JP2023547887A - safe harbor loci - Google Patents

Abstract

Provided herein are safe harbor loci, as well as methods for identifying and using safe harbor loci. Safe harbor loci exhibit high knock-in efficiency and allow stable increased expression of the transgene. TIFF2023547887000137.tif40170

Description

Cross-references to related applications This application is filed in U.S. Provisional Patent Application No. 63/179,143, filed on April 23, 2021; No. 926, and U.S. Provisional Patent Application No. 63/105,834, filed October 26, 2020, the entire contents of which are hereby incorporated by reference for all purposes. Incorporated.

SEQUENCE LISTING This application contains a Sequence Listing filed via EFS-Web and incorporated herein by reference in its entirety. The ASCII copy was created on October 15, 2021, is named ANB-203WO_SequenceListing, and is 623,177 bytes in size.

Cancer continues to present a significant clinical burden despite substantial research efforts and scientific advances in cancer therapy. Blood and bone marrow cancers are frequently diagnosed cancer types (including multiple myeloma, leukemia, and lymphoma). Current treatment options for these cancers are not effective for all patients and/or may have substantial adverse side effects. Other cancer types also remain difficult to treat using existing treatment options. Cancer immunotherapy is a promising solution because it is highly specific and allows for improved therapeutic efficacy and reduced side effects.

Genetically engineered immune cell therapy is a growing field with promising applications for the treatment of diseases including but not limited to cancer. By modifying coding and/or non-coding genomic regions, researchers can introduce transgenes and inserts into cells that facilitate, for example, enhancing cell function, arresting cell growth, inducing cell death, and reducing tumor size/volume. The site has been identified. Identification of safe harbor sites (SHS) has improved the outcomes of genome engineering therapies. Well-known SHS include the AAVS1 adeno-associated virus insertion site on chromosome 19, the human homolog of the mouse Rosa26 locus, and the CCR5 chemokine receptor gene, the absence of which confers HIV resistance. (See, e.g., Pellenz et al., 2018, the related disclosure of which is incorporated herein by reference). However, improvements in gene editing therapies and additional SHS guidelines are needed to address challenges such as low knock-in (KI) efficiency, insertional carcinogenesis, unstable and/or aberrant expression of the transgene and/or adjacent genes. The need still exists.

The present disclosure is particularly directed to safe harbor loci that exhibit high knock-in efficiency and stable expression of their transgenes. These safe harbor loci can be used to engineer T cells for immunotherapy. These safe harbor loci are useful in treating various diseases including cancer.

In one aspect, the present disclosure provides an engineered cell comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus, the safe harbor locus comprising: Expression of at least one sequence encoding a transgene at any one or more of the sgRNA target loci listed in Table 4 is operably linked to an exogenous promoter. provide. In another aspect, the present disclosure provides an engineered cell comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus, wherein the safe harbor locus is , at any one or more of the sgRNA target loci listed in Table 4, in which expression of at least one sequence encoding a transgene is operably linked to an exogenous promoter. I will provide a.

In some embodiments, the target loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000 , chr2:87460000~87470000, chr3:186510000~186520000, chr3:59450000~59460000, chr8:127980000~128000000, and chr9:7970000~7980000 . In some embodiments, the target loci are selected from chr10:72290000-72300000, chr11:128340000-128350000, chr15:92830000-92840000, and chr16:11220000-11230000. In some embodiments, the target locus is chr11:128340000-128350000. In some embodiments, the target locus is chr15:92830000-92840000. In some embodiments, the target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, The gene is selected from SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.

In some embodiments, the safe harbor loci are GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106 , GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120. In some embodiments, the safe harbor locus is any of the integration sites in Table 4 designated GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. or one of the following. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site of Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site in Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS91, GS92, and GS93.

In some embodiments, the exogenous promoter is the EF1a promoter. In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. In some embodiments, the transgene encodes a recombinant protein, optionally a therapeutic agent. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR).

In another aspect, the disclosure provides a composition comprising an engineered cell described herein and a pharmaceutical excipient.

In another aspect, the present disclosure provides a guide ribonucleic acid (gRNA) for editing a cell at a safe harbor locus, the gRNA comprising any one of the sgRNA sequences of Table 4. provide.

In some embodiments, the gRNA comprises any one of SEQ ID NOs: 1-120. In some embodiments, the gRNA comprises any one of SEQ ID NOs: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO: 94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102. In some embodiments, the cell is a stem cell, human cell, primary cell, hematopoietic cell, adaptive immune cell, innate immune cell, T cell, or T cell precursor.

In another aspect, the disclosure provides a method of editing a cell having chromosomal DNA, the method comprising inserting at least one sequence encoding a transgene into a safe harbor locus in the chromosomal DNA of the cell, the method comprising: Provided are methods, wherein the harbor locus is any one or more of the sgRNA target loci listed in Table 4.

In some embodiments, the target loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000 , chr2:87460000~87470000, chr3:186510000~186520000, chr3:59450000~59460000, chr8:127980000~128000000, and chr9:7970000~7980000 . In some embodiments, the target loci are selected from chr10:72290000-72300000, chr11:128340000-128350000, chr15:92830000-92840000, and chr16:11220000-11230000. In some embodiments, the target locus is chr11:128340000-128350000. In some embodiments, the target locus is chr15:92830000-92840000. In some embodiments, the target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, The gene is selected from SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.

In some embodiments, the safe harbor loci are GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106 , GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120. In some embodiments, the safe harbor locus is any of the integration sites in Table 4 designated GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. or one of the following. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site of Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site of Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS91, GS92, and GS93.

In some embodiments, the transgene encodes a recombinant protein, optionally a therapeutic agent. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR). In some embodiments, at least one sequence includes an exogenous promoter, and the exogenous promoter is operably linked to the transgene. In some embodiments, the exogenous promoter is the EF1a promoter. In some embodiments, the cell is a stem cell, human cell, primary cell, hematopoietic cell, adaptive immune cell, innate immune cell, T cell, or T cell precursor. In some embodiments, at least one sequence is inserted using homologous recombination repair. In some embodiments, at least one sequence is inserted using specific insertion that is independent of homologous recombination. In some embodiments, at least one sequence is inserted using one or more guide ribonucleic acids (gRNAs) and one or more Cas9 endonucleases.

In some embodiments, the one or more gRNAs include any one of SEQ ID NOs: 1-120. In some embodiments, the one or more gRNAs include any one of SEQ ID NOs: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO: 94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102.

In another aspect, the disclosure provides a method of editing a T cell, comprising: editing a T cell with one or more guide ribonucleic acids (gRNAs), at least one sequence encoding a transgene, and one or more Cas9 end contacting with a nuclease, the one or more gRNA and the Cas9 endonuclease facilitate insertion of at least one sequence into the chromosomal DNA within the safe harbor locus, the safe harbor locus being the sgRNA of Table 4. A method is provided in which the target locus is selected from any one or more of the target loci.

In some embodiments, the one or more gRNAs include a sequence selected from any one of the sgRNA sequences in Table 4. In some embodiments, the one or more gRNAs include any one of SEQ ID NOs: 1-120. In some embodiments, the one or more gRNAs include any one of SEQ ID NOs: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO: 94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102.

In some embodiments, the target loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000 , chr2:87460000~87470000, chr3:186510000~186520000, chr3:59450000~59460000, chr8:127980000~128000000, and chr9:7970000~7980000 . In some embodiments, the target loci are selected from chr10:72290000-72300000, chr11:128340000-128350000, chr15:92830000-92840000, and chr16:11220000-11230000. In some embodiments, the target locus is chr11:128340000-128350000. In some embodiments, the target locus is chr15:92830000-92840000. In some embodiments, the target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, The gene is selected from SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.

In some embodiments, the safe harbor loci are GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106 , GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120. In some embodiments, the safe harbor locus is any of the integration sites in Table 4 designated GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. or one of the following. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site of Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site of Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS91, GS92, and GS93.

In another aspect, the disclosure provides an ex vivo method of obtaining an engineered cell or population thereof, comprising: (a) obtaining the cell; and (b) placing at least one sequence encoding a transgene at a safe harbor locus. genetically modifying the cell by inserting into the sgRNA target loci of Table 4, wherein the safe harbor locus is selected from any one of the sgRNA target loci of Table 4.

In some embodiments, obtaining the cells includes (i) collecting a tissue sample from the subject, (ii) isolating the cells from the tissue sample, and (iii) culturing the cells in vitro. and, including. In some embodiments, the tissue sample is a blood sample. In some embodiments, the cell is a stem cell, human cell, primary cell, hematopoietic cell, adaptive immune cell, innate immune cell, T cell, or T cell progenitor cell (T cell precursor). In some embodiments, at least one sequence is inserted using homologous recombination repair. In some embodiments, at least one sequence is inserted using specific insertion that is independent of homologous recombination.

In some embodiments, genetically modifying in step (b) comprises contacting the cell with one or more guide ribonucleic acids (gRNAs), at least one sequence, and one or more Cas9 endonucleases. , one or more gRNAs, and a Cas9 endonuclease facilitate insertion of at least one sequence into chromosomal DNA within the safe harbor locus. In some embodiments, the one or more gRNAs include a sequence selected from any one of the sgRNA sequences in Table 4.

In some embodiments, the transgene encodes a recombinant protein, optionally a therapeutic agent. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR). In some embodiments, at least one sequence includes an exogenous promoter, and the exogenous promoter is operably linked to the transgene. In some embodiments, the exogenous promoter is the EF1a promoter.

In yet another aspect, the present disclosure provides a method of treating a subject having or at risk of having a disease, comprising: administering to the subject an effective amount of an engineered cell described herein, a population thereof; , or a composition described herein. In some embodiments, cells, populations thereof, or compositions are administered to a subject by injection.

In yet another aspect, the present disclosure provides a method of treating a subject having or at risk of having a disease, the method comprising: (a) performing any one of the methods described above; (b) administering to a subject a composition comprising an effective amount of a cell or population thereof. In some embodiments, the composition is administered to a subject by injection. In some embodiments, the disease is cancer. In some embodiments, the disease is a blood cancer.

In another aspect, the present disclosure provides a method for identifying safe harbor loci, comprising: identifying the coding region; (b) a linear correlation between the genes or non-coding regions from step (a) and the knock-in (KI) efficiency and estimating the KI efficiency of any gene or coding region on the chromosome; generating a model; and (c) selecting a safe harbor locus based on a threshold parameter, wherein the saver locus is selected for inserting into the cell at least one sequence encoding a transgene. provide a method for

In some embodiments, the threshold parameters include stable expression of the transgene, knockout of the gene confers a benefit on cell function, no known function in the cell, presence or absence of CD3/CD28 stimulation. No stable transgene expression in vitro, negligible off-target cleavages detected by iGuide-Seq or CRISPR-Seq, fewer off-targets compared to other loci detected by iGuide-Seq or CRISPR-Seq Targeted cleavage, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible regulation of neighboring genes. including one or more of deactivation or silencing, and locating outside the cancer-associated gene. In some embodiments, stable expression of a transgene at a safe harbor locus is a 2-fold or less expression change over at least 1, 2, 3, 4, 5, 6, or 7 days, and the expression change is Measured by the average fluorescence intensity of the reporter gene encoded by at least one sequence. In some embodiments, chromatin accessibility is measured using a transposase-accessible chromatin assay using sequencing (ATAC-seq). In some embodiments, the level of expression across developmental states of the cell is measured using RNA sequencing (RNA-seq).

In some embodiments, the cell is a stem cell, human cell, primary cell, hematopoietic cell, adaptive immune cell, innate immune cell, T cell, or T cell precursor. In some embodiments, the linear model has a coefficient of determination ( ^R2 value) of at least 30%.

In yet another aspect, the present disclosure provides an engineered cell, composition, gRNA, or method described herein, wherein insertion within a safe harbor locus increases cytotoxicity of diseased cells. , engineered cells, compositions, gRNAs, or methods.

In yet another aspect, the present disclosure provides an engineered cell, composition, gRNA, or method described herein, wherein the knock-in efficiency at a safe harbor locus is compared to other locations along a chromosome. Provided are highly engineered cells, compositions, gRNAs, or methods.

These and other features, aspects, and advantages of the invention will become better understood with respect to the following description and accompanying drawings.

FIG. 1 includes a schematic diagram illustrating the methodology used to identify safe harbor loci in this disclosure, in some embodiments. See explanation of Figure 1-1.

Figures 2A-C contain schematic diagrams showing the top three safe harbor loci known in the art. AAVS1 (Figure 2A), CCR5 (Figure 2B), and Rosa26 (Figure 2C). These figures are from Sadelain, M. , et al. (2012). Safe harbors for the integration of new DNA in the human genome. Retrieved from Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.

Roth, T. L. , et al. 2019. Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. includes a schematic diagram outlining data described in bioRxiv, 604561, the related disclosure of which is incorporated herein by reference in its entirety.

Figures 4A-4B contain heatmaps of samples clustered based on activation status and cell type, generated using processed RNA-seq data. FIG. 4A includes a sample heatmap generated using processed RNA-seq data. FIG. 4B contains a heatmap sample generated using processed RNA-seq data showing clustering of approximately 20k genes.

5A-5B contain plots generated using processed RNA-seq data. FIG. 5A is based on Roth, T. L. , et al. Includes a plot showing the direct correlation between transcriptional expression data from 2019 and transcriptional expression data generated by the inventors of the present disclosure. Figure 5B contains a heatmap showing the top 10% expressed gene clusters.

Contains heatmaps of samples generated using processed ATAC-seq data.

Contains a plot showing signal enhancement at transcription start sites (TSS) generated using processed ATAC-seq data of coding regions. Contains a plot showing signal enhancement in peak size distribution generated using processed ATAC-seq data of coding regions.

Contains a plot showing open chromatin regions around the TRAC locus.

Contains a plot showing the KI (knock-in) efficiency of the coding region/gene with GFP as reporter.

Contains a plot showing KI efficiency of coding regions/genes with tNGFR as reporter.

Plot showing scaled KI efficiency of 90 genes for d2 (day 2) RNA-seq data, d4 (day 4) RNA-seq data, and ATAC-seq data utilized in predictive linear model. including.

Contains a plot showing chromatin accessibility of top candidate non-coding regions as measured using ATAQ sequencing.

Contains a plot showing cell counts of GFP controls used to evaluate candidate KI loci. Contains the pmax(GFP_high) reading of the GFP control used for evaluation of candidate KI loci.

Contains a plot showing maximum episomal GFP expression (GFP_high) readings for non-targeted controls. Includes non-targeted control cell counts from donors 1, 2, and 3.

Includes cell counts and maximum GFP expression (GFP_high) readings for WT controls.

Contains plots showing cell counts and maximum GFP expression (GFP_high) readings when construct expression was driven by the endogenous promoter using sgRNA5 targeting the B2M safe harbor locus.

