JP2648122B2 - Novel polypeptide and method for producing the same - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION The present invention is new Tadashipo Ripepuchido and
It relates to the manufacturing method .

[0002]

2. Description of the Related Art Human hepatitis B is a kind of DNA virus, that is, hepatitis B virus (Hepatitis BV).
irus (hereinafter also referred to as HBV). The properties of HBV are known as den particles, HBV surface antigens (hereinafter abbreviated as HBsAg) on the surface of the virus particles, double-stranded circular DNA partially having a single-chain portion inside the particles, and HBV core. Antigen (hereinafter abbreviated as HBcAg), HBVe antigen (HBC
eAg), and the activity of endogenous DNA synthase has been detected as an enzyme that repairs the single-stranded portion of double-stranded DNA. HBV DNA has a molecular weight of 2.1 × 10 ⁶ daltons and has about 3,200 base pairs. The antigenicity of HBsAg is based on the common antigen a, adr, adw, ayr, ay
Four types of w are known. HBcAg can be used as a diagnostic reagent for early diagnosis of HBV infection. That is, when infected with HBV, the anti-HBc antibody appears before the anti-HBs antibody appears in the blood. Therefore, by detecting this, the presence or absence of HBV infection can be determined at an early stage. In addition, it has recently been reported that HBcAg is effective in preventing HBV infection. On the other hand, blood containing HBeAg has a high content of den particles, and is highly dangerous as HBV infectious blood. Therefore, knowing the presence or absence of HBeAg is also important in the treatment of HBV-infected patients and is essential for the diagnosis of HBV infection.

[0003]

The object of the invention is to be Solved However, H Be
Collected once Den particles to obtain a Ag, H BEA in this
It must be separated g but Ru contained in Den particles
Since H BeAg is very small, safely this, yet to establish a way to get a large amount has been desired.

[0004]

The present inventors have SUMMARY OF THE INVENTION The RESULTS of extensive research to solve the above problems, by genetic engineering methods H Beag those, have succeeded in providing a method for obtaining them in large quantities It is. That is, the present invention relates to a novel polypeptide exhibiting hepatitis B virus e antigenicity, the hepatitis B virus e antigenicity of culturing a transformant containing a recombinant DN A comprising a DNA encoding the polypeptide preparation of the polypeptide shown, in respect, more particularly (1) the following amino acid sequence: Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Ile Thr Asn, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser or Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu S er Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu A polypeptide exhibiting hepatitis B virus e antigenicity having Glu Tyr Leu Val Ser, (2) a promoter, a translation initiation codon downstream of the promoter, and a polypeptide exhibiting hepatitis B virus e antigenicity according to (1). A transformant containing a DNA encoding the peptide and a recombinant DNA obtained by ligating a stop codon immediately thereafter is cultured, and the polypeptide exhibiting hepatitis B virus e antigenic activity described in (1) is cultured from the culture. and recovering (1) according hepatitis B c Preparation of polypeptides exhibiting Luz e antigenicity, and (3) sequence between the SD sequence and the translation initiation codon of the promoter is ATCGGGC, poly showing a hepatitis B virus e antigenicity described (2) Provides a method for producing peptides
To is intended, and (4) a promoter, downstream of the promoter, translation initiation codon, B type hepatitis virus encodes a c antigenic polypeptides that exhibit DNA and recombinant DNA that formed by connecting a stop codon immediately after In the above, the promoter S
The sequence between the D sequence and the translation initiation codon is ATCGGGGC
(5) the following plasmids: pTB (4) 369 (FERM BP-1153) pTB (4) 369-4 pTB (4) 369-32 and pTB (4) 369- 41, a recombinant DNA according to (4), a promoter, a translation initiation codon downstream of the promoter, a DNA encoding a polypeptide exhibiting hepatitis B virus c antigenicity, and immediately thereafter. And a stop codon ligated thereto, wherein the S
The sequence between the D sequence and the translation initiation codon is ATCGGGGC
Transformant containing the recombinant DNA, characterized in that it is, and, (7) promoter, downstream of the promoter, DNA encoding a polypeptide exhibiting the translation initiation codon, a hepatitis B virus c antigenicity and Immediately after that, a stop codon is ligated to the recombinant DNA.
The sequence between the D sequence and the translation initiation codon is ATCGGGGC
Culturing a transformant containing the recombinant DNA, and recovering a polypeptide exhibiting hepatitis B virus c antigenicity from the culture, wherein the hepatitis B virus c antigen is recovered. preparation of polypeptides exhibiting sex, the
This is also described herein for reference.

