JP2912423B2 - Novel gene conferring macrolide antibiotic resistance - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION <Industrial Application Field> The present invention relates to a DN containing a novel gene that confers at least macrolide antibiotic resistance, particularly mycinamicin resistance.
The present invention relates to an A fragment, a vector carrying the DNA fragment, and a transformant carrying the vector.

<Problems to be solved by the prior art and the invention> Mycinamicin is a micromonospora griseolivida.
A11725 is an antibiotic produced by the strain, and is composed of a 16-membered cyclic lactone and two sugar residues, represented as mycinamicin I, mycinamicin II (generic name: mipolamicin), mycinamicin III, mycinamicin IV and mycinamicin V. Ride antibiotic ("Jour
nal of Antibiotics "Vol.33 No.4, p.364-376,1980 ),
It is an antibiotic that has strong antibacterial activity against Gram-positive bacterial species, mycoplasma, and the like, by binding to bacterial ribosomes as a mechanism of action and causing protein synthesis inhibition.

For macrolide antibiotic-producing bacteria, elucidation of the biosynthetic genes of the substance has been promoted. Especially,
For two antibiotic-producing bacteria, tylosin and erythromycin, their self-resistance genes have been isolated. For tylosin, see tlrA (“International Symp
osium of Biology in Actinomyces '88 "Abstract p.365-37
0 ), tlrB (JP-A-62-294087), tlrC (JP-A-63-294087)
No. 36788) has been identified, and the existence of a group of biosynthetic genes near tlrB has been reported (JP-A-62-294087). One self-resistance gene has been identified for erythromycin, and the presence of a group of biosynthetic genes in the vicinity has been reported (“Gene 38 (1985) p . 103-1010 ).

However, for mycinamicin, a macrolide antibiotic of the same strain, the self-resistance gene of the producing strain has not yet been reported.

<Means for Solving the Problems> The inventors of the present invention have conducted intensive studies to solve the above problems, and found that genomic DNA of micromonospora griseorhida, a mycinamicin-producing bacterium, can be used to convert self-resistance genes for erythromycin and tylosin. Is completely different, clones a novel mycinamicin self-resistance gene DNA fragment comprising at least a gene conferring macrolide antibiotic resistance, allows the gene DNA fragment to be retained in a vector, and uses the vector as a host. We found that it is possible to express mycinamicin resistance as well as other macrolide antibiotic resistance by obtaining a transformant by culturing the transformant by retaining it in an actinomycete, for example, a microorganism belonging to the genus Streptomyces. Was.

In addition, by cloning this macrolide antibiotic self-resistance gene on a vector plasmid, the gene can be transferred into another strain using this cloning vector system, and other gene fragments having macrolide antibiotic resistance as an index can be obtained. It can also be used for cloning or selection of transformants using macrolide antibiotic resistance as an index, and by transforming various actinomycetes using this macrolide antibiotic self-resistance gene, macrolide antibiotic resistance can be obtained. It can be applied to the screening of novel antibiotics that are effective against bacteria, and furthermore, by using the nucleotide sequence of this macrolide antibiotic self-resistance gene to produce a synthetic probe, the DNA of the bacteria producing macrolide antibiotics can be obtained. Can be identified by the hybridization method, Increase in the yield of known materials, and have found that there are many useful applications for the purpose of development of new antibiotics and antibiotic derivatives.

Gives at least macrolide antibiotic resistance, about 2.
It has a restriction enzyme cleavage site shown in FIG. 1 having an 8 Kb DNA fragment, and contains the 5'-CGCAGTACT-3 'base sequence between the restriction enzyme sites SmaI-ScaI and 5'-GGCGCCCT.
A DNA fragment comprising the nucleotide sequence of G-3 'between the restriction enzyme sites Nar I and Sal I; a vector comprising the DNA fragment, wherein the vector DNA which is foreign to the host is And a transformant characterized in that the transformant is retained.

The DNA of the present invention is produced, for example, using a gene recombination technique as follows.

For example, having mycinamicin-producing ability, after separating and purifying the genomic DNA of the microorganism from a microorganism that is a donor of the mycinamicin resistance gene, the DNA was partially digested with a restriction enzyme or the like by a shotgun method, and cut. The linearized expression vector is ligated and closed at the blunt or cohesive ends of both DNAs with DNA ligase or the like. Subsequently, a microorganism carrying the recombinant DNA vector obtained by screening using the marker of the obtained recombinant DNA vector and / or mycinamicin resistance as an indicator is cultured, and the recombinant DNA vector is separated and purified from the cultured cells. Then, the DNA can be produced by collecting the DNA of the present invention imparting mycinamicin resistance from the recombinant DNA vector.

The donor microorganism of DNA has mycinamicin-producing ability,
Any microorganism that provides a mycinamicin resistance gene may be used, and preferred is Micromonospora griseorvida A 11725 (FERM BP-705) belonging to the genus Micromonospora.