Contains plots showing cell counts and maximum GFP expression (GFP_high) readings when construct expression was driven by the EF1a promoter using sgRNA5 targeting the B2M safe harbor locus.

Figure 18 includes plots showing cell counts and maximum GFP expression (GFP_high) readings when sgRNA79 was used to target the TRAC safe harbor locus and construct expression was driven by the endogenous promoter. See explanation of Figure 18-1.

Figure 19 includes plots showing cell counts and maximum GFP expression (GFP_high) readings when construct expression was driven by an exogenous promoter using sgRNA79 targeting the TRAC safe harbor locus. See explanation of Figure 19-1.

Figure 20 contains plots showing TCR (T cell receptor) versus GFP across all donors and time points when using sgRNA79 and the construct is driven by the endogenous promoter. See explanation of Figure 20-1. See explanation of Figure 20-1. See explanation of Figure 20-1.

Figure 21 contains plots showing TCR versus GFP across all donors and time points when using sgRNA79 and the construct is driven by an exogenous promoter. See explanation of Figure 21-1. See explanation of Figure 21-1.

Figure 22 includes plots showing cell counts and maximum GFP expression (GFP_high) readings when construct expression was driven by the endogenous promoter using sgRNA83 targeting the TRAC safe harbor locus. See explanation of Figure 22-1.

Contains plots showing cell counts and maximum GFP expression (GFP_high) readings when construct expression was driven by an exogenous promoter using sgRNA83 targeting the TRAC safe harbor locus.

Figure 24 contains plots showing TCR vs. GFP across all donors and time points when sgRNA83 is used and the construct is driven by the endogenous promoter. See explanation of Figure 24-1. See explanation of Figure 24-1. See explanation of Figure 24-1.

Figure 25 contains plots showing TCR vs. GFP across all donors and time points when sgRNA83 is used and the construct is driven by an exogenous promoter. See explanation of Figure 25-1. See explanation of Figure 25-1.

Includes a plot illustrating potential sources of variation observed between replicates and donors (eg, edge effects and electroporation errors).

Includes a plot illustrating potential sources of variation observed between replicates and donors, e.g. related to inherent differences between donors.

Includes a plot illustrating potential sources of variation observed between replicates and donors, e.g. related to gating error.

Figure 29 includes plots showing GFP mean fluorescence intensity (GFP MFI) and KI efficiency for the top KI loci evaluated with endogenous promoters.

See description of Figure 29-1. Figure 30 includes plots showing GFP mean fluorescence intensity (GFP MFI) and KI efficiency for the top KI loci evaluated at the EF1a promoter. See explanation of Figure 30-1.

Figures 31A-31C contain plots showing all significant KI loci (top KI loci) evaluated in the endogenous and EF1a promoters. Figure 31A contains a plot showing that expression from the EF1a promoter was approximately 10-fold higher than expression from the endogenous promoter. Figure 31B contains a plot showing all significant KI loci (top KI loci) evaluated in the endogenous and EF1a promoters. Figure 31B shows the top KI loci ranked by GFP MFI at week 3. See description of FIG. 31B-1. Figure 31C contains a plot showing all significant KI loci (top KI loci) evaluated in the endogenous and EF1a promoters. Figure 31C shows the top integration loci ranked by GFP MFI (weeks 3 and 4; donors 1-3). See description of FIG. 31C-1.

Contains a plot showing several target loci and their measured transgene expression levels. Includes plots showing transgene (Prime Receptor (PrimeR)) and TCR expression for control and insertion at GS94, GS102, and TRAC loci.

Figure 33A contains a plot showing PrimeR levels measured for the indicated integration sites. FIG. 33B contains a schematic diagram showing the GS94 integration site on chromosome 11.

Contains plots showing CAR induction and primeR expression of engineered T cells after 48 hours of co-culture with K562-CD19 cells. Contains plots showing cytotoxicity and cytokine secretion levels of engineered T cells co-cultured with K562-CD19/MSLN cells for 48 hours.

FIG. 35A includes a schematic showing an experimental outline for evaluating the effect of integration site on cytotoxicity. Figure 35B contains a plot showing the measured cytotoxicity of engineered T cells co-cultured with K562 CD19+/MSLN+ or K562 CD19-/MSLN+ cells for 48 hours.

FIG. 36A includes a schematic showing an experimental outline for assessing the effect of integration site on cytokine secretion. Figure 36B contains a plot showing measured cytokine levels of engineered T cells co-cultured with K562 CD19+/MSLN+ cells for 48 hours.

Includes a schematic diagram showing in vitro experiments performed to determine the effect of integration site on primeR-independent CAR expression. "Flow" refers to flow cytometry and "restim" refers to repetitive CD3/CD28 stimulation of engineered T cells. "EP" refers to electroporation.

Figures 38A and 38B contain plots showing the stability of PrimeR expression over time when using the indicated integration sites. "Flow" refers to flow cytometry and "restim" refers to repetitive CD3/CD28 stimulation of engineered T cells. "EP" refers to electroporation. In Figure 38B, PrimeR expression is normalized to expression from using the TRAC integration site.

Includes a schematic diagram illustrating the iGuide-Seq assay technique. Includes a plot showing on-target efficiency using the iGuide Seq assay for the indicated integration sites. Includes a schematic diagram from an iGuide-Seq analysis showing that GS94 had no putative off-targets that were reproducible across two donors.

Contains a schematic diagram showing the iGuide-Seq workflow and data.

Contains plots showing rhAmp-seq analysis of putative off-target sites identified by iGUIDE-seq and upregulation.

Contains plots showing RNA-seq analysis of cells with GS94, GS102, and TRAC knock-ins of the CD19/MSLN circuit. Scatter plot of gene expression in cells with integrations at the GS94 locus (y-axis) versus cells with integrations at either the TRAC or GS102 loci (x-axis) in two donors. Yellow dots correspond to ETS1 and FLI1. Genes found to be differentially expressed using edgeR are in blue (fold change >0, FDR-corrected p-value <0.01, mean counts per million across conditions compared at least 2). ).

Contains a plot showing the absence of cytokine-independent growth in cells with CD19/MSLN circuit KI in GS94.

A diagram of the 8.3 kb cassette inserted into the GS94 safe harbor locus is shown.

Expression of an 8.3 kb transgene circuit containing priming receptor and CAR in K562 cells is shown.

We show that non-viral editing generated poorly differentiated T cells.

DETAILED DESCRIPTION The present disclosure exhibits high integration efficiency (e.g., high knock-in (KI) efficiency), high and constant levels of transgene expression, and such advantages independent of T cell activation/differentiation status. Safe harbor loci and methods for identifying safe harbor loci are provided. In some embodiments, safe harbor loci also exhibit minimal or no disruption to T cell function and/or capacity for product manufacturing. In some embodiments, these loci are useful for effective and safe integration and expression of transgenes in T cells (eg, CAR T therapy). In some embodiments, the methods described herein can be used to identify safe harbor loci for insertion of transgenes in other cell types.

FIG. 1 illustrates the overall approach used by the inventors of the present disclosure to identify safe harbor loci. In some embodiments, the present disclosure includes the identification of genes within the genome and within non-coding regions that have sustained expression in treated cells (e.g., T cells) as a function of T cell chromatin state and computer analysis. A method is provided for predicting candidate integration sites using a predictive model of KI efficiency. The method determines the actual KI efficiency, the sustained level of transgene expression of the transgene, and the minimal impact on therapeutic cell phenotype (e.g., T cell function and/or capacity for expansion and production of therapeutic products). further comprising evaluating the candidate integration site for disruption of the method. In some embodiments, a safe harbor locus allows integration of a transgene driven by an endogenous promoter. In some embodiments, a safe harbor locus allows for the integration of a transgene driven by an exogenous promoter (eg, the EF1a promoter).

To facilitate understanding of this disclosure, several terms and phrases are defined below. Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by one of ordinary skill in the art. Generally, the pharmacology, cell and tissue culture, molecular biology, cell and cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, genetics, and proteins and nucleic acids described herein The terminology and techniques used in connection with chemistry are well known and commonly used in the art. In case of conflict, the present specification, including definitions, will control.

Unless otherwise defined, all technical terms, notations, and other scientific terms used herein are intended to have the meanings that are commonly understood by those of ordinary skill in the art. In some cases, terms that have commonly understood meanings are defined herein for clarity and/or ease of reference, and the inclusion of such definitions herein is not necessarily intended. , and should not be construed as representing any difference from what is commonly understood in the art. The techniques and procedures described or referenced herein are generally well understood and are described, for example, in Sambrook et al. , Molecular Cloning: A Laboratory Manual 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY using routine methodologies, such as the widely used molecular cloning methodologies described in J.D. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Procedures involving the use of commercially available kits and reagents, as appropriate, are generally performed according to manufacturer-defined protocols and conditions, unless otherwise specified.

As used herein, the singular forms "a," "an," and "the" refer to the plural unless the context clearly dictates otherwise. contains the referent of. Terms such as "include", "such as", etc. are intended to convey inclusion without limitation, unless expressly stated otherwise.

As used herein, the term "comprising" also specifically includes embodiments "consisting of" and "consisting essentially of" the listed elements, unless stated otherwise.

The term "about" refers to and includes the stated value and ranges above and above that value. In certain embodiments, the term "about" refers to ±10%, ±5%, or ±1% of the specified value. In certain embodiments, where applicable, the term "about" refers to the specified value(s) ± 1 standard deviation of the value(s).

As used herein, the term "gene" refers to the basic unit of heredity, consisting of segments of DNA located along chromosomes that code for specific proteins or segments of proteins. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally an intron, and a 3' untranslated region. The gene may further include terminators, enhancers and/or silencers.

As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome at which a gene or genetic marker is located.

As used herein, the term "target locus" refers to a locus on a chromosome where a safe harbor locus can be used for insertion of sequences. A target locus may consist of multiple potential safe harbor loci (integration sites). Examples of target loci are listed in Table 4 as sgRNA target loci. The notation used for sgRNA target loci in Table 4 refers to the genomic region of the target locus as defined by the chromosome of the target locus and the coordinate range of that target locus. For example, chr10:33130000-33140000 refers to a target locus on Chr10 (chromosome 10) starting at coordinates 33130000 and ending at coordinates 33140000.

The term "safe harbor locus" refers to a genetic locus into which a gene or genetic element can be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, safe harbor locus refers to an "integration site" or "knock-in site" into which a transgene-encoding sequence as defined herein may be inserted. In some embodiments, insertions occur by substitution of sequences located at the site of integration. In some embodiments, the insertion occurs without sequence substitution at the site of integration. Examples of contemplated integration sites are shown in Table 4.

As used herein, the term "insertion" refers to a nucleotide sequence that is incorporated (inserted) into a safe harbor site. Inserts can be inserted into safe harbor sites using, for example, homology-directed repair (HDR) CRISPR/Cas9 genome editing or other methods for inserting nucleotide sequences into genomic regions known to those skilled in the art. can be used to refer to genes or genetic elements that are integrated into

The "CRISPR/Cas" system refers to a broad class of bacterial systems for protection against foreign nucleic acids. CRISPR/Cas systems are found in a wide variety of fungal and archaeal organisms. The CRISPR/Cas system includes type I, type II, and type III subtypes. The wild-type type II CRISPR/Cas system utilizes an RNA-mediated nuclease, Cas9, in a complex with guide and activating RNAs to recognize and cleave foreign nucleic acids. Guide RNAs having both guide RNA and activating RNA activities are also known in the art. In some cases, such dual-active guide RNAs are referred to as small guide RNAs (sgRNAs).

Cas9 homologues are found in a wide variety of fungi including, but not limited to, the following taxonomic groups of bacteria: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chloflexi , Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al. , RNA Biol. 2013 May 1;10(5):726-737, Nat. Rev. Microbiol. 2011 June; 9(6):467-477, Hou, et al. , Proc Natl Acad Sci USA. 2013 Sep 24;110(39):15644-9, Sampson et al. , Nature. 2013 May 9;497(7448):254-7, and Jinek, et al. , Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.

As used herein, the term "Cas9" refers to an RNA-mediated nuclease (eg, of or derived from bacterial or archaeal origin). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and its homologues, including, but not limited to, CPF1 (e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 (See October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex and the like refers to Cas9 protein and crRNA (e.g., guide RNA or small guide RNA), Cas9 protein and transactivating crRNA (tracrRNA), etc. , a complex between Cas9 protein and small guide RNA, or a combination thereof (eg, a complex containing Cas9 protein, tracrRNA, and crRNA guide RNA).

As used herein, the terms "T lymphocytes" and "T cells" are used interchangeably to refer to cells that have completed maturation in the thymus and have identified certain foreign antigens in the body. . These terms also refer to major white blood cell types that have various roles in the immune system, including activation and deactivation of other immune cells. The T cell can be any T cell, such as a cultured T cell, eg, a primary T cell, or a T cell from a cultured T cell line, eg, Jurkat, SupT1, etc., or a T cell of mammalian origin. T cells can be CD3+ cells. The T cell can be any type of T cell, CD4+/CD8+ double positive T cell, CD4+ helper T cell (e.g., Th1 and Th2 cell), CD8+ T cell (e.g., cytotoxic T cell), peripheral, These include, but are not limited to, blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδT cells, and the like. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem cells or progenitor cells (eg, progenitor cells).

"CD4+ T cells" refers to a subset of T cells that express CD4 on their surface and are associated with cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4 and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells including monocytes/macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses. On T lymphocytes, the CD4 antigen defines a helper/inducer subset.

"CD8+ T cells" refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes as well as on cytotoxic and suppressive T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in major histocompatibility complex class I restriction interactions.

As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the living organism, and preferably in contrast to natural conditions. The difference is minimal.

As used herein, the term "construct" refers to a complex of molecules that includes a macromolecule or polynucleotide.

As used herein, the term "integration" refers to the process by which one or more nucleotides of a construct are stably inserted into a cell's genome, i.e., covalently linked to a nucleic acid sequence within the chromosomal DNA of a cell. . It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" may further include replacement of the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.

As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, eg, by introduction of the encoding nucleic acid into the host genetic material, eg, by integration into the host chromosome, or as non-chromosomal genetic material, such as a plasmid. Thus, when used in connection with the expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in the host cell under natural, unedited conditions. Similarly, the term, when used in conjunction with the expression of a coding nucleic acid, refers to the expression of a coding nucleic acid that is contained within a cell and is not introduced exogenously.

As used herein, "polynucleotide donor construct" refers to a nucleotide sequence (eg, a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into polypeptide. Polynucleotide donor constructs can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (eg, mammalian) DNA, and synthetic DNA sequences. For example, a polynucleotide donor construct can be a miRNA, shRNA, a naturally occurring polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a naturally occurring polypeptide with less than 100% sequence identity to a naturally occurring polypeptide) or a variant polypeptide (e.g., a naturally occurring polypeptide with less than 100% sequence identity polypeptide) or a fragment thereof.

