JP2739892B2 - Recombinant DNA molecule encoding active human TPA - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] [0001] The present invention relates to the production of therapeutic proteins.
For the application of recombinant DNA technology for
Human tissue plasminogen activator (mT
PA) application of recombinant DNA technology for the production of
You. [0002] BACKGROUND OF THE INVENTION Rijken et al .; Bioc.
him. Biophys. Acta, 580, 140
(1979) describes human tissue plasmid from human uterine tissue.
Reported partial purification of nogen activator (uTPA)
doing. This activator is a single-chain zymogen enzyme
And activated by plasmin in the blood,
Activated to 2-chain form to dissolve thrombus. Therefore, T
PA is used in and around the heart for various vascular diseases, etc.
Suffer from myocardial infarction and deep vein thrombosis resulting from thrombus
Useful as a therapeutic composition to dissolve blood clots in
You. A cancer cell line (Bowes melano)
ma) obtaining mRNA from cells using DNA recombination technology;
And the mRNA encodes the mRNA
The use of sTPA in production is described by Goedd.
el) et al. in European Patent Application No. 0093619.
It is listed. [0004] SUMMARY OF THE INVENTION
Generally, the present invention encodes active human TPA
A natural TPA-encoding DNA molecule is a natural DNA
N-linked carbohydrate recognition sequence Asn-X- (Ser
Or Thr) Asn, Ser or Th encoding
r Codons encoding another amino acid instead of one
In the carbohydrate recognition sequence of TPA
The difference is in preventing the carbohydrate moiety from binding to TPA.
You. In a preferred embodiment, the carbohydrate recognition sequence is
The row is the carbohydrate recognition sequence closest to the carboxy terminus of TPA.
Sequence or two such modified sequences
Ie, the sequence closest to the amino terminus of TPA and
And the middle sequence. Preferably, a modified carbohydrate
In the recognition sequence, non-Asn codons such as glutamine
The don replaces the Asn codon. [0006] The recombinant DNA molecule of the present invention is replicable.
Carried by an expression vector, which is a host mammal
When cells are infected, D encoding active human TPA
Said activity expressing an NA sequence and being expressed in a host cell
Human TPA is the TPA-linked N-linked of native human TPA.
Lacking one or more carbohydrate moieties
You. The modified TPA of the present invention is a pharmaceutically acceptable carrier.
It can be mixed with body material to produce a thrombolytic therapeutic composition.
You. The mTPA of the present invention is a mammalian cell culture solution.
First, in a method that can be applied to any TPA,
Initiation chromatography followed by mTPA anti-T
Affinity chromatography binding to PA antibody
Can be purified in the step of applying [0008] BEST MODE FOR CARRYING OUT THE INVENTION
Details will be described below. [0009]Synthesis of human uterine TPA cDNA The DNA molecules of the present invention are site specific for uTPA cDNA.
It was created by mutagenesis (mutagenesis). So
CDNA encoding human uterine TPA in the next step
More manufactured and cloned: 1) isolating total mRNA from human uterine tissue; 2) Enrich uTPA mRNA from this total mRNA
Do; 3) cDNA is synthesized from TPA mRNA and 3′c
Obtain a DNA sequence and a 5 'cDNA sequence; 4) Join the 5 'and 3' cDNA sequences to
Obtain the complete cDNA sequence in the rasmid vector. [0010]Isolation of uTPA mRNA MRNA from human uterine tissue is isolated as follows.
Was. About 30 g of human uterine tissue was
Anate, 1M2-mercaptoethanol, 50mM vinegar
Sodium acid (pH 5.0) and 1 mM EDTA
In 40 ml of the containing guanidine thiocyanate solution,
The cells were disrupted using a tissue homogenizer. Next, homogene
1 g of CsCl was added per 1 ml of the mixture, and the homogenate was added to 3 ml.
Centrifuged at 000 rpm for 10 minutes. The supernatant is 50m
50 mM sodium acetate (pH 5.0) in a centrifuge tube;
1 mM EDTA, and 1.592 g CsCl / m
over 15 ml of CsCl cushion containing 1 l solvent
And centrifuged at 45,000 rpm at 20 ° C. for 24 hours.
did. The white band containing RNA was recovered and this Cs
Dilute the Cl solution 3 times with water to precipitate RNA
At -20 ° C was added twice the amount of ethanol. Centrifuge the precipitate
Was collected. Repeated dissolution and precipitation to mix CsCl
Was sufficiently removed. About 11 mg of purified RNA was recovered
Was. [0011] The purified RNA was prepared by adding a high salt buffer (10 mM
Tris (pH 8.0), 0.5 M NaCl and 0.2
% Sodium dodecyl sulfate)
Through an affinity column containing 1 ml of
Concentrate with ethanol precipitation and add 0.1 M Tris HCl (pH
7.5) 300 μl, 1 mM EDTA, 1% dodecyl
Add sodium sulfate and 50% formamide to SW41
Obtained during the tube. Tube 35,000 rpm at 15 ° C
m, and centrifuged for 16 hours. Collected separately for fractions
And the size of the RNA in each fraction^ThreeH-labeled
Determined by 4S, 18S and 28S standard markers
Was. The fraction containing TPA mRNA is
Northern blotting
ting) analysis³²Identification using a P-labeled probe
These fractions were pooled together. mRNA
For recovery, an equal volume of 0.4 M NaO
Ac, pH5 was added for dilution, and the gradient solution after dilution was diluted.
