JP2023166382A - Enhanced systems for cell-mediated oncolytic viral therapy - Google Patents

Abstract

To provide enhanced modified viruses for enhancing cell-mediated oncolytic viral therapy, and compositions including such modified viruses.SOLUTION: The present invention provides a composition or a combination, comprising (a) an oncolytic virus and (b)supra adventitialadipose stromal cells (SA-ASC;CD235a-/CD45-/CD34+/CD146-/CD31-) or pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-), where the composition is a mixture of cells and viruses, and the combination is two separate compositions, where one composition includes viruses, and the other composition includes cells.SELECTED DRAWING: None

Description

RELATED APPLICATIONS Priority benefit is granted to inventor Antonio Fernandez Santidrian and applicant Calidi Biotherapeutics, Inc., filed November 6, 2018. US Provisional Application No. 62/756,550 entitled "ENHANCED SYSTEMS FOR CELL - MEDIATED ONCOLYTIC VIRAL THERAPY" of , Inc. No. 62/789,458 entitled ``ENHANCED SYSTEMS FOR CELL - MEDIATED ONCOLYTIC VIRAL THERAPY'' of This application is also filed by inventors Antonio Fernandez Santidrian, Duong Nguyen, Dobrin Draganov, and applicant Calidi Biotherapeutics, Inc. No. 16/676,416, filed on the same day as this case, entitled "ENHANCED SYSTEMS FOR CELL - MEDIATED ONCOLYTIC VIRAL THERAPY." The subject matter and disclosure of each of these applications is incorporated by reference in its entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ELECTRONICALLY An electronic version of the Sequence Listing is submitted with this specification, the contents of which are incorporated by reference in its entirety. The electronic file was created on November 6, 2019, is 793 kilobytes in size, and contains 2601SEQ001. It is titled txt.

FIELD OF THE INVENTION Cell-assisted viral expression systems to improve oncolytic virus therapy, uses of the systems, and methods of treating cancer by administering the systems to subjects in need of such treatment provided.

Background The ability of a delivered or administered virus to infect, colonize and/or replicate within a tumor is dependent on circulating neutralizing antibodies, innate and adaptive immune mechanisms, and other clearance mechanisms against the virus and/or carrier cells. can be hindered by Cells have been used as carriers for the delivery of oncolytic viruses for cancer therapy. There is a need for improved systems that enhance the therapeutic efficacy of oncolytic viruses.

Summary The use of cells, such as stem cells, for the delivery of oncolytic viruses can be improved by incubating the cells and the virus for a sufficient period of time for the virus to express and/or replicate the encoded genes. It is shown herein that this is possible. After incubation, cells can be stored at low temperatures for subsequent use. Long-term incubation increases the effectiveness of oncolytic virus therapy compared to naked virus and compared to previous use of cells that were not incubated with virus for a sufficient amount of time. The obtained cells can be stored, such as by cryopreservation or cryopreservation, for subsequent use. The resulting cells, which provide a more effective oncolytic virus delivery vehicle, can be administered via other routes including systemic administration as well as intratumoral, intraperitoneal and local administration.

Provided herein are cell-assisted viral expression systems (CAVES) that enhance oncolytic virus therapy. This system consists of (1) a cell such as a carrier cell that is permissive for viral infection and replication; (2) an oncolytic virus; (3) at least one expressed immunomodulatory gene encoded by the virus that is expressed in the cell. or therapeutic genes. CAVES are produced by incubating cells and viruses under conditions that allow the virus to infect cells and express genes. Exemplary cells enhance oncolytic virus therapy by having one or more characteristics for this purpose, such as the ability to: (a) amplify expression of viruses and virus-encoded proteins; (b) the ability to protect the virus from inactivation by the humoral immune system or other serum components; and/or (c) the ability to promote colonization and/or spread of viral infection within the tumor. The systems provided herein can be produced using any oncolytic virus and any cell that allows for viral amplification and expression of virally encoded proteins. Generally, the cells/carrier cells are not tumor cells or inactivated tumor cells, but are cells such as, but not limited to, stem cells and fibroblasts.

The systems provided herein allow cells that are permissive for viral infection and replication, as well as viruses, such as oncolytic viruses, to contain viral infection and at least one virally encoded immunomodulatory protein and/or at least one viral code and combination. Recombinantly expressed therapeutic proteins can be produced by incubation together ex vivo for a predetermined period of time sufficient to express the therapeutic protein and optionally one or more cells/recombinant cells.

To create CAVES that do not use cells as a standard delivery vehicle, but rather as part of a system that enhances the delivered oncolytic virus therapy, typically over 2 to 4 hours, generally about 5 or 6 hours to 72 hours or more, such as generally at least about 5 or 6 hours, or about 5 or 6 hours, or more than about 5 or 6 hours to at least about 7, 8, 9, 10, 11, 12, 13; 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, Incubation times of 64, 65, 66, 67, 68, 69, 70, 71 or 72 hours or more are required, such as about 6 hours to 18 hours, or about 12 hours to 48 hours. However, this period depends on the particular oncolytic virus and/or carrier cells used in the system, and combinations thereof. This period is sufficient for infection of the cell by the virus and expression of the virally encoded immunomodulatory or encoded therapeutic protein. For example, in the vesicular stomatitis virus (VSV) viral replication cycle, the time to express recombinant proteins, such as virus-encoded immunomodulatory and/or therapeutic proteins, is generally relatively short, on the order of 2-3 hours; For vaccinia virus, the time to express virus-encoded immunomodulatory proteins and/or recombinant therapeutic proteins is generally longer, on the order of 6-12 hours or more. To prepare vaccinia virus CAVES, it is generally necessary to incubate the virus with the cells for at least about 6 hours.

Upon administration, cell-assisted viral expression systems (CAVES) provide an immediate supply of immunomodulatory and/or therapeutic proteins regardless of tumor permissiveness to viral infection and/or amplification. Enhanced expression of virus-encoded immunomodulatory and/or therapeutic genes offers several advantages. These include prior exposure to the cancer/tumor so that the immunomodulator encoded by the virus acts immediately upon administration to prevent rejection of the virus and/or cells by the patient's immune system. expression, thus involving improved adaptation to conspecific situations. Cell-assisted viral expression systems (CAVES) can promote the expression of proteins that block the inhibitory effects of complement.

Although autologous cells can be used to produce cell-assisted viral expression systems (CAVES), cell-assisted viral expression systems (CAVES) provide a method for using allogeneic cells and standard protocols. can be manufactured and stored for administration. Viral amplification and expression of one or more virally encoded immunomodulatory proteins and/or recombinantly expressed therapeutic genes is initiated ex vivo for a predetermined period of time prior to administration or storage for future administration, as described herein. The cell-assisted viral expression systems (CAVES) provided in this book can be standardized to treat patient populations. Because viruses that infect cells express the encoded proteins upon administration, the therapeutic efficacy of the systems provided herein is subject to variations caused by differences in patient tumor microenvironments in the population. None or not very often. The Cell-Assisted Viral Expression Systems (CAVES) provided herein are designed to address non-permissive cancers/tumors, unfavorable microenvironments and/or tumors that can impede viral amplification and viral-encoded gene expression. overcome or alleviate difficulties associated with malnutrition within the country. Viral release and spread in the tumor can occur immediately after administration due to prior initiation of ex vivo viral amplification and expression of virus-encoded immunomodulatory and/or therapeutic genes.

In any of the compositions and methods provided herein, the cells and/or viruses used to produce CAVES and used in the related methods are modified as provided herein. Ru. The modifications provided herein can provide improved therapeutic benefits, for example, by incorporating encoded therapeutic products, or by incorporating immune and other barriers to improve therapeutic efficacy. , for example, can help overcome tumor vascular blockage. In some embodiments, cells are engineered for conditional immortalization, i.e., grown stably to generate large populations by activating immortalization and then inactivated prior to administration to a subject. can be used to prevent uncontrolled cell division from continuing in the subject. For example, a cell (a "carrier cell") may contain one or more wild-type or modified (mutated or e.g. as a fusion protein) c-myc, c-myc, c-myc, or modified (mutated or e.g. as a fusion protein) to accommodate the cellular components of the CAVES for conditional immortalization. Can be engineered to express v-myc, E6/E7, hTERT, SV40 large tumor antigen, loxP and/or tetR. The proliferation of the carrier cell population so modified can be activated at a first time point(s) prior to the preparation of the CAVES and/or prior to the administration of the CAVES to the subject, wherein the proliferation of the carrier cell population is activated. , can be inactivated at a second time point after expansion of the CAVES and before administration to the subject.

The systems provided herein can be stored stably and indefinitely under cryopreservation conditions, eg, -80°C, and can be thawed as needed or desired before administration. For example, the systems provided herein can be stored at storage temperatures such as -20°C or -80°C for at least or about several or several hours before thawing for administration. or 5 hours, or a number of days including for at least about several years, such as, but not limited to, at least or about 1, 2, 3 or more years, such as at least or about 1, 2, 3, 4 or from 5 hours to at least or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 , 53, 54, 55, 56, 57, 58, 59, 61, 62, 63, 64, 65, 66, 67, 68, 69, 60, 70, 71 or 72 hours, or 4, 5, 6, 7 , 8, 9, 10, 15, 20, 25 or 30 days, or 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 , 10, 10.5, 11, 11.5 or 12 months, or 1, 2, 3, 4 or 5 years or more. The systems provided herein can also be stably stored under refrigerated conditions, such as at 4° C., and/or transported on ice to the site of administration for treatment. For example, the systems provided herein can be stored at 4° C. or on ice for at least or about several hours, such as, but not limited to, 1, 2, 3, 4 or 5 hours prior to administration for treatment. Approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 or more than 48 hours.

Cell-assisted viral expression systems (CAVES) provided herein provide a system for generating pre-expressed virus-encoded proteins, such as immunomodulators and/or recombinantly expressed therapeutic proteins, prior to administration for treatment of a subject. Contains protein. This allows the tumor microenvironment to respond more quickly to treatment. The amount of virus used to generate the systems provided herein can be lower than when administering the virus directly without ex vivo amplification. Viral amplification and expression of virally encoded immunomodulators and/or recombinantly expressed therapeutic proteins occurs ex vivo for a defined period of time prior to administration to the tumor site, so that host immune cells Allogeneic cells can also be used to generate the systems provided herein, as viral infection and release at the tumor site can occur prior to mounting a response against the virus. Viral amplification and expression of virally encoded immunomodulators and/or recombinantly expressed therapeutic proteins is performed ex vivo for a defined period of time before being administered to the tumor site, allowing them to survive longer in the circulation. Extracellular enveloped virus particles (eeV) can be produced in situ immediately after administration of the system to the host.