The transformant which produces the polypeptide having hepatitis B virus e-antigenicity having the amino acid sequence of the present invention has the ability to produce a polypeptide having hepatitis B virus e-antigenicity as a host microorganism. Any group may be used as long as it has a translation initiation codon, a DNA encoding a polypeptide exhibiting hepatitis B virus e antigenicity, and a stop codon immediately after the promoter. Escherichia coli, yeast, etc., which carry the recombinant DNA, include the above-mentioned recombinant DN.
E. coli carrying A is preferred. As a promoter, mRNN is bound by binding of RNA polymerase.
Any substance may be used as long as it contains a site necessary for initiating A synthesis. For example, when E. coli is used as a host, the promoter used is t
rp promoter, recA promoter, lac promoter, λP _L promoter, such as tufB promoter and the like, especially trp promoter is preferable. More preferably, a promoter in which the sequence between the SD [Shine-Dalgarno] sequence in the promoter and the translation initiation codon described below is ATCGGGGC is mentioned. For example, when yeast is used as a host, any promoter can be used as long as it can function in yeast. The translation initiation codon is preferably ATG. The DNA encoding a polypeptide exhibiting hepatitis B virus c antigenicity may be a DNA encoding a polypeptide exhibiting hepatitis B virus c antigenicity of any subtype, but the polypeptide shown in FIG. DNA encoding
(Adw type) is preferred. More preferably, FIG.
dw-type HBV DNA) (showing the entire base sequence of dw-type HBV DNA).
Is more preferred. The DNA encoding the polypeptide exhibiting hepatitis B virus e antigenicity includes the following amino acid sequence: Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Ile Thr Asn, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser or Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Le poly with u Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser, the DNA encoding the peptide is preferred. Specifically, (1) in the base sequence shown in FIG.
At the 3 'end of the nucleotide sequence at positions 1901 to 2332, a base
Having a nucleotide sequence which sequence "ATAACTAAC" was added
1901-2 that DNA, in the nucleotide sequence shown in Figure 1 (2)
At the 3 ′ end of the 314th base sequence, the base sequence “AGA
ATTCTTGAAGACGAAAGGGCCTCG "
DNA having a base sequence added with (3) 1901-1 in the base sequence shown in FIG.
Bases 1985 to 2146 of the 314th base sequence
The base sequence "AG" was added to the 3 'end of the base sequence from which the sequence was deleted.
AATTCTTGAAGACGAAAGGGCCTC
A DNA having a base sequence to which "G" has been added, or (4) 1901-1 to 2-10-2 in the base sequence shown in FIG.
DNA having the 263rd nucleotide sequence is preferred.

As stop codons, TAA, TAG, TG
A is given.