The liquid was precipitated by adding 2.5 volumes of ethanol. Dissolution
And the precipitation procedure is repeated until the recovered RNA
The remaining formamide was also removed. [0013]Production of 3 'sequence of uTPA cDNA The first strand of uTPA cDNA is as follows:
Produced from the isolated mRNA. RNA 50m
M Tris HCl, pH 8.3, 50 mM KCl, 8 m
M MgCl_Two , Each 1 mM dATP, dCTP, d
GTP and dTTP, 25 μg / ml oligo-dT
_12-18 , 50 μ / ml actinomycin D, 30 mM
2-mercaptoethanol, 0.5 mCi / ml (α³²
P] dCTP, 50 units of RNasin and 40 units
At 37 ° C. in a total volume of 50 μl with AMV reverse transcriptase
Incubated for 1 hour. Reaction is 20 mM EDTA
The addition was terminated. The reaction mixture is then added to 10 mM
Tris-HCl (pH 8.0), 1 mM EDTA,
And 0.1% sodium dodecyl sulfate.
E. 50 μg E. coli tRNA for preliminary chromatography
To the Sephadex G-100 column which performed raffy
Attached. [0014] Including m-RNA-cDNA hybrid
Fractions were pooled and precipitated by adding ethanol.
I let you. The recovered hybrid is subjected to 0.5N for several hours at 37 ° C.
  Treat with NaOH, neutralize with glacial acetic acid, then ethanol
And precipitated. The nucleotide triphosphate is used as follows.
This was removed by high salt-ethanol precipitation. DNA
Was first dissolved in 20-50 μl of water and an equal volume of 4 M acetic acid
Ammonium was added. Add 2 volumes of ethanol-
Leave at 70 ° C. overnight. Return the temperature of the solution to room temperature.
A DNA pellet was obtained by centrifugation. Repeat this operation twice more
Repeat, then wash the pellet once with 70% ethanol
Thus, most of the 3 'end of the TPA gene is represented.
The purified cDNA first strand was obtained. The first strand of the cDNA was
EPES buffer (pH 6.9), 10 mM MgCl
_Two , 2mM DTT, 70mM KCl, 0.5m each
M contains dATP, dCTP, dGTP, dTTP
Of cDNA second strand in a total volume of 100 μl
Used for The DNA polymerase-Kleno is added to this mixture.
20 units of fragment were added at 15 ° C. for 20 hours. DN
A: 1: 1 (v / v) phenol and chloroform
Extracted with the mixture and precipitated with ethanol. The double-stranded cDNA is digested with S1 nuclease.
A total volume of 100 μl for processing to remove hairpin structures
30 mM NaOAc (pH 4.4) in 0.3 M
NaCl, 4.5 mM ZnCl, and 50 units of S
Placed in a solution containing 1 nuclease at room temperature for 30 minutes. Anti
To stop the reaction, add EDTA and 1M Tris HCl (p
H8.0) were added to a final concentration of 10 mM and 0.1 mM, respectively.
1M. The DNA was phenol-chloro as described above.
Repeated form extraction and ethanol precipitation at high salt concentration
And purified. The purified double-stranded cDNA sequence is as follows:
And cloned. First, 60 mM was added to the double-stranded cDNA.
Cacodylic acid-0.14 M Tris (pH 7.6), 1 mM
Dithiothreitol, 0.1 mM dCTP, and
0.2 μCi / μl [^ThreeH] 100 μm including dCTP
In one reaction, oligo-dC was tailed. 10m
M CoCl_Two Was added to a final concentration of 1 mM, and 50
15 ° C per unit of terminal deoxytransferase
For 10 minutes. EDTA 1 to stop the reaction
0 mM, 0.1% sodium dodecyl sulfate, and add water
Diluted 2-fold. The reaction mixture is then charged to an agarose gel.
500 bp or longer cD after electrophoresis
NA was recovered from the gel. The oligo-dC tailed cDNA
Was previously linearized with PstI and an oligo-dG tail was added.
In order to anneal to the pBR322 DNA.
15 mM Tris HCl (pH 7.5), 5
In a solution containing 0 mM NaCl and 1 mM EDTA
At 65 ° C for 10 minutes and then at 42 ° C for 2 hours. A
Neiled DNA is pre-CaCl_Two Processed and frozen
Competent E.E. coli (MC10
61) Used to transform cells. Cells and DNA
The mixture was left on ice for 20 minutes and heated at 37 ° C for 7 minutes.
, Followed by 3 with 20 volumes of L-broth.
Incubate at 7 ° C. for 45 minutes and add 15 μg / m
plate on an L-plate containing 1 liter of tetracycline.
I did it. [0020] The recombinant clone is transformed into nitrocellulose
And one set of filters is tetracycline
Surviving clones were stored on plates. replica
The second set of filters containing the recombinant clones
Place on chloramphenicol plate at 37 ° C overnight
Plasmid amplification was performed. Process the filter and D
The NA was exposed. Prehybridization of filters
Is 50% formamide, 3X SSC, 5X den
Heart liquid, 0.1% sodium dodecyl sulfate, and 1
E. 00 μg / ml. in a solution containing E. coli tRNA
At 42 ° C. for 2 hours or longer. This
TPA cDNA in prehybridization solution
Have an array³²Add P-labeled probe and on filter
(42 ° C., 18 hours or less)
Up). Filters were then placed in 3X SSC for 4 hours at 65 ° C.