Also provided herein are methods of treatment comprising administering the systems provided herein to a subject in need of such treatment. This system can be used alone or with, for example, but not limited to, checkpoint inhibitors, CAR-T cells, co-stimulatory molecules, therapeutic antibodies, bi-antibodies and antibody-drug conjugates. Can be administered in combination with other immuno-oncology therapies including.

overview
A. definition
B. Selection of components for cell-assisted viral expression systems (CAVES)
1. Cells (i) sensitized/protected cell media for improved virus amplification and/or immunomodulation; (ii) sensitized for resistance to virus-mediated killing (extended survival and improved for local immunosuppression)
(iii) Cellular media engineered to improve viral amplification and/or immunomodulation (iv) Cellular media engineered to express angiogenesis inhibitors for vascular normalization/tumor vascular reprogramming (v ) Cellular media engineered to express transgenes for conditional cell immortalization
2. virus
C. CAVES production, formulation, storage and transportation
D. Pharmaceutical compositions, combinations and kits
1. pharmaceutical composition
2. combination
3． kit
E. Concomitant (adjunct) treatments administered with CAVES
F. Mode of administration of CAVES for treatment
a. Administration of irradiated or non-irradiated CAVES
b. Route of administration
c. Device
d. Dosage of Administration Regimen
G. Treatment methods and monitoring in conjunction with treatment
H. Exemplary cancer types treated
I. Example

A. Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents, patent applications, published applications and publications, GenBank sequences, databases, websites, and other published materials referenced throughout this disclosure are referred to in their entirety, unless otherwise noted. Incorporated by reference. If there is more than one definition for a term herein, the definition in this section will take precedence. Where a URL or other such identifier or address is referred to, such identifiers may change and specific information on the Internet may change, but equivalent information may not be found by searching the Internet. Understand what is possible. Reference to these evidences the availability and general dissemination of such information.

As used herein, "virus" refers to any of a group of infectious entities that cannot grow or reproduce without a host cell. Viruses typically contain a protein coat and RNA or DNA as genetic material, but do not contain a semipermeable membrane and can only grow and multiply in living cells. Examples include influenza virus, mumps virus, poliovirus, Seneca Valley virus and Semliki Forest virus.

As used herein, "oncolytic virus" refers to a virus that selectively replicates in tumor cells of a tumor subject. These include viruses that naturally preferentially replicate and accumulate in tumor cells, such as poxviruses, and viruses that have been engineered to do so. Some oncolytic viruses can kill tumor cells after infection of the tumor cells. For example, oncolytic viruses can cause death of tumor cells by lysing the tumor cells or by inducing cell death of the tumor cells. Exemplary oncolytic viruses include, but are not limited to, poxviruses, herpesviruses, adenoviruses, adeno-associated viruses, lentiviruses, retroviruses, rhabdoviruses, papillomaviruses, vesicular stomatitis virus, measles virus. , Newcastle disease virus, picornavirus, Sindbis virus, papillomavirus, parvovirus, reovirus, and coxsackievirus.

As used herein, the term "therapeutic virus" refers to the treatment of neoplastic diseases such as cancer, tumors and/or metastases, or diseases or disorders such as inflammation or wounds; Refers to viruses administered for diagnosis and/or both. Generally, the therapeutic viruses herein are those that exhibit anti-tumor activity and minimal toxicity.

As used herein, the term "vaccinia virus" or "VACV" or "VV" refers to a large, complex enveloped virus belonging to the poxvirus family. It has a linear double-stranded DNA genome approximately 190 kbp in length that encodes approximately 200 proteins. Vaccinia virus strains include, but are not limited to, Western Reserve (WR), Copenhagen (Cop), Bern, Paris, Tashkent, Tian Tan, Lister, Wyeth, IHD-J, IHD-W, Brighton, Ankara, Modified vaccinia Ankara (MVA), CVA382, Dairen I, LIPV, LC16M8, LC16M0, ACAM, WR 65-16, Connaught, JX-594 (pexastimogene devacirepvec), GL-ONC1, vvDD TK mutant strain, New York City Department of Health ( NYCBH), EM-63 and NYVAC vaccinia virus strains, strains derived therefrom, or modified strains thereof.

As used herein, "marker" or "selection marker" with respect to engineered viruses refers to a compound, such as a protein, whose expression within and/or on the surface of the virus or the presence allows selection of viruses with desired engineered properties, such as viruses expressing recombinantly expressed therapeutic genes or other proteins, including marker proteins.

As used herein, Lister strain of the Institute of Viral Preparations (LIVP) or LIVP virus strain refers to a virus strain that is an attenuated Lister strain produced by adaptation to calf hide at the Institute of Viral Preparations, Moscow, Russia. (ATCC catalog number VR-1549) (Al'tshtein et al. (1985) Dokl. Akad. Nauk USSR 285:696-699). LIVP strains can be found, for example, at the Institute of Viral Preparations, Moscow, Russia (see, eg, Kutinova et al. (1995) Vaccine 13:487-493); the FSRI SRC VB Vector microbial collection (Kozlova et al. (2010) Environ. Sci. Technol. 44:5121-5126) or from the Moscow Ivanovsky Institute of Virology (C0355 K0602; Agranovski et al. (2006) Atmospheric Environment 40:3924-3929). This is also well known to those skilled in the art as it was the vaccine strain used for vaccination in the USSR and throughout Asia and India. This strain is currently used by researchers and is well known (e.g. Altshteyn et al. (1985) Dokl. Akad. Nauk USSR 285:696-699; Kutinova et al. (1994) Arch. Virol. 134:1-9 ; Kutinova et al. (1995) Vaccine 13:487-493; Shchelkunov et al. (1993) Virus Research 28:273-283; Sroller et al. (1998) Archives Virology 143:1311-1320; Zinoviev et al. (1994) Gene 147:209-214 ; and Chkheidze et al. (1993) FEBS 336:340-342)). LIVP virus strain encompasses any virus strain or virus preparation obtained by propagation of LIVP through repeated passages in a cell line.

As used herein, "modified virus" refers to a virus that has changed compared to the parent strain of the virus. Typically, a modified virus has one or more truncations, mutations, insertions or deletions in the genome of the virus. A modified virus can have one or more modified endogenous viral genes and/or one or more modified intergenic regions. An exemplary modified virus can have one or more heterologous nucleic acid sequences inserted into the genome of the virus. The modified virus can contain one or more heterologous nucleic acid sequences in the form of a gene expression cassette for expression of a heterologous gene.

Typically, the genome of a virus is modified by nucleotide substitutions (substitutions), insertions (additions) or deletions (truncation). Modifications can be made using any method known to those skilled in the art, including those provided herein, such as genetic engineering and recombinant DNA methods. Thus, a modified virus is a virus whose genome has changed compared to that of the parent virus. An exemplary modified virus has one or more heterologous nucleic acid sequences inserted into the genome of the virus. Generally, a heterologous nucleic acid includes an open reading frame encoding a heterologous protein that can be inserted under the control of a viral promoter or a heterologous non-viral promoter. For example, the modified viruses herein can include one or more heterologous nucleic acid sequences in the form of a gene expression cassette for expression of a heterologous gene.

As used herein, "cell", "cell vehicle", "carrier vehicle", "cell-based delivery vehicle" and "cell The term "carrier cell", used interchangeably with "cell-based vehicle", refers to a structure in which a virus can infect or be infected, or a chemical or Refers to any cell that can associate with or associates with a virus, either through physical interaction or by infection of the cytoplasm or nucleus of the cell by the virus. As used herein, a carrier cell refers to a cell that can be infected with a virus, such as an oncolytic virus, and that the virus/oncolytic virus can replicate. The resulting carrier cells contain or are associated with oncolytic viruses.

As used herein, the term "cell-assisted viral expression system" or "cell-assisted viral enhancement system" (CAVES) refers to the immunomodulatory gene products expressed by viruses, generally oncolytic viruses, and associated or at least one virally encoded protein, such as a therapeutic gene product. The term "CAVES" is used herein interchangeably with the term "SNV." The carrier cell is associated with the virus by incubating the virus and the cell under conditions where the virus infects the cell and the viral proteins are expressed by the cell. Depending on the virus, the carrier cell contains or displays on its surface at least one immunomodulatory protein or therapeutic gene product encoded by the virus. In an exemplary embodiment, the CAVES provided herein provide ex vivo or in vitro treatment of carrier cells with a virus for a period of time to achieve expression of a virally encoded immunomodulatory or therapeutic protein. produced by incubation. The period of time is a function of the particular virus and cell, and can range from more than about 2 hours to more than 72 hours, generally from about 3 hours to about 72 hours, such as from about or at least 3, 4, 5 or 6 hours to about or At least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 , 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or 72 hours or more and generally at least one virus-encoded immunomodulatory gene or therapy The temperature that allows expression of the gene is generally about or just 37°C. The specific time and temperature to promote such expression will depend on the type of oncolytic virus used in the system. CAVES result from expression of virally encoded products and replication of the virus in cells. In most embodiments herein, the cells of CAVES are not tumor cells and/or immune cells.

As used herein, "cryopreservation" refers to the process of cooling and preserving cells, tissues, or organs at very low temperatures to maintain their viability. Typically, cryopreservation is carried out at temperatures of about -80°C to -200°C. Cryopreservation media are known to those skilled in the art. For example, such media generally contain the same formulation used to grow the cells, plus up to 20% fetal bovine serum if the cells are grown in serum-free media, and cryopreservatives such as DMSO (7%-10%) and/or glycerol (approximately 10%). The resulting composition is said to be cryopreserved.

As used herein, a "cryopreservation composition" is a composition that has been stored at cryopreservation temperatures for at least 24 hours.

As used herein, "multiplicity of infection" (MOI) refers to the number of virus particles added per cell during infection (i.e., 1 million virus particles added to 1 million cells). Virus particles are at an MOI of 1).

