JP2584213B2 - DNA encoding fladierin and vector having the DNA - Google Patents

Description

Description: TECHNICAL FIELD The present invention relates to a gene encoding flagellin, and an efflux vector having a gene encoding flagellin or a part thereof.

2. Description of the Related Art With the development of genetic engineering in recent years, it has become an easy technique to integrate a gene encoding a target peptide into a vector and introduce the gene into a bacterium such as Escherichia coli to obtain a large amount of the peptide. However, since the expressed peptide is generally accumulated in the cell, the produced protein may inhibit the growth and growth of the cell, or if the protein is produced in excess, the productivity may be suppressed by negative feedback. In order to collect the target protein, the cells must first be collected and destroyed, and the target protein must be purified from the cell disruption. This cell disruption contains many impurities, some of which are harmful to the human body, and it is not always easy to obtain a pure target protein therefrom.

Proteins and secretory proteins that make up the cell membrane are synthesized as precursor polypeptides that have an amino acid sequence signal peptide at one end that is necessary to pass through the membrane inside and outside the cell. The signal peptide portion is cleaved to become an original protein molecule and exhibit its activity and function.

In order to solve the difficulty of purifying the target peptide accumulated in the cell and to improve the productivity of the target protein, the secretory system of the above-mentioned organism is used to secrete the target peptide out of the cell. Attempts have been made. For example, secretion of E. coli β-lactamase by a secretion vector having a Bacillus subtilis α-amylase promoter and signal sequence (The Journal of
Biochemistry (J. Biochem.) 95 , 87-93 (198
4)), secretion of mouse IFN-β by the vector system (Gene 34 , 1-8 (1985)), secretion production of human IFN-α by a secretion vector having an alkaline phosphatase promoter and a signal sequence of E. coli ( The Journal of Biochemistry (J. Bioche
m.) 97 , 1429-1436 (1985)).

In addition, the mechanism by which the protein synthesized inside the cell goes out of the cell is not only the secretion system described above, but also the secretion (ex.
cretion) systems are known. For example, flagellin constituting flagella of Escherichia coli is excreted from the cells by this excretion system. The secretion system differs from secretion in that the synthesized peptide does not have a signal peptide and is excreted as it is outside the cell without being cleaved by peptidase (the Journal of Bacteriology ( J. Bacteriol.) 159 , 1056−
1059 (1984)). The gene encoding flagellin of Escherichia coli is called the hag gene, and has already been cloned into pBR322 and λ-phage (Programs of the 57th Annual Meeting of the Genetics Society of Japan, p63 (1985), The Journal,
J. Bactreial. 130,736-745
(1977)), and some of its DNA sequences have already been analyzed (The Journal of Bacteriology (J. Bactre
ial.) 155 , 74-81 (1983)), but the entire sequence has not yet been determined.

Problems to be Solved by the Invention In a conventional secretory vector, the secreted peptide is limited depending on its type. That is, even if a DNA encoding a desired peptide is incorporated into a certain promoter and signal sequence, it is not secreted, but the peptide that can be secreted is constant, and there are many peptides that are not secreted even when incorporated into a secretion vector. .

The hag gene encoding flagellin of Escherichia coli has been cloned, and although its structure has been partially identified, its entire structure is still unknown. Furthermore, it has not been suggested at all that the flagellin excretion mechanism can be used for extracellular production of a target protein, and no excretion vector having a hag gene has been constructed. If the entire DNA sequence of the hag gene is elucidated, it will be easier to construct such an excretion vector.

Further, even if the target protein is secreted into the medium by the secretion vector, purification from the medium is still not easy,
If it is excreted as a hybrid protein with flagellin to form flagella and make it insoluble, collection from the medium will be easier.

Means for solving the problemThe present inventors have focused on the mechanism of flagellin excretion for a system for producing a target peptide outside the cells, determined the entire nucleotide sequence of the flagellin-encoding hag gene, and used a vector. After integration, the hag gene was cut or partially deleted, and a linker DNA was inserted therebetween. When a DNA encoding a foreign protein was inserted into the linker, it was found that the protein was excreted outside the cells as a hybrid protein with flagellin. The excreted hybrid protein forms flagella under certain conditions, making collection easier. In addition, there is a possibility that exogenous peptides that could not be produced outside the cells can be excreted depending on the secretion system.

Therefore, the present invention specifically relates to a DNA sequence substantially encoding flagellin of Escherichia coli, wherein positions 583 to 1143 of the base sequence shown in FIG. The desired sequence may be inserted into the amino acid sequence described below, or an amino acid sequence variant containing substitutions, deletions, and additions to the amino acid sequence, which has an equivalent function to the amino acid sequence A vector having the DNA sequence; and a method for producing a target peptide using the vector: [Wherein -X- is a single bond, a portion corresponding to one or more linkers, or the amino acid sequence of the peptide of interest inserted into the linker].

The DNA encoding flagellin is E. coli, Bacillus subtilis,
It can be prepared from all bacteria having flagella such as Salmonella typhimurium and bacteria of the genus Proteus. For example, the hag gene encoding flagellin of Escherichia coli can be obtained by the method of Kondo et al. (The Journal of Bacteriology (J. Bactreial.) 130 , 73
6-745 (1977)), but already pBR322 and λ
-The hag gene cloned in the phage may be used.

Hereinafter, the present invention will be described using the hag gene as an example. However, the present invention is not limited to the hag gene as long as it encodes flagellin.

A phage or plasmid having the hag gene is introduced into a strain lacking the hag gene and unable to form flagella, and is screened for its migration. The hag gene-deficient strain is obtained by the method of Kondo et al. (Genetics 84 , 403-42).
1 (1976)), or the W3623Hfla-am76 strain obtained by the method may be used. When a heterologous DNA was inserted into the hag gene, Escherichia coli K-12 C6
00r ^- m ^- hag :: Tn10 strain or Escherichia coli K-12 JA11 (Microtechnical Laboratories No. 8853) in which a kanamycin resistance gene is inserted into the chromosomal hag gene and cannot form flagella can be used.
In the examples of the present invention, the K-12C600r ^- m ^- hag :: Tn10 strain was used, but the K-12 JA11 strain deposited with the Microtechnical Laboratory was used for the additional test of the present invention. It is convenient. As shown in the following Reference Examples, the vector of the present invention can be used in the K-12 JA11 strain without any inconvenience.

Since the strain into which the complete hag gene has been introduced becomes migratory, DNA having the hag gene is prepared again from the strain showing the migratory property. That is, the strain is cultured in large quantities,
DNA containing the complete hag gene is purified by ordinary centrifugation, protein removal, ethanol precipitation, and the like.

A DNA fragment having the hag gene is cleaved from the obtained DNA with an appropriate restriction enzyme, and inserted into an appropriate vector. The restriction enzyme used depends on the DNA sequence carrying the hag gene, but it is preferable that the restriction enzyme does not cut the hag gene and cuts an unnecessary DNA portion as much as possible. Suitable vectors include pNO1523, pSC101, pRK353, pRK646, pRK248, pDF4
1, ColE1, pVH51, pAC105, RSF2124, pCR1, pMB9, pBR3
13, pBR322, pBR324, pBR325, pBR327, pBR328, pKY228
9, pKY2700, pKN80, pKC7, pKB111, pKB158, pKH47, pH
SV-106, pKK233-3, pMK2004, pACYC1, pACYC184, pU
C8, pUC9, pUC12, pUC13, pUC18, pUC19, pAT153, pUR2
22, pBT1-1, pJDB207, Homer111, pHSV-106, ptac1
2, ptrpL1, pSV-neo, cloDF13, R6K, F, RI, R6, Ent
Plasmid vectors such as p307, pC194, pE194, pSA0501, pUB110, pT127 and M13, λgt.λc, λgt.λB,
λWESλC, λWES.λB, λZJvir.λB ', λALO.λ
B, and include phage vectors and vectors constructed from these such λWES.T _s 622, it is not limited thereto, and carrying the hag gene may be any vector which can be introduced into a host. Further, the resulting vector carrying the hag gene may be miniaturized without damaging the hag gene, or the hag gene portion may be transferred to another appropriate vector.

The obtained vector was purified according to a conventional method, and the entire nucleotide sequence of the hag gene was determined. The nucleotide sequence may be determined according to the conventional Maxam-Gilbert method or dideoxynucleotide chain termination method. The entire nucleotide sequence of the hag gene is as shown in FIG. The amino acid sequence deduced from the nucleotide sequence is shown below the nucleotide sequence in FIG.

However, the present invention is not limited to the nucleotide sequence shown in FIG. 1, and the nucleotide sequence encoding the amino acid sequence shown in FIG. 1 or an amino acid sequence having an equivalent excretion effect is also within the scope of the present invention.

When the amino acid sequences at the N- and C-termini of the E. coli flagellin protein were analyzed, the N-terminus was Ala-Gln- and the C-terminus was Gly, which agreed with the amino acid sequence deduced from the nucleotide sequence. The experimental values of the amino acid composition ratio also agreed well with the theoretical values deduced from the nucleotide sequence.

To make it easier to handle as a discharge vector,
One or more appropriate linkers are inserted into the hag gene of the obtained vector. The linker may be any as long as it provides an appropriate restriction enzyme cleavage point and does not impair the secretion function of flagellin, and preferably provides a small number of restriction enzyme cleavage points in the vector, more preferably a unique restriction enzyme cleavage point. Is good. For example, when the hag gene is incorporated into pBR322, Hind III, Avr II, Bcl I, BstE I
I, Bal II, Hpa I, Kpn I, Sac I, Sac II, Sma I, Sst
A linker having a cleavage point such as I, SstII, XbaI, XhoI, or XmaI may be inserted. Insertion of such a linker makes it easier to insert a foreign gene.

The hag gene can delete a part unnecessary for excretion of a flagellin protein, and use that part for an excretion vector. Flagellin expressed by the hag gene was found to be excreted even when the central part was deleted. That is, when a vector having the hag gene whose central portion is deleted is introduced into the above-mentioned strains that do not form flagella, the strains form flagella and migrate. Further, even if a linker is inserted into a defective site in the center and a heterologous DNA is inserted into the linker, flagella can be formed, and the heterologous protein can be excreted outside the cells.

Since the central portion of the hag gene encodes a peptide portion exhibiting the antigenicity of flagellin, deletion of the central portion can be confirmed by a change in the antigenicity of flagella. In the present invention, the vector having the hag gene is randomly cleaved, the DNA is digested from the cleavage point, a linker is added, ligated and cyclized again, and introduced into Escherichia coli. A vector which is capable of migrating, ie, possessed by Escherichia coli having altered flagella antigenicity, was obtained. This vector lacks the central portion of the hag gene, has a linker inserted therein, and gives Escherichia coli the ability to form flagella. The DNA cleavage and digestion in this step was random and several different vectors with similar properties could be obtained. If this step is repeated, the cleavage point and the number of bases digested from the cleavage point are different, that is, ha
It can be easily inferred by those skilled in the art that various vectors having different deletions in the g gene can be obtained. Therefore, the present invention is not limited to the several types of vectors described in the Examples, and all vectors having the above properties as well as the vectors obtained by the above steps are included in the present invention. According to the present invention, positions 583 to 1143 (561 base pairs) of the nucleotide sequence of the hag gene shown in FIG. 9 are deleted,
Even the vector into which the 18-mer linker was inserted still had the above properties.

Further, if flagella formation is not required and only excretion of the hybrid protein outside the cells is required, the vector
It is possible to enlarge the defective site in the hag gene.

If the pHD1 mutation (see Examples) is further added to the vector of the present invention, the number of flagella of Escherichia coli increases, which is effective.

In addition, the meaning of the abbreviation used in this specification is as follows.

DNA: deoxyribonucleic acid cDNA: complementary DNA ccDNA: closed circular DNA RNA: ribonucleic acid mRNA: messenger RNA A: adenine T: thymine G: guanine C: cytosine ATP: adenosine triphosphate TTP: thymidine triphosphate GTP: guanosine triphosphate Phosphate CTP: Cytidine triphosphate dATP: Deoxyadenosine triphosphate dTTP: Deoxythymidine triphosphate dGTP: Deoxyguanosine triphosphate dCTP: Deoxycytidine triphosphate ddATP: Dideoxyadenosine triphosphate ddTTP: Dideoxythymidine triphosphate ddGTP: dideoxyguanosine triphosphate ddCTP: dideoxycytidine triphosphate DTT: dithiothreitol Ala or A: alanine Arg or R: arginine Asn or N: asparagine Asp or D: aspartic acid Cys or C: cysteine Gln or Q: glutamine Glu or E: Glutamic acid Gly or G: Glycine His or H: Histidine Ile or I: Isoleucine Leu Or L: leucine Lys or K: lysine Met or M: methionine Phe or F: phenylalanine Pro or P: proline Ser or S: serine Thr or T: threonine Trp or W: tryptophan Tyr or Y: tyrosine Val or V: valine Example Recloning of hag gene into pBR322 (A) Transduction lambda phage λpfla-H of hag gene
2 Preparation of DNA (a) Identification of λpfla-H2 phage W3 of Escherichia coli K12 strain in which the hag gene is mutated and does not form flagella
623Hfla-am76 strain (Microtechnological Laboratory No. 8619 (FERM P-861)
9), Deposit date: January 25, 1986, Genetix
ics) 84 , 403-421 (1976)) in 1% of a tryptone medium for lambda phage (Bactotripton (manufactured by DIFCO), 0.25% of sodium chloride, 0.003 of thiamine hydrochloride).
Incubate at 37 ° C overnight at pH 7.0 (before sterilization) consisting of 05%. 0.1 ml of this culture solution contains h of E. coli K12 strain KH552 strain.
λpfla-H2 phage carrying the gene containing the ag gene (J. Bacterio
l.) 130, suspected of containing several hundred 736-745 (1977))
Add 0.1 ml of the above tryptone medium and add 0.6% agar 47
3.0 ml of the above-mentioned tryptone medium at ℃ is added and overlaid on the above-mentioned tryptone plate medium containing agar 1.2%. When cultured at 37 ° C overnight, several hundred plaques were formed.