For example, a DNA encoding a polypeptide exhibiting adw-type HBc antigenicity is disclosed in Nucleic Acids Res., Vol. 11, 174.
PBR322-E described on page 7 (1983)
coRI / HBV933 (abbreviated as pHBV933) was fragmented by digestion with the restriction enzyme HhaI, and about 1 kilobase pair of DNA containing the DNA encoding the polypeptide showing HBc antigenicity was separated from the obtained DNA fragments.
After coupling the coRI linker, ptrp781 containing a tryptophan promoter [ptrp701 (see European Patent Publication No. 0068719)] was digested with a restriction enzyme EcoRI, partially digested with ClaI, and the resulting marginal portion was repaired with a DNA polymerase I large fragment. , A plasmid circularized using T4 DNA ligase in which the ClaI site closer to the EcoRI site has been broken] to obtain a plasmid pHE1. Further, the plasmid pHE1 is digested with EcoRI, further digested with nuclease Bal31, and then bound with a ClaI linker, and inserted into the ClaII site of ptrp771 containing a trp promoter (see European Patent Publication No. 0068719). Plasmid pTB368 containing DNA encoding a polypeptide exhibiting sex properties can be obtained (see FIG. 4). Escherichia coli (DH1,
(1776, C600, etc.), an E. coli strain capable of producing a polypeptide exhibiting HBc antigenicity can be obtained. The DNA encoding the polypeptide exhibiting the adw-type HBe antigenicity can be prepared, for example, using appropriate restriction enzymes (eg, AvaI, AvaII) and plasmid pTB368.
And nuclease Bal 31 if necessary.
After digestion with, a suitable linker containing a stop codon is bound thereto, and the plasmid is incorporated into ptrp 771 to obtain a plasmid containing a DNA encoding a polypeptide showing the desired HBe antigenicity. By transforming Escherichia coli (DH1, χ1776, C600, etc.) with the obtained plasmid, an Escherichia coli strain capable of producing a polypeptide exhibiting HBe antigenicity is obtained (see FIG. 5).
HBc antigenicity or HB of a subtype other than adw type
A DNA encoding a polypeptide exhibiting e-antigenicity can be obtained in the same manner as described above. Even when a microorganism other than Escherichia coli is used as a host, the plasmid containing a promoter capable of functioning in the host can be used as the above-mentioned DNA.
By inserting the NA, a microorganism having the ability to produce the target polypeptide can be obtained. Recombinant DNA in which the sequence between the SD sequence of the promoter and the translation initiation codon is ATCGGGC is, for example, a suitable restriction enzyme (eg, Ec
oRI), then allowed to act on S1 nuclease,
Although it can be obtained by performing a ligation reaction, oligonucleotide mutagenesis (oligon
ucleotide mutagenesis).

The obtained transformant of Escherichia coli can be cultured in a medium known per se. As the medium, L broth,
Known media such as M-9 media containing Penassay broth, glucose, and casamino acids can be used. If necessary, an agent such as 3β-indolylacrylic acid can be added to make the promoter work efficiently. Cultivation is usually 15-43 ° C, preferably 2
The reaction is carried out at 8 to 40 ° C. for 2 to 24 hours, preferably 3 to 8 hours, and if necessary, ventilation or stirring can be added. After the culture, the cells are collected by a known method, suspended in a buffer, disrupted by sonication, lysozyme and / or freeze-thawing, and then centrifuged to remove the extract containing the polypeptide of interest. A known method such as a method for obtaining the same can be used. Separation and purification of the target polypeptide from the extract are also performed by a method known per se. In the case of microorganisms other than Escherichia coli, the desired polypeptide can be obtained in the same manner.

[0009]

Polypeptides exhibiting H Be antigenicity of the effects of the present invention can be used as naturally-derived H Be antigen as well as diagnostic agents hepatitis B, protection of infection hepatitis B virus (prophylactic) agents. In the recombinant DNA sequence between the SD sequence and the translation initiation codon of the promoter is ATCGGGC, production of the polypeptide increases showing the H Be antigenicity
And is advantageous for the production of H Be antigen.