As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein encoded by a gene (recombinant DNA) that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression systems). The recombinant protein can be a therapeutic agent, eg, a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide encoding a polypeptide. Transgenes can also refer to non-coding sequences such as, but not limited to, shRNAs, miRNAs, and miRs.

"Protein," "polypeptide," and "peptide" are used interchangeably herein.

As used herein, the term "operably linked" refers to nucleic acid sequences joined into a single nucleic acid fragment such that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if the promoter is capable of affecting the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under transcriptional control by the promoter). There is. Coding sequences can be operably linked to reference sequences in both sense and antisense orientations.

As used herein, the term "developmental state of a cell" refers to, for example, a state in which a cell is inactive, actively expressing, differentiated, aged, etc. The developmental state of a cell can also refer to a cell in a progenitor state (eg, a T cell progenitor or T cell precursor).

As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. Nucleic acid sequences can be either DNA or RNA molecules. In a preferred embodiment, the molecule is a DNA molecule. In other preferred embodiments, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG), and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). including. Between the start and stop codons there is an open reading frame (ORF). Such terms are known to those skilled in the art.

The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-natural sequence. This is done, for example, by using restriction enzymes and ligases, whereby the DNA sequence of interest, which usually encodes the gene of interest, is properly aligned with both molecules to create a compatible overlap. can be incorporated into another nucleic acid molecule by digestion with specific restriction enzymes and then using ligase to join the molecules together. Those skilled in the art are very familiar with such operations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, “Molecular Cloning: A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated by reference. its entirety, including any figures, drawings and tables; Incorporated herein.

As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof described herein. In some embodiments, the disease or condition is cancer.

As used herein, the term "promoter" refers to a nucleotide sequence (eg, a DNA sequence) that is capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter may be derived in its entirety from a natural gene, may be composed of different elements from different promoters found in nature, and/or may include synthetic DNA segments. A promoter can be endogenous to the cell of interest, as contemplated herein, or exogenous to the cell of interest. It will be appreciated by those skilled in the art that different promoters can direct gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters are defined by the strength of the promoter and/or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible/repressible promoters, tissue-specific Alternatively, it can be selected according to developmentally regulated promoters, cell cycle dependent promoters, etc.

The promoter can be an inducible promoter (eg, a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter can be a constitutive promoter (eg, CMV promoter, UBC promoter). In some embodiments, the promoter can be a spatially and/or temporally restricted promoter (eg, tissue-specific promoter, cell type-specific promoter, etc.). See, eg, US Application No. 15/715,068, the disclosure of which is incorporated herein by reference in its entirety.

As contemplated herein, gene editing may involve knocking in or knocking out genes (or nucleotide sequences). As used herein, the term "knock-in" refers to the addition of a DNA sequence or fragment thereof to the genome. Such DNA sequences that are knocked in may include the entire gene or genes, and may include regulatory sequences associated with the gene or portions or fragments of any of the foregoing. For example, a polynucleotide donor construct encoding a recombinant protein can be inserted into the genome of a cell carrying a mutant gene. In some embodiments, a knock-in strategy involves replacing an existing sequence with a provided sequence, eg, replacing a mutant allele with a wild-type copy. On the other hand, the term "knockout" refers to the removal of a gene or expression of a gene. For example, a gene can be knocked out either by deletion or addition of a nucleotide sequence that results in a disruption of the reading frame. As another example, a gene may be knocked out by replacing a portion of the gene with an unrelated (eg, non-coding) sequence.

As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nicked ends of DNA strands are directly ligated without the need for homologous template nucleic acids. NHEJ can result in the addition, deletion, substitution, or combinations thereof of one or more nucleotides at the repair site.

As used herein, "homologous recombination repair" or HDR refers to a cellular process in which broken or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid. Therefore, the original array is replaced with the template array. Homologous template nucleic acids can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repetitive regions on the same or different chromosomes). Alternatively, an exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in sequence at the target site. In this way, specific mutations can be introduced at the cleavage site.

The terms "vector" and "plasmid" are used interchangeably and as used herein refer to a polynucleotide vehicle useful for introducing genetic material into cells. Vectors can be linear or circular. The vector can integrate into the target genome of the host cell or replicate independently within the host cell. A vector can include, for example, an origin of replication, a multiple cloning site, and/or a selectable marker. Expression vectors typically include an expression cassette. Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, viral vectors, cosmids, and artificial chromosomes.

As used herein, the term "expression cassette" includes regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. , recombinantly or synthetically produced polynucleotide constructs. For example, a regulatory sequence can facilitate transcription of a selected polynucleotide within a host cell, or transcription and translation of a selected polynucleotide within a host cell. The expression cassette can, for example, be integrated into the genome of the host cell or present in an expression vector.

As used herein, the phrase "subject in need thereof" refers to a subject exhibiting and/or being diagnosed with one or more symptoms or signs of a disease or disorder described herein. refers to

"Chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapeutic agents" that act to modulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, the compositions may contain additional ingredients such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" means a pharmaceutical composition in such a form that the biological activity of the active ingredients contained therein enables it to be effective in the treatment of a subject. refers to a preparation that does not contain additional ingredients that are unacceptably toxic to the subject in the amounts provided therein.

As used herein, the term "effective amount" refers to an amount of a compound (e.g., a composition described herein, a composition described herein) sufficient to produce a beneficial or desired result. cells). An effective amount may be administered in more than one administration, application or dosage and is not intended to be limited to a particular formulation or route of administration. As used herein, the term "treating" refers to any effect that brings about amelioration or ameliorates the symptoms of a condition, disease, disorder, etc., such as palliation, reduction, modulation, amelioration or Including removal.

The terms "modulate" and "modulate" refer to reducing or inhibiting, or alternatively activating or increasing, the listed variable.

The terms "increase" and "activate" mean 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, Refers to an increase of 90%, 95%, 100%, 2x, 3x, 4x, 5x, 10x, 20x, 50x, 100x, or more.

The terms "reduce" and "inhibit" refer to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90% of the listed variable. %, 95%, 2x, 3x, 4x, 5x, 10x, 20x, 50x, 100x, or more.

Safe harbor locus gene editing therapies include, for example, viral vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional carcinogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406, Porteus et al. Nat Biotechnol. 2005 23:967-973, Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration faces challenges such as low knock-in efficiency, risk of insertional carcinogenesis, unstable and/or aberrant expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). continues to do so. These challenges are due in part to the identification and use of safe harbor loci or safe harbor sites (SHS), sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes. This can be dealt with by

The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs may be identified based on homology to sites first identified in other species (e.g., human homology of the permissive mouse Rosa26 locus), or under some circumstances non-essential. A growing number of human genes have been identified. One putative SHS of this type is the CCR5 chemokine receptor gene, which when disrupted confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs, similar to the original murine Rosa26 locus, have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis. The top three SHSs, AAVS1, CCR5, and Rosa26, are in close proximity to many protein-coding genes and regulatory elements. (See Figure 2 from Sadelain, M., et al. (2012)). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety).

AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (eg, DNA transgenes) with expected functions. It is located at 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55,625,241-55,629,351. Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.”Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference. Exemplary AAVS1 target gRNAs and target sequences are shown below.
●AAVS1-gRNA sequence: gggggccactaggacaggatGTTTTAGAGCTAGAAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
●AAVS1 target sequence: ggggccactagggacaggat

CCR5, located on chromosome 3 at position 3p21.31, encodes the major coreceptor of HIV-1. Disruption of this site in the CCR5 gene has facilitated the development of zinc finger nucleases that target its third exon, which is beneficial in HIV/AIDS treatment. The canonical SHS locus for CCR5 is chr3:46,414,443-46,414,942. Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.”Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference.

The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12 (2007): 14 77-1482 (the relevant disclosure of which is incorporated herein by reference) is a chromosome 3 ( We identified human ROSA26, a human homologue, at the 3p25.3 position). The canonical SHS locus of human Rosa26 (hRosa26) is chr3:9,415,082 to 9,414,043. Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.”Human gene therapy vol. 30, 7 (2019): 81 No. 4-828, the relevant disclosure of which is incorporated herein by reference.

Additional examples of safe harbor sites are provided by Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.”Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosures of which are incorporated herein by reference.

The present disclosure is directed to methods for identifying safe harbor loci that have advantages including, but not limited to, high knock-in efficiency and high expression of the transgene. An example application of the methods of the present disclosure is the identification of safe harbor loci for insertion of transgenes (eg, chimeric antigen receptors (CARs)) into T cells. In some embodiments, the safe harbor loci of the present disclosure are useful for insertion of transgene-encoding sequences. In some embodiments, safe harbor sites include high transgene expression (sufficient to allow transgene functionality or treatment of the disease of interest) and stability of the transgene over days, weeks, or months. allows for the expression of In some embodiments, knockout of the gene at the safe harbor locus benefits the function of the cell, or the gene at the safe harbor locus has no known function within the cell. In some embodiments, safe harbor loci include stable transgene expression in vitro with or without CD3/CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, Less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible resulting in moderate transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of neighboring genes, and localization outside of cancer-associated genes.

As used, "neighboring genes" are about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, It can refer to genes within about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, about 550 kB.

In some embodiments, this disclosure contemplates inserts that include one or more transgenes. The transgene can encode a therapeutic protein, antibody, peptide, suicide gene, apoptosis gene, or any other gene of interest. Safe harbor loci identified using the methods described herein, for example, allow transgene integration that results in enhanced therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of the cells compared to typical immune cells of the same normal cell type. For example, NK cells with "enhanced therapeutic properties" have enhanced, improved, and/or increased therapeutic outcomes compared to typical, unmodified and/or naturally occurring NK cells. has. Therapeutic properties of immune cells can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells also include expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the intratumoral microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity through reduction, It is also manifested by resistance to treatments such as chemotherapy.

As used herein, "insert size" refers to the length of the nucleotide sequence that is incorporated (inserted) into the safe harbor site. In some embodiments, the insert size comprises at least about 100, 200, 300, 400, or 500 base pairs. In some embodiments, the insert size comprises about 500 nucleotides or base pairs. In some embodiments, the insert size is at most 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilo base pairs) or sizes therebetween. In some embodiments, the insert size is 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, greater than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp or any size in between. In some embodiments, the insert size is within the range of 3-15 kbp or any number within that range. In some embodiments, the insert size is within the range of 1.5-8.3 kbp or any number within that range. In some embodiments, the insert size is within the range of 1.5-15 kbp, or any number within that range. In some embodiments, the insert size is within the range of 0.5-20 kbp or any number within that range. In some embodiments, the insert size is 0.5-10, 0.6-10, 0.7-10, 0.8-10, 0.9-10, 1-10, 2-10, 3-10, 4-10, 5-10, 6-10, 7-10, 8-10, or 9-10 kbp. In some embodiments, the insert size is 0.5-11, 0.6-11, 0.7-11, 0.8-11, 0.9-11, 1-11, 2-11, 3-11, 4-11, 5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 0.5-12, 0.6-12, 0.7-12, 0.8-12, 0.9-12, 1-12, 2-12, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp. In some embodiments, the insert size is 0.5-13, 0.6-13, 0.7-13, 0.8-13, 0.9-13, 1-13, 2-13, 3-13, 4-13, 5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp. In some embodiments, the insert size is 0.5-14, 0.6-14, 0.7-14, 0.8-14, 0.9-14, 1-14, 2-14, 3-14, 4-14, 5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 0.5-15, 0.6-15, 0.7-15, 0.8-15, 0.9-15, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp . In some embodiments, the insert size is 0.5-16, 0.6-16, 0.7-16, 0.8-16, 0.9-16, 1-16, 2-16, 3-16, 4-16, 5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15 ~16kbp. In some embodiments, the insert size is 0.5-17, 0.6-17, 0.7-17, 0.8-17, 0.9-17, 1-17, 2-17, 3-17, 4-17, 5-17, 6-17, 7-17, 8-17, 9-17, 10-17, 11-17, 12-17, 13-17, or 14-17, 15 ~17, or 16-17 kbp. In some embodiments, the insert size is 0.5-18, 0.6-18, 0.7-18, 0.8-18, 0.9-18, 1-18, 2-18, 3-18, 4-18, 5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15- 18, 16-18, or 17-18 kbp. In some embodiments, the insert size is 0.5-19, 0.6-19, 0.7-19, 0.8-19, 0.9-19, 1-19, 2-19, 3-19, 4-19, 5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15- 19, 16-19, 17-19, or 18-19 kbp. In some embodiments, the insert size is 0.5-20, 0.6-20, 0.7-20, 0.8-20, 0.9-20, 1-20, 2-20, 3-20, 4-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, 15- 20, 16-20, 17-20, 18-20, or 19-20 kbp.

Inserts of this disclosure refer to nucleic acid molecules or polynucleotides that are inserted into safe harbor sites. In some embodiments, the nucleotide sequence is a DNA molecule, eg, genomic DNA, or includes deoxyribonucleotides. In some embodiments, the insert is isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and/or any other subgenomic segment of DNA. Contains smaller fragments of DNA such as plastid DNA, mitochondrial DNA, or DNA. In some embodiments, the insert is an RNA molecule or includes ribonucleotides. Nucleotides in the inserts are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases, as readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, and internucleotide modifications. Polynucleotides can have any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpin, circular conformations, and other three-dimensional conformations contemplated in the art. It can be.

Inserts can have coding and/or non-coding regions. Inserts can include non-coding sequences (eg, control elements, eg, promoter sequences). In some embodiments, the insert encodes a transcription factor. In some embodiments, the insert encodes an antigen binding receptor, such as a single receptor, T cell receptor (TCR), syn-notch, CAR, mAb, etc. In some embodiments, the insert is an RNAi molecule, including but not limited to miRNA, siRNA, shRNA, etc. In some embodiments, the insert is a human sequence. In some embodiments, the insert is chimeric. In some embodiments, the insert is a multigene/multimodule therapeutic cassette. Multigene/multimodular therapeutic cassettes include inserts with one or more receptors (e.g., synthetic receptors), other exogenous protein coding sequences, non-coding RNAs, transcriptional regulatory elements, and/or insulator sequences, etc. Or refer to a cassette.

A variety of cell types are contemplated as having safe harbor sites in this disclosure. Cells containing safe harbor sites and/or inserts in safe harbor sites described in this disclosure may be referred to as engineered cells. Cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, and the like. Optionally, the cell is a mammalian cell, such as a human cell. In some embodiments, the engineered cell is a stem cell, human cell, primary cell, hematopoietic cell, adaptive immune cell, innate immune cell, T cell, or T cell precursor. Non-limiting examples of immune cells contemplated by this disclosure include T cells, B cells, natural killer (NK) cells, NKT/iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated by this disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells obtained by nuclear transfer ( ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem/progenitor stem cells (HSPC), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal Stem cells and other cells including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tendon cells, adipocytes, pancreatic cells, hepatocytes, kidney cells, follicular cells, and the like. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in this disclosure are human cell lines grown in vitro (eg, intentionally immortalized cell lines, cancer cell lines, etc.).