Each plaque is pierced with a sterilized Tsumaoji, pierced into a migration assay medium (the above medium containing 0.3% agar), and cultured at 37 ° C for 7 to 8 hours. Infected strains of phage that can completely transduce the hag gene form colonies with a migration zone of 3-4 cm in diameter. The medium forming the plaques forming the colonies was turned over, and several drops of chloroform were added dropwise to the lid, followed by standing at 37 ° C. for 10 minutes for sterilization.

(B) Cultivation of λpfla-H2 phage 0.1 ml of the λpfla-H2 phage in a sterilized Tsumayouji
In the above tryptone medium. To this suspension was added E. coli K12 strain C600 0.1 strain cultured overnight in the tryptone medium.
of the tryptone medium 3 containing 0.6% agar at 46 ° C.
Add ml and overlay on the tryptone medium containing 1.2% agar. After culturing at 37 ° C. for 5 to 6 hours, the C600 strain was λpfla-H2
Immediately after being almost lysed by phage, 5 ml of the above-mentioned tryptone medium is added, and the cells are further cultured for 20 to 30 minutes. After addition of a few drops of chloroform, the overlaid 0.6% soft agar was removed, transferred to a centrifuge tube together with 5 ml of the medium added later, and then added.
Centrifuge at 000 rpm for 10 minutes to obtain a supernatant. A few drops of chloroform are added to the supernatant, cultured at 37 ° C. for 5 minutes and sterilized to obtain a seed phage solution of λpfla-H2 phage. The seed phage solution was diluted 10 ⁶ to 10 ⁷ times with the tryptone medium, and 0.05 ml thereof was mixed with 0.1 ml of the C600 strain cultured overnight in the trypton medium, and 46
3 ml of the tryptone medium containing 0.6% agar at 0.6 ° C. was added, and 1.
Overlay the tryptone medium containing 2% agar. 37 per night
The number of phages per 1 ml is determined from the number of plaques appearing after culturing at ° C. A mixture of 0.1 ml of a diluted solution of the seed phage solution containing 2 × 10 ⁷ phages and 0.1 ml of a culture solution of the C600 strain cultured overnight in the tryptone medium containing 0.2% of maltose was mixed.
Leave at ℃ for 10 minutes. To this, 3 ml of the above-mentioned tryptone medium containing 0.6% agar at 46 ° C. is added, and overlaid on the above-mentioned trypton medium containing 1.2% agar. In this manner, 50 laminated flat plates were prepared. After culturing at 37 ° C for 5 to 6 hours, the C600 strain was λpfla-
Immediately after being almost lysed by H2 phage, 5 ml of the above tryptone medium is added, and the cells are further cultured for 20 to 30 minutes. After adding a few drops of chloroform, the overlaid 0.6% soft agar was taken out, transferred to a centrifuge tube together with 5 ml of the medium added later, centrifuged at 3,000 rpm for 10 minutes, and the supernatant was collected to obtain about 350 ml of a phage culture solution. .

(C) Purification of λpfla-H2 phage The above phage culture was ultracentrifuged (25,000 ppm, 4 ° C, 90 min Beckman L8-55 ultracentrifuge, # 30 rotor), the supernatant was discarded, and a small amount of TM buffer was added to the precipitate. (10 mM Tris-HCl (pH 8.
0), 10 mM magnesium sulfate). This suspension 1.3
1.7 ml of TM buffer saturated with cesium chloride at 4 ° C per ml
And ultracentrifugation (23000 rpm, 15 ° C, 40 hours,
L8-55 ultracentrifuge, SW41 rotor). The phage gathered at the center of the centrifuge tube became a band visible to the naked eye, so remove the band from the outside of the centrifuge tube with a syringe (about 1 ml), TE buffer (10 mM Tris-HCl (pH 8.0), 1m
Dialysis was performed overnight at 4 ° C. against sodium sodium ethylenediaminetetraacetate (Na ₂ -EDTA).

(D) Preparation of λpfla-H2 DNA 0.1 volume of 10-fold SSC buffer (1.5 M sodium chloride, 0.15 M sodium citrate) and 0.02 volume of 0.5 M ethylene-amine quake per 1 volume of the λpfla-H2 phage suspension. Add sodium acetate (Na ₂ -EDTA) and 0.01 volume of 20% sodium dodecyl sulfate (SDS) and keep at 37 ° C for 10 minutes. TE
Add an equal volume of phenol saturated with buffer and add 60
Perform phenol extraction of DNA for 30 minutes in a rotating rotary extractor. Then, transfer the contents to a centrifuge tube, centrifuge with a high-speed cooling centrifuge (8000 rpm, 20 ° C), transfer the supernatant to a dialysis tube,
Dialyze overnight against E buffer. The dialysis solution is transferred to a SW41 polymer centrifuge tube (Beckman), 0.1 volume of 3M sodium acetate is added, 2 volumes of cold ethyl alcohol are added, and the mixture is left overnight at -20 ° C. The precipitate is collected by centrifugation at 30,000 rpm for 60 minutes at 4.degree. The precipitate was dissolved in 400 μl of TE buffer and quantified for DNA at an absorbance of 260 nm to obtain about 300 μg of purified λpfla-H2 DNA.

(B) Estimation of the position of the hag gene on λpfla-H2 DNA (a) EcoRI digestion of λpfla-H2DNA λpfla-H2 DNA is digested with EcoRI. 20 μl of a reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM magnesium chloride, 100 mM sodium chloride, 7 mM 2-mercaptoethanol, 0.01% bovine serum albumin, and 500 ng of λpfla-H2 DNA was used at 37 ° C.
Preheated, add 5 units of EcoR I (Takara Shuzo) / 1 μl and add for 30 minutes
React at 37 ° C. Enzyme reaction stop solution (50% glycerol, 1% SDS, 0.02% bromphenol blue mixture)
After stopping the reaction by adding 2 μl, 5 μl of the reaction solution is charged onto a 0.8% agarose slab gel for electrophoresis.
Using a horizontal agarose mini gel electrophoresis apparatus (manufactured by Marisol Co., Ltd.), use an electrophoresis buffer containing 40 mM Tris-HCl (pH 8.1), 5 mM sodium acetate, and 1 mM Na ₂ -EDTA at a constant voltage of 80 V for 30 minutes. Run for ~ 60 minutes. After electrophoresis, the gel was immersed in the above buffer containing 0.5 μg / ml ethidium bromide for about 10 minutes, and irradiated with an ultraviolet lamp (280 nμ) to give DN.
Detect A band. As a result, it was found that λpfla-H2 DNA was cleaved by EcoRI into 21.3, 17.0, 5.82, and 3.54 kilobase (Kb) fragments. Similarly, when DNA of bacteriophage full Urge λC ₁ 857S7 (Takara Shuzo) EcoR I digest, 21.
Fragments of 3, 5.82 and 3.54 kb were detected, but the 17.0 kb fragment was not detected. Thus, E. coli DNA containing the hag gene
The fragment was assumed to be contained in a 17.0 kb fragment.

(B) Digestion of λpfla-H2 DNA with Sal I 500 ng of λpfla-H2 DNA was added to 10 mM Tris-HCl (pH 7.5), 7 mM
Magnesium chloride, 175 mM sodium chloride, 0.2 mM EDTA,
To a mixed solution consisting of 7 mM 2-mercaptoethanol and 0.01% bovine serum abulmin, digested with Sal I as described above,
Agarose gel electrophoresis was performed. λpfla-H2 DNA is S
It was digested by alI into 32.7 kb and 15.3 kb fragments. 15.3
Since the kb fragment is also generated by digestion of λC1857δ7 DNA with SalI, it was inferred that the DNA fragment containing the hag gene was present in a 32.7 kb fragment.

EcoR I in λplfa-H2
FIG. 2 shows the results of digestion with SalI and the estimated positions of DNA fragments derived from Escherichia coli chromosomes containing the hag gene.

(C) Cloning into vector pBR322 λpfla-H2 DNA (2.5 μg) was prepared in the same manner as for -Ba.
Digest with EcoRI in 100 μl reaction mixture. Then 70
Stop the reaction by heating at 5 ° C for 5 minutes, and add 3M sodium acetate 10μ
1) Add 220 μl of cold ethanol and leave at −20 ° C. overnight. After centrifugation (Beckman Microfuge, 10 minutes), the supernatant is discarded, and the precipitate is dissolved in 70 μl of TE buffer.

-B- was added to the EcoRI digest of the obtained λpfla-H2 DNA.
The reaction mixture and SalI are added in the same manner as in b. After completion of the reaction, perform ethanol precipitation as above.
Dissolve in 50 μl of TE buffer.

On the other hand, -B containing 2 μg of pBR322ccDNA (Takara Shuzo)
-EcoR I24 unit / 4 in 144 µl of the reaction solution prepared in the same manner as in -a
μl, 16 units of Hind III / 2 μl, and react at 37 ° C. for 30 minutes. The reaction is stopped by heating at 70 ° C. for 5 minutes, and after ethanol precipitation, the precipitate is dissolved in 100 μl of TE buffer. Then, the precipitate was ethanol-digested similarly with Sal I,
Dissolve in μl TE buffer.

2.5 μg of EcoRI and SalI digested λpfla-H2 DNA and 2
A T4 DNA ligase reaction solution containing pBR322 digested with 50 μg of EcoR I, Sal I and Hind III (66 mM Tris-HCl (pH 7.6),
6.6 mM magnesium chloride, 10 mM DTT, 1 mM ATP) 98 μl T ₄
Add 0.2 units / 2μl of DNA ligase (Takara Shuzo, Lot301)
Reaction was carried out at 22 to 23 ° C. for 6 hours, and ethanol precipitation was performed.
Dissolve the precipitate in 20 μl of TE buffer.

The above-mentioned DNA (250 ng / 20 μl) is mixed and infected with 210 μl of the competent W3623Hfla-am76 strain. Bactotripton 1% (Difco), yeast extract 0.
5. In LB medium (pH 7.0-7.2) containing 0.5% sodium chloride
After shaking culture at 37 ° C. for 1 hour, 0.1 ml thereof is uniformly spread on an LB plate medium containing 0.005% of ampicillin and 1.5% of agar. After overnight culture at 37 ° C, the grown ampicillin-resistant strain is inoculated into a migration assay medium containing 0.005% ampicillin. When the migration of 180 colonies was examined, four colonies formed a migration area. One of the four colonies was purified twice on an LB agar medium containing 50 μg / ml of ampicillin and purified to W3623Hfl.
The a-am76 (pBR322 / hag9) strain was established. W3623Hfl
a-am76 (pBR322 / hag9) has been deposited with the Institute of Microbial Industry and Technology since January 25, 1986 as Microorganisms Kenkyu No. 8620 (FERMP-8620).

(D) Examination of the structure of the recombinant plasmid pBR322 / hag9 (a) Purification of pBR322 / hag9 cc-DNA The W3623Hfla-am76 (pBR322 / hag9) strain was transformed into ampicillin 50
5 ml of LB medium containing μg / ml is inoculated and cultured with shaking at 37 ° C. overnight. This overnight culture was diluted with 50 μl of one ampicillin.
Inoculate on LB medium containing g / ml, shake culture overnight at 37 ° C, and collect by centrifugation (5000 rpm, 4 ° C, 10 minutes).

