ND method) have been developed to overcome the disadvantages of the shotgun method, and are efficient methods for determining the base sequence in order from the end. . However, in the primer walk method, it is necessary to design an appropriate primer every time the nucleotide sequence is analyzed, and in the nested deletion method, it is necessary to prepare a subclone of a continuous length by a nested deletion reaction. Includes the problem that complicated operations are required.

[0010] Furthermore, all of the above three conventional methods involve transformation into Escherichia coli. In particular, the shotgun method requires a cloning step (preparation of subclones by culturing Escherichia coli) to prepare a DNA fragment for analysis. Because of this, there was a problem that it was time-consuming and unsuitable for automation.

[0011]

SUMMARY OF THE INVENTION The present invention has been developed in view of the above circumstances in order to improve the efficiency of DNA sequencing, particularly (i) the "step of preparing a DNA fragment for analysis". That is, the present invention provides a DNA sample (DNA for analysis) useful for achieving efficient base sequence determination.
Fragment)). Furthermore, the present invention provides an efficient DN using the above DNA sample preparation method.
It is an object of the present invention to provide a method for determining a nucleotide sequence of A and a device for determining a nucleotide sequence of DNA.

[0012] The method of the present invention involves the conventional problems in DNA sequencing such as 1) high redundancy, 2) occurrence of misreading due to repetitive sequences, 3) sequential preparation of primers, and 4) troublesome nested deletion reaction. At the same time. Further, the method of the present invention enables automation of preparation of a DNA sample for analysis and automation of DNA sequencing, and as a result, contributes to simple and rapid analysis of the base sequence of long-chain DNA.

[0013]

Means for Solving the Problems The inventors of the present invention have been studying to solve the above problems day and night, and by using a restriction enzyme having different characteristics between a recognition site and a cleavage site, the present inventors have found that the use of restriction enzymes It is found that a DNA fragment can be cleaved from the end, and a specific adapter having a recognition sequence of the restriction enzyme is bound to the end of the DNA to be cleaved and used. It has been found that a DNA fragment having the same can be cut out. Furthermore, by combining this method with a sequencing step, it has been confirmed that the base sequence can be efficiently determined even for long-chain DNA, and the present invention has been developed.

That is, the present invention provides a method for preparing a sample D using a restriction enzyme in which the recognition site and the cleavage site have different properties.
In this method, DNA fragments are sequentially cut out from one end of NA.

Specifically, the present invention provides (1) a step of adding an adapter having a recognition sequence of a restriction enzyme used for excision to the other free end of a sample DNA having one end immobilized thereon, and (2) A step of cleaving a DNA fragment containing the adapter by allowing the restriction enzyme to act on the immobilized sample DNA and cleaving a specific site on the sample DNA away from the recognition sequence in the adapter by a predetermined length. This is a method for cutting out fragments.

The method further comprises the steps of: (1) adding an adapter and (2) treating with a restriction enzyme to the immobilized sample DNA from which the DNA fragments have been cut by the above method. This can be repeated, whereby DNA fragments constituting the full length of the sample DNA can be sequentially cut from the free end (free end). Therefore, the present invention is a method for sequentially cutting out DNA fragments comprising the above steps. The method of the present invention can be automated. Accordingly, the present invention provides a method for sequentially cutting out the above DNA fragments, comprising a centrifuge, a pipetting means, a temperature control means, a solid support for immobilizing a sample DNA, a reaction liquid storage container, a washing liquid storage container, and a product. It also relates to a cyclic reactor having a storage container.

The DNA fragment thus excised is subjected to nucleotide sequence determination with or without amplification, whereby the full-length nucleotide sequence of the sample DNA can be determined.

Accordingly, the present invention provides a method for analyzing DNA, which comprises utilizing the above-described method for extracting DNA and then analyzing the nucleotide sequence of the extracted DNA fragment, and further comprising a reagent kit used for the DNA analysis method. The present invention also relates to a DNA analyzer using the above DNA analysis method.

In the present specification, the abbreviations of base sequences, nucleic acids and the like are referred to by the abbreviations of IUPAC and IUB, “Guidelines for preparation of specifications including base sequences or amino acid sequences” (edited by the Patent Office) and The conventional symbols in the field shall be followed. In addition, the genetic engineering technology used in the present invention and the specific operation thereof follow conventional methods in the art and methods recommended by the manufacture or sale of reagents (J. Sambrook, EFFritsch and T. Mani).
alis, "Molecular Cloning, A Laboratory Manual," Co
ld Spring Harbor Univ. Press, New York, 1988, etc.).

[0020]

BEST MODE FOR CARRYING OUT THE INVENTION The restriction enzyme used in the present invention is not particularly limited as long as the recognition site and the cleavage site on DNA are different from each other. Preferably, it is a restriction enzyme that recognizes a specific base sequence and cuts a site away from the sequence by a certain length, more preferably a DNA that is cleaved at the 3 ′ end or 5 ′
It is a restriction enzyme that generates a double-stranded DNA fragment having a sticky end protruding at the end.

Examples of such a restriction enzyme include a type I restriction enzyme,
Although a type IIs restriction enzyme and a type III restriction enzyme can be mentioned, a type III restriction enzyme and a type IIs restriction enzyme are preferred.