[0010]

EXAMPLES The present invention will be described in more detail with reference to the following examples, which should not be construed as limiting the invention thereto. Example 1 Plasmid pHBV933 was digested with restriction enzymes EcoRI and HhaI and subjected to 1% agarose gel electrophoresis to obtain a DNA fragment containing the HBc antigen gene (1005b).
p) was isolated. In a buffer (10 mM sodium acetate,
150 mM NaCl, 0.05 mM ZnSO ₄ , pH
After treatment with nuclease S1 at 4.0), EcoRI linker d (GGAATTCC) was bound,
oRI treated. This DNA fragment was converted to plasmid ptrp.
After insertion into the 781 EcoRI site, it was used to transform E. coli DH1. A plasmid was extracted from a clone having a plasmid (pHBcHE1) in which the HBcAg gene was integrated, and EcoR was extracted from the plasmid.
An I DNA fragment was cut out. 5 μg of the DNA fragment was added to a buffer (600 mM NaCl, 20 mM Tris · H).
C1, pH8.0,12mM CaC1 _2, 12mM M
GC1 _2, Bal 2 units 1.0 mM EDTA)
The mixture was treated at 31 ° C for 1 minute at 24 ° C. C1aI linker d
(CATCGGATG) was ligated and then digested with C1aI. The DNA fragment was inserted into the ClaI site of ptrp 771 and used to transform Escherichia coli DH1,
Transformants resistant to tetracycline (Escherichia coli
DH1 / pTB368) was obtained.

Example 2 The transformant obtained in Example 1 was cultured at 37 ° C. in an M-9 medium (10 ml) containing 8 μg / ml of tetracycline, and a Klett unit (absorbance at 580 nm) was obtained. At 180-200, 3β-indolylacrylic acid was added to a concentration of 25 μg / ml and the culture was continued for another 2-3 hours. The culture was centrifuged at 5000 rpm for 10 minutes to collect the cells, and 1 ml of a buffer (20 mM) was collected.
Tris-HCl, pH 7.6, 20% sucrose), lysozyme (3 mg / ml), EDTA (final concentration 5 mM) and PMSF (final concentration 1 mM) were added. It was left for 1 hour. The cells are further destroyed by sonication, and 2 minutes at 15000 rpm.
Centrifugation was performed for 0 minutes (twice), and the obtained supernatant (extract) was used for measurement of HBc antigen titer using an ABeott HBe rear kit. As a result, it was found that the transformant was a clone expressing HBc antigen. The bacterial extract of the transformant was diluted with physiological saline, and the antigen titer was measured. As a result, it was possible to detect the HBc antigen even at a concentration of at least 2500-fold dilution.

Example 3 The above transformant (Escherichia coli DH1 / pTB3)
68), the plasmid (pTB368) was extracted, the plasmid was cut with a restriction enzyme AvaΙ, and nuclease B
Treated with al 31 for 30-90 seconds. An EcoRΙ linker with a stop codon is attached and the Cpt of ptrp771
After insertion into the laΙ.EcoRΙ site, E. coli DH1
Was transformed. The obtained transformant was cultured in M-9 medium, and the HBeA titer was measured by the method described in Example 2. H
Transformant producing Be antigen (Escherichia coli D
H1 / pTB441, Escherichia coli DH1 / pT
B449, Escherichia coli DH1 / pTB552)
I got Example 4 A cell extract of a transformant was diluted 5-fold with physiological saline,
The antigen titer was measured using an Abbott HBe rear kit. The results are shown below. P / N = (positive cpm) / (negative control cpm).

Example 5 i) Cell extract of Escherichia coli DH1 / pTB368 was subjected to 40,000 rpm with a Beckman ultracentrifuge (SW55 rotor).
centrifugation at 4 ° C. for 6 hours. The precipitate was washed with a buffer (20 mM Tris-HC1, 1 mM EDTA, 0.15 M NaC).
1, pH 7.6). To 50 μl of the sample, a 2 × concentration buffer for SDS polyacrylamide (0.15 M Tris-HC1, pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.002
% Bromophenol blue) and add 100 μl
After heating at 5 ° C. for 5 to 10 minutes, polyacrylamide gel electrophoresis was performed. The separated protein was electrically adsorbed on a nitrocellulose filter, and ^{125 125} -anti-H
After being reacted with Be antiserum, an autoradiograph was taken after washing. As a result, the protein produced by the transformant was estimated to have a molecular weight of 21,500 to 22,000 daltons (see FIG. 6). ii) Solid cesium chloride was added to the cell extract of Escherichia coli DH1 / pTB368 so that the average ρ became 1.20, followed by centrifugation at 38,000 rpm for 72 hours, fractionation, and fractionation of the antigen of HBc antigen. The HBc antigen was fractionated as a peak at around ρ = 1.34 as a result of examining the fractions having sex (see FIG. 7). From the results of i and ii above, it is presumed that the product of the transformant forms particles of HBcAg.