DNA derived from a microorganism as a gene donor is collected as follows. For example, aeration and agitation culture is performed in a liquid medium for about 1 to 3 days, and the resulting culture is centrifuged to collect cells, and then lysed to prepare a lysate containing the mycinamicin resistance gene. As a lysis method, for example, treatment with a bacterium lysing enzyme such as lysozyme or achromopeptidase is performed, and other enzymes such as a protease or a surfactant such as sodium lauryl sulfate are used in combination, if necessary. Freezing and thawing or French pressing may be performed in combination with the lysis method described above. In order to separate and purify DNA from the lysate obtained in this manner, for example, protein removal treatment by phenol extraction, protease treatment,
It can be performed by appropriately combining methods such as ribonuclease treatment, alcohol precipitation, and centrifugation.

The method of cutting the separated and purified microbial DNA can be performed, for example, by sonication, treatment with a restriction enzyme, or the like.However, in order to facilitate the binding between the obtained DNA fragment and the vector, for example, by a shotgun method, , BamH I, N
It may be partially digested with restriction enzymes such as co I, Pst I, Sph I, etc.
Preferably, BamHI or PstI is suitable.

As a vector, a vector constructed for gene recombination from a phage or a plasmid capable of autonomous propagation in a host microorganism is suitable.

As a phage, for example, when Streptomyces lividans is used as a host microorganism, φC31 or the like can be used. When Escherichia coli is used as a host microorganism, λgt · λC, λgt · λB, or the like can be used.

As the plasmid, for example, when Streptomyces lividans is used as a host microorganism, pIJ41, pI
J922, pIJ702, pIJ680, pIJ364 and the like can be used, and preferably p
IJ41 and pIJ702. When Escherichia coli is used as a host microorganism, pUC118, pBR322, pBR325, pACYC18
4, pUC12, pUC13, pUC18, pUC19, etc. can be used, and preferably p
UC118. Furthermore, a shuttle vector that can autonomously propagate in cells of two or more host microorganisms such as Streptomyces lividans and Escherichia coli can also be used. Such a vector is preferably cleaved with the same restriction enzyme used for cutting the microbial DNA that is the mycinamicin resistance gene donor described above to obtain a vector fragment.

The method of binding the microbial DNA fragment to the vector fragment may be a method using a known DNA ligase.For example, after annealing the cohesive end of the microbial DNA fragment and the cohesive end of the vector fragment, a suitable DNA ligase is used. By the action, a recombinant DNA of the microorganism DNA and the vector fragment is produced. If necessary, after annealing, the DNA can be transferred to a host microorganism, and recombinant DNA can be prepared using in-vivo DNA ligase.

As the host microorganism, any microorganism can be used as long as the recombinant DNA can stably and autonomously proliferate and can express a trait of an exogenous DNA.For example, when the host microorganism is Streptomyces lividans belonging to actinomycetes. , Streptomyces lividans TK-24, Streptomyces lividans TK-23, Streptomyces lividans 1326, Streptomyces lividans TK-21 (all available from John Innes Institute, UK) Can be used, and it is particularly preferable to use Streptomyces lividans TK-24. When the host microorganism is Escherichia coli, Escherichia coli MV1304, Escherichia coli DH
1, Escherichia coli HB101, Escherichia coli W3110,
Escherichia coli C600 or the like can be used, and it is particularly preferable to use Escherichia coli MV1304.

As a method for transferring the recombinant DNA to the host microorganism, for example, when the host microorganism is a microorganism belonging to the genus Streptomyces, the transfer is performed in the presence of polyethylene glycol, and in the case of a microorganism belonging to the genus Escherichia, The transfer of the recombinant DNA may be performed in the presence of calcium ions.

Selection of the presence or absence of transfer of the target recombinant DNA to the host microorganism can be performed by searching for a marker of a vector which is a recombinant DNA carrying the target DNA fragment, preferably a drug resistance marker and / or a microorganism capable of expressing mycinamicin resistance. For example, it may be grown on a selective medium based on a drug resistance marker.

The recombinant DNA having the mycinamicin resistance gene once selected in this manner can be removed from the transformed microorganism and transferred to another host microorganism. Further, a DNA which is a mycinamicin resistance gene is cut out by cutting with a restriction enzyme or the like from the recombinant DNA holding the mycinamicin resistance gene, and ligated with another end of a closed vector obtained by cutting in a similar manner, Recombinant DNA with novel characteristics can also be created and transferred to other host microorganisms.

Specific examples of the transformant thus obtained include:
Micromonospora Grise Orvida A11725 (FERM BP
-705), a plasmid containing the gene encoding mycinamicin resistance was inserted into a plasmid pIJ41, and the plasmid pMCM4 was transferred to a host microorganism to obtain a transformed Streptomyces lividans TK-24 / pMCM4 strain "Micro Engineering Lab. No. 10783 (FERM P-10783).

The nucleotide sequence of the DNA of the present invention thus obtained is Science 2
14 1205-1210 (1981).

For example, a microorganism belonging to Micromonospora griseorbida is used as a mycinamicin resistance gene donor, and the nucleotide sequence of a gene in a plasmid obtained using Escherichia coli as a host microorganism is at least 5 ′.
Characterized in that it comprises the nucleotide sequence of -CGCAGTACT-3 ', 5'-GGCGCCCTG-3', and 5'-CGCAGTACT-
It is characterized in that the 3 'base sequence is contained between the restriction enzyme sites SmaI and ScaI and the 5'-GGCGCCCTG-3' base sequence is contained between the restriction enzyme sites NarI and SalI.