Solution I (50 mM glucose, 25 mM Tris-HCl (pH 8.
0), 20 ml of 10 mM EDTA) is added and suspended, and egg white lysozyme (manufactured by Sigma) is added and dissolved in 100 mg powder. Leave at room temperature for 10 minutes and mix occasionally. Slowly add 40 ml of solution II (0.2 N sodium hydroxide, 1% sodium dodecyl sulfate), mix and place on ice for 10 minutes. Followed by 30 ml ice-cold
Add 5M potassium acetate (pH 4.8) and place on ice for 10 minutes.
After centrifugation (10000 rpm, 30 minutes, 4 ° C.), the supernatant was collected in a 100-ml measuring cylinder, and the volume was measured. Then, it was transferred to a centrifugal tube, and 0.6 volume of isopropanol was added and mixed.
Leave at room temperature for 15 minutes. Centrifugation (10000 rpm, 30 minutes, 15 ° C)
The supernatant is discarded, 140 ml of 70% ethanol is added to the precipitate, and the mixture is centrifuged (10000 rpm, 30 minutes, 4 ° C.), and the supernatant is discarded. The precipitate is almost dried in a vacuum desiccator and dissolved in TE buffer. 50ml
Transfer to a graduated cylinder, add the volume to 30 ml, add 0.3 ml of 10% sodium lauryl sarcosinate, add 2 ml of 10 mg / ml ethidium bromide, and dissolve by adding 33.915 g of cesium chloride. After ultracentrifugation (36000 rpm, 15 ° C., 40 hours, Beckman L8-55 ultracentrifuge, VTi50 rotor), confirm the fluorescent band under an ultraviolet lamp, and insert the lower band out of the two bands from the side of the centrifuge tube. Pull out with. The contents of the syringe were then ultracentrifuged (36000 rpm, 15 ° C, 20 hours,
L8-55 ultracentrifuge, VTi65 rotor). As before, remove the lower band that fluoresces under an ultraviolet lamp with a syringe and transfer to a test tube. Extract ethidium bromide with isopropanol saturated with cesium chloride (repeat 3 times)
Dialyze the aqueous layer against TE buffer overnight.

The dialyzed sample is transferred to a tube for Betman SW50.1 rotor, 0.1 volume of 3M sodium acetate and 2 volumes of ethanol are added. After mixing, the mixture is kept at -20 ° C overnight (ethanol precipitation).

Ultracentrifugation (30,000 rpm, 4 ° C, 30 minutes, Beckman L8-55
Ultracentrifuge, SW50.1 rotor), discard the supernatant, lightly dry in a vacuum desiccator, add 0.6 ml of TE buffer, and place at 4 ° C overnight. RNase (Sigma, pretreated by heating at 96 ° C. for 10 minutes) is added to a final concentration of 10 μg / ml and left at room temperature for 1 hour.

Then, 4 ml of 1M sodium chloride-TE buffer was placed in a tube for SW50.1 rotor, the above sample was overlaid, ultracentrifuged at 40,000 rpm for 6 hours with a SW50.1 rotor, the supernatant was discarded, and the precipitate was discarded with 0.2 ml of TE buffer. Dissolve in Dilute part of it, 260mμ
Measure the absorbance of the DNA and calculate the DNA concentration.

(B) Digestion of pBR322 / hag9 cc-DNA with EcoRI and SalI The pBR322 / hag9 cc-DNA is digested with EcoRI and SalI in the same manner as for -Ba and -BB. The digest was analyzed by agarose gel electrophoresis, and it was confirmed that cc-DNA changed to linear DNA, and it was determined that each of EcoRI and SalI was cut at one site. Then, pBR322 / hag9 DNA was
After the EcoR I digestion, the reaction is stopped at 70 ° C., followed by digestion with Sal I, and the reaction is stopped at 70 ° C. When the digest was examined by agarose gel electrophoresis, about 7.5 kb, about 3.7 kb
(The DNA size marker was λCI857S7DN
A Hind III digest of A was used). The former is derived from λpfla-H2 DNA, and the latter is derived from pBR322 (FIG. 3).

(C) Digestion of pBR322 / hag9 cc-DNA with restriction enzyme BamHI 10 mM Tris-HCl (pH 8.0), 7 mM magnesium chloride, 10 mM
0 mM sodium chloride, 2 mM 2-mercaptoethanol, 0.0
To 10 μl of a reaction solution containing 1 μg of 1% bovine serum albumin and 1 μg of pBR322 / hag9 cc-DNA, 10 units / μl of a restriction enzyme BamHI was added, and the reaction was carried out in the same manner as in the EcoRI digestion of -Ba. Was considered. A HindIII digest of λC1857S7 DNA was used as a DNA size marker. This resulted in pBR322 / hag9 cc-DNA of about 5.7, 3.5, 1.8
It was cut into DNA fragments of 5 Kb in size.

Next, incomplete degradation of BamH I was performed on pBR322 / hag9 DNA completely digested with EcoRI, and incomplete degradation of BamHI was performed on pBR322 / hag9 DNA completely digested with Sal I. Position the BamHI cleavage site on the / hag9 cc-DNA. First, 1 μg of pBR322 / hag9 cc-DNA was
Digestion with EcoRI and SalI in separate tubes as for Ba and -Bb. 1 at 37 ° C
The reaction is allowed to proceed for a period of time and the reaction is stopped by heating at 70 ° C. for 5 minutes.

Next, add 1 unit / μl of BamHI to each test tube,
After 5 minutes, 5 μl is withdrawn and a reaction stop solution (50% glycerol, 1% SDS 0.02% bromphenol blue) is added. The remaining 11 µl of the reaction solution was further supplemented with 1 additional BamHI after 9 minutes.
After 10 minutes and 20 minutes after adding the unit / μ1, 5 μl of each was withdrawn and 0.5 μl of the reaction stop solution was added. Each sample
DNA generated by 0.8% agarose gel electrophoresis
Determine the size of the fragments. ΛC for DNA size marker
A Hind III digest of 1857S7 DNA was used. First, A (5.4 kb) and B in the sample 20 minutes after EcoRI complete digestion and BamHI digestion
(3.9 kb), C (1.95 kb), and D (0.73 kb) fragments were generated. In the sample that had been completely digested with EcoRI and digested with BamHI for 2 minutes (to 5 minutes), D, C, B, and B + D, A, B
+ C, B + C + D, A + C, A + B + C, A + B + C +
A fragment band corresponding to the size of D was confirmed. Meanwhile Sa
In the sample after complete digestion of lI and 20 minutes after digestion with BamHI, a (4.7 k
The fragments of b), b (3.8 kb), c (1.95 kb) and d (1.26 kb) were generated, and Sall was completely digested and BamHI digested for 2 minutes (to 5 minutes).
In the sample of, d, c, c + d, b,
a, b + c, b + c + d, a + b, a + b + c, a + b
A band of a fragment corresponding to the size of + c + d was confirmed.
FIG. 4 shows the position of the BamHI cleavage point on pBR322 / hag9 DNA.

(E) Preparation of recombinant plasmid pBR322 / hag93 First, pBR322 / hag9 cc-DNA in 10 μg / 30 μl TE buffer was
10mM Tris-HCl (pH8.0), 7mM magnesium chloride, 100m
M sodium chloride, 2 mM 2-mercaptoethanol, 0.01
BamHI 40 units / 4 μl is added to 56 μl of a reaction solution containing% bovine serum albumin, and reacted at 37 ° C. for 2 hours. After adding and mixing 60 μl of a phenol / chloroform (1: 1) mixed solution, the mixture is centrifuged with a microfuge to collect a supernatant. To this supernatant, 60 μl of a phenol / chloroform mixed solution is added again, and 60 μl of chloroform is added to the supernatant after centrifugation in a microfuge.
And mix well. Centrifuge in a microfuge and collect the supernatant. Chloroform is added to the supernatant again, and the supernatant is collected after centrifugation in a microfuge. 1/10 volume of 3M sodium acetate is added to the supernatant, and 2 times volume of ethanol is added. The mixture is kept at -20 ° C overnight. After centrifugation in a microfuge, the obtained precipitate was
Dissolve in TE buffer.

The DNA ligation reaction was performed by adding 4 μl of 33 m
250 mM Tris-HCl (pH 7.6) containing M magnesium chloride,
Add 2 μl of 100 mM ATP, 2 μl of 100 mM DTT and add T4 DNA
Ligase 1 unit / μl (Takara Shuzo: Code No. 2010B, Lot No.
Add 301) and allow the reaction to proceed at 13-15 ° C for 6 hours.

10 μl of the above reaction product was transformed into the W3623Hfla-am76 strain, and 200 colonies formed on an LB agar medium containing 50 μg / ml of ampicillin were inoculated on a migration assay medium containing 50 μg / ml of ampicillin, so that 14 strains could migrate. Found a strain. The plasmid DNA of 14 strains was digested with BamHI by the so-called rapid plasmid DNA analysis method ^{* 1} , and a plasmid lacking the B fragment of pBR322 / hag9 in FIG. 4 was found in FIG. 4 and named pBR322 / hag9. (FIG. 5).

* 1 Rapid plasmid DNA analysis A colony is inoculated into an LB medium containing 5 ml of ampicillin 50 μg / ml and cultured at 37 ° C. overnight. 1.5 ml was collected in an eppendorf tube and centrifuged in a microfuge for 1 minute. After removing the supernatant as much as possible, the precipitate was removed and 100 μl of solution I (50 mM glucose, 10 mM EDTA-2Na, 25 mM Tris-HCl (pH 8.0), 4 mg / m 2)
l egg white lysozyme (composed of Sigma). After 5 minutes at ambient temperature, 200 μl of solution II
(Comprising 0.2N sodium hydroxide, 1% SDS) is added little by little, mixed and kept in ice (0 ° C.) for 5 minutes. Then 150μ
Add 1 liter of ice-cooled 3M potassium acetate (adjusted to pH 4.8 with glacial acetic acid) and mix well. After 5 minutes at 0 ° C, 4
Centrifuge at 0 ° C in a microfuge and transfer the supernatant to a new Eppendorf tube. Add an equal volume of a mixture of phenol and chloroform (1: 1), mix, and mix with microfuge.
Centrifuge for 10 minutes and transfer the supernatant to a new Eppendorf tube. After adding 2 volumes of ethanol and mixing, allow to stand at ambient temperature for 2 minutes. Centrifuge in a microfuge for 5 minutes, discard the supernatant, and wipe off the solution remaining on the inner wall of the tube with paper as much as possible. Next, add 1 ml of 70% ethanol, mix well, and centrifuge for 5 minutes in a microfuge. The supernatant is completely removed, dried in a vacuum desiccator, and dissolved in 50 μl TE buffer containing 20 μg / ml of RNase (Sigma, heated at 95 ° C. for 10 minutes). 10μ
l to a new tube, add 1.2 μl of a 10-fold reaction mix of BamHI (100 mM Tris-HCl (pH 8.0), 70 mM magnesium chloride 1000 mM sodium chloride, 20 mM 2-mercaptoethanol, 0.1% bovine serum albumin) and add 1 unit of B
Add amHI and proceed the reaction at 37 ° C for 1 hour. After the reaction, 0.8 of the sample was analyzed by agarose gel electrophoresis.

(F) Examination of the structure of pBR322 / hag93 DNA (a) Purification of pBR322 / hag93 DNA Example from W3623Hfla-am76 (pBR322 / hag93) strain
PBR322 / hag93 cc-DNA was purified in the same manner as in Da.

(B) Digestion of pBR322 / hag93 cc-DNA with restriction enzyme Hinc II 10 mM Tris-HCl (pH 8.0), 7 mM magnesium chloride, 60 mM
mM sodium chloride, 7 mM 2-mercaptoethanol, pBR3
22 units / hag 3 units / 0.
Add 5 μl of Hinc II and react at 37 ° C. for 30 minutes. In the same manner as in Example-Ba, the size of the fragment digested with Hinc II was measured by agarose gel electrophoresis. Five types of fragments, 3.4, 1.85, 1.68, 0.53, and 0.41 kb, were generated. As a result, five Hi sites on pBR322 / hag93 cc-DNA
The cutting point by nc II was estimated at the position shown in FIG.

(C) Subcloning of the 1.68 kb Hinc II fragment into the pUC9 vector plasmid The hag gene is encoded by a 1.68 kb fragment (Example-Fb) between the Hinc II cleavage points (5) and (4). It was estimated that. This 1.68 kb fragment was subcloned into the pUC9 vector plasmid at the Hinc II fragment point.

PBR322 / hag93cc-DNA1 in the same manner as in Example-Ba
PBR322 / in 30.5 μl of a reaction containing 0 μg of EcoR I18 unit
EcoRI digestion of hag93 cc-DNA is performed. After reacting at 37 ° C for 1.5 hours, add 1M Tris-HCl (pH 8.0) 5μl to 29.5μl after the reaction.
and 63 μl of water, and 0.236 units / 2 μl of Escherichia coli alkaline phosphatase (BAP, Takara Shuzo, Lot1112) is added.
Incubate the reaction at 30 ° C for 30 minutes. Extract twice with an equal volume of phenol and chloroform (1: 1 mixture), extract twice with an equal volume of chloroform, and perform ethanol precipitation. The sediment
Dissolve in 20 μl TE buffer. To this 20 μl (10 μg DNA) sample was added 20 units of Hinc II / 4 μl, and the total volume of the reaction solution was 40 μl.
The reaction was allowed to proceed at 37 ° C. for 2 hours in the same manner as in Example-Fb. The reaction was stopped by heating at 65 ° C. for 10 minutes, ethanol precipitation was performed, and the precipitate was dissolved in 20 μl of TE buffer.