Methods for incorporating inserts into safe harbor sites can be viral or non-viral delivery techniques.

In some embodiments, the nucleic acid sequence is inserted into the genome of the engineered cell by introducing a vector, such as a viral vector, containing the nucleic acid. Examples of viral vectors include, but are not limited to, adeno-associated virus (AAV) vectors, retroviral vectors, or lentiviral vectors. In some embodiments, the lentiviral vector is an integrase-deficient lentiviral vector.

In some embodiments, the nucleic acid sequence is inserted into the genome of the T cell via non-viral delivery. In non-viral delivery methods, the nucleic acid can be naked DNA or in a non-viral plasmid or vector. Non-viral delivery techniques can be those described herein or site-specific integration techniques known to those skilled in the art. Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homologous recombination-independent specific insertion using Cas9. . In some embodiments, the non-viral delivery method includes electroporation.

In some embodiments, the insert introduces into the engineered cell (a) a targeting nuclease that cleaves the target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (the insert). The insert is incorporated into the insertion site by, for example, HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are described in U.S. Application No. 16/568,116 and U.S. Application No. 16/622,843, the related disclosures of which are incorporated herein by reference. are incorporated herein in their entirety.

The engineered cells can retain their undifferentiated state after insertion of the transgene. In some embodiments, the engineered cells are undifferentiated. In some embodiments, the engineered cells are undifferentiated after insertion of the transgene. In some embodiments, after insertion of the transgene, the engineered cells are CD45RA ⁺ and CCR7 ⁺ . In some embodiments, after insertion of the transgene, the engineered cells are CD45RA ⁺ CCR7 ⁺ CD27 ⁺ .

CAR T Cell Therapy Chimeric antigen receptor (CAR) T cells are T cells that have been genetically engineered to produce artificial T cell receptors for use in immunotherapy. Chimeric antigen receptors are receptor proteins that have been engineered to confer on T cells the ability to target specific proteins. For example, genetic modification of lymphocytes (eg, T cells) by incorporation of CAR and administration of the engineered cells to a subject is an example of "adoptive cell therapy." As used herein, the term "adoptive cell therapy" refers to cell-based immunotherapy for the transfusion of autologous or allogeneic lymphocytes, referred to as T cells or B cells. In this CAR therapy approach, cells are expanded, cultured ex vivo, and genetically modified prior to transfusion.

Expression of CAR allows engineered T cells to target and bind to specific proteins, such as tumor antigens. In CAR therapy, T cells are taken from a subject; they can be autologous T cells from the subject's own blood or from a donor not receiving CAR therapy. Once isolated, the T cells are genetically modified with a CAR, expanded ex vivo, and administered to a subject (ie, patient), eg, by infusion.

CARs may be introduced into T cells using, for example, viral techniques (eg, retroviral integration) or site-specific techniques. Site-specific integration of the transgene (eg, CAR) allows the transgene to be targeted to safe harbor loci. Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homologous recombination-independent specific insertion using Cas9. .

Engineered CAR T cells have applications in immuno-oncology. For example, CARs can be selected to target specific tumor antigens. An example of a cancer that can be effectively targeted using CAR T cells is blood cancer. In some embodiments, CAR T cell therapy can be used to treat solid tumors.

Gene Editing The term "gene editing" or "genome editing" as used herein refers to the process by which DNA is inserted into or replaced from the genome using artificially engineered nucleases or "molecular scissors". , or refers to a type of genetic manipulation that is removed. This is a useful tool for elucidating the function and effect of sequence-specific genes or proteins or for modifying cellular behavior (eg, for therapeutic purposes).

Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like tools for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). Examples include effector nucleases (TALENs). The DICE (Dual Integrase Cassette Exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly spaced short palindromic repeats/Cas9 (CRISPR/Cas9) technology can be used for targeted gene insertion.

Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

All methods known in the art for targeted insertion of genetic sequences are contemplated with the methods described herein for inserting constructs into safe harbor loci.

Crispr-Cas Gene Editing One effective example of gene editing is the Crispr-Cas approach (eg, Crispr-Cas9). This approach incorporates the use of a guide polynucleotide (eg, a guide ribonucleic acid or gRNA) and a cas endonuclease (eg, Cas9 endonuclease).

As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene; is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, eg, US Pat. No. 8,697,359). Also included in this definition are variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonuclease used in the donor DNA insertion method detailed herein is an endonuclease that introduces a double-strand break in the DNA at a target site (eg, within a target locus or at a safe harbor site).

As used herein, the term "guide polynucleotide" can be complexed with a Cas endonuclease and can enable the Cas endonuclease to recognize and cleave a DNA target site. Relating to polynucleotide sequences. A guide polynucleotide can be single molecule or double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (combined RNA-DNA sequence). A guide polynucleotide containing only ribonucleic acid is also referred to as a "guide RNA." In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (eg, Cas9 endonuclease).

The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA and a second nucleotide sequence that interacts with the Cas endonuclease polypeptide. including. It can be a double molecule (also referred to as a double-stranded guide polynucleotide) that includes a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this dual molecule guide polynucleotide comprises two separate molecules that hybridize along complementary regions. The two separate molecules can be RNA sequences, DNA sequences, and/or combined RNA-DNA sequences.

Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (eg, Cas9 endonuclease). Homologous recombination repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes including base substitutions, sequence insertions, and deletions. Conventional HDR-based CRISPR/Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homology arms that match the locus of interest.

HITI (homology independent targeted insertion) uses a non-homologous end joining (NHEJ)-based homology-independent strategy, which is more efficient than HDR. could be. Guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to include Cas9 cleavage site(s) that flank the inserted gene or sequence. This results in Cas9 cleavage at both the donor plasmid and the genomic target sequence. Both the target and the donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway to result in integration into the genomic DSB site. (For example, Suzuki, K., et al. (2016). In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration.Natural re, 540(7631), 144-149 (this related disclosure is incorporated herein in its entirety). (incorporated herein).

Methods for performing gene editing using the CRISPR-Cas approach are known to those skilled in the art. (See, e.g., U.S. Application Nos. ). Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in U.S. Application No. 13/036,343, the disclosure of which is incorporated herein by reference in its entirety. Are listed.

The guide RNA and/or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g. dodecanediol or undecyl residues), phospholipids such as dihexadecyl-rac-glycerol or triethyl Lipid moieties such as ammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamine or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and octadecylamine or hexylamino-carbonyl-toxycholesterol moieties are mentioned. It will be done. See, eg, US Application No. 15/715,068, the disclosure of which is incorporated herein by reference in its entirety.

Therapeutic Uses For therapeutic uses, engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.

Engineered cells can be administered to a subject by injection (eg, continuous infusion over a period of time) or other modes of administration known to those skilled in the art.

The engineered cells described herein can be administered as part of a pharmaceutical composition. In some embodiments, the present disclosure provides compositions comprising guide RNAs of the present disclosure. Pharmaceutical compositions may include one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used and can be selected by one skilled in the art. Accordingly, the pharmaceutical excipients described below are intended to be illustrative and not limiting. Additional pharmaceutical excipients include those described, for example, in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009) (incorporated by reference in its entirety).

The engineered cells described herein find use in gene therapy as well as non-pharmaceutical uses, such as in the production of animal models and recombinant cell lines expressing proteins of interest.

The engineered cells of this disclosure can be any cells, generally mammalian cells, generally human cells that have been modified by incorporating a transgene into the safe harbor loci described herein. In some embodiments, the engineered cells are immune cells. In some embodiments, the engineered cells are lymphocytes. In some embodiments, the engineered cell is a T cell or T cell precursor.

The engineered cells, compositions, and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy. In some embodiments, insertion of a transgene-encoding sequence within a safe harbor locus maintains TCR expression relative to the case without the insertion, allowing transgene expression while preserving TCR function. do.

Provided herein are various diseases treated using engineered cells, populations thereof, or compositions thereof. Non-limiting examples of such diseases include alopecia areata, autoimmune hemolytic anemia, autoimmune hepatitis, cancer, dermatomyositis, diabetes (type 1), certain juvenile idiopathic arthritis, Glomerulonephritis, Graves' disease, Guillain-Barre syndrome, idiopathic thrombocytopenic purpura, myasthenia gravis, certain myocarditis, multiple sclerosis, pemphigus/pemphigoid, pernicious anemia, nodular polyartery inflammation, polymyositis, primary bile with cirrhosis, psoriasis, rheumatoid arthritis, scleroderma/systemic sclerosis, Sjögren's syndrome, systemic lupus erythematosus, certain thyroiditis, certain uveitis , vitiligo, polyangiitis (Wegener's disease), autoimmune diseases (including but not limited to granulomatosis), hematological malignancies (acute and chronic leukemia, lymphoma, multiple myeloma, and myelodysplastic syndromes). including but not limited to), prostate, breast, lungs, colon, uterus, skin, liver, bones, pancreas, ovaries, testes, bladder, kidneys, heart, head, neck, stomach, cervix, rectum, Tumors of the pharynx or esophageal solid tumors, HIV (human immunodeficiency virus)-related disorders, RSV (respiratory polyhedrosis virus)-related disorders, EBV (Epstein-Barr virus)-related disorders, CMV (cytomegalovirus)-related disorders, and Infectious diseases include, but are not limited to, adenovirus-related disorders and BK polyomavirus-related disorders.

Cancers that can be treated using the engineered cells (eg, CAR T cells), populations thereof, or compositions thereof of the present disclosure include hematological cancers. In some embodiments, the cancer treated using the engineered cells (e.g., CAR T cells), populations thereof, or compositions thereof described herein is a hematological malignancy or a leukemia. . In some embodiments, the engineered cells (e.g., CAR T cells), populations thereof, or compositions thereof described herein are associated with acute lymphoblastic leukemia (ALL) or diffuse large cell B Used for the treatment of cellular lymphoma (DLBCL). In some embodiments, the cancer is acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), myelodysplasia, myelodysplastic syndrome, acute T lymphoblastic leukemia, or acute promyelocytic leukemia. leukemia, chronic myelomonocytic leukemia, or bone marrow blast crisis of chronic myeloid leukemia. Examples of cancers that can be treated using the engineered cells (e.g., CAR T cells) described herein include breast cancer, ovarian cancer, esophageal cancer, bladder or stomach cancer, salivary duct cancer, salivary duct cancer, cancer, adenocarcinoma of the lung, or invasive forms of uterine cancer, such as uterine serous endometrial cancer. In some other embodiments, the cancer is brain cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, leukemia, lung cancer, liver cancer, melanoma, ovarian cancer, Pancreatic cancer, rectal cancer, kidney cancer, stomach cancer, testicular cancer, or uterine cancer. In still other embodiments, the cancer is squamous cell carcinoma, adenocarcinoma, small cell carcinoma, melanoma, neuroblastoma, sarcoma (e.g., angiosarcoma or chondrosarcoma), laryngeal carcinoma, parotid carcinoma, biliary tract carcinoma. Cancer, thyroid cancer, acral lentiginous melanoma, actinic keratosis, acute lymphocytic leukemia, acute myeloid leukemia, adenoid cystic carcinoma, adenoma, adenosarcoma, adenosquamous carcinoma, anal canal cancer, anal cancer, anus Rectal cancer, astrocytic tumor, Bartholin's adenocarcinoma, basal cell carcinoma, cholangiocarcinoma, bone cancer, bone marrow cancer, bronchial carcinoma, bronchial adenocarcinoma, carcinoid, cholangiocellular carcinoma, chondrosarcoma, choroid plexus papilloma/carcinoma, chronic lymphocytic cancer sexual leukemia, chronic myeloid leukemia, clear cell carcinoma, connective tissue carcinoma, cystadenoma, digestive system cancer, duodenal cancer, endocrine system cancer, yolk sac tumor, endometrial hyperplasia, endometrial stromal sarcoma, intrauterine sarcoma Adenocarcinoma, endothelial cell carcinoma, ependymal carcinoma, epithelial cell carcinoma, Ewing sarcoma, eye and orbital cancer, female genital cancer, focal nodular hyperplasia, gallbladder cancer, gastric pyloric carcinoma, gastric fundus carcinoma, gastrinoma, glioblastoma. tumor, glucagonoma, heart cancer, hemangioblastoma, hemangioendothelioma, hemangioma, hepatic adenoma, hepatic adenomatosis, hepatobiliary cancer, hepatocellular carcinoma, Hodgkin's disease, ileal cancer, insulinoma, intraepithelial neoplasm, interepithelial squamous epithelium Cellular neoplasms, intrahepatic cholangiocarcinoma, invasive squamous cell carcinoma, jejunal cancer, joint cancer, Kaposi's sarcoma, pelvic cancer, large cell carcinoma, colorectal cancer, leiomyosarcoma, lentigo maligna-derived melanoma, lymphoma, male genital cancer, Malignant melanoma, malignant mesothelial tumor, medulloblastoma, medulloepithelioma, meningeal cancer, mesothelioma, metastatic carcinoma, oral cancer, mucoepidermoid carcinoma, multiple myeloma, muscle cancer, nasal cavity cancer, nervous system cancer , neuroepithelial adenocarcinoma, nodular melanoma, non-epithelial skin cancer, non-Hodgkin lymphoma, oat cell carcinoma, oligodendroglial carcinoma, oral cancer, osteosarcoma, papillary serous adenocarcinoma, penile cancer, pharyngeal cancer, pituitary tumor , plasmacytoma, pseudosarcoma, pulmonary blastoma, rectal cancer, renal cell carcinoma, respiratory system cancer, retinoblastoma, rhabdomyosarcoma, sarcoma, serous carcinoma, sinus cancer, skin cancer, small cell carcinoma , small intestine cancer, smooth muscle cancer, soft tissue cancer, somatostatin-secreting tumor, spinal cancer, squamous cell carcinoma, striated muscle carcinoma, submesothelial carcinoma, superficial spreading melanoma, T-cell leukemia, tongue cancer, undifferentiated carcinoma, ureteral cancer, urethral cancer, bladder cancer, urinary system cancer, cervical cancer, endometrial cancer, uveal melanoma, vaginal cancer, verrucous cancer, vipoma, vulvar cancer, well-differentiated cancer, or Wilms' tumor.

In some embodiments, the present disclosure provides a method of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. do. As used, the terms "treat", "therapy", etc. generally refer to obtaining a desired pharmacological and/or physiological effect. This effect is prophylactic in terms of complete or partial prevention of the disease and/or therapeutic in terms of partial or complete cure of the disease and/or the adverse effects resulting from the disease. The term "treatment" as used herein encompasses any treatment of a disease in a subject (eg, a mammal, eg, a human). Treatment also includes preventing the development of the disease, inhibiting the progression of the disease, or reducing the disease (i.e., causing regression of the disease) in patients susceptible to the disease but still suffering from it. can refer to the administration of the engineered cells described herein to a subject who has not been diagnosed with the disease. Additionally, treatment may stabilize or reduce undesirable clinical symptoms in a subject (eg, a patient). The cell populations described herein, or compositions thereof, can be administered before, during, or after the occurrence of a disease or injury.