In further additional features, the nucleotide sequence between the restriction enzyme sites SmaI-ScaI and the restriction enzyme site Na
The nucleotide sequences between rI-SalI are as follows.

Further, based on the base sequence of the DNA fragment between the restriction enzyme sites NcoI and SphI of the present invention shown in FIG. 3-i and FIG. 3-ii, for example, the restriction enzyme map shown in FIG. The small fragment base sequence can be obtained by well-known techniques such as hydrolysis in an aqueous medium, preferably a buffer, using one or more appropriate restriction enzymes. The small fragment base sequence having at least the characteristic portion of the DNA conferring macrolide antibiotic resistance of the present invention thus obtained preferably has 10 to several tens of bases or more, and further has a complementary sequence thereof. These small fragments have utility that can be used as probes for the same or similar DNA.

Next, the culture form of the microorganism as the transformant may be selected by considering the nutritional and physiological properties of the culture, and usually, in many cases, liquid culture or industrially, deep aeration stirring culture is performed. Is advantageous. As the nutrient source of the medium, those commonly used for culturing microorganisms can be widely used. The carbon source may be any assimilable carbon compound, such as glucose, saccharose, lactose,
Maltose, fructose, molasses and the like are used. As a nitrogen source, any available nitrogen compound may be used. For example, heptone, meat extract, yeast extract, casein hydrolyzate and the like are used. In addition, phosphates, carbonates, sulfates,
Magnesium, calcium, potassium, iron, manganese,
Salts such as zinc, specific amino acids, specific vitamins and the like are used as necessary.

The culture temperature can be appropriately changed within a range in which the microorganism can grow and develop mycinamicin resistance. In the case of Streptomyces lividans, the culture temperature is preferably about 28 to 30 ° C.
The cultivation time varies somewhat depending on the conditions, but the cultivation may be terminated at an appropriate time in consideration of the time when the expression of mycinamicin resistance appears, and is usually about 48 to 72 hours. Culture medium
The pH can be appropriately changed within a range in which the bacteria can grow and develop mycinamicin resistance, but the pH is particularly preferably about 7.0 to 7.5.

A plasmid pMCM4 having a gene conferring mycinamicin resistance is isolated and purified from the culture of the transformant thus obtained, and the plasmid pMCM4 can be used for various purposes. For example, by cloning a DNA fragment containing the macrolide antibiotic self-resistance gene on a vector plasmid, the gene can be transferred into another strain using this cloning vector system, and the macrolide antibiotic resistance can be used as an index. It can also be used for cloning of gene fragments of or for selection of transformants using macrolide antibiotic resistance as an index.Furthermore, by transforming various actinomycetes using this macrolide antibiotic self-resistance gene, It can also be applied to screening for new antibiotics that are effective against ride antibiotic resistant bacteria. Furthermore, by using the base sequence of this macrolide antibiotic self-resistance gene to produce a synthetic probe, the DNA of the macrolide antibiotic-producing bacterium can be obtained.
Can also be identified by the hybridization method.

<Examples> Hereinafter, the present invention will be described specifically with reference to Examples, but the present invention is not limited thereto.

Example 1 [Preparation of genomic DNA derived from Micromonospora griseorvida A11725] Micromonospora griseorvida A11725 (FERM B
The freeze-dried bacterium of P-705) was seeded with 150 ml of a triangular corben using 30 ml of a seed medium [soluble starch 2 g, yeast extract 0.5 g, NZ amine 0.5 g, tryptocase 0.5 g, calcium carbonate 0.1 g, ferrous sulfate 2 mg, 10N NaOH 20μl, water 100ml,
[pH: 7.2] at 28 ° C. for 48 hours.

Thereafter, the main culture was used as a seed mother, and 100 ml of a culture solution (soluble starch 2.5 g, polypeptone 0.8 g, yeast extract 0.2 g, casamino acid 0.1
g, ferrous sulfate 2mg, magnesium sulfate 50mg, water 90ml, 1 / 10M
pH 7.0 phosphate buffer solution [10 ml] so that the inoculated bacterial mass was 5%, and cultured for 96 hours.

The cultured cells were centrifuged at 4,500 rpm for 20 minutes at 4 ° C.
The precipitate was washed with 50 ml of 0.3 M saccharose. Thereafter, the mixture was centrifuged again at 4 ° C. and 6,500 rpm for 20 minutes, and TES buffer [5
0 mM pH 8.0 Tris-HCl buffer (Sigma), 35 mM Na ₂ ED
TA, 25% saccharose], and add them so that the final concentration becomes 2 mg / ml for lysozyme and 1 mg / ml for achromopeptidase (manufactured by Wako Pure Chemical Industries, Ltd.), and react at 37 ° C. for 3 hours. Was. Then, 10% SDS (Sodium Dodecyl Sulfat
After 0.5 ml of e) was added, the mixture was allowed to stand at 37 ° C. for 5 minutes, and 21 ml of chloroform-phenol was added and stirred. Add this solution to 20
The mixture was centrifuged at 10,000 rpm for 3 minutes, the upper layer was placed in a 100 ml beaker, and 42 ml of ethanol was gently poured. Further, the chromosome DNA was wound up while stirring the solution with a sterilized thin glass rod to obtain a genomic DNA of Micromonospora griseorvida A11725 as a standard.