As used herein, "sensitized" or "sensitizing a cell" refers to altering the properties of a cell, generally prior to use. Refers to the treatment of cells by treatment with drugs, for example, by inducing the expression of genes.

As used herein, amplification of a virus in a carrier cell means that the virus replicates within the cell to maintain the virus or increase the amount of virus within the cell.

As used herein, "host cell" or "target cell" are used interchangeably to refer to a cell that can be infected by a virus.

As used herein, the term "tissue" generally refers to a group, collection, or collection of similar cells that act to perform a specific function within an organism.

As used herein, the term "immunomodulatory protein" or "immunomodulator" refers to the attack by the innate and/or adaptive immune system of target cells, e.g. cells of a tumor. refers to a protein expressed by a virus that can protect the virus from Viral immunomodulatory products have evolved to withstand selective evolutionary pressures imposed by the host immune system. These products can modulate innate and adaptive host immune responses. Exemplary immunomodulatory products encoded by vaccinia include, but are not limited to, VCP (C3L), B5R, HA (A56R), B18R/B19R, B8R, CmrC and CmrE.

As used herein, the term "therapeutic gene product" or "therapeutic polypeptide" refers to the term "therapeutic gene product" or "therapeutic polypeptide" that ameliorates the symptoms of a disease or disorder or ameliorates a disease or disorder; Refers to any heterologous protein expressed by a therapeutic gene encoded by a virus such as an oncolytic virus. Therapeutic gene products include, but are not limited to, moieties that inhibit cell proliferation or promote cell death, moieties that can be activated to inhibit cell proliferation or promote cell death, or inhibit cell proliferation. or activate another agent that promotes cell death. Optionally, the therapeutic agent can exhibit or exhibit additional properties, such as properties that enable use as a contrast agent, as described elsewhere herein. Exemplary therapeutic gene products include, for example, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, angiogenesis inhibitors, or combinations thereof. included.

As used herein, a "compatibility" between a particular cell carrier (also referred to herein as cell media) and the carrier cell and the subject with cancer to be treated with the virus means that the cell carrier is Means sufficiently compatible with the host's immune system to evade the subject's immune system and deliver the virus to the subject's tumor. A carrier cell can also be matched to a virus, and the matching virus can replicate within the cell. A virus-matched carrier cell is compatible for administration to a subject if the virus multiplies/replicates within the cell and the cell delivers the virus to the subject's tumor. Assays for identifying compatible carrier cells and matching carrier cell/virus combinations for the subject being treated are provided in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073. , the contents of which are incorporated herein by reference in their entirety.

For purposes herein, an "antibody" (e.g., an immune cell such as a T cell, γδ (gd) T cell, NK cell, and NKT cell that is depleted or inhibited to suppress an immune response) The list of antibodies directed against antigens expressed on a population includes full-length antibodies and portions thereof, including antibody fragments. Antibody fragments include, but are not limited to, Fab fragments, Fab' fragments, F(ab') fragments, Fv fragments, disulfide-linked Fv (dsFv), Fd fragments, Fd' fragments, single chain Fv ( scFv), single chain Fabs (scFab), diabodies, anti-idiotype (anti-Id) antibodies, or antigen-binding fragments of any of the above. Antibodies also include synthetic antibodies, recombinantly produced antibodies, multispecific antibodies (eg, bispecific antibodies), human antibodies, non-human antibodies, humanized antibodies, chimeric antibodies, and intrabodies. Antibodies provided herein can be of any immunoglobulin type (e.g., IgG, IgM, IgD, IgE, IgA and IgY), of any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or including members of subclasses such as IgG2a and IgG2b.

Antibodies, such as monoclonal antibodies, can be prepared using standard methods known to those skilled in the art (eg, Kohler et al., Nature 256:495-497 (1975); Kohler et al., Eur. J. Immunol. 6:511-519 (1976); and WO 02/46455). For example, animals are immunized by standard methods to produce somatic cells that secrete antibodies. These cells are then removed from the immunized animal for fusion to myeloma cells. Somatic cells, especially B cells, capable of producing antibodies can be used for fusion with myeloma cell lines. These somatic cells can be derived from the primed animal's lymph nodes, spleen and peripheral blood. Specialized myeloma cell lines have been developed from lymphocytic tumors for use in hybridoma production fusion procedures (Kohler and Milstein, Eur. J. Immunol. 6:511-519 (1976); Shulman et al., Nature. 276:269-282 (1978); Volk et al., J. Virol., 42:220-227 (1982)). These cell lines have three useful properties. First, fused hybridomas from myeloma cells that are unfused and also self-proliferate indefinitely by having enzyme defects that prevent them from growing on selective media that favor hybridoma growth. The goal is to make the selection easier. The second is that they have the ability to produce antibodies and are unable to produce endogenous light or heavy immunoglobulin chains. A third property is that they fuse efficiently with other cells. Other methods of producing hybridomas and monoclonal antibodies are well known to those skilled in the art. It is routine to produce antibodies against any polypeptide, such as an antigenic marker on an immune cell population, or an immune checkpoint.

As used herein, a therapeutic agent is an agent that ameliorates the symptoms of a disease or disorder or that ameliorates a disease or disorder. Therapeutic agents, therapeutic compounds or therapeutic regimens include conventional drugs and drug therapies, including vaccines for treatment or prevention (i.e., reducing the risk of developing a particular disease or disorder); known to those skilled in the art and described elsewhere herein. Therapeutic agents for treating neoplastic diseases include, but are not limited to, moieties that inhibit cell proliferation or promote cell death, and can be activated to inhibit cell proliferation or promote cell death. or a moiety that activates another agent that inhibits cell proliferation or promotes cell death. A therapeutic agent for use in the methods provided herein can be, for example, an anti-cancer agent. Exemplary therapeutic agents include, for example, therapeutic microorganisms such as therapeutic viruses and bacteria, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibiotics. , anti-cancer antibodies, angiogenesis inhibitors, radiotherapy, chemotherapy compounds or combinations thereof.

As used herein, tumor cells or cancer cells refer to cells that divide and reproduce abnormally because their growth and division are unregulated and uncontrolled, ie, cells that are susceptible to uncontrolled growth. Tumor cells can be benign or malignant cells. Typically, tumor cells are malignant cells that can spread to other parts of the body, a process known as metastasis.

As used herein, a virus preparation or a virus composition refers to the growth of a virus strain, e.g., a vaccinia virus strain, a vaccinia virus clone strain, or a modified or recombinant virus strain, in vivo or in vitro in a culture system. refers to a virus composition obtained by For example, vaccinia virus preparation refers to a viral composition obtained by propagation of a virus strain in host cells, typically upon purification from a culture system using standard methods known in the art. A virus preparation is generally composed of several virus particles or virions. If desired, the number of virus particles in the sample or preparation can be expressed as the number of plaque-forming units per unit volume of sample (pfu/mL), assuming that each plaque formed represents one infectious virus particle. ) can be determined using a plaque assay. Each virus particle or virion in a preparation can have the same genomic sequence compared to other virus particles (i.e., the preparation is homogeneous in sequence), or can have a different genomic sequence ( i.e., the preparation is heterogeneous in sequence). It will be appreciated by those skilled in the art that in the absence of clonal isolation, heterogeneity or diversity in the viral genome can occur as the virus replicates, such as by homologous recombination events that occur during the natural selection process of viral strains. (Plotkin & Orenstein (eds.), "Recombinant Vaccinia Virus Vaccines" in Vaccines, 3rd edition (1999)).

As used herein, plaque forming units (pfu) or infectious units (IU) refer to the number of infectious or live virus. This therefore reflects the amount of active virus in the preparation. pfu can be determined using standard assays known to those skilled in the art, viral plaque assays or endpoint dilution assays.

As used herein, "targeting molecule" or "targeting ligand" refers to any molecular signal that directs localization to a particular cell, tissue or organ. . Examples of targeting ligands include, but are not limited to, proteins, polypeptides, or molecules that bind to cell surface molecules, including but not limited to proteins, carbohydrates, lipids, or other such moieties. These parts are mentioned. For example, targeting ligands include proteins or portions thereof that bind to cell surface receptors, or antibodies directed against antigens selectively expressed on target cells. Targeting ligands include, but are not limited to, growth factors, cytokines, adhesion molecules, neuropeptides, protein hormones and single chain antibodies (scFv).

As used herein, delivery vehicles for administration are lipid-based, such as liposomes, micelles or reverse micelles, associated with an agent, such as a virus, provided herein for delivery to a host subject. or other polymer-based compositions.

As used herein, accumulation of a virus in a particular tissue refers to the accumulation of a virus in a particular tissue of a host organism after a period of time following administration of the virus to the host that is long enough for the virus to infect an organ or tissue of the host. Refers to the distribution or colonization of viruses in tissues. Those skilled in the art will recognize that the duration of viral infection will vary depending on the virus, the organ(s) or tissue(s) infected, the immunocompetence of the host, and the dose of the virus administered. Generally, the accumulation will be less than about 1 day, about 1 day to about 2, 3, 4, 5, 6 or 7 days, about 1 week to about 2, 3 or 4 weeks, about 1 month to about 2 days after viral infection. , can be determined at 3, 4, 5, 6 months or more. For purposes herein, the virus preferentially accumulates in immune privileged tissues, such as inflamed or tumor tissue, but to the extent that the toxicity of the virus is mild or tolerable and at most non-lethal. cleared from other tissues and organs such as non-tumor tissues of the host.

As used herein, "preferential accumulation" refers to the accumulation of virus at a first location at a higher level than the accumulation at a second location (i.e., the concentration or titer of virus particles at the second location is higher than the concentration of virus particles at the second location). Therefore, viruses that accumulate preferentially in immune-privileged tissues (tissues that are protected from the immune system), such as inflamed and tumor tissues, as opposed to normal tissues or organs. Also refers to viruses that accumulate at high levels (i.e., concentration or viral titer) in immune privileged tissues such as tumors.

As used herein, activity refers to the in vitro or in vivo activity of a compound or virus provided herein. For example, in vivo activity refers to the physiological response that occurs following in vivo administration of a compound or virus (or composition or other mixture thereof) provided herein. Accordingly, activity encompasses the resulting therapeutic effects and pharmaceutical activities of such compounds, compositions and mixtures. Activity can be observed in in vitro and/or in vivo systems designed to test or use such activity.