On the other hand, 5 μg of the pUC9 vector plasmid (manufactured by Pharmacia) is digested in 30 μl of a reaction solution containing 15 units of Hinc II as in the case of -Ba. The reaction is allowed to proceed for 1.5 hours at 37 ° C. and stopped by heating at 60 ° C. for 10 minutes. Perform ethanol precipitation and dissolve the precipitate in 6 μl of TE buffer.

PBR322 / h digested with EcoR I, BAP, Hinc II
In a reaction mixture containing 5 μg / 5 μl of ag93, 5 μg / 6 μl of pUC9 vector plasmid digested with Hinc II, and 0.1 unit / 1 μl of T4 DNA ligase, a ligation reaction of DNA is carried out in the same manner as in -C to transform into W3623fla-am76 strain. . Ampicillin
By inoculating colonies appearing on the LB medium containing 50 μg / ml into a migration assay medium containing 50 μg / ml of ampicillin, 12 migratory colonies were detected from 1112 transformants. These two strains were analyzed by rapid plasmid DNA analysis, and a 1.68 kb fragment was generated by Hinc II digestion.
One of the recombinant plasmids that yielded two fragments of 0.44 and 4.0 kb upon HI digestion was named pUC9 / hag6 (FIG. 7).

The pBR322 / hag93 recombinant plasmid was prepared in Example-Fb
Has a 1.68 kb Hinc II fragment as shown in
Positive direction along the transcription direction of the lac promoter of the UC9 vector plasmid (Hinc II digestion with a 1.68 kb fragment (5) → Bam
(HI ^** direction) to give the W3623Hfla-am76 strain the ability to migrate. That is, this 1.68kb
It was found that a fragment of the structural gene of the hag gene flowing in the direction of BamH I ^** from the Hinc II fragment point (5) was completely contained on the fragment of Hinc II.

(D) HindIII-BamHI of pUC9 / hag6 recombinant plasmid
Subcloning of fragment into pUC8 vector plasmid W3623Hfla-am76 (pUC9 / hag6) strain was prepared in Example-D-
pUC9 / hag6 cc-DNA was purified in the same manner as in a.

EcoR I 36 units / 6 μl, Hind III 36 units / 3 μl, Pvu II
In a 160 μl reaction solution containing 30 units / 6 μl and pUC9 / hag6 cc-DNA 15 μg / 5.1 μl, pUC9 was prepared in the same manner as in Example-Ba.
EcoRI, HindIII and PvuII triple digestion of 9 / hag6 cc-DNA was performed at 37 ° C for 2 hours. On the other hand, EcoR I18 unit / 3μ
l, Hind III 18 units / 1.5 μl, pUC8 (Pharmacia) 5 μg / 20 μl in a reaction solution containing 60 μl,
Double digestion of EcoRI and HindIII of pUC8 was performed at 37 ° C for 2 hours in the same manner as in Ba.

In both reactions, phenol / chloroform (1: 1
(Mixture)), and extracted twice with chloroform, followed by ethanol precipitation. The precipitate was dissolved in 30 μl of TE buffer for the pUC9 / hag6 reaction and 10 μl of TE buffer for PUC8. Next, a DNA ligation reaction is carried out in the same manner as in Example-C in 21 μl of a reaction solution containing 4 μg / 8 μl of digested pUC9 / hag6 DNA, 2 μg / 4 μl of digested pUC8, and 1 unit / μl of T4 DNA ligase. After completion of the reaction, the W3623Hfla-am76 strain was transformed, and a colony appeared on an LB agar medium containing 50 μg / ml of ampicillin was used to analyze the plasmid pUC8 (2.7 kb) +1.68 kb = 4.4 kb by rapid plasmid DNA analysis. Exchange plasmid cc
-Examining whether DNA is present, colony 4 having 4.4 kb cc-DNA
0 strains were selected. It was examined whether this strain exhibited migration on a migration assay medium containing 50 μl / ml of ampicillin. Result is 40
All the colonies did not show migration. This is pU
It can be seen that even if a 1.68 kb fragment was inserted in the C8 downstream of the lac promoter in the opposite direction to the flow of the lac promoter, expression of the hag gene was not observed.

Although the 1.68 kb fragment has the structural gene portion of the hag gene (Example-Fc), it shows that its own promoter region is already deleted.

One strain was selected from the above 40 strains, and the recombinant plasmid possessed was named pUC8 / hag6.
Purified as in -a.

Determination of nucleotide sequence of hag gene (A) Determination of nucleotide sequence of hag gene Example: 1.68 kbp Hinc by Fc and -Fd
Since it was found that the structural gene portion of the hag gene was encoded in the II fragment, the nucleotide sequence of the entire region of this fragment was determined.

The DNA base sequence of the 1.68 kb fragment was determined by the dideoxynucleotide chain termination method using an ordinary M13 phage vector. cc-DNA of pBR322 / hag93, pUC9 / hag6, pUC8 / hag6
Specific fragments generated by Hap II, Hinc II, Taq I, Sau3A, BamH I, and Pst I restriction enzymes (all manufactured by Takara Shuzo) (fragments indicated by arrows in FIG. 8) were converted into M13mp8, mp9, and mp18 vectors (Pharmacia). Was cloned.

Direct DN of 1.68 kbp fragment on pUC8 / hag6, pUC9 / hag6 DNA
A For sequencing, 0.1 M sodium hydroxide and 0.1 mM EDTA-2Na
The DNA was denatured with a solution containing and separated into single-stranded DNA, and then subjected to DNA sequencing by the dideoxynucleotide chain termination method.

The DNA sequencing schedule is shown in FIG. The figure is written in the direction of 5 '→ 3'.

FIG. 9 shows the entire primary structure of the hag gene obtained as a result of DNA sequencing. downstream of ATG, the start codon of the hag gene
DNA sequences up to 60 bases are known DNA sequences (J. Bacteriol.) 15
5 , 78 (1983)).

(B) Determination of amino terminal amino acid and carboxy terminal amino acid of fladierin protein (a) Purification of fladierin protein Escherichia coli K-12W3110 strain is purified on LB agar medium, and cultured at 37 ° C overnight to form colonies. A suitable colony is pierced into the culture medium for migration assay, and cultured at 37 ° C. for 4 to 5 hours.
The cells were inoculated into 100 ml of LB medium and cultured at 37 ° C. overnight. next day,
Spread 3 to 4 ml of the above overnight culture on an LB agar medium prepared on an Eiken Kaku No. 1 plate (80 × 225 mm), 37 ° C.
For overnight. The next day, a small amount of P buffer (0.15 M sodium chloride, 10 mM potassium dihydrogen phosphate-sodium hydrogen phosphate, pH 6.8) was added to the culture surface, scraped with a conical rod (manufactured by Nitsui Corporation), and added to the P buffer. Suspended.

Approximately 250 ml of suspension was obtained from 90 plates. 1
And shaken vigorously 600 times, centrifuged (8000 rpm, 15 minutes, 4 ° C.), filtered the supernatant through a funnel with glass wool, and then centrifuged (25,000 rpm,
1 hour, 4 ° C Beckman ultracentrifuge, rotor # 30)
The precipitate was suspended in about 20 ml of P buffer. Centrifugation (8000 rpm, 1
5 minutes, 4 ° C), and collect the supernatant (flagellate fraction).
After heating at 5 ° C. for 5 minutes, the mixture was centrifuged (25000 rpm, 90 minutes, 4 ° C. Beckman ultracentrifuge rotor # 30), and the supernatant (14.5 ml) was recovered to obtain a crude fragdierin fraction.

Next, it is diluted three-fold with a 10 mM potassium dihydrogen phosphate-sodium hydrogen phosphate solution (pH 6.8) containing 0.05 M sodium chloride, and applied to a DEAE-cellulose (DE52: Whatman) column. Wash with 98 ml of the above diluted solution, containing 0.05M 1
Elution is carried out with an equal concentration gradient between 0 mM potassium dihydrogen phosphate-sodium hydrogen phosphate solution (pH 6.8) and 0.7 mM containing 10 mM potassium dihydrogen phosphate-sodium hydrogen phosphate solution (pH 6.8). Fradierine was eluted at a sodium chloride concentration of 0.3 M (18.8 ml). A protein assay using bovine serum albumin as a standard protein (Biorad)
-Rad), to obtain 26.17 mg / 18.8 ml of purified fladierin.

(B) an amino terminal amino acid, a carboxy terminal amino acid,
Determination of Total Amino Acid Content Prior to analysis, the purified fladierin obtained in Example-Ba was concentrated to 6.5 mg / ml by centrifugation and dialyzed to prepare a starting sample for each analytical method.

The amino terminal amino acid is determined by ordinary Edman degradation, the N-terminal sequence is determined to be Ala (position 1) -Gln (position 2), and Ala (position 1) -Gln can be deduced from the DNA sequence in FIG.
It matches the amino acid at position (2).

Determination of the carboxy terminal amino acid was analyzed by a method using ordinary carboxypeptidase P, and determined as Gly,
This matches Gly (497th place) which can be estimated from FIG.

The analysis of the total amino acid content was performed first in 0.1% ammonia water.
6.5 mg / ml purified fladierine was dissolved. This 10μl
Then, 50 μl of 4M methanesulfonic acid containing 0.2% indoleethylamine was added thereto, and the mixture was hydrolyzed at 110 ° C. for 24 hours. Thereafter, 47 μl of 4N sodium hydroxide and 403 μl of 0.2N sodium citrate were added to obtain a sample. In each of the above analyses, analysis was performed using a Hitachi amino acid analyzer model 835. Table 1 compares the total amino acid content with the amino acid content deduced from the DNA sequence.

In vitro preparation of mutant hag gene with altered H antigenicity (A) Digestion of pBR322 / hag93 cc-DNA with DNase I pBR322 / hag93 cc-DNA (1.35 mg, 1 ml) in TE buffer
Is ethanol precipitated and dissolved in 50 mM Tris-HCl (pH 7.3). A reaction solution consisting of 125 μg of this DNA, 6 ng of DNase I (Takara Shuzo) and 50 mM Tris-HCl (pH 7.3) containing 1 mM manganese chloride was reacted at 37 ° C. for 10 minutes, and immediately an equal volume of phenol / chloroform (1: 1 mixture) was added. The reaction was stopped, and phenol and chloroform were extracted in the same manner as in Example-E. Immediately after ethanol precipitation, TE buffer
Dissolve in 200 μl.

Next, the DNA was separated by agarose gel electrophoresis, and DNA was extracted from the fluorescent band at the position of the linear monomer (pBR322 / hag digested with EcoRI as a size marker for the linear monomer).
93 DNA). The extract was precipitated with ethanol, and
g of linear pBR322 / hag93 DNA was obtained.

(B) Digestion with exonuclease Bal31 Dissolve the DNA of Example-A in 14 μl of water and 2 μl
Dispense into 7 reaction tubes each. Then 2 μl of Ba
l31 reaction solution (24 mM calcium chloride, 24 mM magnesium chloride, 200 mM sodium chloride, 40 mM Tris-HCl (pH 8.0)
Consists of 2 mM EDTA-2Na. ) And warm at 30 ° C for 3 minutes.

Bal31 enzyme solution (Takara Shuzo), 12mM calcium chloride, 12m
A diluent composed of M magnesium chloride, 100 mM sodium chloride, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA-2Na, 0.1% bovine serum albumin, 6.02 units / ml, 3.01 units / ml, 1.51 units
Unit / ml, 0.76 unit / ml, 0.38 unit / ml, 0.19 unit / ml, 0.
Dilute to 10 units / ml in 7 steps. 4 μl of Bal31 at each concentration
In addition, 200 mM ethylene glycol bis (β-aminoethyl ether) -N, N, N ′,
Add 1 μl of N'-tetraacetic acid (EGTA) and cool with ice. The contents of the seven reaction tubes were all collected, and phenol and chloroform were extracted in the same manner as in Example-E, followed by ethanol precipitation.

(C) Repair of Escherichia coli DNA polymerase I with a large fragment (Kleno-fragment) and ligation reaction in the presence of a synthetic HindIII linker The DNA of Example-B is dissolved in 3 μl of TE buffer.
3 .mu.l (about 2 .mu.g) of this DNA was mixed with 1 .mu.l, 4 .mu.l of a 10-fold nickel translation buffer (0.5 M Tris-HCl (pH 7.2), 0.1 M magnesium sulfate, 1 mM dithiothreitol, 500 .mu.g / ml bovine serum albumin). dNTP'S
(Takara Shuzo, dATP, dTTP, dGTP, dCTP each consisting of 1 mM) 1μ
1 cleno-fragment (Takara Shuzo) 3 units / 1 μl, water 1
Incubate for 30 minutes at 30 ° C in μl.

Subsequently, 10 μl of the above reaction solution, 5-fold ligation buffer (0.25 M Tris-HCl (pH 7.4), 0.05 M magnesium chloride, 5 mM spermidine, 0.5 mg / ml bovine serum albumin)
4 μl, Hind III linker (5′-CAAGCTTG, Takara Shuzo)
1 μg / 1 μl, 100 mM dithiothreitol 2 μl, 10 mM A
Incubate 2 μl of TP and 2 units / 2 μl of T4 DNA ligase at 16 ° C. for 16 hours.