Example 2 [Isolation of plasmid pIJ41] (1). Streptomyces lividans TK-24 / pIJ
Inoculation of about 10 ⁸ Streptomyces lividans TK-24 / pIJ41 spores with 10 ml of TSB (tryptocase soyburose, Difco) containing 2 μg / ml thiostrepton,
The culture was grown at 28 ° C. until the culture reached early stationary phase. Next, 5 ml of this was used to inoculate 100 ml of TSB medium containing 2 μg / ml of thiostrepton, and cultured for 48 hours.

(2). Isolation of Plasmid The above cultured cells were collected and washed once with a 0.3 M sucrose solution. Then, 30 ml of a lysozyme solution [50 mM Tris-HCl buffer, 35 mM Na ₂ EDTA, 25% saccharose, lysozyme final concentration 1 mg / ml] was added. This solution was incubated at 30 ° C. for 60 minutes, then 500 μl of 10 N NaOH, 10% SDS
12 ml of a solution consisting of 2.5 ml and 9.5 ml of H ₂ O was added and mixed. After leaving this at 0 ° C. for 10 minutes, 5M potassium acetate buffer [5M
Potassium acetate 20 ml, acetic acid 3.8 ml, was added and mixed H ₂ O9.5ml]. After standing again at 0 ° C for 10 minutes, 4 ° C, 30,000rpm
For 40 minutes. The supernatant was collected, and an equal volume of a chloroform-phenol solution [a mixed solution of 500 ml of phenol and 500 ml of chloroform saturated with 10 mM Tris-HCl buffer and 1 mM of pH 8.0 Na ₂ EDTA] was added and mixed well. 6,500rp
After centrifugation at room temperature for 30 minutes, about 45 ml of the supernatant was transferred to a sterilized bottle. Then 90 ml of cold ethanol was added, and -11 was added.
The mixture was allowed to stand at 0 ° C for 20 minutes and centrifuged at 4 ° C at 6,500 rpm for 30 minutes. 7 ml of TE (10 mM Tris-HCl buffer,
1 mM Na ₂ EDTA), 2 mg / ml RNaseA (Sigma) solution was further added, and the mixture was incubated at 37 ° C. for 20 minutes. Next, 8 ml of a TE-phenol solution was added and mixed well, and then centrifuged at 10,000 rpm at room temperature for 10 minutes. Take the upper layer with a Pasteur pipette, add 16 ml of cold ethanol, leave at -110 ° C for 20 minutes, and then at 10,000 rpm and 4 ° C.
Centrifuge for 10 minutes, dry the precipitate under reduced pressure, add 19 ml of TE.
The DNA was dissolved. Thereto was added 2 ml of a solution containing 20 g of cesium chloride and 10 mg / ml of ethidium bromide, and the mixture was stirred. This solution was transferred to an ultracentrifuge tube and centrifuged at 50,000 rpm at 20 ° C. for 16 hours. Thereafter, the fraction containing the plasmid band was taken out with a sterilized syringe while irradiating with ultraviolet light. The fraction was treated with TE buffer and isopropanol for 5 to 5 minutes.
Extracted 6 times to remove ethidium bromide. Then, it was transferred to a dialysis tube and dialyzed overnight using TE as a dialysate. This procedure yielded about 100 μg of plasmid pIJ41 DNA, which was suspended at a concentration of 1 μg / ml in TE buffer and stored at 4 ° C.

Example 3 [Assembly of plasmid pMCM4] Approximately 5 µg of the genomic DNA of Micromonospora griseorbida obtained in Example 1 was ligated with a restriction enzyme BamHI (10 mM pH 8.0).
Tris-HCl buffer, 7 mM MgCl ₂ , 100 mM NaCl, 2 mM mercaptoethanol, 0.01% bovine serum albumin]. This digested gene was cloned into the BamHI site of plasmid pIJ41 by the following method.

First, plasmid pJI41 was added to 10 mM Tris-HCl buffer, 7 mM
pH8.0 Magnesium chloride, 100mM sodium chloride, 2mM2
-After complete digestion with the restriction enzyme BamHI in a reaction solution containing mercaptoethanol and 0.01% bovine serum albumin, bacterial alkaline phosphatase (manufactured by Toyobo Co., Ltd.) was added to the solution.
Five units were added and reacted at 65 ° C. for 1 hour. Then, treat twice with a chloroform-phenol solution, and dissolve 1 / 10th
Sodium acetate and two volumes of ethanol were added, and the mixture was centrifuged to recover a plasmid fragment. Next, the above BamH
Micromonospora griseolhida DN partially digested with I
The A fragment (4 to 15 kbp) was ligated with the BamH of the above plasmid pIJ41.
The site I was ligated using a ligation kit (Takara Shuzo). The recombinant plasmid obtained by the above operation was introduced into Streptomyces lividans TK-24 for transformation.