As used herein, "anti-tumor activity" or "anti-tumorigenic" refers to a viral strain that prevents or inhibits tumor formation or growth in a subject in vitro or in vivo. refers to Anti-tumor activity can be determined by evaluating one or more parameters indicative of anti-tumor activity.

As used herein, "greater" or "improved" activity with respect to anti-tumor or anti-tumorigenic activity is defined as a virus strain that has a greater degree of activity than a reference or control virus. , or means capable of preventing or inhibiting tumor formation or growth in a subject in vitro or in vivo to a greater extent than without treatment with the virus. Whether anti-tumor activity is "greater" or "improved" should be determined by evaluating the effect of the virus, and, if appropriate, a control or reference virus, on parameters indicative of anti-tumor activity. It can be determined by When comparing the activity of two or more different viruses, the amount of virus used in the in vitro assay or administered in vivo (e.g., pfu) is the same or similar, and the conditions of the in vitro assay or in vivo evaluation (e.g., It is understood that the in vivo administration regimens) are the same or similar.

As used herein, "toxicity" (also referred to herein as virulence or pathogenicity) with respect to a virus refers to an adverse or toxic effect on a host upon administration of the virus. In the case of oncolytic viruses, such as vaccinia virus, the virulence of the virus is related to its accumulation in non-tumor organs or tissues, which can affect host survival or lead to adverse or toxic effects. Toxicity can be measured by evaluating one or more parameters indicative of toxicity. These include effects on the survival or health of the treated subject, such as accumulation in non-tumor tissues and effects on body weight.

As used herein, "reduced toxicity" refers to a host that has not been treated with a virus, or as compared to a host that has been administered another reference or control virus. means that the toxic or harmful effects upon administration of the virus to the patient are attenuated or diminished. Whether virulence is reduced or diminished can be determined by evaluating the effect of the virus, and optionally a control or reference virus, on parameters indicative of virulence. When comparing the activity of two or more different viruses, the amount of virus used in the in vitro assay or administered in vivo (e.g., pfu) is the same or similar, and the conditions of the in vitro assay or in vivo evaluation (e.g., It is understood that the in vivo administration regimens) are the same or similar. For example, when comparing the efficacy of a virus and a control or reference virus when administered in vivo, the subjects are of the same species, size, and sex, and the virus is administered in the same or similar amounts under the same or similar dosing regimen. be done. In particular, a virus with reduced virulence means that when the virus is administered to a host, such as for the treatment of a disease, the virus may cause damage or harm to the host, or to a greater extent than the disease being treated, or to a It can be meant that the virus does not accumulate in non-tumor organs and tissues of the host to an extent that affects the survival of the host to a greater extent than the virus or reference virus. For example, a virus with reduced toxicity includes a virus that does not result in death of the subject during the course of treatment.

As used herein, "control" or "standard" refers to a sample that is substantially identical to the test sample, except that it is not treated with the test parameter, or is a plasma sample. If so, it can be from a normal volunteer not suffering from the condition of interest. The control can also be an internal control. For example, a control can be a sample such as a virus with known properties or activity.

As used herein, dosing regimen refers to the amount of agent, eg, carrier cells or virus or other agent, administered and the frequency of administration over the course of the administration cycle. Dosage regimens are a function of the disease or condition being treated and can vary accordingly.

As used herein, frequency of administration refers to the number of times an agent is administered during a dosing cycle. For example, the frequency can be days, weeks or months. For example, the frequency can be 1, 2, 3, 4, 5, 6 or 7 doses during a dosing cycle. Frequency can refer to consecutive days during a cycle of administration. The particular frequency is a function of the particular disease or condition being treated.

As used herein, "cycle of administration" refers to a repeated schedule of dosing regimens of administration of virus repeated over successive administrations. For example, an exemplary dosing cycle is a 28 day cycle.

As used herein, immunoprivileged cells and tissues refer to cells and tissues, such as solid tumors, that are isolated from the immune system. Immune privileged cells or tissues tolerate antigen introduction without eliciting an inflammatory immune response. For example, administration of a virus to a subject elicits an immune response that eliminates the virus from the subject. However, immune privileged sites are protected or isolated from the immune response, allowing the virus to survive and generally replicate. Immunologically privileged tissues include proliferating tissues such as tumor tissue and other tissues, as well as cells involved in other proliferative disorders, wounds, and other tissues involved in inflammatory responses.

As used herein, a tumor, also known as a neoplasm, is a mass of abnormal tissue that occurs when cells grow at an abnormally fast rate. Tumors include hematopoietic tumors as well as solid tumors. Tumors can exhibit a partial or total lack of structural organization and functional coordination with normal tissue. Tumors can be benign (not cancerous) or malignant (cancerous).

As used herein, malignancy, when applied to tumors, refers to a primary tumor that has metastatic potential with loss of growth and positional control.

As used herein, metastasis refers to the growth of abnormal or neoplastic cells away from the site primarily involved in the pathological process.

As used herein, malignant tumors can be broadly classified into three major types. Carcinomas are malignant tumors that arise from epithelial structures such as, but not limited to, the breast, prostate, lung, colon, and pancreas. Sarcomas are malignant tumors derived from connective tissue or mesenchymal cells such as muscle, cartilage, fat or bone. Leukemia and lymphoma are malignant tumors that develop in hematopoietic structures (structures involved in the formation of blood cells), including components of the immune system. Other malignancies include, but are not limited to, tumors of the nervous system (eg, neurofibromatomas), germ cell tumors, and blastic tumors.

As used herein, a resected tumor refers to a tumor in which a substantial portion of the tumor has been removed. Excision can be performed by surgery (ie, surgically removed tumor). Resection can be partial or complete.

As used herein, disease or disorder refers to a pathological condition of an organism that results from, for example, an infection or a genetic defect and is characterized by identifiable symptoms. Exemplary diseases described herein are neoplastic diseases such as cancer.

As used herein, neoplastic disease refers to any disorder that involves tumor initiation, growth, metastasis and progression, including cancer.

As used herein, cancer is a term for any type of malignancy or disease caused by or characterized by hematologic malignancies, including metastatic cancer, lymphoid tumors, and hematologic cancers. It is. Exemplary cancers include, but are not limited to, acute lymphoblastic leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, acute promyelocytic leukemia, adenocarcinoma, adenoma, adrenal cancer , adrenocortical cancer, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, osteosarcoma/malignant fibrous histiocytes tumor, brainstem glioma, brain cancer, carcinoma, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, optic tract or hypothalamus Glioma, breast cancer, bronchial adenoma/carcinoid, Burkitt's lymphoma, carcinoid tumor, carcinoma, central nervous system lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, colon cancer, Cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, epidermoid carcinoma, esophageal cancer, Ewing sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct Eye cancer/intraocular melanoma, eye cancer/retinoblastoma, gallbladder cancer, gallstone tumor, stomach/stomach cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, giant cell tumor, glioblastoma multiforme , glioma, hair cell tumor, head and neck cancer, heart cancer, hepatocellular/liver cancer, Hodgkin lymphoma, hyperplasia, hyperplastic corneal nerve tumor, carcinoma in situ, hypopharyngeal cancer, intestinal Ganglioneuroma, islet cell tumor, Kaposi sarcoma, kidney/renal cell carcinoma, laryngeal cancer, leiomyoma, lip and oral cavity cancer, liposarcoma, liver cancer, non-small cell lung cancer, small cell lung cancer, lymphoma , macroglobulinemia, malignant carcinoid, malignant fibrous histiocytoma of bone, malignant hypercalcemia, malignant melanoma, Marfanoid tumor, medullary carcinoma, melanoma, Merkel cell carcinoma, mesothelioma , metastatic skin cancer, metastatic squamous cell carcinoma of the neck, oral cavity cancer, mucosal neuroma, multiple myeloma, mycosis fungoides, myelodysplastic syndrome, myeloma, myeloproliferative disorders, nasal cavity and sinuses Cancer, nasopharyngeal cancer, neck cancer, neural tissue cancer, neuroblastoma, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, ovarian epithelial tumor, ovarian germ cell tumor, pancreatic cancer Parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma, pituitary adenoma, pleuropulmonary blastoma, true red blood cell cancer, primary brain tumor, prostate cancer, rectal cancer, renal cell tumor, reticular sarcoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, seminoma, Sézary syndrome, skin cancer, small intestine cancer, soft tissue Sarcoma, squamous cell carcinoma, squamous cell carcinoma of the neck, gastric cancer, supratentorial primitive neuroectodermal tumor, testicular cancer, pharyngeal cancer, thymoma, thyroid cancer, local skin lesions, chorionic tumor, urethral cancer, uterus / Includes endometrial cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenström macroglobulinemia, or Wilms tumor. Exemplary cancers commonly diagnosed in humans include, but are not limited to, bladder, brain, breast, bone marrow, cervical, colorectal, kidney, liver, lung/bronchial, ovarian, Includes cancers of the pancreas, prostate, skin, stomach, thyroid, or uterus. Exemplary cancers commonly diagnosed in dogs, cats, and other pets include, but are not limited to, lymphosarcoma, osteosarcoma, mammary tumors, mast cell tumors, brain tumors, melanoma, Squamous cell carcinoma, carcinoid lung tumor, bronchial adenocarcinoma, bronchial adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, Microgliomas, neuroblastomas, osteoclastomas, oral neoplasms, fibrosarcomas, osteosarcomas and rhabdomyosarcomas, genital squamous cell carcinomas, Sertoli cell tumors, hemangioectiocytomas, histiocytomas, chloromas (e.g. granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, gastric tumor, adrenal adenocarcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma , follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma, and squamous cell carcinoma of the lung. Exemplary cancers diagnosed in rodents such as ferrets include, but are not limited to, insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. Exemplary neoplasms affecting agricultural livestock include, but are not limited to, leukemia, hemangioectiocytoma and bovine ocular neoplasm (bovine); foreskin fibrosarcoma, ulcerative squamous cell carcinoma, foreskin carcinoma; Connective tissue neoplasms and mast cell tumors (horses); hepatocellular carcinoma (swine); lymphoma and pulmonary adenomatosis (sheep); pulmonary sarcoma, lymphoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B Cellular lymphoma and lymphocytic leukemia (avian species); retinoblastoma, liver neoplasm, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swim bladder sarcoma (fish species), caseating lymphadenitis (CLA): These include the chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and the contagious lung tumor of sheep caused by Jaegsikte.