The type III restriction enzyme recognizes a base sequence having usually 4 to 6 bases, and then recognizes a certain chain length (usually 4 to 25 bases).
It has a cleavage mode in which a site distant from the base is cleaved. For example, EcoP15I is the longest currently known distance from the recognition unit to the cutting unit, and has a cutting mode represented by the following equation.

[0023]

Embedded image

[Here, (N) ₂₅ and (N ') ₂₇ each represent a nucleotide sequence having 25 bp and 27 bp consisting of any combination of A, T, G or C nucleotides. N ′ is a complementary nucleotide to N. Examples of such a remote cleavage type enzyme of about 25 bp include EcoPI, Hinel, HinfIII, NgoM
X and StylTI can be exemplified.

Examples of the IIs type restriction enzyme include, for example,
Fokl having a proximity cutting type cutting mode as described below can be mentioned.

[0026]

Embedded image

[Here, (N) ₉ and (N ') ₁₃ each represent a nucleotide sequence having 9 bp and 13 bp consisting of an arbitrary combination of four nucleotides of A, T, G or C. N ′ is a complementary nucleotide to N. In addition, as restriction enzymes having a proximity cleavage type cleavage mode, BseRI, BsgI, BsmFI, BspMI,
MboII, MnII, PleI, SfaNIEco571
And the like.

These restriction enzymes are commercially available and can usually be obtained commercially.

The adapter used in the present invention may be basically a double-stranded DNA having a recognition sequence for the restriction enzyme used for cutting out a DNA fragment. By binding such an adapter to the free end side of the sample DNA of interest and then causing the restriction enzyme to act, the restriction enzyme recognizes the recognition sequence in the adapter and then recognizes a base on the sample DNA that is a certain distance away from the adapter. Cut the sequence.
As a result, a double-stranded DN of a predetermined length can be obtained from the sample DNA.
The A fragment is cut out in a state of having a cohesive end, preferably at the 3 ′ end or 5 ′ end, in a state of being bound to an adapter.

Preferably, the adapter can be designed to have a protruding end at either the 3 'end or the 5' end in addition to the recognition sequence of the restriction enzyme. The number of bases at the protruding end includes the number n of bases at the cohesive end of the DNA fragment generated by the restriction enzyme used for excision. For example, as a restriction enzyme, the aforementioned EcoP1
When using 5I or Fokl, from its cleavage mode,
Adapters each having two (27-25 (N'-N) = 2 (n)) or four (13-9 (N'-N) = 4 (n)) protruding ends can be employed. . The base sequence of the protruding end is not particularly limited, and A, T,
It can be any sequence consisting of any G or C nucleotide.

The adapter sample used in the reaction system includes all bases (A, T,
A mixture of adapters having a base sequence consisting of a combination of G, C) (ie, a mixture containing 4 ⁿ types of adapters) is used. By using such a mixture, the protruding end of the specific adapter in the mixture is complementary to any base sequence of the cohesive end of the DNA fragment generated by excision of the sample DNA, regardless of the base sequence. It can be added (ligated) by bonding. Thereby, after the sample DNA is treated with a restriction enzyme to cut out the DNA fragment, subsequently, the adapter can be repeatedly attached to the remaining sample DNA having the cohesive end generated by the cutting out of the DNA fragment. As a result, it becomes possible to repeatedly cut a predetermined length of DNA fragment from the end of the sample DNA.

For example, taking as an example the case where EcoP15I having the cleavage mode shown in the above formula (1) is used as a restriction enzyme, the adapter can be more preferably designed as shown below.

[0033]

Embedded image

Here, X ₁ X ₂ represents the above-mentioned protruding end. Since the number of bases sticky ends of DNA fragments resulting from cleavage by EcoP15I is a two, all combinations are 16 kinds of the nucleotide sequence of X ₁ X ₂ (4 ² types) there. Therefore, as the adapter sample, a mixture of 16 types of adapters containing all types of protruding ends is used.

[0035] In addition to the recognition sequence and the protruding end, the adapter is located on the side opposite to the protruding end (ie, the sample DN).
It is preferable to have an arbitrary number m of arbitrary base sequences (hereinafter referred to as additional sequences) on the side opposite to A. This is adopted to prevent the restriction enzyme often from recognizing the sequence at the end, and to prevent this and to efficiently cut out the DNA fragment.

Since the number m of bases in such an additional sequence varies depending on the type of restriction enzyme used, it can be appropriately determined according to the enzyme. In many type II restriction enzymes, the number m of bases in the additional sequence has been examined. For example, the number m of bases in the additional sequence required for cutting 90% or more in 2 hours under normal conditions is 8 bp for NotI and PstI for PstI. Then 2 bp,
In BstXI, it is 8 bp. The type III and type IIs restriction enzymes are not limited, but are similarly 2 to 20 bp,
Preferably, the number of bases is about 6 to 8 bp. The base sequence of the additional sequence is not particularly limited as long as it is suitable for the above purpose, and may be any base sequence.