Wash with 0.1% SDS for 30 minutes and again 3XSS
C for 30 minutes at room temperature. Air dry the filter
Kodak XAR-5 X-ray using intensifying screen
The film was exposed at -70 ° C for 16 hours. Next, 10 candidate positive clones were isolated.
Subcloned and screened again as described above.
I did it. Repeat only positive clones
And analyzed by restriction endonuclease cleavage. p
The clone named UPA327 has the largest cDN
A insert (2.15 kb) was included. [0022]Preparation of 5 'sequence of uTPA cDNA The full coding sequence of uTPA even for the largest cDNA clones
Was isolated, the lost 5 'sequence was isolated.
The following method was used to do this. Do not choose a size
The mRNA was isolated as described above, except for the differences. Continued
The first cDNA was obtained by the primer extension method shown below.
The strand was synthesized. 80% formaldehyde in 100 μl
Mid, 10 mM PIPES buffer (pH 6.4),
0.4 M NaCl, 0.25 μg of 72 bp fragment
And a reaction mixture containing 70 μg of mRNA
And TPA, cDNA (nucleotides 552-624)
The 72 bp PstI fragment of
Annealed. Heat the mixture at 85 ° C. for 5 minutes and
Incubate at 0 ° C for 20 hours to hybridize
Was performed. Recovery of DNA-RNA hybrids is slow.
The buffer solution was diluted three times with water, and ethanol precipitated at -20 ° C overnight.
Performed with settling. Repeat the mRNA dissolution and precipitation procedure.
Repeatedly to remove contaminant components. First strand cDNA
The conditions for the synthesis were the 3 'sequence except that oligo-dT was omitted.
The same conditions were used. The synthesis of the second strand cDNA is carried out by DNA
Primer for polymerase I-Klenow fragment
Synthetic pentadecamer as (nucleotide 1-15)
(CTGTGA AGC AAT CAT)
became. 50 mM HEPES buffer in 100 μl
(PH 6.9), 10 mM MgCl_Two , And 70m
500 ng of pentadecamer in MKCl
At 65 ° C to anneal with one strand cDNA
5 minutes, 65 ° C to 43 ° C for 15 minutes, 43 ° C for 15 minutes
The mixture was kept on ice until use. Double
The strand cDNA is substantially the same as described above for the 3 'sequence.
And cloned as described above. On a plate, the screening and
After subcloning, a clone named pUPA432
Identified the loan. This clone has been lost 5 '
Clone pUPA372 and 60 bp containing coding sequence
Had overlapping portions. [0025]Production of full-length uTPA cDNA Encodes the full length human uterine TPA gene. cDNA cDNA
Prior to producing the loan, 5 'and 3' of the gene
Portions were sequenced. For this, clone pUPA4
32 (5 'coding sequence) and pUPA372 (3'
Maxam-Gilbert Chemical Degradation
Method and Sanger dideoxynucleotide chain
The analysis was performed in combination with the termination method. Got
The nucleotide sequence is shown in FIGS. After the sequence of the gene was determined, FIGS.
The complete cDNA gene was produced as described in
Was. Plasmid pUPA432 (5 'sequence) was first
Digested with a combination of glI and BglII. Polyak
400 bp BglI-BglII from Lilamide gel
Isolate the fragment and partially with HaeIII
Digested. The obtained BglII-HaeIII fragment
(Nucleotide 117-387)
Purified by electrophoresis on a midgel. Fragment Pst
I-NarI (nucleotides 321-448) is Pst
Combination of digestion of I and NarI followed by gel
Isolated by electrophoresis. This fragment is further transformed into Hae
And digested with 61 bp HaeIII-NarI
A fragmentation occurred. BglII-HaeIII
Fragments and HaeIII-NarI fragments
Were directly digested with a combination of BamHI and NarI digestion.
It was cloned into linearized pBR322. Obtained
Loan (named pUPA-BglII / NarI)
From the BglII-NarI fragment (nucleotide
117-448) and larger BglII
-The SalI fragment was isolated. Plasmid pUPA372 was digested with BglII.
Digest and form blunt ends with DNA polymerase I
And a SalI linker was added, followed by E. coli. in E. coli
Cloning to generate pUPA372-SalI
Thus, the nucleoside of the plasmid pUPA372
Convert the BglII site of Pide 2091 to a SalI site
Was. Subsequently, pUPA372-SalI was replaced with NarI and
Cleavage with a double digestion of SalI, NarI-SalI
Fragment (nucleotides 448-2091)
Was. Next, the GC tail is obtained from pUPA432.
By removing and introducing a SalI site, the uterine TP
Genetic processing was added to the leader sequence of A cDNA.
Was. The introduction of this SalI site was achieved by c
DNA is isolated and cleaved with SfaN1 in the 5 'untranslated region
To form blunt ends with DNA polymerase I,
The allI linker was added and the SalI and BglII pair
And digested directly with double digestion with BamHI and SalI.