(D) Transformation and Selection of Strains with Changed H-Antigeneticity The reaction product of Example-C was converted to C600r ^- m ^- ha of E. coli K12 strain.
Transform to g :: Tn10. C600r ^- m ^- hag :: Tn10 strain C600 strain (thr-1, leu-6 , thi-1, supE44, lacY1, tonA21, λ -)
Bruno r- (restrictor Chillon Minus) m ^- a (model IF Ike Chillon minus) strain is a strain which Tn10 in hag gene was inactivated inserted. Approximately 8600 shape-inverted colonies were obtained on LB agar containing 50 μg / ml of ampicillin. From about 5,000 colonies, culture at 37 ° C for 5 to 6 hours on a migration assay medium containing an anti-flagellar polymer antibody diluted 10,000-fold to the same extent as on a migration assay medium without antibody. Were isolated (12 groups (group A)). In addition, 4 strains (group B) that clearly showed migration despite the presence of the antibody at 37 ° C. for 20 hours were isolated.

Anti-flagellar polymer antibody was prepared by adding ammonium sulfate to 60% (w /
v), leave at 4 ° C overnight, and centrifuge (15000
g, 15 minutes) was suspended in P buffer (1.3 ml), and dialysis was repeated against the same buffer to use as the antigen.
The adjuvant used was incomplete from DIFCO. Rabbit (New Zealand White Female)
3 mg / wing was injected subcutaneously into the palms and thighs of both hind limbs, the same injection was performed on days 9 and 14, and the whole blood was collected from the carotid artery on day 21. After blood collection, a crude serum fraction was obtained by an ordinary method.

(E) Analysis of the hag gene of the strain with altered H antigenicity (a) Rapid plasmid DNA analysis For the groups A and B collected in Example-D, the possessed plasmid was cut with the restriction enzyme Hind III. Ruka Rapid Plasmid DNA analysis was used.

Plasmids of 4 strains from Group A and 1 strain from Group B were digested with HindIII. Since these plasmids were originally derived from the pBR322 / hag93 plasmid and did not have a HindIII breakpoint, this cleavage site was used in Example-C.
This was caused by insertion of the synthetic Hind III linker used in the above into the plasmid.

(B) Positioning of Hind III Breakpoint on Plasmid DNA Three strains were selected from among four strains of Group A of Example-Ea, and their plasmids were named pFD1, pFD2, and pFD3. B
One strain of the group was named pHD-1. The positioning of these four plasmid HindIII breakpoints was performed by rapid plasmid DNA analysis.

Rapid plasmid DN from strains with pFD1, pFD2, pFD3
The sample prepared by the A analysis method was subjected to double digestion with EcoR I and Hind III, and the size of the digest was examined by agarose gel electrophoresis.

Approximately 5.3 kbp and approximately 2.3 kbp fragments were observed in all samples. Therefore, the Hind III breakpoint is the EcoRI breakpoint (Example-
It is located at a distance of about 2.3 kbp from Fb). On the other hand, pB
It has been shown that digestion of R322 / hag93 DNA with BamHI results in fragments of about 5.8 kbp and about 1.9 kbp (-C), but digestion with BamHI followed by HindIII yields a fragment of about 1.9 kbp. Was divided into two fragments. From this, the Hind of any sample
The III breakpoint was also present at a distance of about 2.3 kbp clockwise from the EcoRI cut point, and was found to be located within the about 1.9 kbp fragment upon BamHI cut. First BamH clockwise from EcoR I cutting point
The distance to the break point I is about 0.7 kbp (-C), and further clockwise, about 0.7 kbp to the break point Hinc II (-Fb).
^{* 1} . Clockwise 1.4 kbp from the convenient EcoRI cut point corresponds to the DNA region encoding the hag gene. Ec
oR I Hi that exists about 2.3 kbp clockwise from the break point
The nd III breakpoint will be present in the DNA region encoding the hag gene (FIG. 10).

* 1 Example-Fb, Hinc II (1) in FIG.
The distance between Hinc II (5) is 1.85 kbp and EcoR I
The distance of BamHI ^* is about 0.73 kbp. On the other hand, Hinc II (1)
The distance from EcoRI to about 0.45 kbp (JGSutcliffe, 197
9, Cold Spring Harbor Lab. Symposia 43 , p.83). Therefore, the distance between BamHI ^{* and} HincII (5) is about 0.7 kbp.

The position of the HindIII breakpoint on the pHD-1 plasmid was determined in the same manner as described above. The double digestion of EcoR I and Hind III separated into fragments of about 6.4 kbp and about 1.4 kbp. Thus, the Hind III breakpoint is about 1.4 kbp from the EcoRI breakpoint. On the other hand, in double digestion of BamHI and HindIII, about 5.
Fragments of 8 kbp, 1.2 kbp and 0.7 kbp were obtained. From this, pH
The HindIII breakpoint in the D-1 plasmid was 1.4 kbp clockwise from the EcoRI breakpoint, and the HindIII breakpoint in FIG.
I (5) It was found that it was located near the cutting point. This is hag
It is near the start codon ATG of the gene.

(C) Analysis of DNA deficient sites in pFD1, pFD2 and pFD3 plasmid DNA In the process of preparing pFD1, pFD2 and pFD3 plasmids in vitro,
The cleavage point by DNase1 was slightly digested with Bal31 nuclease (Example-B). DNA deficiency due to this digestion
It should have occurred at the insertion site of the ind III DNA linker. This insertion site is located approximately 2.3 Kbp clockwise from the EcoRI cut point on the plasmid.
(5) Present in the -Ndel ^{* 1} fragment.

* 1 Restriction enzyme Nde1 cleaves 5 'CA' TATG, and this base sequence is located at nucleotide position 953 in FIG. It is about 2.4 kbp from the EcoR I breakpoint and about 1 kbp downstream from the HincII (5) breakpoint.

A sample for rapid plasmid DNA analysis containing the above four plasmid DNAs was double-digested with Hinc II and Ndel, and the resulting fragments were examined by agarose gel electrophoresis.

From FIG. 9, it can be seen that the Hinc II fragment containing the hag gene has a size of about 1.7 kbp and is divided into fragments of about 1.0 kbp and 0.7 kbp by Ndel digestion. In experiments, this fragment was pBR322 / hag93 DNA
Approximately 1020 bp in the digest, 930 bp from pFD1 DNA, pFD2 DN
A measured 990 bp and pFD3 DNA measured 990 bp. Therefore, the Hinc II (5) -Ndel DNA fragment containing Hind III is pFD
About 90 bp for 1 DNA, about 30 bp for pFD2 and pFD3 DNA, pBR322 /
It was shown to be shorter than the fragment on hag93.

(D) DNA sequencing near the Hind III breakpoint with the pFD1, pFD2, and pFD3 plasmids The pFD1, pFD2, and pFD3 plasmids were transferred to the host C600r ^- m ^- ha
g :: Tn10 strain, and ccDNA in the same manner as in Example-Da.
Was purified. Hind using this purified plasmid DNA
For DNA sequencing near the III breakpoint (FIG. 11), the dideoxynucleotide chain termination method using an ordinary M13 phage vector was used. M13mp for M13 phage vector
Using 18 (Pharmacia), double digestion of Hind III and BamHI is performed, and phenol and chloroform are extracted, followed by ethanol precipitation and dissolution in a TE buffer. Plasmid DN
A is dissolved in the TE buffer in the same manner. This digested D
Ligation of NA with T4 DNA ligase, JM105 strain (Pharmacia)
Infect and make plaque. A of Fig. 11 according to the usual method
Alternatively, M13mp18 DNA having the B fragment was prepared. As above
After cloning on the M13mp18 vector, single-stranded DNA was prepared and DNA sequencing was performed by the dideoxynucleotide chain termination method.

The hag gene carried by pFD1 lacks the nucleotide sequence at positions 754 to 854 in FIG. 9 and has a 5 'CAAGCTTG (synthetic Hind III linker) inserted, resulting in the amino acid sequence NDGT
34 amino acid residues of VTMATGATANATUTDANTTKATTITSGGTP were deleted and 3 amino acids of QAC were inserted. The hag gene carried by pFD2 lacks the nucleotide sequence at positions 719 to 765 in FIG. 9 and has a 5 'CAAGCTTG (synthetic Hind III linker) inserted, resulting in the amino acid sequence DNDGKYYAVTVANDGT.
16 amino acid residues were deleted and 3 amino acids of ASL were inserted. The hag gene carried by pFD3 is from position 778 to 83 in FIG.
The nucleotide sequence at position 6 is deleted, and 5 'CAAGCTTG (synthetic Hind III
Linker) has been inserted, resulting in the amino acid sequence
20 amino acid residues of TGATANATVTDANTTKATTI were deleted and 3 amino acids of QAC were inserted.

(E) PHD1 plasmid on Hind III cleavage point near the DNA sequencing ^{C600r - m - hag :: Tn10 (} pHD1) implemented since strain Example -D-a
The ccDNA was purified in the same manner as described above. Hi of purified plasmid DNA
DNA sequencing near the nd III breakpoint (Figure 12)
Similar to the dideoxynucleotide chain termination method using the M13 phage vector described in -Ed, single-stranded DNA of M13mp18 having the A or B fragment of FIG. 12 was prepared and performed. As a result, the hag gene carried by pHD1 lacks 8 bases of 5'AACGACTT at positions -28 to -21 in FIG.
Eight bases of CAAGCTTG (synthetic Hind III linker) were inserted. This mutation was named pHD1 mutation. pHD1 mutation is DN
A sequencing revealed that the mutation was not a mutation in the protein coding region of the hag gene. Therefore, even if the pHD1 mutation occurs, the flagellin produced by the hag gene is the same as that of the wild type, and the H antigenicity of the host does not change.

Number of flagella of host strain C600r ^- m ^- hag :: Tn10 having pHD1 plasmid C600r ^- m ^- hag :: Tn10 strain having pHD1 plasmid and pBR322 /
C600r with hag93 plasmid ^- m ^- 1 In hag :: Tn10 strain 30 ° C. of
The flagella of the cells cultured overnight were stained, and the number of cells having each flagellum count was counted under an optical microscope (Table 2).

C600r with pHD1 plasmid ^- m ^- In hag :: Tn10 strain number of flagella with the cells is increased. Both strains were -Aa
When comparing the migration ability on the migration assay medium in the same manner as
The average migration zone diameter after culturing at 37 ° C for 5 hours is pBR322
Strains with pHD1 migrate better, with 16mm with / hag93 and 36mm with pHD1. The hag gene with the pHD1 mutation on a multicopy plasmid such as pBR322
The ag gene was found to make host Escherichia coli more flagellar than that carried by pBR322.

pFD202 plasmid created (A) digestion by PFD 2 DNA nucleases ^{Bal31 C600r - m - hag :: Tn10} (pFD2) implemented since strain Example -D-a
The ccDNA was purified in the same manner as described above. pFD2 ccDNA20μg / 6.2μ
l, 10-fold Pvu II buffer (100 mM Tris-HCl (pH 7.5), 70
To a mixture of 10 μl of mM magnesium chloride, 600 mM sodium chloride, 70 mM 2-mercaptoethanol) and 73.8 μl of water, 120 units / 10 μl of a restriction enzyme Hind III are added and reacted at 37 ° C. for 1 hour. Phenol as in Example-E
Perform chloroform extraction and ethanol precipitation, and dissolve in 20 μl of 0.05% bovine serum albumin solution. 4μ of the above DNA solution
Add 4 μl of 2 fold Bal31 buffer (Example-B) to 1
Incubate for 3 minutes at ° C. Nuclease Bal31 (4
(Unit: 900 units / ml) diluted 520-fold with Bal31 buffer, 8 μl was added, and reacted at ambient temperature for 10 minutes.
Add 2 μl of 0 mM EGGTA (Example-B) and cool with ice. After phenol / chloroform extraction and ethanol precipitation, dissolve in 10 μl of TE buffer.

(B) Repair with Kleno-fragment and ligation reaction in the presence of synthetic DNA linker (Hind III-Sma I-Bal II) Sample DNA of Example-A (about 4 μl / 10 μl TE buffer) 5
To 1 μl, 1 μl of a 10-fold concentration of nick translation buffer, 4 μl of dNTP's (Example-C) and 3 units of cleno-fragment / 1 μl are added, and reacted at ambient temperature for 30 minutes. Next, a ligation buffer (Example-C) having a 5-fold concentration and a synthetic DNA linker (Hind II) were added to the above reaction solution.
I-Sma I-Bal II, 5'AAGCTTCCCGGGAGATCT3 'and 3'T
Two 18-mer polynucleotides of TCGAAGGGCCCTCTAGA5 ': chemically synthesized by solid-phase synthesis using phosphophotoesters) 0.5 μg / 1 μl, 2 μl of 10 mM ATP, 2 μl of 100 mM DTT,
2 μl of water was mixed, 2 units of T4 DNA ligase / 2 μl was added, and the mixture was reacted at 14 ° C. for 18 hours.