Further, a sequence of a sequence primer may be employed as the additional sequence. For example, when excision of a DNA fragment according to the present invention is followed by sequencing of the excised DNA fragment, M13FW, M13FW,
4. Sequences of sequence primers such as M13REV, T3 and T7 (Bio-General Catalog, 1997/1998 edition, Takara Shuzo) are adopted as additional sequences of the adapter, and one oligonucleotide of the cut DNA fragment is used as a template. Subsequently, a sequence reaction such as a Sanger reaction (dideoxy reaction) can be performed. In this case, an arbitrary base sequence (hereinafter, also referred to as a spacer sequence) is further provided downstream of the sequence primer.
May be added. This is in view of the difficulty in starting to read immediately downstream of the primer at the time of sequencing.
Any base sequence having 50 bp, preferably 15 to 20 bp can be mentioned.

The adapter may have a label for immobilization at its end (the side opposite to the side that binds to the sample DNA), preferably at the end of the additional sequence of the adapter. This makes it possible to immobilize the DNA fragment containing the adapter cut out by the restriction enzyme treatment on an arbitrary stationary phase such as a column via the label of the adapter. As a result, the cut-out DNA fragment and the remaining sample DNA can be easily separated, and the cut-out DNA fragment can be subjected to sequencing in an immobilized state. As the label for immobilization, those commonly used for immobilizing oligonucleotides are widely used, and examples thereof include biotin, digoxigenin, aminohexanol and the like (TOYOBO Biochemicals For Life).
Science 97/98 version catalog etc.). For example, when biotin is used as the immobilization label, immobilization can be performed by biotin-avidin binding using a stationary phase on which avidin is immobilized.

Although the present invention is not particularly limited, it is usually 2 to
DNA having a base length of 20 kb can be used as a sample DNA as a starting material. More specifically, a sample DNA having a base length of 2 to 10 kb is used as the restriction enzyme that recognizes 6 bases. Preferably 4-6
This is a sample DNA having a base length of about kb. In addition, the method of the present invention provides a DN having such a long base length.
It is characterized in that it can be applied to A. Of course, it can be applied to those having a base length of 2 kb or less.

The sample DNA is preferably treated in advance with a restriction enzyme used for excision to prepare a restriction enzyme map and confirm the cutting mode.

The sample DNA can be prepared by inserting into a vector and amplifying by PCR using primers of the vector. At this time, by using a primer with a label for immobilization as a primer to be used for amplification, the label for immobilization can be attached to one end of the sample DNA. Specifically, a sample DNA having an immobilized label at the upstream end can be prepared by PCR amplification using a combination of a labeled sense strand primer and an unlabeled complementary strand primer, and conversely, A sample DNA having an immobilized label at the downstream end can be prepared by PCR amplification using a combination of the strand primer and the labeled complementary strand primer.

The label for immobilization is not particularly limited. For example, biotin, digoxigenin,
Aminohexanol and the like (see the above catalog). Preferably it is biotin. By using such an immobilization label, the sample DNA can be easily immobilized on a solid support.

The solid phase carrier is not limited, and examples thereof include latex beads, magnetic beads, CPG columns, and synthetic resins (such as polystyrene derivatives).

Specifically, when biotin is used as the immobilizing label, avidin is introduced and immobilized on the surface of the solid support, and when digoxigenin is used as the label, the antibody is immobilized, and aminohexanol is further immobilized. When is used, a silanol group or a carboxyl group is used by being immobilized on a carrier. Alternatively, a method may be used in which a nucleotide having a restriction enzyme digestion end (blunt end or cohesive end) is previously bound to the solid phase carrier, and the sample DNA is bound thereto using ligase, complementary binding, or the like.

The sample DNA is subjected to the excision reaction of the present invention, with one end thereof being immobilized on a solid support.
At this time, if the sample DNA does not have a recognition site for a restriction enzyme used for excision, the upstream end (5 ′ end) (or downstream end (3 ′ end)) of the sample DNA is immobilized on a solid support. Then, the DNA fragment is cut in the 5 'direction from the 3' end which is the free end of the sample DNA (or in the 3 'direction from the 5' end) by the excision reaction. Further, when the sample DNA has one recognition site for a restriction enzyme used for excision therein, for example, a sample in which the upstream end (5 ′ end) of the sample DNA is immobilized on a carrier, Two types of samples were prepared, a sample having a downstream end (3 'end) immobilized on a carrier, and each sample was digested with the restriction enzyme to remove free DNA fragments, and the upstream region of the sample DNA (enzyme cleavage). (Sample A) on which a DNA fragment corresponding to the region upstream of the site (immobilized) and a sample (Sample B) on which a DNA fragment corresponding to the downstream region of the sample DNA (downstream from the enzyme cleavage site) were immobilized. And get two. When the excision reaction of the present invention is performed on each of these two samples, the sample A goes from downstream to upstream (3 ′ to 5 ′ direction), and the sample B goes from upstream to downstream (5 ′ to 3 ′). The DNA fragment is cleaved in the direction (1), and as a result, the excision reaction of the present invention has been performed on the sample DNA, and a sample for base sequence analysis containing all the base sequences of the sample DNA can be prepared.