After regenerating until spores settle, mycinamicin II
The replica was replicated in a tryptocase soyager (TSA, manufactured by Difco) medium containing 400 μg / ml and thiostrepton 30 μg / ml to obtain a mycinamicin-resistant strain. When plasmids were prepared from this resistant strain, all plasmids were BamH
The plasmid contained an approximately 5 Kbp DNA fragment cut out by I, and these plasmids imparted mycinamicin resistance to Streptomyces lividans TK-24 by retransformation.

The thus obtained DNA fragment of about 5 Kbp was subcloned by safety digestion with BamHI and SphI, and the obtained DNA fragment of about 2.8 gKbp was recovered from a low-melting-point agarose gel [“Lab-Manual Gene Optics” Masami Muramatsu (Published by Maruzen Co., Ltd.) p.20-28]. About 2.8 Kbp restriction enzyme obtained
FIG. 1 shows a restriction map of the DNA fragment between BamHI and SphI.

On the other hand, after the plasmid pIJ41 was completely digested with BamHI and SphI, 0.5 units of bacterial alkaline phosphatase (manufactured by Toyobo Co., Ltd.) was added to 50 mM pH 8.0 Tris-HCl buffer, and reacted at 65 ° C. for 1 hour. Was. Then chloroform-
Treated twice with a phenol solution, added 1/10 dissolved 3M sodium acetate and 2 volumes of ethanol to the aqueous layer, centrifuged,
The plasmid was recovered.

Then, about 2.recovered from the low melting point agarose gel.
The 8 Kbp insert fragment and the plasmid pIJ41 completely digested with BamH I and Sph I were ligated using a ligation kit (Takara Shuzo). The thus obtained recombinant plasmid was designated as plasmid pMCM4, and this plasmid pMCM4 was used.
The restriction map of M4 is shown in FIG.

Example 4 [transformation into Streptomyces lividans TK-24] Streptomyces lividans TK-24 with Trypto Soy Broth (TSB, Difco Co.) to early stationary phase by approximately 10 ⁸ spores added to 10ml Grow at 28 ° C until reached. Next, 5 ml of this was used to inoculate 100 ml of TSB medium and cultured for 48 hours. Thereafter, after cooling and centrifuging at 4 ° C. and 6,500 rpm for 20 minutes, the precipitate was washed with 50 ml of 0.3 M sucrose, and a hypertonic phosphate buffer [25 mM trismethyl 2-aminoethanesulfonic acid was added to adjust the lysozyme to 1 mg / ml. , 25 mM CaCl ₂ , 0.0
5% KH ₂ PO ₄ , sucrose 103g, K ₂ SO ₄ 0.25g, MgCl ₂ · 6H
^{_{2 O 2.02g, * Trace Element Solution}} 2ml, H 2 O 800ml ] 4
The suspension was reacted at 30 ° C. for 100 minutes. ^* Composition of Trace Element Solution Thereafter, the bacterial suspension was filtered with sterilized glass wool, and the liquid passed through the glass wool was centrifuged at 1,300 rpm for 5 minutes. After the supernatant was again filtered through glass wool, 2,800 r
Centrifugation was performed for 10 minutes at pm, and protoplast cells were obtained from the sedimentation. This precipitation is performed using the above hypertonic phosphate buffer.
The suspension was suspended in 500 μl to obtain a protoplast solution of 2.4 × 10 ⁹ cells / ml.

A 50 μl aliquot of this protoplast solution was mixed with 10 μl of the plasmid pMCM4 obtained in Example 3, and sterilized 25%
500 μl of a polyethylene glycol solution (molecular weight: 1,000) was added and left at room temperature for 2 minutes. After another 2 minutes, 500 μl of hypertonic phosphate buffer was added and mixed, and the mixture was diluted. The MR0.3S medium (2% soluble starch, 0.75% meat, 0.5% polypeptone, 0.1% calcium carbonate, sulfate) was used as a regeneration medium. Ferrous iron 4mg, 0.5% magnesium chloride, 10.3% saccharose, ^*
Trace Element Solution 1ml, agar 2.2g, pH: 7.2) and 0.6
% Agar and a phosphate buffer (P-soft agar).

24 hours later, thiostrepton (final concentration 2μg / ml),
P-soft agar containing mycinamicin II (final concentration 100 μg / ml) was overlaid again and cultured at 30 ° C. for 5 days. The obtained transformant was cultured in 5 ml of TSB medium containing 2 μg / ml of thiostrepton and 100 μg / ml of mycinamicin II at 28 ° C. for 2 days, and 1 ml of the culture was collected by centrifugation.
The transformant obtained in this way is Streptomyces
Lividans (Streptomyces lividans) TK-24 / pMCM4
This was deposited with the Institute of Microbial Industry and Technology, National Institute of Advanced Industrial Science and Technology as Microbial Laboratories No. 10783 (FERM P-10783).