Cloning into the linearized pBR322 vector
This was done by This genetically engineered uterine TPA Lee
In a combination of XhoII and SalI digestion.
Cut from the jar. This SalI-BglII flag
Fragment (nucleotides 7-117) with BglII-
NarI, NarI-SalI and BglII-Sa
The fragments of lI are formed by ligating as described above.
SalI-BglII fragment (nucleotide 1)
17-2091). Both SalI sites
The full-length uterine TPA gene at the end, and then pUC9 vector
At the SalI site. See Figures 4 and 5
Teru. This pUC9-uTPA plasmid was subsequently
Used for production of recombinant DNA encoding mTPA. [0030]Production of mTPA DNA In FIG. 9, native human uTPA has three of its molecules.
Asparagine residues at positions 120, 187 and 451
N-glycosylated (these positions are
Amino terminal glycine residue next to the carboxy terminus of the sequence
1 to 3, and 114, 181 and FIGS.
And 445 positions, respectively. In FIGS. 1 to 3,
The position immediately following the three-leader cleavage site is designated as position 1.
You. ). The recognition sequence for N-linked glycosylation is Asn-
X- (Ser or Thr). One of these positions
To prevent glycosylation in one or more
We have identified glycosylation recognition of uTPA cDNA.
AAC or AAT encoding asparagine in the sequence
Place the codon at the CAA codon (encoding glutamine)
The method of changing was adopted. As detailed below, these
Mutant sites (A, B and C in FIG. 9)
In vitro site-specific using matched primers
Created by Mutagenesis: (A) For mutant position A, TCGGTGACTGTTCTTTTGAAGTAA AGTTTGT (B) For the mutant position B, CAACGCCGCTGCTTTGCCAGTTTGGT GCA (C) For the mutant position C, GTAGGCTGACCCTTGCCCAAAGT AGCA Using mutant A single-stranded DNA as a template,
Mutants AB, AC and ABC are also manufactured, respectively.
Was. Finally, mutants B and C are recombined and muted.
Tanto BC was obtained. All seven possible non-
Alternatively, make a partially glycosylated human TPA mutant
Built. Mutants A, B, and C are muted
The Gln codon in place of the Asn codon
Mean that it is otherwise identical to natural DNA
There is thus mutant AB at sites A and B
Has n codons. Gln was used for convenience only.
And other non-Asn codons can be used as well. Ma
Also, instead of replacing the Asn codon,
The Ser or Thr codon two downstream from the other
Substituting don, eg Gln, for similar results
Can be. [0031]Site-specific mutagenesis In vitro site-specific mutagenesis is the first
Miss et al., Gene, 8, 81-87, 99-106 (1
979) by modifying the method as follows:
I did it. The above-mentioned mismatched oligonucleotide group
The primer is applied to the Applied Biosystem
Muzu (Applied Biosystems)
It was synthesized using a synthesizing apparatus. As shown in FIG. 6, human uterine TPA is
The encoding DNA (described above) was transferred to phage M13mp18
[Pharmacia or Newey
Ngrand Biolabs (New England)
Biolabs).
Was. Digestion of plasmid pUC9-uTPA with SalI
And isolating the fragment containing the uTPA gene,
of the M13-mp18 vector cut with
It was inserted into a strand body. Next, uTPA significant
Single strike including sense strand
The Rand phage DNA was isolated and
Mutagenesis templates performed by
Used as Each mismatched oligonucleotide
Primer at 65 ° C. for 10 minutes, then at room temperature for 10 minutes,
20 mM Tris-HCl, pH 7.5, 10 mM Mg
Cl_Two , 50 mM NaCl, 1 mM dithiothreitol
, 0.2 pmol single strand M13-m
p18-TPA DNA, and 20 pmoles of 5 '
Reaction solution containing acid-mismatched oligonucleotide
And annealed to the template. next,
30 mM Tris-HCl, pH 7.5, 10 mM M
gCl_Two , 2 mM mercaptoethanol, 1 mM each
ATP, dCTP, dGTP, dTTP and 1 mM
An equal volume of buffer PE containing ATP was mixed with the annealing reaction mixture.
Added to the mixture. 5-10 units of DNA polymerase
Klenow fragment and 3-5 units of T4 ligase
And incubate at 16 ° C overnight to obtain primers
Was extended. The reaction mixture was diluted and competent JM
Used for transformation of 105 cells. Phage plaque
Mutageni in-situ
Oligonucleotide oligonucleotide plaque hybridization
In the solution method,³²Use P-labeled mismatched primer
And screened for the desired mutant. this
The method is that the desired mutant is completely complementary to the primer
Sex, but the native DNA may have one or more mistakes.
Based on the inclusion of the match. That is, appropriate
Under conditions of hybridization, mismatched primers
The degree to which a hybrid forms a mutant with a mutant
It is larger than forming a hybrid with a natural type. This c
Difference in ability to form hybrids makes it possible to select the desired mutant
Is possible. The candidate mutant was isolated and the restriction endonuclease was
Identified by creatase digestion and DNA sequencing.