On the other hand, if the sample DNA has two or more restriction enzyme recognition sites,
One or more DNA fragments result. At this time, since the immobilized label cannot be added to the excised DNA fragments other than the both ends by the above-described amplification method using the immobilized labeled primer, the immobilized label cannot be added, and thus the application of the excision method of the present invention is difficult. Becomes Confirmation of the cutting mode by creating a restriction enzyme map as described above is a measure to avoid such inconvenience in advance, and in the present invention, it is necessary to search for a restriction enzyme suitable for cutting out a sample DNA by such preliminary preparation. desirable. Alternatively, when the sample DNA has two or more enzyme recognition sites, a treatment may be performed in which the fragment on the end side is deleted by partial digestion with a restriction enzyme / self ligation at the stage of inserting the sample DNA into the vector.

When the DNA fragment (double-stranded) cut out by the cutting method of the present invention is prepared using an adapter with an immobilized label, the DNA fragment (double-stranded) is immobilized using the adapter, and the precipitate obtained by centrifugation is then used. Can be washed and subjected to sequence analysis. In the case of using an adapter without an immobilized label, a spin column (MERmaid SP)
IN, manufactured by Funakoshi) and then subjected to sequence analysis.

The sequential excision of DNA fragments according to the method of the present invention can be conveniently carried out in a cyclic reactor. Such a reaction apparatus includes at least a centrifuge, a pipetting means, a temperature control means, a sample D
It has a solid support for NA fixation, a reaction liquid storage container, a washing liquid storage container, and a product storage container. The present invention also provides such a cyclic reactor. As the above various means, those commonly used in the art, such as those used in an automatic plasmid purification apparatus, are widely adopted.

Further, the present invention provides a method for determining the nucleotide sequence of a DNA fragment sequentially cut out using the DNA fragment cutting out method of the present invention,
Thus, the entire base sequence of the sample DNA can be determined. Specifically, (1) a step of binding an adapter having a recognition sequence for a restriction enzyme to the other free end of the sample DNA having one end immobilized, (2) a step of cutting the sample DNA with the restriction enzyme, And (3) a step of analyzing the base sequence of the DNA fragment cut out in the above step.
This is a method for analyzing NA, and the base sequence can be easily determined even for a long-chain DNA of about 20 kb by repeatedly performing the cycle including the operations including the steps (1), (2) and (3) as a unit cycle. can do.

The present invention also relates to a DNA analyzer used for such a DNA sequencing method. The DNA analyzer includes at least a plurality of reaction vessels, a unit for supplying a reagent or sample DNA to each reaction vessel,
And a means for treating the sample DNA with a restriction enzyme, a means for separating the cleaved DNA fragments, and a means for analyzing the base sequence of the separated oligonucleotide. As the means for analyzing the base sequence, mass spectrometry and application of a DNA array chip can be suitably mentioned.

The present invention also relates to a reagent kit for use in the DNA analysis method or DNA analysis apparatus of the present invention, wherein the reagent kit comprises a restriction enzyme having a different recognition site and a cleavage site on the DNA, It has an additional sequence having the above-mentioned sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end. It contains at least an adapter sample consisting of a mixture of 4 ⁿ types of adapters consisting of all combinations of bases (A, T, G, C). In addition, the reagent kit of the present invention can also have, for example, a ligation buffer or the like as another component.

[0052]

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in detail below based on embodiments with reference to the drawings. However, these examples are only one embodiment of the present invention, and the present invention is not limited to these examples.

Example 1 Utilization of Restriction Enzyme: BspMI FIG. 1 is a flowchart showing a method for cutting out a DNA fragment in this example. Note that, for convenience of explanation, the first sample DNA to be cut out is sample D
NA (1), the second sample DNA from which the DNA fragment for analysis was removed by restriction enzyme treatment was used as the sample DNA
(2) (hereinafter, similarly, sample DNA (3),
(4) and (5). ).

(A) BspMI was selected as a restriction enzyme used for cutting out a DNA fragment. The restriction enzyme is shown in FIG.
Recognize the sequence (11) as shown in (1) and cut the DNA at the position shown by the arrow.

As the sample DNA (1), a phytoene synthase gene (DDBJ acces) of the Spirulina genome was used.
The DNA containing the strain number AB001284) was employed. Specifically, the sample DNA (1) is Spirulina
Synechococcus PCC7952 from λZAPII phage vector genomic library of genomic DNA of platensis strain M-135 (partial degradation by Sau3A)
The library was screened using a probe DNA made from the conserved sequence of the phytoene synthase gene of (DIG-High Prime DNA Labeling & Detection Kit: Boehringer Maiheim), and then the phage vector was separated from the selected clones. It was prepared as follows by the PCR method.

(B) T3 labeled with biotin at the 5 ′ end
Primer (sense strand primer: Sawadee Technology) and unlabeled T7 primer (complementary primer)
PCR (TAKARA Ex Taq. DNA polymerase 5U / 100μ) using the phage clone as a template
1) was carried out and purified by a spin column (SP-400, Pharmacia). PCR was performed at 94 ° C for 30 seconds and at 55 ° C for 3 seconds.
30 minutes at 72 ° C. for 30 cycles. The sample DNA thus obtained is introduced into a streptavidin-coated tube (Boehringer Mannheim) and bound. On the other hand, the product from PCR using a T7 primer (complementary strand primer) labeled with biotin at the 5 ′ end and a T3 primer (sense strand primer) without labeling is immobilized on another streptavidin-coated tube.