In certain embodiments, the subject has a disease, condition, and/or injury that can be treated and/or ameliorated by cell therapy. In some embodiments, the subject in need of cell therapy is a subject that has an injury, disease, or condition, thereby causing cell therapy (eg, a therapy in which cellular material is administered to the subject). However, it is contemplated that it is possible to treat, ameliorate, and/or reduce the severity of at least one symptom associated with an injury, disease, or condition. In certain embodiments, subjects in need of cell therapy include candidates for bone marrow or stem cell transplantation, subjects who have undergone chemotherapy or radiation therapy, hyperproliferative diseases or cancers (e.g., hematopoietic), Includes, but is not limited to, subjects who have or are at risk of developing a proliferative disease or cancer, a tumor (e.g., solid tumor), a viral infection or virus. Not done. It is also intended to encompass subjects suffering from or at risk of contracting a disease associated with an infectious disease.

In some embodiments, the present disclosure provides compositions of the present disclosure along with instructions for use. Instructions for use may be present with the kit as a package insert, on the label of the container of the kit or its components, or in digital form (e.g., on a CD-ROM or via a link on the Internet). Through). The kit can include one or more of a genomic targeting nucleic acid, a polynucleotide encoding a genomic targeting nucleic acid, a site-specific polypeptide, and/or a polynucleotide encoding a site-specific polypeptide. Additional components within the kit are also contemplated, such as buffers (reconstitution buffer, stabilization buffer, dilution buffer, etc.), and/or one or more control vectors.

Combination Therapy In some embodiments, engineered cells of the present disclosure or compositions thereof are administered with at least one additional therapeutic agent. Any suitable additional therapeutic agent may be administered with the engineered cells, populations thereof, or compositions thereof described herein. In some embodiments, the additional therapeutic agent is selected from radiation, ophthalmic agents, cytotoxic agents, chemotherapeutic agents, cytostatic agents, anti-hormonal agents, immunostimulatory agents, anti-angiogenic agents, and combinations thereof. Ru.

In some embodiments, engineered cells of the present disclosure or compositions thereof are administered with steroids. Administration of steroids can prevent or reduce the risk of a subject receiving the engineered cell(s) or composition thereof having an autoimmune response.

Additional therapeutic agents may be administered by any suitable means. In some embodiments, the engineered cells, populations thereof, or compositions thereof described herein and the additional therapeutic agent are administered in the same pharmaceutical composition, eg, by injection. In some embodiments, the engineered cells described herein and the additional therapeutic agent are included in different pharmaceutical compositions.

Pharmaceutical compositions may include one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used and can be selected by one skilled in the art. Accordingly, the pharmaceutical excipients described below are intended to be illustrative and not limiting. Additional pharmaceutical excipients include those described, for example, in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009) (incorporated by reference in its entirety).

Various modes of administering additional therapeutic agents are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration. Generally, modes of administration include, but are not limited to, intravitreal, subretinal, suprachoroidal, intraarterial, intradermal, intramuscular, intraperitoneal, intravenous, nasal, parenteral, topical, pulmonary, and subcutaneous routes. .

In embodiments where the engineered cells described herein and the additional therapeutic agent are included in different pharmaceutical compositions, administration of the engineered cells described herein is prior to administration of the additional therapeutic agent. , simultaneously and/or subsequently.

Further Embodiments In some aspects, herein is an engineered cell comprising at least one sequence encoding a transgene, the at least one sequence being inserted within a safe harbor locus. , safe harbor loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15:928 30000~92840000, chr16:11220000~11230000, chr2:87460000~ 87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, chr9:7970000-7980000, APRT, B2M, CAPNS1, CB LB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, at any one or more of the sgRNA target loci selected from PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28 , providing engineered cells.

In some embodiments, expression of at least one sequence encoding a transgene is operably linked to an endogenous promoter.

In some embodiments, expression of at least one sequence encoding a transgene is operably linked to an exogenous promoter.

In some embodiments, the target loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000 , chr2:87460000~87470000, chr3:186510000~186520000, chr3:59450000~59460000, chr8:127980000~128000000, and chr9:7970000~7980000 .

In some embodiments, the target locus is chr11:128340000-128350000 or chr15:92830000-92840000.

In some embodiments, the target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, The gene is selected from SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.

In some embodiments, the safe harbor locus is the GS94 or GS102 integration site of Table 4.

In some embodiments, the exogenous promoter is the EF1a promoter.

In some embodiments, the engineered cells are natural killer (NK) cells, induced pluripotent stem cells (iPSCs), human pluripotent stem cells (HSPCs), T cells, or T cell precursors.

In some embodiments, the transgene encodes a recombinant protein, therapeutic agent, or chimeric antigen receptor (CAR).

In some embodiments, provided herein are compositions comprising engineered cells described herein and pharmaceutical excipients.

In some embodiments, described herein is a guide ribonucleic acid (gRNA) for editing a cell at a safe harbor locus, the gRNA comprising any one of SEQ ID NOs: 1-120. Provide nucleic acids.

In some embodiments, described herein is a method of editing a cell having chromosomal DNA, the method comprising inserting at least one sequence encoding a transgene into a safe harbor locus in the chromosomal DNA of the cell. , safe harbor loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15:928 30000~92840000, chr16:11220000~11230000, chr2:87460000~ 87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, chr9:7970000-7980000, APRT, B2M, CAPNS1, CB LB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, at any one or more of the sgRNA target loci selected from PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28 , provides a method.

In some embodiments, the target loci are chr10:33130000-33140000, chr10:72290000-72300000, chr11:128340000-128350000, chr11:65425000-65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000 , chr2:87460000~87470000, chr3:186510000~186520000, chr3:59450000~59460000, chr8:127980000~128000000, and chr9:7970000~7980000 .

In some embodiments, the target locus is chr11:128340000-128350000 or chr15:92830000-92840000.

In some embodiments, the target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, The gene is selected from SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.

In some embodiments, the transgene encodes a recombinant protein, therapeutic agent, or chimeric antigen receptor (CAR).

In some embodiments, at least one sequence includes an exogenous promoter, and the exogenous promoter is operably linked to the transgene.

In some embodiments, the cell is a T cell or T cell precursor.

In some embodiments, at least one sequence is inserted using homologous recombination repair or homologous recombination-independent specific insertion.

In some embodiments, at least one sequence is inserted using one or more guide ribonucleic acids (gRNAs) and one or more Cas9 endonucleases, and the one or more gRNAs are selected from among SEQ ID NOS: 1-120. Contains any one of the following.

In some embodiments, described herein is an ex vivo method of obtaining an engineered cell or population thereof, comprising: obtaining the cell and inserting at least one sequence encoding a transgene within a safe harbor locus. genetically modifying the cell by 1), chr15:92830000~ 92840000, chr16:11220000-11230000, chr2:87460000-87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-12 8000000, chr9:7970000-7980000, APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, SOCS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and sgRNA targets selected from TRIM28 Ex vivo methods are provided for at any one or more of the genetic loci.

In some embodiments, obtaining the cells includes (i) collecting a tissue sample from the subject, (ii) isolating the cells from the tissue sample, and (iii) culturing the cells in vitro. and, including.

In some embodiments, the cells are stem cells, natural killer (NK) cells, induced pluripotent stem cells (iPSCs), human pluripotent stem cells (HSPCs), T cells, or T cell precursors.

In some embodiments, at least one sequence is inserted using homologous recombination repair or homologous recombination-independent specific insertion.

In some embodiments, genetically modifying in step (b) comprises contacting the cell with one or more guide ribonucleic acids (gRNAs), at least one sequence, and one or more Cas9 endonucleases. , one or more gRNAs and a Cas9 endonuclease to facilitate insertion of at least one sequence into the chromosomal DNA within the safe harbor locus, and the one or more gRNAs are any of SEQ ID NOS: 1-120. Contains one.

In some embodiments, at least one sequence includes an exogenous promoter, and the exogenous promoter is operably linked to the transgene.

In some embodiments, described herein is a method of treating a subject having or at risk of having a disease, the method comprising: administering to the subject an effective amount of an engineered cell described herein. Provides a method including:

In some embodiments, described herein is a method of treating a subject having a disease or at risk of having a disease, the method comprising: performing a method described herein; and administering to the subject an effective amount of administering a composition comprising a cell or population thereof.

In some embodiments, the disease is cancer.

The following are examples of methods and compositions of the invention. It will be appreciated that various other embodiments may be practiced given the general description provided herein.

The following are examples of specific embodiments for carrying out the invention. The examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (eg, amounts, temperatures, etc.) but, of course, some experimental errors and deviations should be allowed for.

The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology, within the skill of the art. Such techniques are well explained in the literature. For example, T. E. Creighton, Proteins: Structures and Molecular Properties (WH. Freeman and Company, 1993), A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition), Sambrook, et al. , Molecular Cloning: A Laboratory Manual (2nd Edition, 1989), Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Pr ess, Inc.), Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990).

Example 1: Identification of knock-in loci in coding regions The purpose of the experiments in this set of examples is to identify T cell knock-in (KI) loci in coding regions other than the T cell receptor alpha constant (TRAC) locus. Was that. The criteria and requirements shown in Table 1 were used to select candidate loci.

Generally, the requirement for candidate KI loci within the coding region was that the coding gene is not essential for T cell function or that knockout of the gene is beneficial for chimeric antigen receptor therapy (CAR T) function. .

As shown in Table 1, for comparative purposes, some of the data utilized to identify candidate KI loci was based, in part, on Roth, T. L. , et al. 2019 (Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. bioRxiv, 604561), the related disclosure of which is hereby incorporated by reference in its entirety. Incorporated. Roth, T. L. et al. Figure 3 shows an overview of the data in the paper.

Figures 4A and 4B show processed RNA-seq data and show that samples cluster based on activation status and by cell type. Donor 4 (AKI4) clustered differently from other donors and was therefore identified as an outlier and excluded from the remaining analyses. Roth, T. L. et al. Transcript expression data from RNA-seq experiments of 90 genes cited in the paper by Roth, T. L. et al. This was correlated with the transcriptional expression data of the paper. (See Figures 5A and 5B).

Figure 6 shows process ATAC-seq data focusing on a 10 kb region around the transcription start site (TSS). Again, donor 4 (AKI4) was identified as an outlier based on both CD4 and CD8 cell expression profiles and was excluded from the remaining analyses. The results of the remaining ATAC-seq analyzes are shown in Figures 7A-8. The data in Figure 7A for TSS enrichment scores also showed that all libraries were of high quality. Data on open chromatin regions around the TRAC locus revealed the highest signal near exon 3, but not exon 1 (Fig. 8).

Determination of knock-in efficiency:
Roth, T. L. et al. The KI efficiency results (obtained using the model described below) based on 5 donors, 2 gRNAs, and 2 replicates/gRNA from the paper are shown in FIGS. 9 and 10.

A linear model was constructed to estimate the KI efficiency of approximately 90 genes using RNA-seq and ATAC-seq data. The linear model captured 33% variation in the data (ie, R ² =0.33). FIG. 11 shows KI efficiency for day 2 (d2) RNA-seq data, day 4 (d4) RNA-seq data, and d2 ATAC data. A linear model was applied to the remaining candidate genes to estimate their KI efficiency.

Candidate coding loci were selected by first ranking all genes in the pooled dataset by predicted KI efficiency using d2 (day 2) RNA-seq expression data. Candidate coding loci needed to be stably expressed during T cell activation (eg, ≦2-fold change in expression compared to day 0 (d0)). Candidate loci also had to be accessible based on ATAC-seq data. Using the selection process/requirements, 16 well-characterized coding genes (with known functions) were selected as candidate genes. Knockout of these 16 species will confer a benefit on CAR T cell function (eg, B2M, CD5, SMAD2, PTPRC, CD3E). An additional 12 coding genes with high predicted KI efficiency and no obvious essential functions (inactive coding genes) were selected as candidate genes. (See Table 2).

Example 2: Identification of knock-in loci in gene deserts Criteria for selection of candidate loci in non-coding regions or gene deserts are summarized in Table 3.

To select candidate regions within non-coding regions, we here started by examining highly accessible regions (10 kb windows) of the genome. The most accessible regions are (i) annotated protein-coding genes (>50% accessible regions), (ii) pseudogenes and non-coding RNAs (approximately 20% accessible regions), and (iii) overlapped with enhancer/regulatory regions (approximately 20% accessible region). Candidate genes needed to be <10 kb from the coding region. Several regions that overlap with long intergenic non-coding RNAs (lincRNAs) but have no apparent function in T cells were also considered.

Examples of other criteria used in the art for SHS selection are, for example, Pellenz, S.; , et al. (2019). New human chromosomal sites with “safe harbor” potential for targeted transgene insertion. Human gene therapy, 30(7), 814-828, the relevant disclosure of which is incorporated herein by reference in its entirety.

FIG. 12 is a plot showing normalized ATAQ SEQ data for top candidate non-coding regions.

Eleven candidate regions in the gene desert were selected using the selection process/requirements described above. In total, there were 39 KI candidate loci including coding and non-coding regions that were evaluated as safe harbor loci (predicted loci).

Example 3: Experimental evaluation materials for predicted loci ● 120 sgRNAs were ordered from Synthego (3 sgRNAs per region) and editing efficiency was evaluated by next generation sequencing (NGS).
■87 target-encoding genes ■33 target gene deserts ●189 constructs synthesized using Genscript ■Homologous arms: 450 bp each
■ eGFP was used as a reporter ■ Vector backbone: pUC57-Kan skeleton ■ 78 has an endogenous promoter ■ 111 has an EF1a-HTLV promoter ● Constructs were sequence verified by Genscript and most were internally verified by sequencing . The sgRNA sequences are listed in Table 4 and the construct sequences are listed in Table 5.

Method

To assess the validity of the predicted loci, we used:

(87 endogenous constructs + 120 exogenous constructs) *2 = 414 wells + control = 460

3 donors, 2 replicates at 3 time points: week 1 (d6 = day 6), week 3 (d21 = day 21), and week 4 (d28 = day 28)

contrast

DNA only (no ribonucleoprotein (RNP)): episomal expression (n=8)

DNA + non-targeting guide + RNP: to see if DNA delivery is more efficient with RNP (n=8)

pMax GFP was measured to confirm whether the transfection was successful (n=3).

WT cells without electroporation

WT cells with electroporation

Controls were distributed throughout the plate.

Cells were electroporated without RNP/HDR to see if cell counts made sense.

Two more donors were added and changed to three replicates at one time point: week 1 (d6)

FACS panel: GFP, TCR, Zombie

Wash every third well.