Iii) 0.5 ml of a cell extract of Escherichia coli DH1 / pTB368 and Escherichia coli pTB441 was applied to a 5 to 25% sucrose concentration gradient solution (20 mM Tris, pH 7.6,
0.15M NaCl, 0.001M EDTA) 35m
and centrifuged at 24,000 rpm at 4 ° C. for 4 hours, followed by fractionation into 30 tubes. 200μ of each fraction
HBcAg and HBeAg were detected by the EIA (Enzyme Immunoassay kit, Abbott) method of HBcAg. The product of E. coli DH1 / pTB368 was mainly fractionated into fractions 9 and 10, and the product of E. coli DH1 / pTB441 was fractionated into fractions 20, 21, 22, and 23 (see FIG. 8).
The former was presumed to be a particulate peptide, and the latter was presumed to be a peptide that did not take the form of particles. iv) HBV was added to the cell extract of E. coli DH1 / pTB368.
After adding anti-HBc antiserum obtained by immunization with HBcAg particles extracted from the liver of infected chimpanzee, the decrease in antibody titer was measured using an anti-HBc assay kit (Abbott). The reaction was found to neutralize the anti-HBc antibody. On the other hand, E. coli DH1 / p
TB441, E. coli DH1 / pTB449, E. coli D
The cell extract of H1 / pTB552 hardly reacted with the anti-HBc antibody. The extract and ¹²⁵ iota-anti -HBc antibodies of the transformant is reacted, the following results of examining the residual amount of ¹²⁵ iota-anti -HBc antibody with anti HBc assay kit (Abbott).

Example 7 A cell extract (E. coli DH1 / pTB368, 64-fold dilution; E. coli DH1 / pTB441, 4-fold dilution) previously diluted with physiological saline to show about 20,000 cpm and 100 μl of serum HBeAg (undiluted) Rabbit anti-H diluted 100 times, 500 times, and 1000 times with physiological saline
Bc antibody and saline, solid phase H as control
The Be (HBc) antibody was added, and the reaction was allowed to proceed overnight at room temperature, and then the antigen bound to the solid phase was measured. The results are shown in FIG. 10 in% (percent) with the count of the system to which physiological saline was added as a control taken as 100%. The control counts were E. coli DH1 / pTB368, 22340, respectively.
cpm, E. coli DH1 / pTB441, 23471 cp
m, serum HBeAg, 9491 cpm. Serum H
As apparent from FIG. 10, the count of the BeAg was reduced only by about 10% at the maximum even when the anti-HBc antibody was added, even though only about 1/2 of the other antigen was added. . Therefore, this anti-HBc antibody is HBcA
It is considered that it hardly affects the detection of g. In the E. coli DH1 / pTB368 extract, the count was clearly decreased by the addition of the anti-HBc antibody, indicating that the product had HBc antigenicity. E. coli D
In the H1 / pTB441 extract, E. coli DH1 / pTB3 was used.
There was no apparent decrease in counts as in the 68 extract, suggesting that the product was predominantly HBe antigenic.