Next, these two types of immobilized samples D
NA (1) was digested with the restriction enzyme BspMI to remove the free part, and the sample DN immobilized with the T3 primer was used.
A (a sample in which the sample DNA upstream of the enzyme cleavage site is immobilized: hereinafter referred to as sample DNA (A1)) and a sample DN immobilized with the T7 primer
A (sample in which the sample DNA downstream of the enzyme cleavage site was immobilized: hereinafter referred to as sample DNA (B1)) was prepared (FIG. 1, step 0).

(C) Sample DNA bound to a solid support
(A1) or on the free end side of the sample DNA (B1),
An adapter (12) consisting of a known sequence containing a recognition sequence for the restriction enzyme BspMI is bound by ligation (Step 1). Specifically, an adapter sample described below is added to and mixed with a sample containing the sample DNA (A1) or the sample DNA (B1), and a ligation reaction (incubation at 16 ° C. for 2 hours) is performed using T4 DNA ligase.

The adapter (12) used here comprises, as shown in FIG. 3, a) a sequencing primer, b) a spacer sequence, c) a restriction enzyme BspMI recognition sequence, and d) a protruding end consisting of 4 bases. Is what is done.

[0060] Here, d) the nucleotide sequence employed in the protruding end _{(X 1 X 2 X 3 X} 4) is, A, T, C, array constituted by a combination of any of a base G (4 ⁴ ways, That is, all 256 types are included. Therefore, as adapter samples, 256 types of adapters are prepared according to the above d) base sequence of the protruding end, and a mixture thereof is used. By using an adapter sample (mixture) having as its protruding ends a base sequence (X ₁ X ₂ X ₃ X ₄ ) containing all combinations of such bases, free use of sample DNA (A1) or sample DNA (B1) is achieved. Depending on the arbitrary base sequence of the cohesive end, it becomes possible to bind an adapter having a complementary sequence to the sequence.

Although the sample DNA used in this example had one restriction enzyme recognition site, in the case of a sample DNA having no restriction enzyme recognition site, a primer having a label for immobilization was used. By amplifying, an immobilized label is attached to either the 5 'end or the 3' end, and the label is used to bind to a solid phase carrier.
The first excision reaction can be performed using an adapter with (X ₁ = T).

Sample DNA (A1) or sample DN
After ligation of the adapter for each of A (B1), washing and BspMI digestion are performed (37 ° C.,
2 hour incubation) (Step 2). Then,
DNA containing adapter from sample DNA (A1)
The fragment (a) and the DNA fragment (b) containing the adapter are cleaved from the sample DNA (B1).

The obtained DNA fragments (a) and (b) are collected and subjected to a desired sequence analysis. For example, specifically, a cycle sequencing reaction is performed using the obtained sample as a template, and sequence determination can be performed by an automatic capillary electrophoresis sequencer. In this example, an automatic capillary electrophoresis sequencer (ABI PRISM 310 gnetic Analyzer) was employed, and a FITC-labeled primer M4 (manufactured by TAKARA) and a Thermo Sequenase complementary to the 3 ′ end were used for the cycle sequencing reaction.
Fluorecent labelled primer cycle sequencing kit
(Manufactured by Amersham) and PCR was performed using Thermal Cycler.
(TP2000 TAKARA) and the nucleotide sequence of the oligonucleotide was determined under the conditions recommended by the manufacturer.

As a result, as shown in FIG. 4, the nucleotide sequence of the long oligonucleotide of the DNA fragment (a) was 5′g
atcatat- (adapter sequence excluding protruding ends)
The base sequence of the long-chain oligonucleotide of the DNA fragment (b) was 3 ′ (adapter sequence excluding the protruding end) tagaggc 5 ′.

On the other hand, the immobilized sample DNA (2) (sample DNA) from which the DNA fragment (a) or (b) was cut out
Corresponding to (A) and (B), they are referred to as immobilized samples (A2) and (B2), respectively. ), The above-mentioned steps 1 and 2 are repeated using the above-mentioned adapter sample (see FIG. 1). As described above, by using an adapter mixed sample having all base sequences (X ₁ X ₂ X ₃ X ₄ ) as protruding ends as an adapter, any adhesion of the immobilized sample DNA (A2) or (B2) A complementary base sequence (X ₁ X ₂ X
₃ X ₄₎ can be coupled to an adapter having a.

That is, in this case, the adhesive end 3′cta
g5'-containing sample DNA (A2)
An adapter with ₁ X ₂ X ₃ X ₄ = ctag also provided a sample DNA (B
In 2), an adapter having a protruding end X ₁ X ₂ X ₃ X ₄ = gagc is bound by a ligation reaction. After washing and digestion with BspMI, each sample DNA
The DNA fragment (a2) or (b2) containing the adapter is cleaved from (A2) or (B2), and the DNA fragment thus obtained is subjected to the analysis and determination of the base sequence as described above. Note that, since the sequence is actually determined using the fixed sequence of the adapter region of the cleaved DNA fragment as a primer, as shown in FIG.
In 1), the sequence of the lower complementary strand is determined in the 5 ′ → 3 ′ direction, and in the sample DNA (B1), the sequence of the upper positive strand is determined in the 5 ′ → 3 ′ direction. Become.