Secondary data collected included: RNA-seq data: at d0, d2, and d4 (to determine stable expression), ATAC-seq data: at d2 (to identify activated cells). ). The methods used to perform RNA-seq and ATAC-seq experiments are described by Roth, T.; L. , et al. 2019. (Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. bioRxiv, 604561, incorporated herein by reference in its entirety).

．． Automatic gating was performed on the FACS data using fcs files. For constructs with endogenous promoters, all five donors and all three time points were used. For constructs with the EF1a promoter, three donors (donors 1-3) and two time points (weeks 3 and 4) were used.

To summarize the data, wells with %KI efficiency (% GFP-high cells) ≦10% (possibly gating error, experimental error, or minimum integration) were excluded. Loci were then ranked by median expression between donors and median %KI efficiency between donors.

Significance of loci was calculated using robust rank aggregation, a methodology used to consistently rank loci across donors and time points. Methods for performing robust rank aggregation are known in the art. (For example, Kolde, R., et al. (2012). Robust rank aggregation for gene list integration and meta-analysis. Bioinformatics (Oxford, England) ), 28(4), 573-580 (the disclosure of which is incorporated herein by reference). (incorporated herein in its entirety).

result

The results of the analysis of the control and experimental groups are shown in Figures 13A-25.

The results of the pmax_GFP control experiment revealed that donor 5 had significantly higher cell counts than the other donors. In general, GFP_high readings decreased over time as expected. (Figures 13A and 13B).

Experiments analyzing non-targeted controls for changes in episomal GFP expression revealed that episomal GFP expression decreased to less than 0.05 over time. (Figures 14A and 14B). Some of the outliers were due to gating errors, which were most severe in donor 3. The WT control experiment also showed a GFP_high reading of <0.05 (Figure 15), as expected.

As shown in Figures 16 and 17, there was a trend that was more consistent across donors when using sgRNA5 to target the B2M safe harbor locus.

Comparison of GFP expression trends between sgRNA79 and sgRNA83 for TRAC insertion and expression using an endogenous reporter shows that the trends for donor 2 are different between sgRNA79 and sgRNA83, while the trends for donor 4 are the same. (Figures 18 and 22). Some potential reasons for the observed variation between replicates and donors include:

(1) Manual processing of multiple plates (e.g., Figure 26):

edge effect

electroporation error

(2) Inherent differences between donors (e.g., Figure 27):

There were consistent differences in the throughput of certain wells in the assay (over several weeks)

Cell numbers varied between donors

(3) Gating error (e.g., Figure 28):

1 peak vs > 2 peaks in GFP signal

Example 4: Ranking of loci by expression and KI efficiency Loci were ranked based on the mean fluorescence intensity (MFI) of the reporter gene, GFP, and KI efficiency.

Figure 29 shows GFP MFI and KI efficiency of all important loci with endogenous promoters. The B2M locus reported the highest GFP MFI. The TRAC locus was among the top 10 MFIs. The highest GFP MFI readings were reported at week 1 and decreased slightly at weeks 3 and 4. The results also showed that most of the top loci had more than 1 sgRNA. Regarding KI efficiency, the SOCS1 locus reported the highest KI efficiency. Overall, KI efficiency showed greater variation between donors than GFP MFI.

Figure 30 shows GFP MFI and KI efficiency of all important loci with exogenous promoters (eg, EF1a promoter). The TRAC locus reported the highest GFP MFI. There was a comparable expression from week 3 to week 4. The results also showed that most of the top loci had more than 1 sgRNA. Regarding KI efficiency, the SOCS1 locus reported the highest KI efficiency. Overall, KI efficiency was less variable when driven by the exogenous promoter than when driven by the endogenous promoter.

Figures 31A, 31B, and 31C show GFP MFI and KI efficiency of all important loci with endogenous and exogenous (eg, EF1a) promoters. The results showed that expression driven by the EF1a promoter was approximately 10-fold higher than the endogenous promoter (Figure 31A). Regarding KI efficiency, the SOCS1 locus reported the highest KI efficiency. At weeks 3 and 4, KI efficiency was higher when driven by the exogenous promoter than when driven by the endogenous promoter.

Example 5: Evaluation of TCR expression at candidate non-coding sites This experiment was performed to identify target loci and integration sites that allow high transgene expression without disrupting the TCR. Several gene deserts (eg, gene deserts 2, 3, 5, and 6) were identified as having high transgene expression (Figure 32A).

To evaluate and identify preferred knock-in sites, TCR expression was measured after knock-in of the Prime Receptor (Myc) circuit cassette. Myc indicates an N-terminal Myc epitope tag to facilitate detection of surface expressed primer receptors. Briefly, CD3-CD28 Dynabead-activated T cells were stimulated with sgRNA/Cas9 RNP targeting the indicated sites (see Figures 32B and 33A) and HDR-mediated activation of CD3-CD28 Dynabead-activated T cells to the indicated sites. Electroporated with HDRT with a homologous arm directing integration. Six days after electroporation, cells were stained with anti-TCR alpha/beta and anti-myc antibodies and analyzed on an Attune NxT flow cytometer. As shown in Figure 32B, TCR expression was maintained at the GS94 and GS102 candidate integration (knock-in) sites. Only two-thirds of the cells in which the PrimeR circuit cassette was knocked in at the GS79 (TRAC) locus maintained TCR expression. These results indicated that GS94 and GS102 sites showed better potential for TCR stimulation.

The percentage of cells showing effective knock-in (based on PrimeR measurements) was 36% ± 4% using the GS94 integration site compared to 32% ± 5% using the TRAC integration site. Ta. These results revealed a GS94-containing integration site that supported reproducible high circuit cassette knock-in rates. See Figure 33A.

Example 6: Evaluation of circuit expression and function of GS94 GS94 is a candidate integration site located on the distal q-arm of chromosome 11. Although it is within 180-350 kb of the promoters of ETS1 and FLI1 (Figure 33B), the risk of integrating vector gene therapy is considered low. The circuit expression and functional potential of the GS94 gene were evaluated.

T cells underwent circuit cassette integration with PrimeR at the GS79 (TRAC) and GS94 integration sites. Cells were co-cultured with K562 C19 cells for 48 hours and then PrimeR-induced CAR MFI was compared to PrimeR MFI.

Briefly, T cells generated as described in the Examples above were co-cultured with K562 CD19+/MSLN- cells 7 days after electroporation. MSLN (mesothelin) is a gene that is overexpressed in human pancreatic cancer. Cells were then stained with anti-FLAG antibody 48 hours after the start of co-culture and analyzed on an Attune NxT flow cytometer. Results revealed that GS94 resulted in excellent CAR induction with high primeR expression after 48 hours of co-culture with K562 C19 cells. See Figure 34A. GS94 resulted in prime antigen-dependent CAR expression approximately 2-fold higher than expression at several other candidate integration sites as well as the TRAC integration site. Additionally, on average, prime receptor surface expression levels were greater than 50% of expression levels when using TRAC integration sites.

Cytotoxicity and Cytokine Secretion To assess the effect of candidate integration sites on cytotoxicity and cytokine secretion, T cells that had undergone PrimeR and circuit cassette integration at the GS79 (TRAC) and GS94 integration sites were isolated from K562 C19/MSLN cells. and co-cultured for 48 hours. MSLN is a gene that is overexpressed in human pancreatic cancer. Cells were treated with a 1:1 effector:target cell ratio (1:1 E:T). Briefly, T cells generated as described above were co-cultured with K562 CD19+/MSLN+ cells 7 days after electroporation. Forty-eight hours after the start of co-culture, supernatants were collected and analyzed for cytokine levels via Luminex. Cytokine measures were IL-2, INFg, and TNF. Cytotoxicity was analyzed by measuring luciferase activity in remaining target cells after 48 hours. Each data point in Figure 34B represents two replicates and the line represents the range of cytotoxicity for the replicates. As shown in Figure 34B, the GS94 integration site resulted in superior cytotoxic capacity and cytokine secretion after 48 hours of co-culture with K562 C19/MSLN cells.

Prime-independent cytotoxicity To compare the effect of candidate integration sites on cytotoxicity with prime-independent cytotoxicity, T cells that had undergone PrimeR and circuit cassette integration at the GS79 (TRAC) and GS94 integration sites were Seven days after electroporation, cells were co-cultured with K562 CD19+/MSLN+ cells or K562 CD19-/MSLN+ cells ("K562_MSLN") for 48 hours. 0.3, 1.0, and 3.0 E:T cell ratios were tested. See Figures 35A and 35B. Cytotoxicity was analyzed by measuring the luciferase activity of the remaining target cells 48 hours after the start of co-culture. As shown in Figure 35B, the GS94 integration site resulted in cytotoxic performance comparable to the TRAC integration site, with no prime-independent cytotoxicity.

Prime-independent cytokine secretion To compare the effect of candidate integration sites on cytotoxicity with prime-independent cytotoxicity, PrimeR and circuit cassette integration were performed at the GS79 (TRAC) and GS94 integration sites generated as described above. The received T cells were co-cultured with K562 CD19+/MSLN+ cells. A group with only target cells (E:T=0, target only) was compared with a group with an E:T cell ratio of 1. After 48 hours of co-culture with K562 CD19+/MSLN+ cells, supernatants were collected and analyzed for cytokine levels via Luminex to measure secretion of IL-2, INFg, and TNF cytokines. See Figures 36A and 36B. As shown in Figure 36B, the GS94 integration site resulted in equivalent cytokine secretion to the TRAC integration site, with no prime-independent secretion of IL-2, INFg, or TNF.

Prime-independent CAR expression To assess the effect of candidate integration sites on prime-independent CAR expression, T cells that underwent PrimeR and circuit cassette integration at the GS79 (TRAC) integration site, the GS94 integration site, and the GS102 integration site. were cultured in vitro for 32 days. On days 5, 12, 19 and 28 of the experiment, cells were treated with repetitive CD3/CD28 stimulation. On day 16, cells were assessed for CAR expression using a flow cytometry assay. As shown in Figure 37, T cell activation by TCR did not result in prime R-independent CAR expression from circuit cassette integration at candidate integration sites.

T cells generated as described above were cultured in 96-well plates, and T cell growth medium was changed every two days. On days 5, 12, 19 and 28, T cells were stimulated with 1:1 CD3/CD28 Dynabeads. Cells were analyzed for PrimeR expression by myc epitope tag staining and CAR expression by FLAG epitope tag staining at the indicated time points. Flow analysis was performed on an Attune NxT flow cytometer.

Example 7: Assessing the stability of prime receptor expression over several weeks To assess the effect of candidate integration sites on stable (sustained) expression of PrimeR, PrimeR and circuitry were synthesized at the integration site shown in Figure 38. T cells that had undergone cassette integration were cultured in vitro for 32 days. Briefly, T cells generated as described above were cultured in 96-well plates, and T cell growth medium was changed every two days. On days 5, 12, 19 and 28, T cells were stimulated with 1:1 CD3/CD28 Dynabeads repetitive stimulation. Flow cytometry assays were performed on days 16 and 32 using an Attune NxT flow cytometer. Cells were analyzed for PrimeR expression by myc epitope tag staining. As shown in Figures 38A and 38B, the GS94 integration site resulted in stable PrimeR expression for at least 4 weeks.

Example 8: Evaluation of on-target editing efficiency To evaluate the on-target editing efficiency of candidate knock-in sites, an iGUIDE-Seq assay was used. The method used to perform the iGUIDE-Seq assay is illustrated in Figure 39A and as described in Nobles et al. Genome Biology (2019), which is incorporated herein by reference in its entirety. As shown in Figure 39B, the GS94 integration site had the highest on-target editing efficiency among the candidate integration sites evaluated. As shown in Figure 39C, GS94 did not result in the putative off-target editing observed in the two donors.

Example 9: Evaluation method for GS94 knock-in Elevation prediction: Calculated prediction of potential off-target sites from (gs94) was performed using Elevation-search (Listgarten et al. 2018. Prediction of off-target activities for the end -to- The end design of CRISPR guide RNAs. Nat Biomed Engr 2, 37-48, software available from https://github.com/Microsoft/Elevation) was used. All sites identified by Elevation-search were analyzed using rhAmp-seq.

rhAmpSeq: The 49 candidate off-target sites of GS94 and GS94 target sites identified by iGUIDE or upstream prediction algorithms were characterized by rhAmpSeq (Integrated DNA Technologies, Inc.). This targeted amplification allows NGS-based quantification of edits occurring simultaneously at multiple sites. Genomic DNA from T cells from at least two donors treated alone with each of the following seven guides: GS84, GS94, GS95, GS96, GS102, GS108, and GS138 was purified using the GenFind V3 DNA purification system (Beckman Coulter ) was isolated. Two separate rhAmpSeq amplification pools were used to cover 50 loci and this procedure was performed as recommended by Integrated DNA Technologies for each sample. The rhAmpSeq library was sequenced on a MiniSeq with Intermediate Output Kit (300 cycles) (Illumina). The CRISPResso2 algorithm (https://github.com/pinellolab/CRISPResso2) was used to determine the insertion and deletion rates at each of the amplified loci. Statistical significance (FDR-adjusted p-value ≦0.001) using chi-square test was observed only at the GS94 site.

RNA-seq: To assess the changes induced by GS94 integration at the transcriptional level, the CD19/MSLN circuit was integrated at the GS79 (TRAC), GS94, and GS102 integration sites. Six days after integration, 1e6 edited cells were sorted using a BD FACSAria based on transgene expression. RNA was isolated from sorted T cells using the RNeasy kit (Qiagen). Purified RNA was converted into an NGS library using TruSeq RNA library preparation kit v2 (Illumina). Libraries were sequenced on either a NovaSeq6000 or NextSeq550 instrument (Illumina). Align RNA-seq data against the reference human GRCh38 transcriptome to obtain gene-level read counts using the STAR2.7.3a aligner (Dobin A. et al. Bioinformatics. 2013.29:15-21). Ta. Differential expression was calculated by combining data across both donors using edgeR (Robinson MD et al. Bioinformatics. 2010.26:139-140). The only genes within 300 Kb of the GS94 site, ETS1 and FLI1, were differentially expressed in cells with integration at the GS94 integration site compared to cells with integration at either of the other two loci. was not expressed. At an FDR-adjusted p-value cutoff of 0.01, the number of differentially expressed genes was minimal (less than 100 genes genome-wide).

Cytokine-independent proliferation assay: To assess the safety of primary T cells harboring the GS94 locus KI, a cytokine-independent proliferation assay was performed to assess the potential for oncogenic transformation. Briefly, primary human T cells containing CD19/MSLN circuit cassette integration at the GS94 locus were thawed and allowed to recover overnight. 1×10 ⁶ cells were then seeded into one well of a 24-well-GRex plate and cultured for 5 days in medium with or without cytokines. Cell numbers and viability were recorded on days 0, 3 and 5. As a positive control, 1×10 ⁶ Jurkat cells were cultured in parallel in medium without cytokines. As shown in Figure 43, GS94 KI T cells maintained good viability and total cell counts when cultured with cytokines, but the viability of GS94 KI T cells decreased for 5 days when cultured without cytokines. decreased dramatically over time, with no viable cells remaining on day 5. Positive control Jurkat cells maintained good viability and expansion without cytokines throughout the assay. Taken together, this data shows that GS94-edited primary human T cells are still dependent on exogenous cytokines for growth, survival and expansion, and therefore there is no concern for cell transformation.