As used herein, a cell involved in a disease or disease process refers to a cell whose presence contributes to, exacerbates, causes, or is involved in the pathogenesis of the disease or disease process. Inhibition or killing of such cells can ameliorate symptoms of the disease or ameliorate the disease. An example of such a cell is a tumor cell. Killing tumor cells or inhibiting their growth or proliferation results in treatment of the tumor. Other examples are immune effector cells involved in inflammatory responses that contribute to the pathology of various diseases. Diseases that have an inflammatory component can be treated by inhibiting or killing immune effector cells.

As used herein, "killing or inhibiting growth or proliferation of cells" means that the cells die or are eliminated. Inhibiting growth or proliferation means that the number of such cells does not increase, but can decrease.

As used herein, a "tumor cell" is any cell that is part of a tumor. Typically, carrier cells provided herein preferentially home to tumor cells, and viruses provided herein preferentially home to tumor cells of interest compared to normal cells. Infect.

As used herein, a "metastatic cell" is a cell that has metastatic potential. Metastatic cells have the ability to metastasize from a first tumor in a subject and can colonize tissue at a different site in the subject to form a second tumor at that site.

As used herein, a "tumorigenic cell" is a cell that is capable of forming a tumor when introduced into the appropriate site of a subject. Cells can be non-metastatic or metastatic.

As used herein, "normal cells" are cells that are not derived from a tumor, but are derived from healthy, non-diseased tissue.

As used herein, "metastasis" refers to the spread of cancer from one part of the body to another. For example, in the process of metastasis, malignant cells can spread from the site of the primary tumor where they arose and migrate to lymphatics and blood vessels, which transport the cells to normal tissues elsewhere in the organism. Here the cells continue to proliferate. Tumors formed by cells that spread through metastasis are called "metastatic tumors," "secondary tumors," or "metastasis."

As used herein, an anti-cancer agent or anti-cancer compound (used interchangeably with "anti-tumor or anti-neoplastic agent") means Refers to any drug or compound used in the treatment of cancer. These include, when used alone or in combination with other compounds, to alleviate, reduce, ameliorate, prevent or put into remission clinical symptoms or diagnostic markers associated with neoplastic diseases, tumors and cancers; Includes any agent that can cause or maintain a state of remission and that can be used in the methods, combinations, and compositions provided herein. Anticancer agents include anti-metastatic agents. Exemplary anticancer agents include, but are not limited to, chemotherapeutic compounds (e.g., toxins, alkylating agents, nitrosoureas, anticancer antibiotics, antimetabolites, antimitotic agents, and Topoisomerase inhibitors, cytokines, growth factors, hormones, photosensitizers, radionuclides, signal transduction modulators, immunotherapeutics, CAR-T cells, checkpoint inhibitors, CRISPR therapy, anti-cancer antibodies, anti-cancer oligos Exemplary chemotherapeutic compounds include, but are not limited to, peptides, anti-cancer oligonucleotides (e.g., antisense RNA and RNAi such as siRNA and shRNA), angiogenesis inhibitors, radiotherapy, or combinations thereof. include, but are not limited to, Ara-C, cisplatin, carboplatin, paclitaxel, doxorubicin, gemcitabine, camptothecin, irinotecan, cyclophosphamide, 6-mercaptopurine, vincristine, 5-fluorouracil, and methotrexate. .

As used herein, references to anticancer or chemotherapeutic agents refer to combinations of anticancer or chemotherapeutic agents, or multiple anticancer or chemotherapeutic agents, unless otherwise indicated. including.

As used herein, a subject includes any organism, including animals, for which diagnosis, screening, monitoring, or treatment is contemplated. Animals include mammals such as primates and domesticated animals. An exemplary primate is a human. Patient refers to a subject, such as a mammal, primate, human, or domestic animal subject, who is suffering from a disease condition, or for whom a disease condition is determined, or for whom the risk of a disease condition is determined.

As used herein, patient refers to a human subject exhibiting symptoms of a disease or disorder.

As used herein, treatment of a subject with a condition, disorder or disease refers to any method of treatment in which the symptoms of the condition, disorder or disease are ameliorated or beneficially altered. Treatment includes any pharmaceutical use of the cell-assisted viral expression systems described and provided herein.

As used herein, treatment of a subject with a neoplastic disease, including a tumor or metastasis, refers to any manner of treatment in which the symptoms of having a neoplastic disease are ameliorated or beneficially altered. Typically, treatment of tumors or metastases in a subject involves slowing tumor growth, lysing tumor cells, including inhibiting tumor angiogenesis, tumor cell division, tumor cell migration, or degrading the basement membrane or extracellular matrix. , any mode of treatment that results in a reduction in tumor size, prevention of new tumor growth, or prevention of metastasis of a primary tumor.

As used herein, therapeutic effect means an effect resulting from treatment of a subject that alters, typically improves or ameliorates, or cures the symptoms of a disease or condition. A therapeutically effective amount refers to an amount of a composition, molecule or compound that produces a therapeutic effect after administration to a subject.

As used herein, amelioration or alleviation of symptoms of a particular disorder, such as by administration of a particular pharmaceutical composition, may be permanent or temporary, sustained Refers to any reduction, whether temporary or temporary.

As used herein, efficacy means that upon administration of a virus or viral composition, the virus colonizes and replicates in proliferating or immune privileged cells, such as tumor cells. Colony formation and replication in tumor cells indicates that the treatment is or will be an effective treatment.

As used herein, effective treatment with a cell carrier/virus is one that is capable of increasing survival compared to the absence of treatment. For example, viruses are effective treatments if they stabilize the disease, cause tumor regression, reduce the severity of the disease, or slow or reduce tumor metastasis.

As used herein, an effective or therapeutically effective amount of a virus or compound to treat a particular disease is an amount that ameliorates or in some way reduces the symptoms associated with the disease. The amount varies from individual to individual and depends on several factors including, but not limited to, age, weight, general health of the patient, and severity of the disease. A therapeutically effective amount can be administered as a single dose or can be administered in multiple doses according to an effective regimen. Although this amount can cure the disease, it is typically administered to ameliorate the symptoms of the disease. Repeated administration may be required to achieve the desired improvement in symptoms.

As used herein, an effective or therapeutically effective amount of a virus or compound for treating a neoplastic disease, including tumors or metastases, includes, but is not limited to, slowing tumor growth, lysing tumor cells. , an amount that ameliorates or in any way reduces symptoms associated with a neoplastic disease, including reducing the size of a tumor, preventing new tumor growth, or preventing metastasis of a primary tumor.

As used herein, preventing a disease or condition means reducing the probability of developing or increasing the likelihood of developing the disease or condition.

As used herein, "composition" refers to any mixture of two or more products or compounds. It can be a solution, suspension, liquid, powder, paste, aqueous, non-aqueous, or any combination thereof.

As used herein, formulation refers to a composition containing at least one active pharmaceutical or therapeutic agent and one or more excipients.

As used herein, co-formulation refers to a composition containing two or more active agents or pharmaceuticals or therapeutic agents and one or more excipients.

As used herein, combination refers to any association between or within two or more items. A combination can be two or more separate items, such as two compositions or two sets, a mixture thereof, such as a single mixture of two or more items, or any variation thereof. Can be done. The elements of a combination are generally functionally associated or related. Exemplary combinations include, but are not limited to, two or more pharmaceutical compositions, two or more active ingredients, such as two viruses, or a virus and an anti-cancer agent, such as two chemotherapeutic compounds. Compositions containing the above viruses, viruses and therapeutic agents, viruses and contrast agents, viruses and multiple therapeutic agents and/or contrast agents, or any association thereof are included. Such combinations can be packaged as kits.

As used herein, composition refers to a mixture of two or more ingredients, such as a therapeutic agent, in or mixed with a pharmaceutically acceptable vehicle.

As used herein, direct administration refers to administering the composition without dilution.

As used herein, a kit is a packaged combination, optionally including instructions for use of the combination and/or other reactions and components for such use.

As used herein, an "article of manufacture" is a product that is manufactured and sold. As used throughout this application, the term encompasses articles containing carrier cells and vaccinia virus alone or in combination with a second therapeutic agent or therapeutic energy source contained in the same or separate packaging. is intended.

As used herein, device refers to something manufactured or adapted for a particular task. Exemplary devices herein are devices that can cover, coat, or contact the epidermis or skin surface. Examples of such devices include, but are not limited to, wraps, bandages, binds, dresses, sutures, patches, gauze, or dressings.

As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. .

As used herein, ranges and amounts can be expressed as "about" or "approximately" a particular value or range. "About" or "approximately" includes a precise amount. Thus, "about 5 milliliters" also means "about 5 milliliters" and "5 milliliters". Generally, "about" includes quantities that are expected to be within experimental error.

As used herein, "about the same" means within a range of amounts that one of ordinary skill in the art would consider to be the same or within an acceptable margin of error. For example, typically within at least 1%, 2%, 3%, 4%, 5% or 10% is considered similar for pharmaceutical compositions. Such amounts can vary depending on the subject's tolerance for particular compositional variations.

As used herein, "optional" or "optionally" means that the subsequently described event or situation occurs or does not occur; Including when the situation occurs and when this does not occur.

As used herein, an "allogeneic cell" is a cell that is genetically different with respect to a particular subject, generally because it is derived from genetically different individuals of the same species. For example, allogeneic stem cells are stem cells derived from a donor other than the patient (or identical twin).

As used herein, an "autologous cell" is a cell obtained from the individual being treated with the cell. For example, autologous cells are obtained from the subject being treated (ie, the patient). For example, autologous stem cells are stem cells derived from a patient.

As used herein, the term "engineered" with respect to cellular media or carrier cells refers to genetic modification of the cell such that it expresses proteins that can improve or enhance the performance of the cell. do. For example, cells can be engineered for improved viral amplification and/or improved immunomodulation.

As used herein, "immunomodulation" refers to any process by which an immune response is modified to a desired level, eg, by inducing, enhancing, or suppressing the immune response.

As used herein, "immune suppression" or "immunosuppression" refers to the suppression or reduction of an immune response.