Then, 50 mM pH 8.0 Tris-HCl buffer containing 2 mg / ml lysozyme, 35 mM pH 8.0 Na ₂ EDTA, 25
After adding 0.2 ml of% sucrose and reacting at 37 ° C. for 60 minutes, 100 μl of 0.4N NaOH containing 25% SDS was added and mixed.
Then, this was left at 0 ° C. for 5 minutes, and then a potassium acetate solution [600 μl of 5M potassium acetate, 115 μl of acetic acid, 285 μl of water] 150
μl was added and left at 0 ° C. for 5 minutes. Then 15,000
After centrifugation at 5 rpm for 5 minutes, the supernatant was treated with an equal amount of chloroform-phenol, and the aqueous layer was washed with ether.
After 2 times treatment, add 2 volumes of ethanol.
Let stand for minutes. Thereafter, the precipitate was collected by centrifugation at 15,000 rpm for 15 minutes, and the precipitate was collected, washed with 75% ethanol, dried under reduced pressure, and the precipitate was dissolved in water containing 5 μg / ml RNaseA.
After complete digestion with Sph I, clones containing the insert were selected.

Example 5 [Experiment for imparting drug resistance to bases between NcoI-EcoRI sites between restriction enzyme sites Nco I-EcoR I] Using plasmid pMCM4 obtained in Example 3, after complete digestion with restriction enzyme EcoRI at 37 ° C for 1 hour, At 65 ° C
Treated for 30 minutes. Thereafter, the protruding ends were filled into the blunt ends with T4 DNA polymerase, and then
Digestion was completed at 7 ° C for 1 hour. This was treated twice with a chloroform-phenol solution, and 1/10 dissolved 3M sodium acetate and 2 volumes of ethanol were added to the aqueous layer, followed by centrifugation.
A bp DNA fragment was recovered from the low melting point agarose gel. On the other hand, after the plasmid pIJ702 was completely digested with EcoRV and NcoI, 0.5 units of vector alkaline phosphatase (manufactured by Toyobo Co., Ltd.) was added to 50 mM pH 8.0 Tris-HCl buffer, and reacted at 65 ° C. for 1 hour. Perform chloroform-phenol treatment twice, add 1/10 dissolved 3M sodium acetate and 2 volumes of ethanol to the aqueous layer, centrifuge, and perform EcoR
The plasmid pIJ702 completely digested with V and NcoI was recovered.

Next, about the obtained from the low melting point agarose gel
0.9 Kbp DNA fragment and pIJ7 completely digested with EcoRV and NcoI
02 was ligated using a ligation kit (Takara Shuzo). The recombinant plasmid thus obtained was transformed into Streptomyces lividans TK-24, and the degree of drug resistance of the transformant to macrolide antibiotics was examined. As in Lividans TK-24, macrolide antibiotic resistance expression did not occur.

Similarly, as a result of an experiment for imparting drug resistance to the base between the restriction enzyme site Sau 3A I and EcoR I, no macrolide antibiotic resistance was expressed.

Example 6 [Experiment for imparting drug resistance to base between EcoR I and Sph I restriction enzyme sites] In the same manner as in Example 5, the plasmid pMCM4 obtained in Example 3 was heated to 37 ° C with the restriction enzyme EcoR I. After digestion for 1 hour, the mixture was treated at 65 ° C. for 30 minutes. Then T4DN
Fill out the protruding end with A polymerase to make it blunt,
Thereafter, digestion was completed with the restriction enzyme Sph I at 37 ° C. for 1 hour.
This was treated twice with a chloroform-phenol solution, and 1 / 10-soluble 3M sodium acetate and 2-fold ethanol were added to the aqueous layer, followed by centrifugation. Then, a DNA fragment of about 1.0 Kbp was recovered from the low-melting point agarose gel. Was. On the other hand, plasmid pIJ702 was replaced with Ec
After complete digestion with oRV and Sph I, 0.5 units of bacterial alkaline phosphatase (manufactured by Toyobo Co., Ltd.) was added to 50 mM pH 8.0 Tris-HCl buffer, reacted at 65 ° C. for 1 hour, and then treated with chloroform-phenol for 2 hours. Done once, in the water layer
1 / 10-soluble 3M sodium acetate and 2 volumes of ethanol were added and centrifuged to collect plasmid pIJ702 completely digested with EcoRV and SphI.

Next, about the obtained from the low melting point agarose gel
A 1.0 Kbp DNA fragment and pI completely digested with the above EcoRV and SphI
J702 was linked using a ligation kit (Takara Shuzo). The recombinant plasmid thus obtained was transformed into Streptomyces lividans TK-24, and the degree of drug resistance of the transformant to macrolide antibiotics was examined. As in Lividans TK-24, resistance expression did not occur.

In the same manner, as a result of an experiment for imparting drug resistance to the base between the restriction enzyme sites EcoR I and Pvu II, microlide antibiotic resistance expression did not occur.

Example 7 [Determination of base sequence] (1). Recombination into plasmid pUC118 and transformation into Escherichia coli The approximately 2.8 Kbp BamHI-SphI restriction fragment obtained in Example 3 was cloned into the BamHI-SphI site of vector pUC118 as follows: Escherichia coli MV1304 was transformed.