Insert the desired mutant uTPA gene into the appropriate M13m
For SalI digestion of the replication form of the p18-TPA mutant
Therefore, it was isolated. As shown in FIG. 8, each of the isolated mutators
The uTPA gene was replaced with the X of plasmid pCLH3ax.
inserted into the hoI cloning site (plasmid pCL
H3ax is a pBR322 sequence, mouse metallothione
Base pairs containing the 5 'regulatory sequence of the
Xh with 237 base pairs containing the 3 'regulatory sequence of V40
oI cloning site). Plasmid pCLH
3ax was derived from plasmid pCL28 as shown in FIG.
The starting plasmid pCL28 was replaced with HindI.
Cleavage at II and reorients the metallothionein gene
The new plasmid was replaced with Bg
cleaved with II and BamHI and 237 salt of SV40
A base pair polyA region was inserted; finally a BglII site
Is converted to an XhoI site by adding an XhoI linker
did. The resulting plasmid is cut with XhoI and isolated.
Each mTPA gene was inserted. Each mutant DN
Each construct containing A is named pCT [mutant].
You. Here, [mutant] indicates that each mTPA is
The site modified to prevent cosylation is indicated. example
For example, a construct containing a modification at site A would be named pCTA.
You. [0037] The final step of construction is the sensitization of mammalian host cells.
Bovine papilloma virus (BPV)
This is the addition of the array to be loaded. Plasmid pB2-2 is replaced with an enzyme
Digestion with BamHI and SalI to reduce the BPV genome
A 7.9 kb fragment was generated. This flag
Was digested with the same two enzymes beforehand.
). This final product (pCAT
[Mutant]) is a 5 'metallothionein regulatory signal
Null part, modified uTPA gene, 3 ′ signal of SV40
(With poly A addition site) and complete BPV
Includes genome. These pCAT [mutant] expression vectors
The vector is then expressed by infecting a mammalian host cell.
Used to isolate the modified uTPA protein.
Was. [0038]Infection of mammalian cells (transfection
N) Wigler et al., Cell, 11, 22.
3 (1977), using a modification of the infection technique,
And the pCAT [mutant] plasmid DNA
Mouse C127 cells. 5-2 of pCAT [mutant] DNA
0 μg of 2 containing 10 μg of carrier salmon sperm DNA
40 mM CaCl_Two Added into 0.5 ml. This solution
The solution was added to an equal volume of 2XHBS (280 mM NaCl, 20
mM Hepes and 1.5 mM sodium phosphate
PH: 7.1) while whisking. 30 at room temperature
Form calcium phosphate precipitate for 5 min.^Five Pieces
Plate C127 cells 24 hours prior to infection
Was. Cell growth during calcium phosphate precipitation
The medium was changed. Add calcium phosphate precipitate to cells
And incubated at 37 ° C. for 6-8 hours. DNA
Removed and cells were washed with phosphate buffered saline (PBS), p
Exposure to 20% glycerol in H7 for 1-2 minutes at room temperature
Was. The cells are washed with PBS and 10% calf serum (MA
Biologicals), penicillin / streptomycin,
Containing 10 mM and 10 mM glutamine (GIBCO)
10 ml of R. kkoco's modified medium was added. 24 hours after culture
And every 3-4 hours thereafter. 14-21 days
The focus was detected later, and the cloning
By the cloning ring method
Isolated. This focus was expanded for analysis. The infected cells are cultured by conventional means,
MTPA was continuously harvested from the culture medium. pCAT
The transformed C127 cells containing [mutant]
PA was produced at a high rate. BPV vector (this is DNA
Powerful metallothionein in increasing copy number)
Promoter regulated mTPA production and BPV
The continuous growth characteristics of transformed cells
To provide an optimal system for mass production of [0041]Extraction and purification of mTPA from culture medium Activity-modified TPA produced by transformed mammalian cells
Was recovered from the host cell culture medium. Cell extract or
Purification of active mTPA from culture media generally involves 1) sparse
Aqueous affinity chromatography, and 2) anti-
Body affinity chromatography. This
Method applies to wild-type TPA and other modified TPA
it can. Specifically, these steps are performed as follows. [0042]Hydrophobic affinity chromatography This step involves converting mTPA in the host cell culture medium to, for example,
Tris Acrylic Blue (LKB), Macro Solvable
-Or CM Affigel Blue (BioRad)
Can bind to mTPA, but some other
Includes the step of complexing with a dye that does not bind to proteins
You. (Affigel Blue is a human neuroblastoma
Plasminogen activator isolated from the line
In another purification of the invention, (NH_Four )_Two SO_Four Sinking
And p-aminobenzamidine-sepharose chromosome
Used in combination with matography; Bio
chim. Biophys. Acta, 704, 450
-460, 1980. ) Filter the medium for clarification and then
Used without dilution or concentration. Phosphate buffered raw
Equilibrate with saline, 0.01% Tween, pH 7.1
50 Tris acrylic blue matrix (LKB)
ml / l was added. Tris acrylic blue matrix
(20 ml / mg TPA) (batch type
Solution), the solution was gently stirred at 4 ° C. for 2 hours. Mato
Lix was then added to 20 mM phosphate buffer, pH 7.4,
0.15 M NaCl, and 0.01% Tween 80
Washed with. The TPA-containing material is then loaded (loa).
d factor) into the gel filtration column at 50%,
Gel filtration was performed at a linear velocity of 85 cm / hour. Tris Aqua
0.5M arginine from Lil Blue Matrix, 0.