(C) Selection of transformant The reaction product of Example-B was used for the C600r ^- m ^- ha of E. coli K-12 strain.
g :: Tn10. L containing 50 μg / ml ampicillin
About 1200 transformed colonies were obtained on B agar. When this transformed colony was pierced into a migration assay medium containing 50 μg / ml of ampicillin and cultured at 37 ° C. for 5 to 6 hours,
About 50% showed migratory properties. Of these strains, 90 were examined by rapid plasmid DNA analysis to determine whether their plasmids were cleaved with SmaI. As a result, the plasmids of the two strains were digested with SmaI. Among them, the plasmid of one strain was named pFD202. pFD202 is Hind III, bg
It was confirmed by rapid plasmid DNA analysis that the fragment was cleaved by lII.

(D) DNA Sequencing Near the Synthetic DNA Linker Insertion Site of pFD202 Plasmid pFD202 was slightly digested with the nuclease Bal31 from the HindIII cleavage point of pFD2 as in Example-A. Therefore, the synthetic DNA linker insertion site is Hind II of pFD2.
This is near the I breakpoint, and this portion is included in an approximately 900 bp fragment generated when the plasmid is double-digested with Hinc II and Pst I.

(A) pFD202DNA of Hinc II-Pst I by double digestion ^{C600r - m - hag :: Tn10 (} pFD202) from strain, Example -D
The ccDNA was purified as in -a. pFD202ccDNA23μg /
10 μl, 10 μl of 10-fold concentrated Pvu II buffer, 10 μl of 70 mM 2-mercaptoethanol, 5 μl of 0.2% bovine serum albumin, 60 units of Hinc II / 10 μl, 96 units of Pst I / 6 μl were added to make a total volume of 100 μl, and the mixture was made up to 100 μl for 80 minutes at 37 ° C. Let react. After completion of the reaction, 10 μl of a 5 × sample buffer (sucrose 25%, sodium acetate 5 mM, sodium dodecyl sulfate 0.1%, bromophenol blue 0.05%) was added, and the whole amount was electrophoresed on a 0.8% agarose gel at 100 V for 4 minutes. After staining with 0.5 μg / ml ethidium bromide, a gel containing a band of about 900 bp is cut out. Electroelution was performed twice at 10 V for 10 minutes using Max Yield, and the precipitate was dissolved in 200 μl of TE buffer after ethanol precipitation.

(B) Double digestion of Hinc II-Pst I of M13mp8 DNA 3 μg / 30 μl of M13mp8 RF DNA, 10 times concentration of Pvu II buffer 10
μl, 70 mM 2-mercaptoethanol 5 μl, water 40 μl
Hinc II 18 units / 3μl, Pst I32 units / 2μ
After 1 hour of reaction at 37 ° C., phenol / chloroform extraction and ethanol precipitation are performed, and the resultant is dissolved in 21 μl of TE buffer.

(C) Cloning of Hinc II-Pst I fragment into M13mp8 vector and DNA sequencing 10 μl of TE buffer containing Hinc II-Pst I fragment of Example-Da, 3 μl of sample of Example-D-b (approximately 430ngDN
A) 5 μl concentration of ligation buffer 4 μl, 100
T4DN was added to 21 μl of a reaction solution containing 2 μl of mMDTT and 2 μl of 10 mM ATP.
A reaction solution containing 1 unit of A ligase / 1 μl was reacted at 14 ° C. for 18 hours, and the whole amount was transformed into JM109 strain (Takara Shuzo).

After cloning into the M13mp8 vector, single-stranded DNA was prepared, and DNA sequencing was performed by the dideoxynucleotide chain termination method. As a result, the hag gene carried by the pFD202 plasmid lacked 78 base pairs (positions 711 to 788 in FIG. 9) compared to the wild-type hag gene, had 18 base pairs inserted, and had 26 natural amino acids. It was found that it was deleted and six artificial amino acid sequences were inserted.

pFD301, pFD303, pFD306, pFD307 plasmid creating (A) digestion by PFD3 DNA nucleases ^{Bal31 C600r - m - hag :: Tn10} (pFD3) implemented since strain Example -D-a
The ccDNA was purified in the same manner as described above. pFD3ccDNA50μg / 12μ
l, 10 μl of Pvu II buffer solution (25 μl) and water (188 μl) were mixed with the restriction enzyme Hind III (300 units / 25 μl).
Let react for hours. After the reaction, in the same manner as in Example-E,
Phenol / chloroform extraction followed by ethanol precipitation was carried out and dissolved in 25 μl of water. To 5 μl of this reaction solution (about 2 μg DNA / μ1), 12.5 μl of 0.2% bovine serum albumin solution and 32.5 μl of water were added, and a final DNA concentration of about 200 ng / μl was added.
A 0.05% bovine serum albumin solution was used. 20 μl of this solution
Add 20 μl of 2Bal31 buffer to and incubate at 30 ° C. for 30 minutes. Nuclease Bal31 (1700 units / ml) Bal31
Add 40 μl of 1140-fold diluted solution using diluent, and add
After reacting at ambient temperature for 100 minutes, add 100 mM
Add 5 μl of GTA and cool on ice. After phenol / chloroform extraction and ethanol precipitation, it was dissolved in 10 μl of water.

(B) Repair with cleno-fragment and ligation reaction in the presence of synthetic DNA linker (HindIII-SmaI-BglII) 10-fold concentration of nick translation buffer 1.5 with 10-fold concentration of sample DNA of Example-A (about 1 μg / 10 μl) μl, dNT
Add 2 μl of P's and 3 units / 1 μl of Kleno-fragment and react at ambient temperature for 30 minutes. Subsequently, 3.7 μg of a synthetic DNA linker (Hind III-Sma I-Bgl II) was added to the reaction solution.
/ 5 μl, 7 μl of 100 mM DTT, 3 μl of 10 mM ATP, 1 μl of 500 mM Tris-HCl (pH 7.3) and 1.5 μl of water were mixed, and 2 units / 2 μl of T4 DNA ligase was added thereto, followed by reaction at 15 ° C. for 18 hours.

(C) Selection of Transformant The reaction product of Example-B was dialyzed against a TE buffer for about 4 hours, and then transformed into Escherichia coli K12 strain C600r ^- m ^- hag :: Tn10. About 560 colonies of the transformed strain were obtained on LB agar containing 50 μg / ml of ampicillin. Pick this colony 50 ampicillin
Strain into the migration assay medium containing μg / ml, and strains showing slight migration were also regarded as migrating and picked up.
Got the strain. With respect to these 23 strains, it was examined whether or not the plasmid possessed by them was cleaved with the restriction enzyme SmaI, and 4 strains were obtained. Plasmids of these four strains are called pFD301, pFD303, pFD306, pFD3
Named 07. Rapid plasmid DNA analysis confirmed that these four species were also cleaved by Hind III and Bgl II.

(D) DNA sequencing near the synthetic DNA linker insertion site of the pFD301, pFD303, pFD306, and pFD307 plasmids pFD301, pFD303, pFD306, and pFD307 were prepared from the HindIII cleavage point of pFD3 in the same manner as in Example-A.
PFD301, pFD30
3, pFD306, pFD307 synthetic DNA linker insertion site is pFD3
Near the Hind III cutting point. Therefore, for DNA sequencing of the synthetic DNA linker insertion site, two fragments A 'and B' of Hind III-Hinc II (FIG. 13) may be sequenced from the Hind III cleavage point.

(A) Hinc I of pFD301, pFD303, pFD306, pFD307 ccDNA
I, HindIII double digestion C600r with pFD301, pFD303, pFD306, pFD307 ^- m ^- ha
ccDNA was purified from g :: Tn10 strain in the same manner as in Example-Da. 5μg of ccDNA of pFD301, 5μ of 10 times Pvu II buffer
l, 70 mM2-mercaptoethanol 5 μl, Hinc II 30 units / 5 μl, Hind III 50 units / 5 μl, add water to make 50 μl
The reaction mixture was incubated at 37 ° C. for 1 hour, extracted with phenol / chloroform, precipitated with ethanol, and dissolved in 10 μl of water. Similar processing was performed for pFD303, pFD306, and pFD307.

(B) Double digestion of M13mp18 RFDNA with Hinc II and Hind III 2.5 μg / 5 μl of M13mp18 RFDNA, 5 μl of 10-fold Pvu II buffer
l, 70 mM2-mercaptoethanol 5 μl, water 25 μl, add Hinc II 30 units / 5 μl, Hind III 50 units / 5
After adding 1 μl and reacting at 37 ° C. for 1 hour, phenol / chloroform extraction and ethanol precipitation were carried out and dissolved in 10 μl of water.

(C) Cloning of Hinc II-Hind III fragment into M13mp18 vector and DNA sequencing Example-Hinc II-Hind III fragment of Da 1.5 μg / 3
μl, Example-Db sample 0.5 μg / 2 μl, 5 × concentration of ligation buffer 4 μl, 100 mM TTT 2 μl, 1
T4 DNA ligase 2 was added to the reaction mixture containing 2 μl of 0 mM ATP and 5 μl of water.
The reaction solution was incubated at 15 ° C. for 18 hours, and the whole amount was transfected into JM109 strain (Takara Shuzo). 10 plaques are collected and a single-stranded DN is prepared according to a standard method.
A was prepared. The reaction product obtained by double digestion of the double-stranded DNA with Hinc II and Hind III was examined by 1.6% agarose gel electrophoresis using a double digest of Hind II and Hind III of pFD3cc DNA as a DNA fragment size control. After that, pFD3ccDN
Both the A and B fragments derived from A (FIG. 13) have disappeared, and instead, two types of fragments A ′, which are smaller than the A and B fragments,
B 'was observed. Single strand cloning both fragments
DNA samples were prepared using the dideoxynucleotide chain termination method.
Sequencing was performed. As a result, the hag gene carried by the pFD301 plasmid was 56
As a result of deletion of one base pair (positions 583 to 1143) and insertion of 18 base pairs, it was found that 187 natural amino acids were deleted and 6 artificial amino acid sequences were inserted. (FIG. 14A). hag to carry pFD303, pFD306, pFD307
The gene sequences are shown in FIGS. 14B, 14C and 14D.

Preparation of plasmids pFD311, pFD313 and pFD315 Plasmids were prepared in the same manner as in Examples -A, -B, -C and -D, except that the reaction time of nuclease Bal31 was set to 5 minutes, to obtain pFD311, pFD313 and pFD315. . The DNA sequence of each plasmid is shown in FIGS. 15A, B and C.

Polypeptide HBsA using pFD1 vector plasmid
Emission of flagellin chimerized from gI (A) Cleavage of cc-pFD1 by restriction enzyme Hind III and repair by cleno-fragment 10 mM Tris-HCl containing 20 μg of cc-pFD1 DNA (pH 7.
5) 100 units of the restriction enzyme Hind III are added to a reaction solution containing 7 mM magnesium chloride and 60 mM sodium chloride, and reacted at 37 ° C. for 30 minutes. After phenol / chloroform extraction and ethanol precipitation, dissolve in 20 μl of TE buffer.

2 μl of 10-fold nick translation buffer and 2 μl of 2NTP (each XTP is 1 mM) in 20 μg / 20 μl TE buffer of the above DNA
l, 3 units of Kleno-fragment / 1 μl, add at room temperature
Incubate for 30 minutes. Add 1 μl of 500 mM EDTA, extract with phenol / chloroform, precipitate with ethanol, and add 20 μl of TE.
Dissolved in buffer.

(B) Annealing of synthetic polynucleotide Chemically synthesized polynucleotide RTH-1603 (5'ACAAAACCT
ACGGATGGAAATGG3 ′) About 20 μg / 100 μl water and RTH-1604
(5 'CCATTTCCATCCGTAGGTTTTGT3') About 20μg / 100μl
After adding 20 μl of a 10-fold concentration of TE buffer to water and keeping the temperature at 60 ° C. for 30 minutes, annealing was performed by gradually lowering the temperature to 28.5 ° C. over 6 hours.

(C) Ligation of chemically synthesized DNA to pFD1 vector 1 μg / 1 μl of the sample DNA of Example-A, 180 pmol / 13 μl of the synthetic DNA of Example-B, 4 μl of a 5-fold ligation buffer, 5.6 units of T4 DNA ligase / 2 μl, At 16 ° C
After reacting for 16 hours, the mixture is dialyzed against TE buffer for 2 hours.

(D) Selection of transformed strain The sample DNA of Example-C was transformed into C600r ^- m ^- hag :: Tn10 strain. On LB medium containing 50 μg / ml ampicillin,
3.8 × 10 ⁴ ampicillin-resistant colonies appeared per 1 μg of pFD1 DNA. 90 of the colonies were examined for migratory activity, and 82 strains showed migratory activity. Rapid DNA analysis was performed on 62 strains, and strains # 11 and ## whose plasmids were not cleaved by the restriction enzyme Hind III were analyzed.
A total of five stocks, 12, 12, 14, and 17, were selected. The plasmids of the five strains were respectively named pFD1 / HBsAg-I # 11 and # 1.
Named 2, # 14, # 16, # 17.