First, an insert fragment of about 2.8 Kbp obtained by completely digesting pIJ41 with BamH I and Sph I was recovered from low melting point agarose.
Further, after the plasmid pUC118 was completely digested with BamH I and Sph I, 0.5 units of bacterial alkaline phosphatase was added to 50 mM pH 8.0 Tris-HCl buffer and reacted at 65 ° C. for 1 hour. After treating twice with a chloroform-phenol solution, 1/10 volume of 3M sodium acetate and 2 volumes of ethanol were added to the aqueous layer, and the mixture was centrifuged to recover the plasmid.

The insert fragment recovered from the gel and the plasmid pUC118 digested with BamH I and Sph I were ligated using a ligation kit. 100 ml of Ψ medium (1 g of bactotryptone, 5 g of vectoro extract, MgS
O _4, pH: harvested Escherichia coli MV1304 logarithmic growth phase cultured in 7.6), ice-cold buffer [potassium 30mM acetate _{40ml, 100mM RbCl, 10mM CaCl 2} , 50mM MnCl 2, 15% glycerol, pH : 5.8], allowed to stand at 0 ° C for 5 minutes, centrifuged, collected, and further 4 ml of 10 mM MOPS buffer (manufactured by Dotite) [5 mM CaCl ₂ , 10 mM RbCl, 15% glycerin, pH: 6.
5] and left at 0 ° C. for 15 minutes to obtain competent cells. 20 μl of the ligated DNA solution was added to 200 μl of the Escherichia coli suspension, and the mixture was allowed to stand at 0 ° C. for 30 minutes. Then heat-treated at 42 ° C for 90 seconds,
800 μl was added and incubated at 31 ° C. for 90 minutes.
300 μl of this was mixed with 50 μg / ml ampicillin, 0.02% X-ga
l (5-bromo-4-chloro-3-indolyl-β-galactoside) and 50 μM IPTG (isopropyl-β-D
-Thio-galactopyranoside) on an LB medium agar plate and cultured overnight to obtain a transformant.

A single transformed white colony was cultured overnight in 2 ml of LB medium and collected by centrifugation. 50 mM pH 8.0 Tris-HCl containing 1 mg / ml lysozyme, 50 mM pH 8.0 Na ₂ E
Add 0.6 ml of a solution consisting of DTA and 15% saccharose, and add
After 15 minutes of reaction at room temperature, 12 μl of 10% SDS was added and mixed, 60 μl of 5M potassium acetate was added, and the mixture was allowed to stand at 0 ° C. for 30 minutes. Then, after centrifugation at 10,000 rpm for 15 minutes, the supernatant was treated with an equal amount of chloroform-phenol, the aqueous layer was treated with ether, and twice the volume of ethanol was added, and the mixture was left at -70 ° C for 15 minutes. did. Thereafter, the precipitate was collected by centrifugation at 15,000 rpm for 15 minutes, washed twice with 75% ethanol, and dried under reduced pressure. The precipitate was dissolved in water containing 5 μg / ml RNaseA, digested with BamHI and SphI, and clones containing the insert were selected.

(2). Determination of nucleotide sequence 6 ml single colony containing the clone thus obtained
After overnight culture at 37 ° C in LB medium, 5 ml of the
The cells were inoculated into LB medium and cultured at 37 ° C. For bacterial solution in logarithmic growth phase
Chloramphenicol at 150 μg / ml was added, and the cells were further cultured overnight. The cells were collected by centrifugation at 6,000 rpm for 10 minutes, lysozyme was added to 10% saccharose 20 ml, 25 mM Na ₂ EDTA, 50 mM pH 8.0 Tris-HCl to a final concentration of 20 mg / ml, and the mixture was added at 37 ° C. for 10 minutes. After the reaction, add 2 ml of 10% SDS, and add
For 2 minutes. After centrifugation at 14,000 rpm for 30 minutes, the supernatant was treated with an equal volume of chloroform-phenol, and the aqueous layer was added with 1/10 volume of 3M sodium acetate and 2 volumes of ethanol, and the mixture was heated to -70 ° C. And left for 15 minutes. 3,000rpm
After 15 minutes of centrifugation at 21 ° C., 21 ml of Tris-
Hydrochloric acid (pH 7.4) was added for dissolution, 20 g of cesium chloride and 1 ml of ethidium bromide were added, and the mixture was centrifuged at 4 ° C and 50,000 rpm overnight. Then, the closed circular plasmid DNA is collected,
Extraction was performed 5 times with isopropanol to remove ethidium bromide. Thereafter, cesium chloride was removed by dialysis, and twice the volume of ethanol was added, and the mixture was left at -70 ° C for 15 minutes. 3,
After centrifugation at 000 rpm for 30 minutes, the precipitate was washed twice with 75% ethanol, dried under reduced pressure, and adjusted to a concentration of about 1 μg / μl.

From the obtained plasmid, a single strand of both positive and negative strands over a region between the restriction enzyme sites NcoI and SphI of about 2.2 Kbp.
DNA was prepared and the dioxy method using M13 (Science, 214, 12
05-1210 (1981)] to analyze the base sequence.
The determination was made as shown in Fig. i and Fig. 3-ii. As a result, the gene DNA of the present invention contains at least the restriction enzyme EcoR I site GAATT
C in the middle basin and at least 5'-CGCAG upstream
Including the nucleotide sequence of TACT-3 ', downstream 5'-GGCGCCCT
Characterized in that it contains the base sequence of G-3 ',
-The base sequence of CGCAGTACT-3 'was changed to the restriction enzyme site Sma I-
It had a feature that it contained between Sca I and the 5'-GGCGCCCTG-3 'nucleotide sequence between the restriction enzyme sites Nar I and Sal I.