As used herein, "immune privileged" or "immunoprivileged" refers to cells or tissues that do not elicit an immune response and are able to evade the immune system. Immune privileged cells and tissues refer to cells and tissues, such as solid tumors and the tumor microenvironment, that are isolated from the immune system by the immunosuppressive properties of the tumor. As a result, oncolytic viruses preferentially accumulate in tumors in the tumor microenvironment, as they are protected from the immune system. However, immune privileged tissues and cells are protected or isolated from the immune response, allowing the virus to survive and generally replicate.

As used herein, "disease or disorder" refers to a pathological condition of an organism that results from, for example, an infection or a genetic defect and is characterized by identifiable symptoms.

As used herein, "resistant" with respect to viral infection refers to cells that are not infected, or are infected to a very low extent, by the virus upon exposure to the virus.

As used herein, "permissive" with respect to viral infection refers to a cell that is easily infected upon exposure to a virus.

As used herein, immunological compatibility is sufficient to evade the subject's/host's immune system for a sufficient time to deliver the virus to the subject's tumor or cancerous cells. refers to cells or viruses that are compatible with

As used herein, "co-culture" refers to a cell culture in which two or more different cell populations are cultured.

As used herein, the term "loading" with respect to a cell refers to a cell and, for example, viruses, small molecules, therapeutic agents, and antibodies or antigen-binding fragments thereof, on the surface of the cell or within the cell. can refer to the association of a cell with a drug, such as by chemical or physical interaction between the drugs.

As used herein, adipose-derived stem cells or ADSCs are mesenchymal stem cells obtained from donor adipose tissue.

As used herein, a peripheral blood mononuclear cell or PBMC is any peripheral blood cell with a round nucleus, such as a lymphocyte, monocyte or macrophage.

As used herein, "L14 VV" or "CAL14 VV" is the TK insertion Turbo-FP635 engineered LIVP strain of vaccinia virus.

As used herein, "ACAM2000" (ACAM1000 and ACAM2000 having the same genomic sequence deposited as ATCC Deposit No. PTA-3321; U.S. Patent Nos. 6,723,325, 6,723,325, 7,115,270 No. 7,645,456) is a wild-type thymidine kinase (TK)-positive Wyeth strain of vaccinia virus. This is a smallpox vaccine strain available from the CDC. ACAM1000 is the name of the virus when grown in MRC5 cells, and ACAM2000 is the name of the virus when grown in Vero cells. In an embodiment, the ACAM2000 virus has the sequence shown in SEQ ID NO:70.

As used herein, "CAL-01" or "CAL1" or "WT1", used interchangeably herein, refers to a virus amplified or cultured from ACAM2000 or ACAM1000. In an exemplary embodiment, the CAL1 virus has the sequence shown in SEQ ID NO:71.

As used herein, "CAL-02" or "CAL2," as used interchangeably herein, refers to exogenous genes, such as OX40L, 4-IBBL, single chain antibodies directed against checkpoint inhibitors, Refers to recombinant forms of ACAM2000 or CAL1 viruses encoding, for example, CTLA-4.

As used herein, "CAL-03" or "CAL3," as used interchangeably herein, refers to a single chain antibody directed against an anti-angiogenic gene, such as VEGF, optionally with one or more other ACAM2000, CAL1 or CAL2 viruses expressed in combination with exogenous genes of eg OX40L, 4-IBBL, single chain antibodies against checkpoint inhibitors, eg CTLA-4.

As used herein, "SNV-1" or "SNV1," as used interchangeably herein, refers to CAVES (or SNV). When 1×10 ⁷ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-1a (or SNV1a). When 1×10 ⁶ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-1b (or SNV1b). When 1×10 ⁵ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-1c (or SNV1c).

As used herein, "SNV-2" or "SNV2," as used interchangeably herein, refers to CAVES (or SNV). When 1×10 ⁷ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-2a (or SNV2a). When 1×10 ⁶ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-2b (or SNV2b). When 1×10 ⁵ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-2c (or SNV2c).

As used herein, "SNV-3" or "SNV3," as used interchangeably herein, refers to CAVES or SNVs formed by incubating the CAL-03 virus with a cell carrier such as a stem cell. refers to When 1×10 ⁷ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-3a (or SNV3a). When 1×10 ⁶ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-3b (or SNV3b). When 1×10 ⁵ pfu of virus is incubated with cell carriers, the resulting SNV is called SNV-3c (or SNV3c).

As used herein, viral plaque assay (VPA) is an assay used to determine the amount of infectious virus or viral titer given as plaque forming units (pfu) per ml or per sample. It is.

As used herein, "primed" or "protected" cell media or carrier cells are cells that contain cytokines, such as interferon (IFN), to protect the cells from an immune response. or pretreated with and/or loaded with agents such as allogeneic inactivating/rejection determinant antagonists.

As used herein, treatment refers to amelioration of symptoms of a disease or disorder.

As used herein, prophylaxis refers to prophylactic treatment to reduce the risk of developing, or reduce the severity of, a disease or condition.

As used herein, subject refers to any mammal that can be treated by the methods and uses herein. Mammals include humans, other primates such as chimpanzees, bonobos and gorillas, dogs, cats, cows, pigs, goats, and other farm animals and pets. Patient refers to a human subject.

As used herein, "inactivation" of a gene or locus means that the expression of one or more products encoded by the gene or locus is reduced, e.g. by 10% or more, generally by 50% or more, e.g. about or Just 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 , 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% means partially or completely inhibited. Inactivation can be achieved, for example, by partial or complete truncation of the genetic locus and/or by insertion of exogenous genes, such as therapeutic genes.

As used herein, abbreviations for protecting groups, amino acids, and other compounds refer to their common usage, recognized abbreviations, or IUPAC-IUB Committee on Biochemical Nomenclature, unless otherwise noted. (1972) Biochem. 11:1726).

In the interest of clarity, and not limitation, the detailed description is divided into the following subsections.

B. Selection of components for cell-assisted viral expression systems (CAVES) Cells have been used as carriers for therapeutic oncolytic viruses. Viruses were understood to be loaded into cells ex vivo with the aim of loading as much virus per cell as possible (see, eg, Kim et al. (2015) Viruses 7:6200-6217). Generally, a multiplicity of infection (MOI) of at least 200 viruses/cells or higher is used to accomplish this. Also, the virus should be loaded as quickly as possible to avoid premature initiation of viral replication, which reduces cell carrier viability and also results in clearance by the host immune system. Premature presentation of viral antigens above was also understood to increase (see, eg, Kim et al. (2015) Viruses 7:6200-6217). It is shown herein that this previous understanding is incorrect. Herein, infection of cells should be carried out at a low MOI, generally less than 10, e.g. 0.1 or less, up to a maximum of about 1 MOI/cell, and incubation of the virus with the cells is such that viral replication is initiated and the virus Expression of genes, such as immunomodulatory gene products and therapeutic products, should proceed long enough to be expressed. Generally, cells containing viruses provided herein will contain less than about 100 virus particles/cells at the time of administration or storage by freezing or refrigeration for future use; It should express the protein encoded by the virus. The specific amount of virus depends on the cells and virus selected. For example, vaccinia virus and stem cells, such as MSC or adipose SVF-derived cells, must be incubated for at least 6 hours, up to about 35, about 40 or about 50 hours. The initial MOI should be less than 10 pfu/cell, such as 0.1-10, or 0.01-10, or 0.1-1 viral particles/cell. Generally, the cells are stem cells or primary cells, such as fibroblasts, and not cancer cells, including inactivated cancer cells and/or immune cells.

1. Cells Oncolytic viruses (OVs) have the ability to preferentially infect, accumulate, and kill tumor cells compared to normal cells. This ability can be an inherent feature of the virus (eg, poxviruses, reoviruses, Newcastle disease virus and mumps virus), or the virus can be modified or selected for this property. Viruses can be genetically attenuated or modified so that they can evade antiviral immunity and other defenses in a subject (e.g., vesicular stomatitis virus, herpes simplex virus, adenovirus), so that They preferentially accumulate in tumor cells or the tumor microenvironment and/or a preference for tumor cells can be expressed against viruses using, for example, tumor-specific cell surface molecules, transcription factors and tissue-specific microRNAs. (e.g., Cattaneo et al., Nat. Rev. Microbiol., 6(7):529-540 (2008); Dorer et al., Adv. Drug Deliv. Rev. ., 61(7-8):554-571 (2009); Kelly et al., Mol. Ther., 17(3):409-416 (2009); and Naik et al., Expert Opin. Biol. Ther., 9 ( 9): 1163-1176 (2009)).

Delivery of oncolytic viruses can be performed via direct intratumoral injection. Direct intratumoral delivery can minimize the exposure of normal cells to the virus, but for some patients, e.g. due to inaccessibility of the tumor site (e.g. brain tumor) or spread over a large area. There is often a restriction to tumors that are in the form of nodules or metastatic disease. Viruses can be delivered via systemic or local delivery, such as by intravenous or intraperitoneal administration, and other such routes. Systemic delivery can deliver the virus not only to the primary tumor site but also to disseminated metastases.

However, regardless of the delivery mode, successful treatment using oncolytic viruses can be compromised by the host's immune system, which can induce an immune response and neutralize the virus (Kerrigan et al. (2017) Cytotherapy 19(4):445-457; Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). For example, intravenously delivered viruses are exposed to complement and various immune cells, as well as antibodies, sequestered in organs such as the lungs, spleen and liver, and then eliminated (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). The host's immune system has evolved to eliminate viruses. For example, neutralizing antibodies (NAbs) bind to viruses and block their attachment to cell surface receptors, inhibiting viral infection and thus limiting the therapeutic potential of administered therapeutic viruses (Jennings et al. (2014) Int. J. Cancer 134:1091-1101). In addition to the innate immune response, previous exposures resulting in adaptive immunity are more specific and potent and can also limit the therapeutic potential of OV. Physical barriers such as the tumor's extracellular matrix and high interstitial fluid pressure can prevent efficient delivery of viral particles to tumor cells (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56).