Results The specificity of CRISPR reagents (eg, SpCas9 complexed with sgRNA) targeting candidate loci including GS94 was evaluated by iGUIDE-seq (Figure 40). GS94-targeted CRISPR RNP showed the highest proportion of iGUIDE-seq oligo cassette trapping events of all candidates evaluated, and control sgRNA sequences from the iGUIDE-seq paper were similar to those reported in the original publication. specificity, suggesting that the assay performed as expected.

The putative off-target site was obtained from the iGUIDE-seq output, which already suggested that the putative site was false. Additional target sites were predicted by a computational approach (Elevation software package). We used rhAmp-seq to prepare high-throughput sequencing libraries for each of the putative off-target sites and applied the method to DNA samples from T cells electroporated with CRISPR RNPs targeting the candidate target sites. Applied. The resulting NGS data was processed with CRISPResso2 software, and the frequency of insertions and deletions (indels) was taken as an indicator of CRISPR cleavage activity, as is common in the field. We show that T cells electroporated with GS94-targeted CRISPR RNPs do not have a higher frequency of indels in a set of putative off-target sites than T cells treated with CRISPR RNPs targeted to other sites; Consistent with a GS94-targeted CRISPR RNP with no consequential or detectable off-target activity, and thus the most specific of the set evaluated (Figure 41).

The potential effect of transgene integration at the GS94 site on the regulation of the T-cell transcriptome is demonstrated by knocking a large cassette into the site, growing T cells for several days, and selecting cells expressing the transgene within the cassette. It was then evaluated by collecting RNA from the cells. RNA-seq libraries were prepared and sequenced, and analysis of the resulting Illumina sequencing data showed that cells with integration at the GS94 site compared to cells with integration at the TRAC or GS102 site. No biologically or statistically significant differences were shown in the expression of any genes within 300 kb of (Figure 42). Additionally, other gene expression differences that reached statistical significance were minimal in number and effect size, consistent with being noise in the comparison.

To assess whether transgene integration at GS94 can confer a transformed phenotype, cells with integration at the GS94 site were cultured in vitro with and without cytokines. Cells survived and remained viable with cytokine addition, but died and lost viability without cytokine supplementation (Figure 43). Positive control Jurkat cells remained viable and proliferated. Overall, this shows that transgene integration in GS94 does not confer the capacity for cytokine-independent growth, which is a hallmark of T cell transformation.

Example 10: In Vivo Insertion of a CAR Expression Cassette A transgene cassette expressing a CAR that recognizes a tumor antigen or a CAR that recognizes a tumor antigen under the control of a priming receptor that recognizes the antigen in the anatomical vicinity of the tumor. The in-vivo efficacy of T cells with a CAR antigen is evaluated against human tumor cells, such as K562, engineered to express a CAR antigen or to express an antigen recognized by both the priming receptor and the CAR. Tumor cells (eg, 1e6) are injected subcutaneously into the flank of NSG mice (Jackson Laboratories). Tumor growth is assessed by caliper measurements every 2-4 days. When the tumor volume reached approximately 100 cubic mm, mice were treated with 5e6 T cells carrying CAR or prime-CAR circuit cassettes integrated at specific sites by CRISPR-mediated insertion, or T cells engineered with CRISPR RNP alone. , or PBS alone as a sham injection, intravenously. Tumor growth is monitored and mice are euthanized when tumor volume reaches 2000 cubic mm. Peripheral blood is bled from mice via a retroorbital procedure and flow cytometry and/or ddPCR is used to observe the expansion of engineered T cells over time. At sacrifice, spleen, blood, tumors and/or other tissues are analyzed for the presence of engineered T cells via flow cytometry, ddPCR, and/or immunohistochemistry. The results showed that T cells engineered with cassette integration at one of the defined genomic loci produced tumor regression and clearance compared to T cells without cassette integration in injected mice, and engineered We demonstrate that injected T cells are detectable in the peripheral blood and tissues of injected mice.

Example 11: Evaluation of non-viral insertion of a large 8.3 kb expression cassette in GS94 An 8.3 kb insert was then inserted into the GS94 safe harbor locus in T cells using materials/methods as previously described. did. A diagram of the cassette is shown in FIG.

Construct generation

To generate plasmid constructs for knock-ins, synthetic DNA was ordered from Twist, IDT and GENEWIZ and assembled via Gibson Assembly and Golden Gate Assembly. The plasmid contained homology arms homologous to sequences flanking the CRISPR target site in the genome that were 1.2 kb or 450 bp long.

T cell manipulation

T cells were obtained from peripheral blood mononuclear cells (PBMCs) obtained from a normal donor Leukopak (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and EasySep Human T Cell Isolation Kit (STEMCELL Technologies). es). T cells were then cultured in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi Premium Grade). The cells were activated with CD3/CD28 Dynabeads (ThermoFisher, 40203D) at a bead to cell ratio of 1:1, cultured for 48 hours at 37°C and 5% CO2, and then electroporated.

CRISPR RNPs were prepared with 120 μM of sgRNA targeting the DNA sequence GAGCCATGCTTGGCTTACGA (GS94, SEQ ID NO: 94) (Synthego), 62.5 μM of sNLS-SpCas9-sNLS (Aldevron) in a volume ratio of 5:1:3:6. , and P3 buffer (Lonza) and incubated for 15 minutes at room temperature. Optimal amounts of plasmid DNA (range 0.5-3 micrograms) determined by dose titration experiments were mixed with 3.5 μl of RNP. T cells were counted, bead removed, centrifuged for 10 min at 90xG, supplemented (Lonza) and resuspended in 10^6 cells/14.5 μl of P3. 14.5 μl of T cell suspension was added to the DNA/RNP mixture, transferred to a Lonza 384-well Nucleocuvette plate, and pulsed with a Lonza HT Nucleofector system, code EH-115. Cells were allowed to rest for 15 minutes at room temperature before being transferred to 96-well plates (Sarstedt) in TexMACS medium supplemented with 12.5 ng/ml human IL-7 and IL-15 (Miltenyi Premium Grade).

Transgene expression was detected by staining with anti-Myc antibody (Cell Signaling Technology clone 9B11) and anti-Flag antibody (RnD system, clone 1042E) and analyzed on an Attune NxT flow cytometer. Other antibodies used were LIVE/DEAD Fixable Near-IR (Thermo Fisher), TCR alpha/beta antibody (BioLegend clone IP26), CD4 antibody (BioLegend clone RPA-T4), CD8 antibody (BioLegend clone SK1) .

Priming receptor induction

To assess the functional activity of the transgene (i.e., synthetic circuit), the edited T cells were co-cultured with a target cell line expressing the priming antigen at a 1:1 E:T ratio and incubated for 24 hours. did. T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess priming receptor and CAR expression, respectively.

To assess whether the 8.3 kb transgene integration in GS94 resulted in a functional knock-in, cells were incubated with parental K562 cells and K562 cells expressing the cognate priming antigen at a 1:1 E:T cell ratio. Cultured. Cells were assayed by flow cytometry after 48 hours as described above. K562 cells with priming antigen, but not control parental K562 cells, induced CAR expression (Figure 45). Overall, this indicates that the priming receptor induced CAR expression after insertion of the 8.3 kb transgene circuit. Therefore, insertion of the 8.3 kb transgene circuit resulted in the expression of multiple functional genes.

Example 12: T cell differentiation method after editing

Two donor T cells edited as described above using priming receptor and CAR synthesis circuits were phenotypically profiled with cell surface T cell subset markers by flow cytometry. Resting T cells were harvested from in vitro culture conditions and washed with PBS before staining with Zombie-Aqua viability dye, CD4, CD8, CD45RA, CCR7, and CD27, using FMO as a control for gating; Analyzed with Attune NxT. In FlowJo, single viable lymphocytes are selected by SSC and FSC and subset profiling with a combination of CCR7, CD27, CD45RA is used to detect naïve or stem cell memory (Tn/Tscm) on CD4+ and CD8+ subpopulations. CD45RA+CCR7+CD27+), central memory- (Tcm:CD45RA-CCR7+CD27+), effector memory (Tem:CD45RA-CCR7-CD27-), or terminal effector (Tte:CD45RA+CCR7-CD27-) T cells were identified.

result

Non-viral editing generated a poorly differentiated T cell product (Figure 46). In both donors, non-viral editing did not contribute to the expansion of terminally differentiated T cells, as the major subsets of T cells in both subpopulations retained positive expression of CD45RA and CCR7. (Figure 46). This suggests that the edited T cells include the ability to expand, survive, and persist in vivo.

References Eyquem, J. , Mansilla-Soto, J. , Giavridis, T. , van der Stegen, S. J. , Hamieh, M. , Cunanan, K. M. 、． ．． ．． & Sadelain, M. (2017). Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumor rejection. Nature, 543(7643), 113-117.

Sadelain, M. , Papapetrou, E. P. , & Bushman, F. D. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58.

Irion, S. , Luche, H. , Gadue, P. , Fehling, H. J. , Kennedy, M. , & Keller, G. (2007). Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nature biotechnology, 25(12), 1477-1482.

Pellenz, S. , Phelps, M. , Tang,W. , Hovde, B. T. , Sinit, R. B. , Fu, W. 、． ．． ．． &Monnat Jr,R. J. (2019). New human chromosomal sites with “safe harbor” potential for targeted transgene insertion. Human gene therapy, 30(7), 814-828.

Roth, T. L. , Li, P. J. , Nies, J. F. , Yu, R. , Nguyen, M. L. , Lee, Y. 、． ．． ．． & Nguyen, D. N. (2019). Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. bioRxiv, 604561.

Claims (148)