As a result, the DNA fragment (a2) or (b
The nucleotide sequence of the sample DNA determined from 2) was as follows: a2: 5 'gtcgcag3' b2: 5 'ctcggaag3' Similarly, sample DNAs (3), (4) and (5) obtained sequentially And the DNA fragments a3, b3, a4, b
Starting from 4, a5 and b5, the base sequence of the sample DNA was sequentially determined as follows: a3: 5′gcaggtca3 ′ b3: 5′gaagggtt3 ′ a4: 5′gtcaacgt3 ′ b4: 5′gttgatat3 ′ a5: 5′acgtatgg3 ′ a5: 5′acgtatgg3 ′ I was able to decide.

From these results, the sample DNA (1)
As shown in FIG. 5, the nucleotide sequence of 5′-ccat acgt tgac
ctgc gatc atat ctcg gaag ggtt gaat atcc-3 ′.

Example 2 Utilization of Restriction Enzyme: EcoP15I Restriction enzyme Ec having a cleavage mode represented by the above formula (1)
Sample DNA whose base sequence is unknown using oP15I
Was analyzed.

Specifically, first, as in the first embodiment,
The ZAPII clone was amplified by PCR using a biotin-labeled T3 primer and an unlabeled T7 primer, and the resulting PCR product was immobilized on a solid support streptavidin-coated tube. In the same manner as above, PCR using biotin-labeled T7 primer and unlabeled T3 primer
The product was immobilized on another streptavidin coated tube. Next, the two kinds of immobilized DNAs were
To remove free DNA. For convenience of explanation, the former immobilized sample DNA was replaced with the sample DNA (A
1) The latter immobilized DNA is referred to as sample DNA (B1).

As adapters, a) sequencing primer, b) spacer sequence, c) restriction enzyme BspMI
A recognition sequence, and d) a protruding end consisting of 2 bases (X ₁ X ₂ )
DNA having the sequence shown in FIG. Here cohesive end sequence X ₁ X ₂ for 4 ^two ways, it means that there That ways 16, 16 types of adapters having respective protruding ends were prepared and the mixture with the adapter sample. Next, the adapter sample is added to the sample DNA (A1) or (B1), and T4DN
A ligation reaction (incubation at 16 ° C. for 2 hours) was performed using A ligase, and the sample DNA (A
The protruding end (X ₁ ) complementary to the sticky end of (1) or (B1)
An adapter with X ₂ ) was attached to the end of the sample DNA.

Next, the obtained sample DNA was washed, digested with EcoP15I (incubation at 37 ° C. for 2 hours), and the sample DNA (A1) or (B
The DNA fragment (a1) or (b1) was cut from 1), respectively. A cycle sequencing reaction is performed using the obtained sample as a template in the same manner as in Example 1, and sequencing can be performed using an automatic capillary electrophoresis sequencer. Specifically, since the sequence is determined using the fixed sequence of the adapter region of the cleaved DNA fragment as a primer, as shown in FIG. 7, in the sample DNA (A1), the sequence of the upper positive chain is 5 ′ → 3 ′. The sequence of the lower complementary strand of the sample DNA (B1) is determined in the 5 ′ → 3 ′ direction.

The base sequence of the sample DNA determined from the DNA fragment (a1) or (b1) was as follows.

A1: 5 ′ tcccaccgtcccagcgacccgatagca 3 ′ b1: 5 ′ gactgatgtctttggcggttatgggta 3 ′ On the other hand, the DNA fragment (a1) or (b1) corresponds to the immobilized sample DNA (2) (sample DNA (A) and (B)). And each immobilized sample (A2)
Or (B2). Regarding (2), the above-mentioned adapter sample was added again to carry out a ligation reaction, and a specific adapter having a complementary sequence at the free cohesive end was bound. After washing, this was treated with EcoP15I to separate the DNA fragment (a) from the sample (A2) or (B2).
2) or (b2) was recovered. Such a DNA fragment (a
The base sequence of the sample DNA determined from 2) or (b2) was as follows.

A2: 5'caatataaattcaactcatcaaaggta3 'b2: 5'tactgctgaaccggatctgagtgttcc3' As a result, the nucleotide sequence of the sample DNA (1) is 5'-ggaacactcagatccggttcagcagtacccataaccgccaaagaca
tcagtcccaccgtcccagcgacccgatagcaatataaattcaactcatca
aaggta-3 'was determined.

[0076]

Efficient DNA sequencing techniques are very important for the development of the biotechnology industry and for basic biological research. In the conventional DNA sequencing technology, it takes a lot of time and effort to prepare a subclone to be a template DNA for sequencing from a large clone, and automation is difficult. The DNA fragment excision method of the present invention is a method in which a DNA fragment having a predetermined base length can be sequentially excised from the end of a sample DNA by repeatedly using the same restriction enzyme and the same adapter. Therefore, it is suitable for automation,
By combining oligonucleotide sequencing techniques with DNA chips and mass spectrometers,
It is possible to automatically analyze the base sequence of a long chain DNA of b to several tens kb, preferably about 10 kb, more preferably 4 to 6 kb. Therefore, according to the present invention, DNA analysis can be performed more easily and quickly, and the efficiency of DNA analysis operation can be increased. Thus, the present invention can be applied not only to all fields based on DNA sequences, such as genetic diagnosis and criminal investigation, but also to wide-ranging human genomic DNA, which is currently being rapidly promoted.