02M phosphate buffer, 0.15M NaCl, 0.01
Elution with% Tween, pH 7.4. Recovery rate of TPA
Was generally 90-95%. As described above, in this step, trisacryl
A matrix other than blue may be used. An example
Is CM Affigel Blue (Bio Rad)
It binds mTPA equally well and uses trisacryl
Elutes mTPA in a pattern similar to blue. [0044]Affinity chromatography The next step in achieving high purification is on a solid support column.
Take using anti-TPA antibody immobilized on the surface
Chromatography. Polycloth made by conventional means
Either monoclonal or monoclonal anti-TPA antibodies
Can be used. Preferred affinity chromatography
The steps are performed as follows. Tris acrylic blue
The material eluted from the matrix is contained in the eluate.
Monoclonal anti-T capable of binding all mTPA activities
Very loose at 4 ° C in PA Sepharose matrix
Let go through. Suitable antibodies are available from the Scottish
Bioscott, Ltd. or A
American Diagnostica (American D
commercially available from E. ignostica). This antibody
To CNBr-activated Sepharose with 5 mg antibody / ml
Combine with the amount of fat. 0.1M Trial of antibody matrix
Pre-plated with pH 8.0 and 0.01% Tween 80
Equilibrated, 0.5 M NaCl, 0.01% Tween 8
2. Wash with 0, 0.1 M Tris, pH 8.0, and
0M KSCN, 0.01% Tween 80, 0.1M
Elution at squirrel, pH 8.0. Elution is at a linear velocity of 60 cm /
Time, yields greater than 70-80% recovery
You. Next, the concentrated mTPA was added to 0.3 M Tris HC.
1, pH 8.0, 0.25 M NaCl, and 0.0
Dialyze against 1% Tween 80. Recovered from antibody / sepharose column
Purified mTPA was 5% by SDS PAGE electrophoresis
It has the following contaminant components. Under reducing conditions, some 2-chain T
PA (active; single chain is the preferred type) observed
Was. Add aprotinin to the buffer used in the purification process
This can prevent a two-chain type. [0047]Uterine TPA cDNA and modified uTPA
Determination of properties As described above, FIGS.
When the nucleotide sequence is encoded by the cDNA,
Shown together with the back calculated amino acid sequence of uterine TPA. Interim
Tentative prepro sequence
sequence) corresponds to amino acids -38 to -1.
You. Each column before amino acids +1, -3 and -6 in FIG.
Lines indicate cleavage sites. The glycosylation site is As
indicated by n-residue CHO;
It is not glycosylated. Plasmin cleavage site (single chain
The site where uTPA is converted to 2-chain uTPA) is indicated by an arrow.
Is shown. Conserved active center of serine protease
The sequence is underlined. Figures 1-3 also show the uterus
TPA cDNA and various asparagine codons in the present invention
With a recombinant DNA molecule in which is replaced with glutamine codon
Shows the nucleotide sequence differences of These specific accounts
By removing the spargin codon, the T
Reducing the degree of N-linked glycosylation of PA molecules
it can. The partial or non-glycosylation is mTP
The effect of A on the half-life was determined by measuring the half-life and their
Ratio of half-life to known half-life of fully glycosylated uTPA
It was checked by comparison. The half-life measurement was performed using rabbits and TP
A. Take blood samples at various times after injection and present
The activity and amount of TPA were determined on the fibrin plate and E, respectively.
This was done by examining the LISA test. Of this comparison
As an example, the analysis results of mutants A and BC are shown below.
Is shown. [0049]Mutant A TPA and Mutant
Analysis of BC TPA Glycosylation for uTPA half-life in vivo
Rabbits to determine whether or not
Tested as Dell [Collen
J. et al. Pharm. Exp. Ther. , 231: 1
46-152, 1984]. New Zealand white rabbit (4-5 pons)
C) from the vein around the ear, 50-200 μg of modification
Inject 50-200 μg of TPA or wild-type TPA
did. 1 ml blood sample from the rabbit aorta
At time 0 into 3.8 ml sodium citrate directly
And 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes,
Collect after 7 minutes, 10 minutes, 15 minutes, 20 minutes set time
Was. Centrifuge the sample to remove cell-free plasma
This was stored frozen until the assay. Each wild-type TPA and
And at least 3 rabbits per modified TPA
Was. When plotting the data, each TPA tested has
It showed a similar half-life of 2-3 minutes. However, long hours
When the curve is analyzed over a period of time (20 minutes), the modified TP
Some of A have higher concentrations in plasma than wild-type TPA.
It turned out to be high. Therefore, the initial rapid
Stall rates are approximate for all TPA tested.
However, the disappearance rate up to the 20th minute was that with modified TPA.
Was lower. An example is shown in FIG. Table 1 shows the mu
-A and BC were significantly slower than wild-type TPA.
It summarizes the results suggesting that you have a stall
You. [0051] [Table 1] These results are based on ELISA (ng / ml) and¹²⁵I
-Measured in both fibrinolysis tests (MIU / ml)
Was. [0052]⁺tPA sample (20 minutes after injection)
Indicates presence (+) or absence (-) of ibulin lytic activity
You. ND = not measured. The next experiment was performed using ELISA assays.