An engineered cell comprising at least one sequence encoding a transgene, said at least one sequence inserted into a safe harbor locus, said safe harbor locus comprising an sgRNA as described in Table 4. The engineered cell wherein expression of the at least one sequence encoding the transgene at any one or more of the target loci is operably linked to an endogenous promoter. An engineered cell comprising at least one sequence encoding a transgene, said at least one sequence inserted into a safe harbor locus, said safe harbor locus comprising an sgRNA as described in Table 4. The engineered cell wherein expression of the at least one sequence encoding the transgene at any one or more of the target loci is operably linked to an exogenous promoter. The sgRNA target loci are chr11:128340000 to 128350000, chr10:33130000 to 33140000, chr10:72290000 to 72300000, chr11:65425000 to 65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000, chr2:87460000~ 87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, or chr9:7970000-7980000. Any of claims 1 to 3, wherein the sgRNA target locus is selected from chr11:128340000-128350000, chr10:72290000-72300000, chr15:92830000-92840000, or chr16:11220000-11230000. Operations described in Section 1 cells. The engineered cell according to any one of claims 1 to 4, wherein the sgRNA target locus is chr11:128340000-128350000. The engineered cell according to any one of claims 1 to 4, wherein the sgRNA target locus is chr15:92830000-92840000. The sgRNA target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2 , SOCS1, SRP14 , SRSF9, SUB1, TET2, TIGIT, TRAC, or TRIM28. The safe harbor locus is GS94, GS88, GS89, GS90, GS91, GS92, GS93, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109 , GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, or GS120. The engineered cell according to any one of the above. The safe harbor locus is selected from any one of the integration sites in Table 4 designated as GS94, GS91, GS92, GS93, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. The engineered cell according to any one of claims 1 to 4. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS103, GS104, or GS105. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS94, GS95, or GS96. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is the GS94 integration site of Table 4. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS100, GS101, or GS102. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is the GS102 integration site of Table 4. 10. The engineered cell of claim 8 or 9, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS91, GS92, or GS93. The engineered cell according to any one of claims 2 to 15, wherein the exogenous promoter is the EF1a promoter. Engineered cells according to any one of claims 1 to 16, which are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 18. The engineered cell of claim 17, which is a T cell or a T cell precursor. The engineered cell according to any one of claims 1 to 18, which is undifferentiated. Engineered cell according to any one of claims 1 to 18, which is CD45RA ⁺ and CCR7 ⁺ . Engineered cell according to any one of claims 1 to 20, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. Engineered cell according to any one of claims 1 to 21, wherein the transgene encodes a chimeric antigen receptor (CAR). A composition comprising an engineered cell according to any one of claims 1 to 22 and a pharmaceutical excipient. A guide ribonucleic acid (gRNA) for editing cells at safe harbor loci, said gRNA comprising any one of the sgRNA sequences of Table 4. The gRNA according to claim 24, comprising any one of SEQ ID NOs: 1-120. The gRNA according to claim 24 or 25, comprising any one of SEQ ID NOs: 91-96 and 100-105. gRNA according to any one of claims 24 to 26, comprising SEQ ID NO: 94 or SEQ ID NO: 102. gRNA according to any one of claims 24 to 26, comprising SEQ ID NO: 94. gRNA according to any one of claims 24 to 26, comprising SEQ ID NO: 102. gRNA according to any one of claims 24 to 29, wherein the cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell, or a T cell precursor. A method of editing a cell having chromosomal DNA comprising inserting at least one sequence encoding a transgene into a safe harbor locus of said chromosomal DNA of said cell, said safe harbor locus being 4. The sgRNA target loci are chr11:128340000 to 128350000, chr10:33130000 to 33140000, chr10:72290000 to 72300000, chr11:65425000 to 65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000, chr2:87460000~ 32. The method of claim 31, wherein the method is selected from chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, or chr9:7970000-7980000. 33. The sgRNA target locus is selected from chr11:128340000-128350000, chr10:72290000-72300000, chr15:92830000-92840000, or chr16:11220000-11230000. Method described. 34. The method according to any one of claims 31 to 33, wherein the sgRNA target locus is chr11:128340000-128350000. 34. The method according to any one of claims 31 to 33, wherein the sgRNA target locus is chr15:92830000-92840000. The sgRNA target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2 , SOCS1, SRP14 32. The method of claim 31, wherein the gene is selected from , SRSF9, SUB1, TET2, TIGIT, TRAC, or TRIM28. The safe harbor locus is GS94, GS88, GS89, GS90, GS91, GS92, GS93, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109 , GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, or GS120. Method described. The safe harbor locus is selected from any one of the integration sites in Table 4 designated as GS94, GS91, GS92, GS93, GS95, GS96, GS100, GS101, GS102, GS103, GS104, or GS105. 34. The method according to any one of claims 31 to 33. 34. The method of any one of claims 31-33, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS103, GS104, or GS105. 34. The method of any one of claims 31-33, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS94, GS95, or GS96. 34. The method of any one of claims 31-33, wherein the safe harbor locus is the GS94 integration site of Table 4. 34. The method of any one of claims 31-33, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS100, GS101, or GS102. 34. The method of any one of claims 31-33, wherein the safe harbor locus is the GS102 integration site of Table 4. 34. The method of any one of claims 31-33, wherein the safe harbor locus is selected from any one of the integration sites in Table 4 designated GS91, GS92, or GS93. 45. A method according to any one of claims 31 to 44, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. 46. The method of any one of claims 31-45, wherein the transgene encodes a chimeric antigen receptor (CAR). 47. The method of any one of claims 31-46, wherein said at least one sequence comprises an exogenous promoter, said exogenous promoter being operably linked to said transgene. 48. The method of claim 47, wherein the exogenous promoter is the EF1a promoter. 49. The method of any one of claims 31 to 48, wherein the cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 50. The method of claim 49, wherein the cell is a T cell or a T cell precursor. 51. The method according to any one of claims 31 to 50, wherein the engineered cells are undifferentiated. 52. The method of any one of claims 31-51, wherein the engineered cells are CD45RA ⁺ and CCR7 ⁺ . 53. A method according to any one of claims 31 to 52, wherein said at least one sequence is inserted using homologous recombination repair. 53. A method according to any one of claims 31 to 52, wherein said at least one sequence is inserted using homologous recombination-independent specific insertion. 55. The method of any one of claims 31 to 54, wherein said at least one sequence is inserted using one or more guide ribonucleic acids (gRNA) and one or more Cas9 endonucleases. 56. The method of claim 55, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 1-120. 57. The method of claim 55 or 56, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 91-96 and 100-105. 58. The method of any one of claims 55-57, wherein the gRNA comprises SEQ ID NO: 94 or SEQ ID NO: 102. 59. The method of any one of claims 55-58, wherein the gRNA comprises SEQ ID NO:94. 59. The method of any one of claims 55-58, wherein the gRNA comprises SEQ ID NO: 102. A method of editing a T cell comprising contacting a T cell with one or more guide ribonucleic acids (gRNAs), at least one sequence encoding a transgene, and one or more Cas9 endonucleases, the method comprising: one or more gRNAs and a Cas9 endonuclease facilitate insertion of said at least one sequence into chromosomal DNA within a safe harbor locus, said safe harbor locus being one of the sgRNA target loci in Table 4. The above-mentioned method is selected from one or more of the above methods. 62. The method of claim 61, wherein the one or more gRNAs comprise a sequence selected from any one of the sgRNA sequences of Table 4. 63. The method of claim 61 or 62, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 1-120. 64. The method of any one of claims 61-63, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 91-96 and 100-105. 65. The method of any one of claims 61-64, wherein the gRNA comprises SEQ ID NO: 94 or SEQ ID NO: 102. 66. The method of any one of claims 61-65, wherein the gRNA comprises SEQ ID NO:94. 66. The method of any one of claims 61-65, wherein the gRNA comprises SEQ ID NO: 102. The sgRNA target loci are chr11:128340000 to 128350000, chr10:33130000 to 33140000, chr10:72290000 to 72300000, chr11:65425000 to 65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000, chr2:87460000~ 87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, or chr9:7970000-7980000, according to any one of claims 61-67. method. 69. The sgRNA target locus of claims 61-68, wherein the sgRNA target locus is selected from chr11:128340000-128350000, chr10:72290000-72300000, chr15:92830000-92840000, or chr16:11220000-11230000. The method described in any one of the above . 70. The method of any one of claims 61-69, wherein the sgRNA target locus is chr11:128340000-128350000. 70. The method of any one of claims 61-69, wherein the sgRNA target locus is chr15:92830000-92840000. The sgRNA target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2 , SOCS1, SRP14 , SRSF9, SUB1, TET2, TIGIT, TRAC, or TRIM28. The safe harbor locus is GS94, GS88, GS89, GS90, GS91, GS92, GS93, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109 , GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, or GS120. The method described in any one of the above. The safe harbor locus is selected from any one of the integration sites in Table 4 designated as GS94, GS91, GS92, GS93, GS95, GS96, GS100, GS101, GS102, GS103, GS104, or GS105. 74. The method of any one of claims 61-68 and 73, wherein 75. According to any one of claims 61-68 and 73-74, wherein the safe harbor locus is selected from any one of the integration sites of Table 4 designated GS103, GS104, or GS105. the method of. 75. According to any one of claims 61-68 and 73-74, wherein the safe harbor locus is selected from any one of the integration sites of Table 4 designated GS94, GS95, and GS96. the method of. 77. The method of claim 76, wherein the safe harbor locus is the GS94 integration site of Table 4. 75. According to any one of claims 61-68 and 73-74, wherein the safe harbor locus is selected from any one of the integration sites of Table 4 designated GS100, GS101, or GS102. the method of. 79. The method of claim 78, wherein the safe harbor locus is the GS102 integration site of Table 4. 75. According to any one of claims 61-68 and 73-74, wherein the safe harbor locus is selected from any one of the integration sites of Table 4 designated GS91, GS92, or GS93. the method of. 81. The method of any one of claims 61-80, wherein the engineered cells are undifferentiated. 82. The method of any one of claims 61-81, wherein the engineered cells are CD45RA ⁺ and CCR7 ⁺ . An ex vivo method of obtaining engineered cells or populations thereof, comprising:
a. a step of obtaining cells;
b. Genetically modifying said cell by inserting at least one sequence encoding a transgene into a safe harbor locus, said safe harbor locus being any of the sgRNA target loci of Table 4. The ex vivo method comprises the steps selected from one of: Obtaining the cells comprises: (i) collecting a tissue sample from the subject; (ii) isolating the cells from the tissue sample; and (iii) culturing the cells in vitro. 84. The method of claim 83, comprising: 85. The method of claim 84, wherein the tissue sample is a blood sample. 86. The method of any one of claims 83-85, wherein the cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 87. The method of claim 86, wherein the cell is a T cell or a T cell precursor. 88. The method of any one of claims 83-87, wherein the engineered cells are undifferentiated. 89. The method of any one of claims 83-88, wherein the engineered cells are CD45RA ⁺ and CCR7 ⁺ . 90. The method of any one of claims 83-89, wherein said at least one sequence is inserted using homologous recombination repair. 90. The method of any one of claims 83-89, wherein said at least one sequence is inserted using homologous recombination-independent specific insertion. said genetic modification in step (b) comprising contacting said cell with one or more guide ribonucleic acids (gRNA), said at least one sequence, and one or more Cas9 endonucleases, said one or more 92. The method of any one of claims 83-91, wherein said gRNA and Cas9 endonuclease facilitate said insertion of said at least one sequence into chromosomal DNA within said safe harbor locus. 93. The method of claim 92, wherein the one or more gRNAs comprise a sequence selected from any one of the sgRNA sequences of Table 4. 94. The method of any one of claims 83-93, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. 94. The method of any one of claims 83-93, wherein the transgene encodes a chimeric antigen receptor (CAR). 96. The method of any one of claims 83-95, wherein the at least one sequence comprises an exogenous promoter, and the exogenous promoter is operably linked to the transgene. 97. The method of claim 96, wherein the exogenous promoter is the EF1a promoter. 23. A method of treating a subject having a disease or at risk of having a disease, comprising administering to said subject an effective amount of a cell, a population thereof, according to any one of claims 1 to 22, or a population thereof, as claimed in claim 23. The method comprises administering a composition according to. 99. The method of claim 98, wherein said cells, said population thereof, or said composition are administered to said subject by injection. A method of treating a subject having or at risk of having a disease, the method comprising:
a. Carrying out the method according to any one of claims 83 to 97;
b. administering to said subject an effective amount of a composition comprising said cell or population thereof. 101. The method of claim 100, wherein the composition is administered to the subject by injection. 102. The method according to claim 100 or 101, wherein the disease is cancer. 103. The method according to any one of claims 100 to 102, wherein the disease is a blood cancer. 1. A method for identifying safe harbor loci, the method comprising:
a. identifying genes or non-coding regions within a chromosome that exceed a threshold level of expression and/or chromatin accessibility across developmental states of the cell;
b. generating a linear model that correlates the knock-in (KI) efficiency with said gene or non-coding region from step (a) and estimates the KI efficiency of any gene or coding region on said chromosome, and c ．． selecting the safe harbor locus based on a threshold parameter;
Said method, wherein said safe harbor locus is selected for inserting at least one sequence encoding a transgene into a cell. The threshold parameters are: stable expression of the transgene, knockout of the gene confers a benefit on the function of the cell, no known function within the cell, in vitro with or without CD3/CD28 stimulation. stable transgene expression, negligible off-target cleavages detected by iGuide-Seq or CRISPR-Seq, fewer off-target cleavages compared to other loci detected by iGuide-Seq or CRISPR-Seq, Negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible neighboring gene deregulation or silencing. 105. The method of claim 104, comprising one or more of: sing, and locating outside the cancer-associated gene. stable expression of the transgene at the safe harbor locus is a change in expression of no more than 2-fold over at least 1, 2, 3, 4, 5, 6, or 7 days; 106. The method of claim 105, as measured by the mean fluorescence intensity of a reporter gene encoded by. 107. The method of any one of claims 104 to 106, wherein the chromatin accessibility is measured using a transposase accessible chromatin assay using sequencing (ATAC-seq). 108. The method of any one of claims 104 to 107, wherein the expression level across developmental states of the cell is measured using RNA sequencing (RNA-seq). 109. The method of any one of claims 104 to 108, wherein the cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 110. A method according to any one of claims 104 to 109, wherein the linear model has a coefficient of determination ( ^R2 value) of at least 30%. 7. The engineered cell, composition, gRNA, or method of any one of the preceding claims, wherein insertion within the safe harbor locus increases cytotoxicity of diseased cells. 12. The engineered cell, composition, gRNA, or method of any one of the preceding claims, wherein knock-in efficiency at the safe harbor locus is high compared to other locations along the chromosome. An engineered cell comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus, the safe harbor locus being inserted into any of the sgRNA target loci. or in which the expression of the at least one sequence encoding the transgene is operably linked to an endogenous promoter or an exogenous promoter, the engineered cell is undifferentiated; engineered cells. The safe harbor locus is GS94, GS88, GS89, GS90, GS91, GS92, GS93, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109 114. The engineered engineered protein of claim 113 selected from any one of the integration sites designated as: cell. 115. The engineered cell of claim 113 or 114, wherein the safe harbor locus is the GS94 integration site. The sgRNA target loci are chr11:128340000 to 128350000, chr10:33130000 to 33140000, chr10:72290000 to 72300000, chr11:65425000 to 65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000, chr2:87460000~ 114. The engineered cell of claim 113, wherein the engineered cell is selected from: The sgRNA target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2 , SOCS1, SRP14 114. The engineered cell of claim 113, wherein the engineered cell is a gene selected from , SRSF9, SUB1, TET2, TIGIT, TRAC, or TRIM28. 118. The engineered cell of any one of claims 113-117, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 1-120. 119. The engineered cell of any one of claims 113 to 118, which is a stem cell, a human cell, a primary cell, a hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell, or a T cell precursor. 120. The engineered cell of claim 119, which is a T cell or a T cell precursor. 121. The engineered cell of any one of claims 113-120, which is CD45RA ⁺ and CCR7 ⁺ . Engineered cell according to any one of claims 113 to 121, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. 123. The engineered cell of any one of claims 113-122, wherein the transgene encodes a chimeric antigen receptor (CAR). A composition comprising an engineered cell according to any one of claims 113 to 123 and a pharmaceutical excipient. A method of editing a cell having chromosomal DNA comprising inserting at least one sequence encoding a transgene into a safe harbor locus of the chromosomal DNA of the cell, the safe harbor locus comprising an sgRNA. any one or more of the target loci, and the engineered cell is undifferentiated. 126. The method of claim 125, wherein the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 127. The method of claim 125 or 126, wherein the cell is a T cell or a T cell precursor. A method of editing a T cell comprising contacting a T cell with one or more guide ribonucleic acids (gRNAs), at least one sequence encoding a transgene, and one or more Cas9 endonucleases, the method comprising: The method, wherein one or more gRNAs and a Cas9 endonuclease facilitate insertion of said at least one sequence into chromosomal DNA within a safe harbor locus. The safe harbor locus is GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109 , GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, or GS120. The method described in section. 129. The method of any one of claims 125-128, wherein the safe harbor locus is the GS94 integration site. The sgRNA target loci are chr11:128340000 to 128350000, chr10:33130000 to 33140000, chr10:72290000 to 72300000, chr11:65425000 to 65427000 (NEAT1), chr15 :92830000~92840000, chr16:11220000~11230000, chr2:87460000~ 87470000, chr3:186510000-186520000, chr3:59450000-59460000, chr8:127980000-128000000, or chr9:7970000-7980000, any one of claims 125-128. The method described in. The sgRNA target locus is APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2 , SOCS1, SRP14 , SRSF9, SUB1, TET2, TIGIT, TRAC, or TRIM28. 133. The method of any one of claims 125-132, wherein the one or more gRNAs comprise any one of SEQ ID NOs: 1-120. 134. The method of any one of claims 125-133, wherein the engineered cell is CD45RA ⁺ and CCR7 ⁺ after inserting the at least one sequence into the safe harbor locus. 135. The method of any one of claims 125-134, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. 136. The method of any one of claims 125-135, wherein the transgene encodes a chimeric antigen receptor (CAR). An ex vivo method of obtaining undifferentiated engineered cells or populations thereof, comprising:
c. a step of obtaining cells;
d. genetically modifying said cell by inserting at least one sequence encoding a transgene into a safe harbor locus, said engineered cell being undifferentiated. Obtaining the cells comprises: (i) collecting a tissue sample from the subject; (ii) isolating the cells from the tissue sample; and (iii) culturing the cells in vitro. 138. The method of claim 137, comprising: 139. The method of claim 138, wherein the tissue sample is a blood sample. 140. The method of any one of claims 137-139, wherein the cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. 141. The method of claim 140, wherein the cell is a T cell or a T cell precursor. 143. The method of any one of claims 137-142, wherein the engineered cells are CD45RA ⁺ and CCR7 ⁺ . 144. The method of any one of claims 137-143, wherein the transgene encodes a recombinant protein, optionally a therapeutic agent. 144. The method of any one of claims 137-143, wherein the transgene encodes a chimeric antigen receptor (CAR). 124. A method of treating a subject having or at risk of having a disease, comprising administering to said subject an effective amount of a cell, a population thereof, according to any one of claims 113 to 123, or claim 124. The method comprises administering a composition according to. A method of treating a subject having or at risk of having a disease, the method comprising:
c. carrying out the method according to any one of claims 125 to 144;
d. administering to said subject an effective amount of a composition comprising said cell or population thereof. 147. The method of claim 146, wherein the composition is administered to the subject by injection. 148. The method of claim 146 or 147, wherein the disease is cancer.

Images