[0077]

[Sequence List] <110> Takeo Satou: Director general, Agency of Industrial Science & Technology <120> Method for sequential cleavage of DNA and method for analysis of DN A using the same <130> 113M0181 <160> 6 <210> 1 <211> 44 <212> DNA <213> Spirulina <400> 1 ccatacgttg acctgcgatc atatctcgga agggttgaat atcc 44 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <400> 2 tcccaccgtc ccagcgaccc gatagca 27 <210 > 3 <211> 27 <212> DNA <213> Artificial Sequence <400> 3 gactgatgtc tttggcggtt atgggta 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <400> 4 caatataaat tcaactcatc aaaggta 27 <210 > 5 <211> 27 <212> DNA <213> Artificial Sequence <400> 5 tactgctgaa ccggatctga gtgttcc 27 <210> 6 <211> 102 <212> DNA <213> Spirulina <400> 6 ggaacactca gatccggttc agcagtaccc ataaccgcca aagacatcag tcccaccgt ccagcgaccc gatagcaata taaattcaac tcatcaaagg ta 102

[Brief description of the drawings]

FIG. 1 is a diagram showing a flowchart of Embodiment 1 of the present invention.

FIG. 2 is a view showing a cleavage mode of a restriction enzyme BspMI used in Example 1.

FIG. 3 is a view showing a base sequence of an adapter used in Example 1.

FIG. 4A shows a sample DN in Example 1.
A (D) obtained by cutting A (A) with a restriction enzyme
FIG. 3 shows the nucleotide sequence of NA fragment (a), and FIG.
DN obtained by cutting (B) with a restriction enzyme
It is a figure which shows the base sequence of A fragment (b).

FIG. 5 is a diagram showing a base sequence site determined in five cycles including Step 1 and Step 2 and a part of the sequence in Example 1.

FIG. 6 is a view showing a base sequence of an adapter used in Example 2.

FIG. 7 is a view showing a base sequence site determined in two cycles of Step 1 and Step 2 and a part of the sequence in Example 2.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission Date] July 16, 1999 (1999.7.1)
6)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Correction contents]

[Claims]

(1) A recognition site on DNA is cleaved at the other free end of a double-stranded sample DNA having one end immobilized.
A method for cutting out a DNA fragment, comprising a step of ligating an adapter having a recognition sequence of a restriction enzyme having a different site, and a step of (2) cutting the sample DNA with the restriction enzyme.

3. An adapter having an additional sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number of bases as the number of bases of the cohesive end of a DNA fragment generated by the restriction enzyme. The method according to claim 1, wherein the method comprises a salt tomb array.

4. The method according to claim 3 , wherein the additional sequence of the adapter has a sequence primer sequence.

5. A two adapter further comprises a label for immobilization
The method according to any one of claims 1 to 4 , which is a single-stranded DNA .

6. A DNA fragment according to claim 2, comprising centrifugal separation means, pipetting means, temperature control means, a solid support for immobilizing sample DNA, a reaction solution storage container, a washing solution storage container and a product storage container. Cyclic reactor used in the method.

7. The step (1) is an adapter having an additional sequence, a restriction enzyme recognition sequence and a protruding end, wherein the protruding end has the same number of bases n as the cohesive end of the DNA fragment generated by the restriction enzyme. And its base sequence is composed of all bases (A,
T, G, and C).
The method according to any one of claims 2 to 5 , wherein the method is performed by blending a mixture of ⁿ kinds of adapters into a sample DNA sample.

At the other free end of 8. (1) On the other hand the double-stranded immobilized end sample <br/> Le DNA, digestion and recognition site on DNA
Ligation of an adapter having a recognition sequence for a restriction enzyme having a different site , (2) cutting the sample DNA with the restriction enzyme, and (3) analyzing the nucleotide sequence of the DNA fragment cut out in the step. A method for analyzing DNA, comprising the steps of:

9. The according to claim 8 (1), (2) and (3)
A method for analyzing DNA, wherein the operation including the step of (1) is defined as a unit cycle and the cycle is repeated.

10. An adapter having an additional sequence having a sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end corresponds to the number of bases of the cohesive end of a DNA fragment generated by the restriction enzyme. 9. The method according to claim 8 , which comprises a base sequence having the same number of bases.
Is the method described in 9 .

Step of 11. (1) additional sequences having the sequence primer sequences, comprising an adapter having a recognition sequence and the protruding end of a restriction enzyme, identical to the cohesive ends of the DNA fragments resulting protruding ends by restriction enzyme claims carried out in having a base number n, by blending the base sequence full nucleotide (a, T, G, C ) a mixture of adapters 4 ⁿ types of all the combinations of the sample DNA in the sample 9. The method according to 9 .