EXAMPLE 8 Plasmids pTB441, pTB449 and pTB5
52 of the DNA encoding HBeAg inserted in
The base sequence at the 3 'end is shown below. i) pTB441 CCA, CCA, AAT, GCC, CCT, AGA, ATT, CTT, Pro Pro Asn Ala Pro Arg Ile Leu (134) GAA, GAC, GAA, AGG, GCC, TCG, TGA Glu Asp Glu Arg Ala Ser- That is, the peptide produced by the plasmid is H
47 amino acids at the C-terminal side of BcAg are deleted (natural HBe
Ag is missing at the C-terminal side of Ag) and another 9 amino acids are added. ii) pTB449 AGA / CGA / CGG / CTA / GAA / TTC / TTG / AAG / (2348) ACG / AAA / GGG / CCT / CGT / GAT / ACG / CCT / ATT / TTT / ATA / GGT / TAA That is, HBcAg 33 amino acids on the C-terminal side are deleted, and another 16 amino acids are added. iii) pTB552 GTA, CTT, GAA, TAT, TTG, GTC, TCC, TAG (2243) That is, 64 amino acids on the C-terminal side of HBcAg are deleted.

Example 9 Plasmid pTB368 was digested with the restriction enzyme EcoRΙ and then treated with exonuclease Bal31. Next, a PstI linker d (GCTGCAGC) was ligated and treated with ClaI and PstI to obtain a ClaI.PstI DNA fragment containing the HBcAg gene. The DN
The A fragment was inserted into the ClaI.PstI site of ptrp771, cut with ClaI, and EcoRI linker d.
(GGAATTCC), EcoRI and P
The DNA fragment obtained by the stI treatment was digested with ptrp781 E
Built into EcoRI · PstI site, which E. coli DH1 was transformed with the plasmid pTB (4) 368
-1 carrying a transformant (Escherichia coli DH1
/ PTB (4) 368-1). The transformant was cultured in M-9 medium, and the amount of HBcAg produced in the cell extract was measured. As a result, the transformant was found to be E. coli DH1 / pTB3.
HBcAg production was confirmed to be about 10 times that of 68. S at the promoter site of plasmid pTB (4) 368-1
Results of examination of the nucleotide sequence from D sequence to the translation initiation codon of the HBcAg gene was 1 4 bp. SD array and A
PTB (4) 368 to reduce the number of bases between TG
-1 is digested with EcoRI and treated with S1 nuclease, and then a ligation reaction is performed. Escherichia coli DH1 is transformed using the reaction solution, and plasmid pT
E. coli carrying B (4) 369 / pTB (4) 369
I got As a result of measuring the amount of HBcAg produced by the transformant, the amount of HBc was 105 times that of Escherichia coli DH1 / pTB368.
It was found to produce Ag. Plasmid pTB
(4) The nucleotide sequence between the 369 SD sequence and ATG was 7 bp as follows.

Example 10 (i) Plasmid pTB (4) 369 was digested with AvaI, a single-stranded portion was double-stranded with a Klenow fragment, treated with PstI, a large fragment was separated, and a PstI recognition site was obtained. PstI stop linker Was combined. After treating with PstI, a large fragment was separated, a ligation reaction was performed, and plasmid pTB (4) 369
-4 was obtained (see FIG. 11). (Ii) treating pTB (4) 369 with StyI;
After obtaining a small fragment and treating the fragment with AvaII, Klenow
Repaired with fragments. After binding the PstI stop linker, treatment with HpaI and PstI,
A 502 bp fragment was isolated and the fragment was
Incorporation into the paI and PstI sites, pTB (4) 369-
32 was obtained (see FIG. 12). (Iii) The small fragment obtained by StyI treatment of pTB (4) 369 was treated with HpaII and then repaired with a Klenow fragment. After binding the PstI stop linker described above, treatment with HpaI and PstI resulted in 472
The bp fragment was isolated and the fragment was converted to HpaI of ptrp771.
-Incorporation into the PstI site yielded pTB (4) 369-41 (see Figure 12). (Iv) The DNA fragment between the BglII site 5 ′ of the two BglII sites present in the HBeAg gene of pTB441 and the PstI site in the vector was converted into the BTB of pTB (4) 369.
glII (5 'side) ・ PstI site, pTB
(4) 441-1 was obtained (see FIG. 13). (V) A DNA fragment between the BglII site 3 ′ of the two BglII sites present in the HBeAg gene of pTB441 and the PstI site in the vector was converted into the BTB of pTB (4) 369.
glII (5 'side) ・ PstI site, pTB
(4) 441-8 was obtained (refer FIG. 14). (Vi) A DNA fragment between the BglII site 5 ′ of the two BglII sites present in the HBeAg gene of pTB552 and the PstI site in the vector was converted into the BTB of pTB (4) 369.
glII (5 'side) ・ PstI site, pTB
(4) 552-8 was obtained (see FIG. 15).