(E) Chemical synthesis inserted into pFD1 / HBsAg-I plasmid
Sequencing of DNA portion The chemically inserted DNA fragment of the pFD1 / HBsAg-I plasmid is the third fragment from the largest molecular size of the fragments generated by digestion with the restriction enzymes Hinc II and Pst I. include.

(A) Double digestion of pFD1 / HBsAg-I plasmid with Hinc II and Pst I An LB medium containing 50 μg / ml of ampicillin and 5 strains # 11, # 12, # 14, # 16 and # 17 of Example-D Culture in 10 ml for 1 day to make a sample for rapid DNA analysis of each strain. Dissolve the sample in 150 μl TE buffer.

To the above sample, 22 μl of 10-fold Pvu II buffer, 22 μl of 70 mM 2-mercaptoethanol, 0.2% bovine serum albumin 1
1 μl, 80 units of Hinc II / 10 μl, 96 units of Pst I / 12 μl are added, and the reaction is allowed to proceed at 37 ° C. for 1 hour.

Concentrate to 100 μl with a centrifugal evaporator (Sakuma Seisakusho), add 10 μl of sample buffer, and perform 0.8% agarose gel electrophoresis. The third fluorescent band from the largest in terms of molecular size is cut out, subjected to electroelution, precipitated with ethanol, and dissolved in 15 μl of TE buffer.

(B) Double digestion of M13mp18 FR DNA with Hinc II and Pst I Instead of M13mp8 RF DNA, M13mp18 RF DNA 2μg / 4μ
l-Db except that 66 μl of water was added.
Double digestion with Hinc II and Pst I was performed in the same manner as described above.

(C) Cloning of Hinc II-Pst I Fragment into M13mp18 Vector and DNA Sequencing Example—Employed on 4 μl of DNA samples of strains # 11, # 12, # 14, # 16 and # 17 of Ea Example-DNA of Eb
Add 4 μl (400 ng) of sample, 4 μl of 5 × ligation buffer, 2 μl of 100 mM DTT, 2 μl of 10 mM ATP, 1 μl of water
1, 1 unit of T4 DNA ligase / 1 μl was added thereto and reacted at 16 ° C. for 16 hours, and the whole amount was transfected into JM109 strain.

After cloning into the M13mp18 vector, single-stranded DNA was prepared, and DNA sequencing was performed by the dideoxynucleotide chain termination method. As a result, the structure of the chemically synthesized DNA portion in each strain plasmid was determined as follows.

Polypeptide HBsA using pFD1 vector plasmid
Emission of flagellin chimerized from g-II (A) Cleavage of cc-pFD1 by restriction enzyme Hind III and repair by cleno-fragment In the same manner as in Example-A, cc-pFD1 was replaced with the restriction enzyme Hind.
Cut with III and repaired with Kleno-fragment.

(B) Annealing of synthetic polynucleotide RSM-2103 (5'ACA) as a chemically synthesized polynucleotide
AACCTTCGGATGGAAATGG3 '), RSM-2104 (5'CCATTTCCA
Annealing was carried out using TCCGAAGGTTTTGT3 ') in the same manner as in Example-B.

(C) Ligation of chemically synthesized DNA to pFD1 vector Chemical synthesis to pFD1 vector in the same manner as in Example-C
The DNA was ligated.

(D) Selection of transformed strain The sample DNA of Example-C was transformed into C600r ^- m ^- hag :: Tn10 strain. On the LB medium containing 50 μg / ml ampicillin, 2 × 10 ⁴ ampicillin-resistant colonies appeared per 1 μg of pFD1 DNA. Among them, 68 colonies were examined for migration, and 43 strains showed migration. Of the 16 strains, rapid plasmid analysis of the plasmids of the strains was performed in the same manner as in Example-D, and # 1, # 2,
The plasmids of the strains # 3, # 6, # 8, # 13, and # 16 were not cut by Hind III. Plasmids of this strain were called pFD1 / HBsAg-II # 1, # 2,
3, # 6, # 8, # 13, and # 16.

(E) Chemical synthesis inserted into pFD1 / HBsAg-II plasmid
DNA sequencing DNA sequencing was performed using pFD1 / HBsAg-II # 1, pFD1 / HB
The sAg-II # 13 plasmid was used in the same manner as in Example-E. Chemically synthesized DNA in both plasmids
The structure of the part is shown below.

Increase in flagella number due to pHD1 mutation (A) pFD1, pFD1 / HBsAg-I, pFD1 / HBsAg from dam ^- bacteria
-II plasmid cc-DNA Preparation C600r ^- m ^- in hag :: Tn10 strain pFD1, pHD1, pFD1 / HBsAg- I
# 11, prepare sample DNA for rapid DNA analysis of strains each having pFD1 / HBsAg-II # 1. Using each DNA sample, GM33dam ^- the strain was transformed, GM33dam ^- (pFD1), GM33
^{dam - (pHD1), GM33dam -} (pFD1 / HBsAg-I # 11), GM33
dam ^- to establish a (pFD1 / HBsAg-II # 1 ) strain. CcDNA was purified from each strain in the same manner as in Example-Da.

(B) EcoRI-Bcl1 from pHD1 plasmid (about 1.4 kbp)
Preparation of DNA Fragment 10-fold Bc to 29.7 μg / 25 μl of cc-pHD1 DNA of Example-A
11 buffer solution (500 mM Tris-HCl (pH 8.0), 100 mM magnesium chloride, 500 mM sodium chloride) 20 μl, 70 mM 2-mercaptoethanol 20 μl, 0.2% bovine serum albumin 10
μl, 75 units of EcoR I / 10 μl, and 105 μl of water were added, and the reaction was allowed to proceed at 37 ° C. for 1 hour.
Incubate for 1 hour at ° C. After the reaction, 189 µl of the sample buffer and 20 µl of the sample buffer are mixed, and 0.8% agarose gel electrophoresis is performed. The fluorescent band corresponding to 1.4 Kbp was cut out and electroeluted in the same manner as in Example-Ea.
Dissolve in 30 μl of TE buffer.

(C) pFD1, pFD1 / HBsAg-I # 11, pFD1 / HBsAg-II # 1
Digestion, alkaline phosphatase (BAP) treatment, partial digestion with Bcl1 Example-A cc-pFD1 DNA, cc-pFD1 / HBsAg-I #
11DNA or cc-pFD1 / HBsAg-II # 1 DNA 40μg / 40μl
10 times EcoRI buffer (1 M Tris-HCl (pH 7.5), 70 mM
Magnesium chloride, 500mM sodium chloride) 16μl, 70m
Add 16 μl of M2-mercaptoethanol, 8 μl of 0.2% bovine serum albumin and 60 μl of EcoRI 60 units, and carry out the reaction at 37 ° C. for 30 minutes. Add water to make up to 160 μl.
Let react for hours. Next, 1 M Tris-HCl (pH 8.
0) Add 6μl, BAP1.2 unit / 10μl, water 25μl, 65 ℃
And react for 30 minutes.

After phenol / chloroform extraction, perform ethanol precipitation and dissolve in 100 μl of TE buffer. Then, 8 μl of 10-fold Bcl1 buffer was added to 8 μg DNA / 20 μl of each sample, 0.2%
Bovine serum albumin 4μl, water 44μl, Bcl12 unit / 4μ
Then, the reaction is allowed to proceed at 50 ° C. for 40 minutes, extracted with phenol / chloroform, precipitated with ethanol, and dissolved in 40 μl of TE buffer.

(D) Ligation reaction About 90 ng / 30 μl of the sample DNA of Example-B, Example-C
Sample DNA of 800ng / 4μl, 10 times ligation buffer 3μl, 100mMDTT3μl, 10mMATP3μl, water 12μl in T4D
NA ligase (2 units / 2 μl) is added and reacted at 16 ° C. for 16 hours.

(E) Transformation The sample DNA of Example-D was dialyzed against TE buffer for 3 hours and then used for transformation of C600r ^- m ^- hag :: Tn10. 50μg / ml
PFD1 DNA1μ after operation in LB medium containing ampicillin
2.6 × 10 ⁵ per g, per μg of pFD1 / HBsAg-I # 11 DNA
3.75 × 10 ⁵ pieces, 2.4 × 10 per 1 μg of pFD1 / HBsAg-II # 1 DNA
^Five colonies were obtained.

(F) Migratory properties of transformed colonies and presence / absence of HindIII breakpoint on plasmids of these strains The transformed strains of Example-E were examined for migrating properties. 45 obtained by transformation of engineered pFD1
Of the strains, 11 showed migration. pFD1 / HBsAg-I # 1
1. From pFD1 / HBsAg-II # 1, 12 out of 45
The strain was migratory. DNA samples for rapid DNA analysis of these 11, 12, and 12 strains were prepared. 7 μl of sample DNA for rapid DNA analysis, 1 μl of 10-fold EcoRI buffer, 70 mM 2−
Mercaptoethanol 1 μl, 0.2% bovine serum albumin 0.5 μl, EcoR I4 unit / 0.5 μl, Hind III 5 unit / 0.5
The reaction was performed at 37 ° C. for 30 minutes with μl. DNA fragments generated by 0.8% agarose gel electrophoresis were examined. From 11 strains obtained from pFD1, a plasmid producing three fragments containing 1.4 Kbp and 0.7 kbp was found, named pHFD1, and a strain having this plasmid was purified to purify C600r ^- m ^- hag :: Tn10 (pHFD1 ) Established as. From 12 strains obtained from pFD1 / HBsAg-I # 11
Find a plasmid that produces two fragments containing 1.4 Kbp and
FD1 / HBsAg-I # 11, a strain having this plasmid was purified, and C600r ^- m ^- hag :: Tn10 (pHFD1 / HBsAg-I # 1
1) established as. Similarly, manipulated pFD1 / HBsAg-II
From 12 strains obtained from # 1, a plasmid producing two fragments containing 1.4 Kbp was found, named pHFD1 / HBsAg-II # 1, and a strain having this plasmid was purified to obtain C600r ^- m ^- ha
g :: Tn10 (pHFD1 / HBsAg-II # 1).

(G) PHD1 migratory C600r dependent mutation into a plasmid having hag gene with ^{- m - (pBR322), C600r} - m - hag :: Tn10 (pFD3), C
600r ^- m ^- hag :: Tn10 (pHFD1), C600r ^- m ^- hag :: Tn10 (pHFD
1 / HBsAg-I # 11), C600r ^- m ^- hag :: Tn10 (pHFD1 / HBsAg
-II # 1) was examined for migration. 5 shares to 50
Purify to LB medium containing μg / ml ampicillin,
Culture overnight and inoculate the resulting colonies into a migration assay medium (1% bactotryptone, 0.25% sodium chloride, thiamine 5 μg / ml, 0.3% agar, pH 7.0) containing 50 μg / ml ampicillin. After culturing at 37 ° C. and 30 ° C., the diameter of the migration zone after 6 hours was examined (Table 3).

pHFD1, pHFD1 / HBsAg-I # 11, pHFD1 / HBsAg-II # 1
And migration ability of hag :: Tn10 strain is always better migration than the strains with PHD3, wild strain C600r ^{- -} m ^- C600r with close to (pBR322) ^- m.

Elimination of flagellin chimerized from polypeptide HBsAg-III using pFD1, pFD303, pFD306, pFD307, pFD311, and pFD315 vector plasmids (A) cc-pFD1, cc-pFD303, cc-pFD306, cc-pFD30
7, Cleavage of cc-pFD311 and cc-pFD315 by restriction enzyme HindIII and repair by Kleno-fragment cc-pFD1, cc-pFD303, cc-pFD306, cc-pFD307, cc
Each of -pFD311 and cc-pFD315 was cut with the restriction enzyme HindIII in the same manner as in Example-A, and repaired with Kleno fragment.

(B) Assembly of synthetic polynucleotide Chemically synthesized polynucleotide HBsAgA-1 ^{* 1} , HBsAgA-
2 ^{* 2} , HBsAgA-3 ^{* 3} , HBsAgA-4 ^{* 4} , HBsAgA-5
^{* 5} was synthesized by the solid phase phosphoramidite method using ZEON GENET A-II (Zeon).

* 1 5'TTGACACGTATCCTCACAATACCGCAGTC3 '* 2 5'ACTAGACTCGTGGGG3' * 3 5'GAGGATACGTGTCAA3 '* 4 5'CTAGTGACTGCGGTATTGT3' * 5 5'CCCCACGAGT3 'HBsAgA-2 (500pM / 12.2AgM
12.2 μl) and HBsAgA-4 (500 pM / 15.4 μl) were placed in three Eppendorf 1.5 ml tubes, each containing 19.
Add 8 μl, 19.8 μl, 16.6 μl. Subsequently, 10 μl of 10-fold kinase buffer I (0.5 M Tris-HCl (pH 7.6), 0.1 M magnesium chloride, 50 mM dithiothreitol, 1 mM spermidine, 1 mM EDTA), γ- ³² PATP (5000 Ci / mM: 10 μC)
/ μl, Amalsham) 1μl, 10μMATP5μl, T4 polynucleotide kinase (Takara Shuzo) 2μl
Warm for minutes. Further, 2.5 μl of 1 mM ATP and 5 units / 2 μl of T4 polynucleotide kinase are added, reacted at 37 ° C. for 1 hour, heated at 90 ° C. for 5 minutes, and rapidly cooled in ice.