The characteristics of the nucleotide sequence between the restriction enzyme sites Sma I and Sca I and the nucleotide sequence between the restriction enzyme sites Nar I and Sal I were as follows.

The open reading frame of the gene DNA of the present invention was as shown in FIG.

Example 7 [Drug resistance test of Micromonospora griseorvida A11725, Streptomyces lividans TK-24, and transformant Streptomyces lividans TK-24 / pMCM4] Micromonospora griseorvida, donor microorganism
A11725, the host cell Streptomyces lividans TK-24 and the transformant Streptomyces lividans TK-24 / pMCM4 obtained in Example 4 were examined for drug resistance to various macrolide agents.

20ml tryptic case soy agar (TSA, Difco)
Put in a Petri dish and add the macrolide antibiotic mycinamicin II (a component of mycinamicin), josamycin, erythromycin, and thiostrepton at 10 μg / ml
The medium was prepared by changing the concentration up to 500 μg / ml.

This Petri dish has Micro Monospora Grise Orvida
A11725, Streptomyces lividans TK-24 and Streptomyces lividans TK-24 / pMCM4, a cryopreserved bacterium at -70 ° C, were coated with a platinum loop and cultured at 28 ° C for 48 hours. The minimum suppressed concentration was defined as the degree of resistance, and is shown in Table 1.

<Effects of the Invention> The macrolide antibiotic resistance gene of the present invention is obtained by cloning this macrolide antibiotic self-resistance gene on a vector plasmid, and using this cloning vector system to transfer the gene into other bacterial species, It can also be used for cloning other gene fragments using macrolide antibiotic resistance as an index, or for selecting transformants using macrolide resistance as an index. Furthermore, various actinomycetes can be used using this macrolide antibiotic self-resistance gene. Can be applied to the screening of new antibiotics that are effective against macrolide antibiotic-resistant bacteria, and furthermore, use the nucleotide sequence of this macrolide antibiotic self-resistance gene to produce synthetic probes This allows the DNA of bacteria producing macrolide antibiotics to be hybridized. To enable identification by the
It provides many useful uses for increasing the yield of known substances and for developing new antibiotics and antibiotic derivatives.

[Brief description of the drawings]

FIG. 1 shows a restriction map of a DNA fragment between the restriction enzymes BamHI and SphI. FIG. 2 shows the physicochemical properties of plasmid pMCM4. Figures 3-i and 3-ii show restriction enzymes
The nucleotide sequence between NcoI and SphI is shown. FIG. 4 shows an open reading frame.

──────────────────────────────────────────────────続 き Continuing on the front page (51) Int.Cl. ⁶ identification code FI C12R 1: 465) Examiner Kazuyuki Yoshizumi (58) Investigated field (Int.Cl. ⁶ , DB name) C12N 15 / 65,15 / 76,1 / 21 CA (STN) REGISTRY (STN) DDBJ, GENBANK, EMBL GENESEQ

Claims (9)

(57) [Claims] (1) It confers at least macrolide antibiotic resistance, has a restriction enzyme cleavage site shown in FIG. 1 having a DNA fragment of about 2.8 Kb, and has a 5'-CGCAGTACT-3 'base sequence. Included between restriction sites Sma I and Sca I, 5 '
The nucleotide sequence of -GGCGCCCTG-3 'was changed to the restriction enzyme site Nar I-
A DNA fragment that is contained between Sal I. 2. The nucleotide sequence between the restriction enzyme sites Sma I and Sca I is CCCGGGCCGGCGCGGCCGTCTGCGACACCTGGGGCCGGTTGCCG.
CTGGCCGATGCCACGGTCGCAGTACT and restriction enzyme site Na
The base sequence between rI-SalI is GGCGCCCTGCTCGTGGTGACAC
CGACCGCCGAACACCTGGTCGAGCTGGTGGACCGGCTGGGGCTGCTGCGG
2. The DNA fragment according to claim 1, which is GTCGAC. 3. The DNA fragment according to claim 1, wherein the gene conferring macrolide antibiotic resistance is a gene conferring mycinamicin resistance. [4] a vector, which carries the DNA fragment of [1]; [5] a transformant, which comprises the vector DNA according to [4], which is exogenous to a host; 6. The transformant according to claim 5, wherein the host is a microorganism belonging to actinomycetes. 7. The transformant according to claim 6, wherein the actinomycete is a microorganism belonging to the genus Streptomyces. 8. The transformant according to claim 7, wherein the microorganism belonging to the genus Streptomyces is a microorganism belonging to Streptomyces lividans. 9. The microorganism belonging to Streptomyces lividans, wherein the microorganism belongs to Streptomyces lividans.
The transformant according to claim 8, which is "yces lividans) TK-24 / pMCM4" Microorganism accession number: No. 10783, FERM P-10783 ".