Example 11 Escherichia coli DH1 carrying the plasmids obtained in Examples 9 and 10 was cultured in the same manner as in Example 2, and the cells were collected.
A and lysozyme were added, and a cell extract was obtained by sonication. As a result of measurement of HBcAg and HBeAg using HBe.EIA and Corezyme (Corzyme) of Abbott, pTB (4) 369 and pTB (4) 36
9-4, pTB (4) 369-32 or pTB (4) 36
E. coli DH1 carrying 9-41 is HBcAg and HBcAg.
The production of BeAg also indicates that pTB (4) 44
E. coli D carrying 1-1 or pTB (4) 552-8
H1 was found to produce HBeAg. pT
The cell extract of Escherichia coli DH1 holding B (4) 441-8 was diluted, and the antigen titer was measured using an RIA HBe measurement kit manufactured by Abbott. The results are shown below.

Example 12 Plasmids pTB (4) 369-4, pTB (4) 36
The base sequence at the 3 'end of the DNA encoding HBeAg inserted into 9-32 and pTB369-41 is shown below. Plasmid pTB (4) 441-8 lacks a site encoding the 29th to 82nd amino acids in the HBcAg gene, lacks a portion encoding 47 amino acids at the C-terminal side, and encodes 9 other amino acids. Base sequence.

Example 13 pTB (4) 441-1 or pTB (4) 552-8
The molecular weight of a product showing HBeAg antigenicity of Escherichia coli DH1 carrying E. coli DH1 was determined by Western blotting using ¹²⁵ I-anti-HBe antiserum [Towbi.
n, H, "Proceding of National Academy of Science (Proc. Natl. Acad. Sci. USA), Volume 76,
No. 9, 4350-4354 (1979)] and immunoprecipitation using human anti-HBe antiserum. That is, pTB is obtained by the Western blotting method.
(4) The molecular weight of the product of Escherichia coli retaining 441-1 was found to be 15,000 to 15,500 daltons (see FIG. 16). In addition, Escherichia coli 1 carrying pTB (4) 552-8 was cultured in M-9 medium in the presence of ¹⁴ C-amino acid, and a human anti-HBe antiserum was added to the cell extract to obtain 3 cells.
After reacting at 7 ° C, Protein A (10% solution)
Was added, and the antigen-antibody reaction product was recovered, subjected to polyacrylamide gel (17%) electrophoresis, and the molecular weight of the product was measured by autoradiography. As a result, 13,000 was obtained.
１３13,500 daltons (Fig. 1
7). The depository organization and the accession number of the transformant are as follows. Escherichia coli DH1 is a known microorganism [Selson, M .;
E. et al., Nature, 217, 1110 (1968).
Year)〕. The IFO receives the accession number of the Fermentation Research Institute, F
ERM represents the accession number of the Institute of Biotechnology and Industrial Technology of the Ministry of International Trade and Industry.

[0022]

H Be antigen according to the present invention can only be obtained from only human or chimpanzee after HBV infection in nature,
It has been limited in quantity. In addition, handling of these diseased animals involves the risk of HBV infection and is inconvenient. The present invention solves these problems, close to that antigenicity of the native, according to the present invention, an inexpensive, safe, yet large quantities H Be
A polypeptide exhibiting antigenicity is obtained.

[0023]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 147 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Valuu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Ile Thr Asn 145.

SEQ ID NO: 1 Sequence length: 147 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu 130 135 140 Arg Ala Ser 145.