The reaction products HBsAgA-2, HBsAgA-3, HBsAgA-4 and HBsAgA-1 (500 pM / 23.5 μl), HBsAgA-5 (500 p
M / 8.1 μl), put into a dialysis membrane (Spectra Pore / Molecular weight cut-off 1000, Spectrum Medical Industries) and dialyze in water at 4 ° C. overnight. Transfer to an Eppendorf 1.5 ml tube and concentrate with a centrifugal evaporator. Dissolve in 15 μl of Tris-HCl (pH 7.6), 10 mM magnesium chloride, warm at 60 ° C. for 30 minutes, and slowly return to room temperature over 6 hours. 5x ligation buffer
16 μl, 200 mM TTT 4 μl, 10 mM ATP, T4 DNA ligase 22.4
Add unit / 8 μl and water 37 μl and proceed with the reaction at 15 ° C. for 16 hours. After electrophoresis on a 15% polyacrylamide gel, the band was detected by autoradiography, the band at 44 bp was cut out, placed in a 1.5 ml tube of Eppendorf, crushed with a glass rod, added with 1 ml of water, and added at 4 ° C for 16 hours. Extract. After centrifugation, the supernatant (about 700 μl) is concentrated using a centrifugal evaporator. After concentrating to about 200 μl, centrifuge again to remove gel residues.

(C) pFD1, pFD303, pFD306, pFD307, pFD311, pFD315
Ligation of chemically synthesized DNA to Example 500-500 ng / 1 μl of the sample DNA of Example-A, 250 μM / 100 μl of the synthetic DNA of Example-B, 4 μl of 5-fold ligation buffer, 2 μl of 200 mM DTT, 2 μl of 10 mM ATP, 2 μl of T4 DNA ligase, and 4 μl of water. Let the reaction proceed for 16 hours.
After dialysis against TE buffer, the entire amount was used for transformation.

(D) Selection of transformed strain and presence or absence of migratory property The sample DNA of Example-C was used to transform C600r ^- m ^- hag :: Tn10 strain. 5 × 10 ⁴ colonies / 1 μgpFD1 DNA, 2 × 10 ⁵ colonies on LB medium containing 50 μg / ml ampicillin
/ 1μgpFD303DNA, 1.8 × 10 ⁵ colonies / 1μgpFD306DNA, 2.
3 × 10 ⁴ colonies / 1μgpFD307 DNA, 1.3 × 10 ⁵ colonies / 1μ
gpFD311 DNA, 8 × 10 ⁴ colonies / 1 μgpFD315 DNA appeared.

The migration of 100 colonies from each group was examined on a migration assay medium, and the migrated colonies were cultured overnight in LB medium containing 50 μg / ml of ampicillin, and HindIII digestion on the plasmid of the strain was performed. The presence or absence of points was examined. The HindIII restriction point on the vector side was cut with HindIII, followed by Kleno-
Synthetic DNA HBsAg-I
When II is inserted in the forward direction and T is supplied from the 5 'end of the synthetic DNA, the Hind III restriction point is restored. On the other hand, if not inserted or inserted in the opposite direction, there is no Hind III restriction point. Therefore, when cutting with Hind III and Sst II (the Sst II restriction point is located at a relatively short distance downstream of the insertion point), if a small fragment is generated, the synthetic DNA is inserted in the forward direction, and the small fragment is inserted. If not, the synthetic DNA has not been inserted or has been inserted in the opposite direction. From the above, it is possible to estimate the presence or absence of the synthetic DNA inserted in the forward direction.
Double digestion of dIII and SstII was performed. 8 μl of DNA sample,
10-fold Sst II buffer (500 mM Tris-HCl (pH 8.0), 100 mM
Magnesium chloride, 500mM sodium chloride) 2μl, 70m
M2-mercaptoethanol 2μl, Hind III 10 units / 1μ
l, 7 units of Sst II / 1 μl, double digestion with 6 μl of water, 5% polyacrylamide gel electrophoresis (150 V, 95
After that, the cells were stained with ethidium bromide to examine the presence or absence of a fluorescent band corresponding to a small fragment. As a result, 2
Each strain was able to establish a migratory strain into which the synthetic DNA was inserted in the forward direction. These strains contain the peptide Leu-Thr-Arg-Ile-Leu-Thr-Ile-Pro-Gln-S which is a peptide encoded by a chemically synthesized DNA portion (HBsAg-III) inserted on a plasmid.
Flagellin chimerized from er-Leu-Asp-Ser-Trp-Gly is excreted as flagella.

Elimination of flagellin chimerized from polypeptide HBsAg-IV using pFD1, pFD303, pFD306, pFD307, pFD311, and pFD315 vector plasmids (A) cc-pFD1, cc-pFD303, cc-pFD306, cc-pFD30
7, Cleavage of cc-pFD311, cc-pFD315 by restriction enzyme HindIII and repair by Kleno-fragment In the same manner as in Example-A, cc-pFD1, cc-pFD303,
cc-pFD306, cc-pFD307, cc-pFD311 and cc-pFD315 were cut with the restriction enzyme HindIII and repaired with Kleno fragment.

(B) Assembly of synthetic polynucleotides Chemically synthesized polynucleotides HBsAgB-1 ^{* 1} , HBsAgB-
2 ^{* 2} , HBsAgB-3 ^{* 3} , HBsAgB-4 ^{* 4} , HBsAgB-5
^{* 5} , HBsAgB-6 ^{* 6} is synthesized in the same manner as in Example-B.

* 1 5'TTGGTTCTTCTGGATTAT3 '* 2 5'CAGAAGAACCAA3' * 3 5'CAAGGTATGTTGCCCGT3 '* 4 5'AACATACCTTGATAATC3' * 5 5'TTGTCCTCTAGG3 '* 6 5'CCTAGAGGACAAACGGGC3'HBsAgBpH5S H
BsAgB-3 and HBsAgB-4 were each taken at 500 pM / 13.8 μl into four Eppendorf 1.5 ml tubes, and water was added to each of 22.3 μl, 22.3 μl, 18.2 μl, 18.2 μl
Add one by one. In the same manner as in Example-B, the 5 'end of the synthetic polynucleotide is phosphorylated. With all of the above reactants
14.6 μl of each of HBsAgB-1 and HBsAgB-6 are mixed and ligated in the same manner as in Example-B. Next, the sample after the ligation reaction is separated by polyacrylamide electrophoresis to obtain 200 μl of sample DNA.

(C) pFD1, pFD303, pFD306, pFD307, pFD311, pFD315
Ligation of chemically synthesized DNA to HBsAg-I to a vector molecule in the same manner as in Example-C.
V DNA is ligated and the entire reaction is used for transformation.

(D) Selection of transformed strain and presence or absence of migratory activity Using the sample DNA of Example-C, C600r ^- m ^- hag :: Tn10
The strain was transformed. 4.4 × 10 ⁴ colonies / 1 μg pFD1 DNA, 2.9 × 10 ⁴ colonies on LB medium containing 50 μg / ml ampicillin
Colony / 1 μg pHD303 DNA, 3.8 × 10 ⁴ colonies / 1 μg pF
D306 DNA, 3.2 × 10 ⁴ colonies / 1 μg pFD307 DNA, 1.4 × 1
0 ⁵ colonies / 1 μg pFD311 DNA, 5.8 × 10 ⁴ colonies / 1 μg
pFD315 DNA appeared. In the same manner as in Example-B, six migrating bacterial strains were selected from each group, and two bacterial strains having a plasmid into which chemically synthesized DNA HBsAg-IV was inserted in the forward direction were established for each of the bacterial strains. These strains are peptides Leu-Val-Leu-Le encoded by a chemically synthesized DNA portion (HBsAg-IV) inserted on a plasmid.
u-Asp-Tyr-Gln-Gly-Met-Leu-Pro-Val-Cys-Pr
Flagellin obtained by chimerizing o-Leu-Gly is excreted as flagella.

Reference example E. coli using plasmid pBR322 / hag93 cc-DNA
Transformation of strain JA11 Escherichia coli strain JA11 (Microtechnical Laboratories No. 8853) was transformed by the method of Hanahan et al. (D. Hanahan, Journal of Molecular Co., Ltd.).
Biology (J. Mol. Biol.), 166 , 557-580 (198
3) Culture to make competent. The cc-DN of plasmid pBR322 / hag93 was prepared by dissolving 210 μl of competent cells of the JA11 strain prepared at −70 ° C. and dissolved in 20 μl of TE buffer in 0 ° C. ice prepared by the method of Hanahan et al.
Add A200ng. After placing in 0 ° C. ice for 30 minutes and heating at 42 ° C. for 100 seconds, 0.8 ml of SOC culture solution is added, followed by shaking culture at 37 ° C. for 1 hour. After the culture, the bacterial solution is diluted 10 ⁴ , and 0.1 ml thereof is spread on an LB agar medium containing 50 μg / ml of ampicillin. After culturing overnight at 37 ° C., 52 colonies appeared. This result indicates that the JA11 strain was transformed at an efficiency of 2.6 × 10 ⁷ colonies per μg of cc-DNA of pBR322 / hag93.

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence of the hag gene encoding flagellin of Escherichia coli and the amino acid sequence deduced therefrom. FIG. 2 shows the results of digestion of λpfla-H2 with EcoR I and Sal I, and the hatched portion shows the estimated position of the DNA fragment derived from the Escherichia coli chromosome containing the hag gene. Fig. 3 shows pBR322 / ha
The result of digestion of g9 with EcoR I and Sal I is shown. 4th
The figure shows the BamHI breakpoint of pBR322 / hag9. Figure 5 shows pBR32.
The plasmid pBR322 / hag93 lacking the 2 / hag9 B fragment is shown. FIG. 6 shows five Hinc II cleavage points on pBR322 / hag93. FIG. 7 shows pUC9 / hag6. Figure 8 is hag
1 shows a schedule for gene sequencing. Fig. 9
The entire primary structure of the hag gene obtained as a result of DNA sequencing is shown. FIG. 10 shows a simple restriction enzyme map of pFD1, pFD2 and pFD3. FIG. 11 shows a DNA sequencing schedule near the Hind III breakpoint of pFD1, pFD2, and pFD3. Twelfth
The figure shows the DNA sequencing schedule near the Hind III breakpoint of pHD1. FIG. 13 shows pFD3 and pFD301. 14th
The figure shows the hag carried by pFD301, pFD303, pFD306 and pFD307.
1 shows a sequence of a gene. FIG. 15 shows the sequence of the hag gene carried by pFD311, pFD313 and pFD315.

 ──────────────────────────────────────────────────続 き Continuation of the front page (72) Inventor Shin-Yu 3-110, Koryo-cho, Kita-ku, Kobe (56) References Bacteriology, Vol. 155, no. 1, P. 74-81 (1983)

Claims (10)

(57) [Claims] 1. A DNA sequence which substantially encodes flagellin of Escherichia coli, comprising 5% of the nucleotide sequence shown in FIG.
Positions 83 to 1143 have been deleted, and the desired sequence may have been inserted into the deleted portion, the amino acid sequence described below, or the substitution or deletion of one or several amino acids in the amino acid sequence, DNA sequence encoding an amino acid sequence variant containing an addition and having an equivalent function to the amino acid sequence: [Wherein -X- is a single bond, a portion corresponding to one or more linkers, or the amino acid sequence of the peptide of interest inserted into the linker]. 2. The DNA according to claim 1, wherein -X- is a portion corresponding to one or more linkers.
Array. 3. The DNA sequence according to claim 1, wherein the flagellin is derived from Escherichia coli. 4. The DNA sequence according to claim 1, wherein said E. coli is E. coli K-12 strain. 5. The DNA sequence according to claim 4, wherein said E. coli K-12 strain is HK552 strain. 6. A DNA sequence substantially encoding flagellin of Escherichia coli, comprising 5% of the nucleotide sequence shown in FIG.
Positions 83 to 1143 have been deleted, and the desired sequence may have been inserted into the deleted portion, the amino acid sequence described below, or the substitution or deletion of one or several amino acids in the amino acid sequence, A vector having a DNA sequence encoding an amino acid sequence variant containing an addition and having an equivalent function to the amino acid sequence: [Wherein -X- is a single bond, a portion corresponding to one or more linkers, or the amino acid sequence of the peptide of interest inserted into the linker]. 7. The vector according to claim 6, wherein -X- is a portion corresponding to one or more linkers. 8. The vector according to claim 6, wherein the flagellin is derived from Escherichia coli. 9. The vector according to claim 6, wherein said E. coli is E. coli K-12 strain. 10. The vector according to claim 9, wherein said E. coli K-12 strain is HK552 strain.