12. The D according to claim 8, wherein
A reagent kit used for the NA analysis method, wherein at least a recognition site and a cleavage site on DNA are different from each other;
And an additional sequence having a sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number n of bases as the cohesive end of a DNA fragment generated by the restriction enzyme, and the base sequence is entirely Bases (A, T,
A reagent kit comprising an adapter sample consisting of a mixture of 4 ⁿ types of adapters consisting of all combinations of G and C).

D according to any one of claims 13] Claims 8 to 11
A DNA analyzer using the NA analysis method.

14. At least a plurality of reaction vessels, means for supplying a reagent or sample DNA to each reaction vessel, means for connecting an adapter to sample DNA, and sample D
14. The DN according to claim 13 , further comprising means for treating NA with a restriction enzyme, means for separating a cleaved DNA fragment, and means for analyzing the base sequence of the separated oligonucleotide.
A analyzer.

 ────────────────────────────────────────────────── ─── Continuing from the front page (72) Inventor Shinichi Yano 1-3-131 Midorioka, Ikeda-shi, Osaka F-term in Osaka Institute of Technology (reference) 4B024 AA20 HA09 HA19 4B029 AA07 AA23 BB20 CC03 FA15 4B063 QA13 QQ43 QQ44 QR14 QR20 QR32 QR62 QR82 QR84 QS03 QS16 QS25 QS28

Claims (17)

[Claims] 1. A step of connecting an adapter having a recognition sequence for a restriction enzyme to the other free end of a sample DNA having one end immobilized thereon, and a step of cutting the sample DNA with the restriction enzyme. A method for cutting out a DNA fragment, comprising: 2. A method for sequentially cutting out DNA fragments, wherein the operation including the steps (1) and (2) according to claim 1 is defined as a unit cycle and the cycle is repeated. 3. The method according to claim 1, wherein an enzyme having a recognition site and a cleavage site on DNA different from each other is used as the restriction enzyme. 4. The method according to claim 3, wherein the restriction enzyme is a type III or type IIs restriction enzyme. 5. The adapter according to claim 1, wherein the adapter has an additional sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number of bases as the number of bases of the cohesive end of the DNA fragment generated by the restriction enzyme. The method according to any one of claims 1 to 4, wherein the method comprises a base sequence. 6. The method according to claim 5, wherein the additional sequence of the adapter has a sequence primer sequence. 7. The method according to claim 1, wherein the adapter further has a label for immobilization. 8. A DNA fragment according to claim 2, comprising centrifugal separation means, pipetting means, temperature control means, a solid support for immobilizing sample DNA, a reaction solution storage container, a washing solution storage container and a product storage container. Cyclic reactor used in the method. 9. The step (1) is an adapter having an additional sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same base number n as the cohesive end of a DNA fragment generated by the restriction enzyme. And its base sequence is composed of all bases (A,
T, G, and C).
The method according to any one of claims 2 to 7, wherein the method is performed by blending a mixture of ⁿ kinds of adapters into a sample DNA sample. 10. A sample DNA having one end immobilized.
Binding an adapter having a recognition sequence for a restriction enzyme to the other free end of the above, (2) a step of cutting the sample DNA with the restriction enzyme, and (3) a base sequence of the DNA fragment cut out in the step. Analyzing, the DN
Analysis method of A. 11. A method for analyzing DNA, wherein the operation including the steps (1), (2) and (3) according to claim 10 is defined as a unit cycle and the cycle is repeated. 12. The method according to claim 10, wherein the restriction enzyme is a type III or type IIs restriction enzyme. 13. An adapter having an additional sequence having a sequence primer sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end corresponds to the number of bases of the cohesive end of a DNA fragment generated by the restriction enzyme. 11. The base sequence having the same number of bases.
13. The method according to any one of claims 1 to 12. 14. The step (1) is an adapter having an additional sequence having a sequence primer sequence, a recognition sequence of a restriction enzyme, and an adapter having a protruding end, wherein the protruding end is the same as the cohesive end of a DNA fragment generated by the restriction enzyme. Base number n
13. The method according to claim 11, wherein a mixture of 4 ⁿ types of adapters having a base sequence consisting of all combinations of all bases (A, T, G, C) is incorporated into a sample DNA sample. the method of. 15. A reagent kit for use in the DNA analysis method according to any one of claims 10 to 14, wherein the restriction enzyme has at least a recognition site and a cleavage site on DNA which are different from each other; and an addition having a sequence primer sequence. A sequence, a recognition sequence for a restriction enzyme, and a protruding end, wherein the protruding end has the same number of bases n as the cohesive end of the DNA fragment generated by the restriction enzyme, and the base sequence is composed of all bases (A
A reagent kit comprising an adapter sample consisting of a mixture of 4 ⁿ types of adapters consisting of all combinations of (T, G, C). 16. A DNA analyzer using the DNA analysis method according to claim 10. 17. At least a plurality of reaction vessels, means for supplying a reagent or sample DNA to each reaction vessel, means for connecting an adapter to the sample DNA, and sample D
17. The DN according to claim 16, further comprising means for treating NA with a restriction enzyme, means for separating the cleaved DNA fragment, and means for analyzing the base sequence of the separated oligonucleotide.
A analyzer.