That the modified TPA in the collected blood is biologically active
Went to confirm. TPA activity is¹²⁵I-Five
Phosphorus-based fibrin clot lysis assay
Indirect amide substrate lysis assay (amidolytic)
assay). The results are shown in Table 1 and FIG.
According to that, mutants A and BC are wild
Irrespective of the assay method compared to type uterine TPA,
It showed a long disappearance time. The above experiments show that the modified TPA is
It shows that it retains biological activity. Mu
Yet another test of the fibrinolytic activity of Tanto is in vitro.
And by dissolving the clot in vivo. Modification
Is TPA first in vitro¹²⁵I-fiberlink lock
Test was conducted on the Five-link lot is 10
mM CaCl_Two Normal human pooled plasma containing 0.5
1.5 μCi in ml¹²⁵I fibrin (IBRI
N, Amersham) and 10 μl of thromboplast
Made from a mixture of components. Clot is 3ml during the experiment
It was kept in the plasma. Baseline of emitted radioactivity
Pre-incubation at 37 ° C for 30 minutes to stabilize
And then add the same amount of wild-type or mutant TPA
In an amount of 0.1 to 2 μg protein,¹²⁵I-fibrinclo
And incubation continued at 37 ° C.
Was. At various times after TPA addition, 50 μl of sample was
After removal, the radioactivity in the solution was counted. time
The calculation of percent clot dissolution at t is
Add or count radioactivity in solution in solution
Calculate by dividing by the total count (100% soluble)
Was. FIG. 11 shows TP of wild-type TPA and mutant A
A, in vitro comparing TPA of mutant BC
3 shows the results of dissolving the clot. Can be seen in the graph of FIG.
For each specific amount, the modified TPA
The lytic activity was comparable to that of wild-type TPA. Next, the in vivo fibrosis of the modified TPA
Tested for fibrinolytic activity against blinklot
Was. In vivo clot dissolution when using rabbit plasma
The improved sensitivity of the solution test was
Same 0.5 or 1 ml for dissolution experiments¹²⁵If
Eblink lot was created. 12 clots of this clot
New Zealand white rabbit weighing 4 pounds using a large needle
In the jugular vein. Administer TPA from ear vein
Plasma sample through a catheter in the carotid artery
Withdrawn each hour between 30 seconds and 3 hours. TPA
After testing the various parameters of the injection, TPA was increased to 45
Following a large dose of μg, a 0.25 mg / hr
It is possible to perform a continuous infusion for 110 minutes at
Comparison of fibrinolytic activity of type A and mutant A
It turned out to be optimal. As shown in FIG.
The fibrinolytic activity of the three rabbits injected with TPA was:
Observed to be larger than rabbits injected with the same amount of wild-type TPA
I was guessed. Further, during injection, mutant A
Amide lysis activity in plasma samples containing proteins
Is not only larger than in the case of wild-type TPA,
Amidolysate present in blood 40-60 minutes after completion
Mutant A TPA also produces wild-type TPA
Larger than those in the plasma samples of the treated rabbits
(FIG. 13). Results of these in vivo clot dissolution tests
Clearly show long biological half-life of mutant A
Accumulation of TPA in the plasma during the continuous injection
Will lead to an increase in About Mutant BC
Similar results were observed. In vitro and in vivo
From both biological assays, two TPA mu
Tanto A and BC are always
Has a longer elimination time and retains its biological activity
Is determined. As mentioned above, complete
Liver excretion of lycosylated TPA is very fast,
The half-life is about 2 minutes (Thromb. Haemo.
stas. 46, 658, 1981). Therefore, TPA
Is usually not administered by injection, but infuses a large amount over 3 hours
To be administered. The long half-life of mTPA is
Since the amount required to achieve clot dissolution is reduced,
Allows treatment by injection without any delay. [0058]Use The mTPAs of the present invention may be used in human patients in need of thrombotic treatment, for example,
For post-surgical patients, patients who have recently had a myocardial infarction
To dissolve blood clots in patients who are susceptible to venous and deep vein thrombosis
Used for purpose. mTPA is a pharmaceutically acceptable carrier
Mixed with a substance, for example, a salt solution, and administered orally, intravenously, etc.
Or injected into a damaged artery or heart
You. The following is an exemplary embodiment. [0059] BEST MODE FOR CARRYING OUT THE INVENTION Example 1 5 to 10 mg for urgent treatment of thrombus by large dose
Of lyophilized mTPA in saline with saline
Put a large amount into a syringe barrel for intravenous administration to a patient.
Was. Embodiment 2 Due to infusion for rapid dissolution of coronary thrombi, approx.