SEQ ID NO: 3 Sequence length: 93 Sequence type: amino acid Topology: linear Sequence type: protein sequence Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Val Val 20 25 30 Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp 35 40 45 Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr 50 55 60 Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro 65 70 75 80 Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser 85 90.

SEQ ID NO: 4 Sequence length: 121 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser 115 120.

[Brief description of the drawings]

FIG. 1-1 shows the entire nucleotide sequence of adw-type HBV DNA, and follows FIG. 1-2.

FIG. 1-2 shows the entire nucleotide sequence of adw-type HBV DNA, and follows FIG. 1-3.

FIG. 1-3 shows the entire nucleotide sequence of adw-type HBV DNA, and follows FIG. 1-4.

FIG. 1-4 shows the entire nucleotide sequence of adw-type HBV DNA, and follows FIG. 1-5.

FIG. 1-5 shows the entire nucleotide sequence of adw-type HBV DNA, and follows FIG. 1-6.

FIG. 1-6 shows the entire nucleotide sequence of adw-type HBV DNA, and is continued from FIG. 1-7.

FIG. 1-7 shows the entire nucleotide sequence of adw-type HBV DNA, which is completed in FIGS. 1-1 to 1-7.

FIG. 2 shows the amino acid sequence of adw-type HBcAg.

FIG. 3 shows the nucleotide sequence of DNA encoding adw-type HBcAg.

FIG. 4 is a construction diagram of pTB368.

FIG. 5 is a construction diagram of a plasmid for expressing HBeAg.

FIG. 6: Escherichia coli DH1 / pTB368 in lanes 1 and 2
Western blotting of the product of
ting).

FIG. 7 shows the results of analysis of the product of Escherichia coli DH1 / pTB368 by cesium chloride equilibrium density gradient centrifugation.

FIG. 8 shows the results of analysis of the product of Escherichia coli DH1 / pTB368 by sucrose gradient centrifugation.

FIG. 9 shows the results of analysis of the product of Escherichia coli DH1 / pTB441 by sucrose gradient centrifugation.

FIG. 10: HBe (HBc) using rabbit anti-HBc antibody
9 shows the results of a RIA neutralization test.

FIG. 11 is a construction diagram of pTB (4) 369-4.

FIG. 12. pTB (4) 369-32 and pTB (4)
It is a construction diagram of 369-41.

FIG. 13 is a construction diagram of pTB (4) 441-1.

FIG. 14 is a construction diagram of pTB (4) 441-8.

FIG. 15 is a construction diagram of pTB (4) 552-8.

FIG. 16 is an analysis diagram of the molecular weight of the product of the present invention by Western blotting.

FIG. 17 is an analysis diagram of the molecular weight of the product of the present invention by immunoprecipitation.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical indication (C12P 21/02 C12R 1:19) (56) References JOURNAL OF IMMUNO LOGY, VOL. 130-6! (1983) P.S. 2903-2907 NATURE, VOL. 282 (1979-DEC-6) p. 575-579

Claims (3)

(57) [Claims] The following amino acid sequence: Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Ile Thr Asn, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser Or Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile A polypeptide exhibiting hepatitis B virus e antigenicity, comprising: Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser. 2. A promoter, downstream of the promoter,
Translation initiation codon, following amino acid sequence: Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Ile Thr Asn, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val A sn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser, Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Arg Ile Leu Glu Asp Glu Arg Ala Ser or Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Gln Asp Pro Ala Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys DNA encoding a polypeptide exhibiting hepatitis B virus e antigenicity having Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser and a stop codon immediately thereafter. Culturing a transformant containing the ligated recombinant DNA,
And recovering the polypeptide indicating the hepatitis B virus e antigenicity from the culture, preparation of polypeptides representing the hepatitis B virus e antigenicity. 3. The method for producing a hepatitis B virus e antigenic polypeptide according to claim 2, wherein the sequence between the SD sequence of the promoter and the translation initiation codon is ATCGGGC.