The majority of human individuals are exposed to several viruses, including measles virus, adenovirus, vaccinia virus, and reovirus, and as a result, existing antiviral therapies can reduce the therapeutic efficacy of oncolytic virus therapy. Indicates viral immunity. For example, most subjects born before the mid-1970s have received smallpox vaccination, which confers pre-existing antiviral immunity against orthopoxviruses, including vaccinia virus. Even if the subject does not already have pre-existing immunity to a particular OV, the first dose of virus produces an antiviral immune response, which is typically required to achieve a strong antitumor response. Limiting the effectiveness of repeated dosing. Strategies to circumvent this include the use of immunosuppressive drugs such as cyclophosphamide and the use of carrier cells (cellular vehicles) to bypass the immune system and deliver OVs to the tumor site.

Transient immunosuppression using immunosuppressive drugs such as cyclophosphamide, tacrolimus, mycophenolate mofetil and methylprednisolone sodium succinate has been used in organ transplantation, but enhanced tumor delivery of systemically administered OV has had limited success (Guo et al. (2010) Gene Ther. 17(12):1465-1475). The use of immunosuppressive drugs can also increase the potential toxicity of the virus and further reduce the anti-tumor response initiated by the immune system that aids tumor lysis (Thorne et al. (2010) Molecular Therapy 18(9):1698-1705).

Carrier cells were used for delivery of OVs. Carrier cells can mimic the way viruses evolved and spread within the host. For example, human immunodeficiency virus can bind to circulating dendritic cells (DCs) and macrophages, which migrate to lymph nodes and allow the virus to reach its targets: CD4 ⁺ T cells. Furthermore, viruses that replicate by spreading from cell to cell can evade neutralizing antibodies. Clinical trials have shown that oncolytic reovirus, when administered intravenously, binds to circulating cells, retains its infectivity, and reaches tumor cells even in the presence of neutralizing antibodies (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). Advantages of using cell-based vehicles include specific delivery of OVs to tumor cells, increasing their therapeutic potential and preventing off-target toxicity, and the ability to protect OVs from pre-existing antiviral immunity. It will be done.

The effectiveness of carrier cells for delivering OVs depends on several factors, including but not limited to: (1) ex vivo loading of virus; (2) in vivo loading of virus at the tumor site. accumulation; and (3) viral amplification/production at the tumor site (Guo et al. (2010) Gene Ther. 17(12):1465-1475). The ideal carrier cell would not only protect the OV from neutralization by the immune system, but also deliver the OV specifically to the tumor and have its own antitumor activity. The carrier cells should be safe to administer, easy to isolate and/or manufacture, susceptible to infection by the virus, allow the virus to replicate, and release the virus at the tumor site before being destroyed. be.

In the case of the CAVES provided herein, the carrier cells, in addition to being effective for the delivery of OVs, are capable of ex vivo amplification (replication) of the virus and at least one virus-encoded immunomodulatory protein and/or recombinant It must be possible to promote expression of the expressed therapeutic protein. In the systems provided herein, a cell, such as a carrier cell, is placed in a predetermined manner that enables ex vivo replication (amplification) of the virus and expression of at least one virus-encoded immunomodulatory protein and/or recombinantly expressed therapeutic protein. Incubate with virus for a period of time. The length of time can vary depending on the replication cycle of the virus, for example from more than 2 hours, such as more than 3 hours, more than 4 hours, such as from 6 to 48 hours, to for example more than 72 hours. For example, VSV is a rapidly replicating virus, and delivery through carrier cells can be achieved when cells are injected 1-2 hours after infection. Slowly replicating viruses such as vaccinia virus provide greater flexibility in optimizing the timing of infection and delivery of carrier cells.

Cells used in the systems provided herein can be autologous or allogeneic. The use of autologous carrier cells (cells obtained from the subject being treated) can minimize the innate and immune response directed against the carrier cells, but is cumbersome to the subject, expensive, and difficult to obtain. Possibilities may be limited. Allogeneic carrier cells, which can include a variety of readily isolated and/or commercially available cells/cell lines, offer ease of availability and non-invasiveness to the subject, but an order of magnitude greater natural and/or or adaptive immune responses can compromise therapeutic efficacy and clinical applicability.

The systems provided herein are capable of head-starting viral therapeutic effects, i.e., through ex vivo viral replication and immunomodulatory and/or expression of recombinantly expressed therapeutic protein(s) prior to administration. to overcome or alleviate the host immune response by providing a host immune response, thereby allowing the use of allogeneic cells to create the above system. The cells used in the systems provided herein are also immunologically compatible or otherwise optimized for therapeutic efficacy for the particular subject being treated; Or can be optimized. Methods for matching cells to viruses and even subjects are described in US Provisional Patent Application No. 62/680,570 and US Patent Application No. 16/536,073. The cells used in the systems provided herein are capable of overcoming or mitigating immune host responses, as described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073, and below. It can also be modified to do so. Modified cells can also be made compatible with the virus and/or the subject to be treated.

In some embodiments, the carrier cells used to generate the CAVES systems provided herein are not tumor cells. In other embodiments, the carrier cell is not a cancer cell. In yet other embodiments, the carrier cell is not a cancer cell line, such as an immortalized cancer cell line. In embodiments, carrier cells are selected among stromal cells, stem cells and fibroblasts.

Exemplary cells, such as carrier cells that can be used to make the systems provided herein, are described below.

Stem cells, immune cells, cancer cell lines Stem cells, immune cells, tumor/cancerous cells include HSV-1, parvovirus, measles virus, vesicular stomatitis virus (VSV), vaccinia virus, reovirus, Newcastle disease virus and adenovirus. It can be used as a delivery vehicle for oncolytic viruses (OV), including viruses. These cells exhibit tumor homing properties that enhance the therapeutic efficacy of OV. This tumor selectivity is due to the attraction of these cells to the tumor microenvironment, which is characterized by hypoxia, inflammation, and numerous chemoattractant molecules such as cytokines and chemokines.

Stem Cells Stem cells have an inherent tumor-homing ability, which makes them attractive as carrier cells for oncolytic virus therapy. This is due to the tumor microenvironment (TME), which is rich in various growth factors, angiogenic factors, cytokines and chemokines that support the uncontrolled growth of tumors. The hypoxic nature of the TME also promotes stem cell migration into tumors. Stem cells are also used as carrier cells because they are highly immunosuppressive and express low levels of molecules necessary for antigen processing and presentation, delaying recognition by the immune system of the viruses they carry (Kim et al. 2015) Viruses 7:6200-6217). Examples of stem cells that can be used as carrier cells for OV include endothelial progenitor cells, neural stem cells and mesenchymal stem cells.

Endothelial progenitor cells have been shown to home to sites of tumor neovasculature and have been used to deliver oncolytic measles virus in a mouse model of human glioma (Guo et al. (2008) Biochim Biophys Acta 1785(2):217-231). Although these cells divide rapidly in vivo, they are not immortal and new cells must be repeatedly isolated from clinical samples (Kim et al. (2015) Viruses 7:6200-6217).

Neural stem cells (NSCs), which differentiate into a variety of different cells of the nervous system, including neurons and glial cells, were the first stem cells to be investigated as carrier cells to deliver therapeutic agents to brain tumors (Kerrigan et al. (2017) Cytotherapy 19(4):445-457). NSCs induce hypoxia-inducible factor (HIF)-mediated stromal cell-derived factor-1 (SDF-1), vascular endothelial growth factor (VEGF), and urokinase plasminogen activator (uPA) in glioma cells. It exhibits strong tropism for glioblastoma tumors due to the expression of (Kim et al. (2015) Viruses 7:6200-6217). NSCs have been used, for example, to deliver OVs such as IL-4, IL-12, IL-23, cytosine deaminase, the anti-angiogenic protein thrombospondin, and adenovirus to gliomas. NSCs must be isolated from fetal brain tissue or the periventricular zone of adult brains during surgery, which is a disadvantage for their utility as carrier cells.

Adult human bone marrow has been used as an alternative source of stem cells because bone marrow stem cells are easily obtained and can be supplied by the patient himself for autologous transplantation, eliminating immune rejection (Kerrigan et al. (2017) Cytotherapy 19). 4): 445-457). Among the different bone marrow stem cells available, mesenchymal stem cells (MSCs) are easily isolated from patients, expanded in vitro, support OV replication and protection from immediate neutralization by the immune system, and are readily available. They are attractive as carrier cells because they can be manipulated into cells and essentially home to tumors in vivo due to their tumor-associated expression of inflammatory cytokines. MSCs can even be used as stand-alone anti-cancer agents. For example, studies have demonstrated the tumor homing ability and oncolytic effects of MSC expressing IFN-β (Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3):119-126).

Allogeneic transplantation is possible because MSCs express low levels of MHC class I molecules and no MHC class II molecules on the cell surface. MSCs can inhibit T cell proliferation and monocyte differentiation into dendritic cells (DCs) and can suppress the expression of interferon γ and tumor necrosis factor produced by CD4+ T helper cells (Kim et al. (2015) Viruses 7:6200-6217). MSCs can also degrade extracellular matrix through secretion of proteases that can help overcome physical barriers to oncolytic virus delivery (Ramirez et al. (2015) Oncolytic Virotherapy 4:149–155 ). Another advantage of using MSCs is that they can be frozen after viral infection, retaining active viral replication and antitumor activity upon thawing, allowing for storage (Roy and Bell (2013) Oncolytic Virotherapy 2:47–56 ). In addition to bone marrow, MSCs can also be isolated from adipose tissue, cord blood, peripheral blood, muscle, cartilage, and amniotic fluid, making adipose tissue the most attractive source due to its easy access and abundance. Yes (Kerrigan et al. (2017) Cytotherapy 19(4): 445-457; Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3): 119-126).

MSCs can be used as carriers of oncolytic adenoviruses to treat pancreatic cancer, brain cancer, renal cell carcinoma, glioblastoma and ovarian cancer, as well as to treat ovarian cancer and hepatocellular carcinoma. It has served as a carrier of measles virus (Kim et al. (2015) Viruses 7:6200-6217). For example, MSCs have been used as carriers for the oncolytic adenovirus ICOVIR-5 to treat children with advanced metastatic neuroblastoma (Kerrigan et al. (2017) Cytotherapy 19(4):445-457 ; Ramirez et al. (2015) Oncolytic Virotherapy 4:149-155).