100 mg / hour of lyophilized mTPA over about 1 hour
About 50 mg over 3 hours
/ Hour intravenous infusion. Embodiment 3 Injection aimed at the rapid dissolution of coronary thrombi
According to the formulation of Example 2, except that saline
A large amount of about 10 mg of mTPA was injected intravenously. Embodiment 4 Infusion therapy aimed at gentle dissolution of deep vein thrombosis
About 15 m of freeze-dried mTPA dissolved in physiological saline
intravenous infusion over a period of about 12 to 24 hours at a rate of g / hour
did. [0063] Other embodiments are within the following claims.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a series of nucleotide sequence diagrams showing the nucleotide sequence of the native human uterine TPA gene, including flanking regions, together with examples of codon replacements in the recombinant DNA molecule of the present invention. It is the first figure. FIG. 2 is a nucleotide sequence diagram showing the continuation of FIG. 1 halfway. FIG. 3 is a nucleotide sequence diagram showing the continuation of FIGS. 1 and 2 to the end. FIG. 4 is the first of a series of process diagrams illustrating the method for producing the complete uTPA cDNA sequence. FIG. 5 is a process chart showing the continuation of FIG. 4 to the end; FIG. 6 is a flow chart showing a method for producing a recombinant DNA molecule encoding mTPA. FIG. 7 is the first of a series of process diagrams illustrating the method for producing the mammalian expression vector of the present invention. 8 is a process chart showing the continuation of FIG. 7 to the end; FIG. 9 is a schematic diagram of human uterine TPA with N-glycosylation sites and disulfide binding sites and glycosylation mutant sites in the present invention. FIG. 10 is a graph for determining in vivo half-life of uTPA and mTPA mutant A. FIG. 11 is a graph showing in vitro thrombolysis test data of uTPA and mTPA mutants A and BC. FIG. 12 is a graph showing thrombolysis test data for examining the in vivo disappearance rates of uTPA and mTPA mutants A and BC. FIG. 13 is a graph showing indirect amide substrate dissolution test data for examining the in vivo disappearance rates of uTPA and mTPA mutants A and BC.

   ────────────────────────────────────────────────── ─── Continuation of front page    (72) Inventor Nancy Shun               United States Massachusetts               02181, Wellesley, Washington Su               Treat 594E (72) Inventor Vamli Be Reddy               United States Massachusetts               01701, Framingham, Too Jo               N McQuinn Circle (No address) (72) Inventor Jeffrey F. Lemonto               United States Massachusetts               02165, West Newton, Fair               Way Drive 165 (72) Inventor William Dakowski               United States Massachusetts               01721, Ashland, Oregon strike               REET 73 (72) Richard Douglas, inventor               United States Massachusetts               01772, Southborough, Edgewood Lo               Mode 46 (72) Inventor Edward S. Coul               United States Massachusetts               01756, Mendon, Semitary Story               Port 11 (72) Inventor Richard Dee Purcell Juni               A               United States Massachusetts               02158, Newton, Maple Aveni               View 17 (72) Inventor David Thai-Yui Law               United States Massachusetts               01752, Marlborough, Westerby               -Drive 12                (56) References JP-A-61-247384 (JP, A)                 International Publication No. 84/1786 (WO, A)

Claims (1)

(57) [Claims] At least one, but not all, of the Asn, Ser or Thr codons of the N-linked carbohydrate recognition sequence Asn-X- (where X represents Ser or Thr) of the DNA molecule encoding native human TPA is replaced by another An active human TPA which differs from a native TPA-encoding DNA molecule in that the substitution has a mutation that prevents the carbohydrate component from binding to the carbohydrate recognition sequence of TPA. A recombinant DNA molecule encoding 2. The recombinant DNA molecule according to claim 1, wherein the mutated carbohydrate recognition sequence is the carbohydrate recognition sequence closest to the carboxy terminus of TPA. 3. 3. The recombinant DNA according to claim 2, wherein the Asn codon of the carbohydrate recognition sequence is replaced with a non-Asn codon.
molecule. 4. 4. The recombinant DNA molecule according to claim 3, wherein the Asn codon is replaced with a Gln codon. 5. 2. The recombinant DNA molecule according to claim 1, wherein the mutated carbohydrate recognition sequence is the carbohydrate recognition sequence closest to the amino terminus of TPA. 6. 6. The recombinant DNA molecule according to claim 5, wherein the codon of the carbohydrate recognition sequence near the center is also replaced. 7. Replace the Asn codon in the carbohydrate recognition sequence closest to the amino terminus and in the carbohydrate recognition sequence near the center with non-As
7. The recombinant DNA molecule according to claim 6, wherein the molecule is substituted with n codons. 8. 8. The recombinant DNA molecule according to claim 7, wherein the Asn codon is replaced with a Gln codon. 9. A replicable expression vector capable of expressing a DNA sequence encoding human TPA that is active in a host mammalian cell, comprising the N-type DNA molecule encoding native human TPA.
Bound carbohydrate recognition sequence Asn-X- (where X is Se
r or Thr) Asn, Ser or Thr
A DNA encoding a natural TPA in that at least one, but not all, of the codons have been replaced with another to form a mutation which prevents the carbohydrate component from binding to the carbohydrate recognition sequence of the TPA. An expression vector comprising a recombinant DNA molecule encoding active human TPA, characterized in that it is different from the molecule. 10. A replicable expression vector capable of expressing a DNA sequence encoding human TPA that is active in a host mammalian cell, comprising a DNA molecule encoding native human TPA.
-Bound carbohydrate recognition sequence Asn-X- (where X is S
er or Thr) Asn, Ser or Th
encodes a native TPA in that at least one, but not all, of the r codons have been replaced with another to form a mutation that prevents the carbohydrate component from binding to the carbohydrate recognition sequence of the TPA. A mammalian cell transfected with an expression vector comprising a recombinant DNA molecule encoding active human TPA, characterized in that it is different from the DNA molecule.