However, one drawback of using MSCs is their ability to promote tumor growth, which has been demonstrated in breast cancer, endometrial tumor, and glioma models. To overcome this potential cause of failure, MSCs can be engineered to ensure their destruction upon delivery of OVs, for example by carrying suicide genes (Kerrigan et al. (2017) Cytotherapy 19 (4):445-457).

Examples of stem cells (autologous or allogeneic) that can be used as carrier cells include, for example, when stem cells are adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells. , induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, unipotent stem cells, adipose stromal stem cells, endothelial stem cells (e.g., endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes) , adult peripheral blood stem cells, myoblasts, small immature stem cells, skin fibroblast stem cells, tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells.

Mesenchymal cells include, but are not limited to, adult bone marrow, adipose tissue, blood, dental pulp, newborn umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adhesive stromal cells, and placenta-derived mesenchymal cells. Decidual stromal cells, endometrial regenerating cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, villi Membrane villous mesenchymal stromal cells, subcutaneous white adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous primary teeth Included are mesenchymal stem cells isolated from/derived from stem cells, periodontal ligament stem cells, dental follicle progenitor cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells.

Cell Populations Derived from Adipose Stromal Vascular Cell Populations In some embodiments, the carrier cells used in the systems and methods provided herein are de novo isolated from adipose tissue stromal vascular cell populations (SVF). isolated and/or SVF-derived cultured adipose-derived mesenchymal stromal/stem cells (AD-MSCs). Any of the oncolytic viruses known to those skilled in the art and provided herein may be combined with such cells to produce the CAVES systems provided herein and/or You may use them in the manner provided. In some embodiments, the oncolytic virus is vaccinia virus (VACV). In embodiments, the VACV is ACAM2000, having the sequence set forth in SEQ ID NO:70, or is a CAL1 virus, having the sequence set forth in SEQ ID NO:71.

We demonstrated the ability of these carrier cells to protect, deliver, and amplify the virus, as well as to overcome innate and adaptive immune barriers, to those infected with VACV in the presence of human serum or peripheral blood mononuclear cells from healthy donors. ex vivo co-cultures of cells were analyzed by flow cytometry, microscopy and viral plaque assay. Comparative analyzes were performed to establish statistically significant correlations and evaluate the effects of stem cells on the activity of key immune cell populations. It was found that SVF cells are able to protect VACV from serum inactivation. Cell sorting revealed that epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-) We demonstrated that the primary population of SVF cells is the most efficient for delivery of oncolytic virus to tumor cells. This demonstrates validating their clinical use as a tool to enhance oncolytic virus therapy in autologous and also allogeneic settings.

Cultured AD-MSCs (derived from CD34+ SA-ASCs) as delivery vehicles are herein shown to protect against serum inactivation and to amplify virus in the presence of human PBMCs in autologous and allogeneic settings. has been proven. This may be related to their inherent immunosuppressive properties and avoidance of allogeneic rejection. Herein, we demonstrate that these cells provide transient immunosuppression by inhibiting antiviral responses derived from both innate (NK) and adaptive (T) immune cells, thus inhibiting viral oncolysis. and has been shown to enhance the generation of anti-tumor immunity.

SA-ASCs and pericytes are provided herein for use as carrier cells with oncolytic viruses known to those of skill in the art, including any described or provided herein. These include, but are not limited to, poxviruses, adenoviruses, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, mumps virus, influenza virus, measles virus, reovirus, human immunodeficiency virus (HIV ), hantavirus, myxoma virus, cytomegalovirus (CMV) and lentivirus. Examples of viruses are vaccinia viruses, such as ACAM1000 and ACAM2000, an example of which is the sequence shown in SEQ ID NO: 70, or CAL1, an example of which is the sequence shown in SEQ ID NO: 71, or a minor Variations (85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity in the genome excluding ITRs, and possibly lower sequence identity due to recombination of ITRs during replication) ). SA-ASC (CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-), SA-ASC and/or pericytes and/or AD-MSCs produced by culturing such cells are treated with at least one immunomodulatory or recombinant therapeutic protein for oncolysis on or within SA-ASCs, pericytes or AD MSC carrier cells. can be incubated together for a sufficient period of time to produce the CAVES systems provided herein.

Sorting of cell populations from adipose SVF that promotes viral infection and/or replication may be carried out at temperatures suitable for such infection, such as room temperature (approximately 20°C) or higher, such as 32-42°C, e. This can be done by incubating the SVF with an oncolytic virus, such as ACAM1000, ACAM2000 or CAL1, at 37°C, typically 37°C. Loading the virus into cells at a suitable MOI, generally a low MOI, such as about 0.001 to 10, such as 0.01 to 1.0, or less than 1.0, for example at 20 RPM, for about 20 minutes to about 5 hours, generally about 30 minutes. It can be run continuously for about 2 hours. In embodiments, incubation is about 1 hour. After loading SVF cells or subpopulations thereof or MSCs produced therefrom with oncolytic virus, the cells are labeled with a panel of antibodies against cell surface markers for different cell populations, such as CD235a, CD45, CD34, CD31 and CD146. and can be stained for viability with an appropriate stain such as propidium iodide (PI). SVF cells can then be sorted by flow cytometry based on the expression of cell surface markers. In adipose SVF, there are seven distinct cell populations: red blood cells (CD235a+); epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-), which are the major MSC precursors in culture; ); pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-), which are also MSC precursors in culture; granulocytes (CD235a-/CD45 medium/high, high side scatter (SSC)); lymphocytes Monocytes (CD235a-/CD45 high, SSC medium); monocytes (CD235a-/CD45-high SSC medium); and endothelial progenitor cells (CD235a-/CD45-/CD34+/CD146+/CD31+) were identified and sorted. The composition (%) of the main cell populations is described in Example 4.

To measure viral infection, individual cell populations sorted from the SVF are then seeded onto appropriate recipient cell monolayers, e.g. A549 tumor cell monolayers, for a period of time to allow plaque formation, e.g. It can be incubated for 5 days, such as 1-3 days or 3 days or about 3 days. The number of plaques formed on cell monolayers can be fixed and stained with an appropriate stain such as crystal violet to determine the number of cells from each sorted population harboring oncolytic virus. It can be measured by In adipose SVF, five distinct cell populations: erythrocytes, SA-ASCs, pericytes, granulocytes and lymphocytes were found to harbor oncolytic viruses such as vaccinia viruses such as ACAM2000 or CAL1. The main cell populations from the three SVF fractions harboring vaccinia virus (eg, ACAM2000 or CAL1) were identified as SA-ASCs (MSC precursors) and pericytes. These cell populations can also promote viral amplification.

Accordingly, also provided herein are red blood cells, SA-ASCs, pericytes, granulocytes and SVF-derived lymphocytes for use as carrier cells with oncolytic viruses. In embodiments, the oncolytic virus is vaccinia virus (VACV). In further embodiments, the VACV is ACAM2000, which has the sequence shown in SEQ ID NO: 70, or is a CAL1 virus, which has the sequence shown in SEQ ID NO: 71. In embodiments, red blood cells, SA-ASCs, pericytes, granulocytes, and lymphocytes are isolated from tumor cells by at least one immunomodulatory or recombinant therapeutic protein on or within the SA-ASC or pericyte carrier cells. can be incubated together for a sufficient period of time to be expressed by a lytic virus, thereby generating the CAVES system provided herein.

Immune cells Immune cells, which respond to "danger signals" released by tumors by transport to cancer sites, have been investigated as carrier cells for OVs. Immune cells include, but are not limited to, CAR-T cells that target tumor-specific antigens; TCR transgenic cells that target tumor-specific antigens; NKT cells, lymphocytes, monocytes; These include macrophages, mast cells, granulocytes, dendritic cells (DCs), natural killer (NK) cells, myeloid-derived suppressor cells, lymphokine-activated killer (LAK) cells, and cytokine-induced killer (CIK) cells. Immune cells are attractive as carrier cells because they circulate throughout the body and can recognize tumors (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). Additionally, the use of immune cells as carriers for OVs provides additional antitumor activity in the form of direct cytotoxicity or by priming an adaptive antitumor immune response (Jennings et al. (2014) Int. J. Cancer 134:1091-1101).

For example, tumor antigen-specific T cells exhibit direct anti-cancer effector functions, and activated T cells have been extensively investigated in the delivery of OVs to tumors. It has been shown that loading adoptively transferred T cells with OVs can help combat the immunosuppressive properties of the tumor microenvironment, as the proinflammatory nature of viral infection can prevent T cell silencing and inactivation. (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). Intratumoral expression of chemokines such as CCL3, CCL21 and CXCL10 (IP-10) enhances tumor-specific trafficking of adoptive T cells. T cells can also be genetically engineered to express chemokine receptors such as CXCR2 to target them to tumors (Guo et al. (2008) Biochim Biophys Acta 1785(2):217-231). Studies have shown that vesicular stomatitis virus, reovirus, herpes simplex virus, Newcastle disease virus and retroviral particles can attach to the surface of T cells, either passively or at cellular synapses between carriers and tumor cells. (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). Despite the advantages of using T cells as carriers for OV, generating T cell populations against highly tumor-specific antigens from patients remains extremely expensive and difficult, making their use (Willmon et al. (2009) Molecular Therapy 17(10): 1667-1676).

Lymphokine-activated killer cells (LAK cells) have been used in combination with IL-2 in the treatment of ovarian cancer. Immature dendritic cells (iDCs), LAK cells and their co-cultures (LAKDCs) are tested as carriers of reovirus in the treatment of ovarian cancer, and reovirus-loaded LAKDCs protect reovirus from neutralizing antibodies have been shown to be able to induce a pro-inflammatory cytokine environment and generate innate and adaptive anti-tumor immune responses (Jennings et al. (2014) Int. J. Cancer 134:1091-1101). DC cells have also been used as carriers of reovirus to treat melanoma (Jennings et al. (2014) Int. J. Cancer 134:1091-1101).

CIK cells are another type of immune cell that can be used as a carrier for OVs. While tumor antigen-specific T cells recognize a single antigen, CIK cells recognize the NKG2D ligand, which is upregulated on a variety of tumor cells, making them more versatile. CIK cells are also easy to isolate from patients and grow ex vivo, can produce high titers of virus, and have been used to deliver measles and vaccinia viruses to tumors (Roy et al. Bell (2013) Oncolytic Virotherapy 2:47-56; Willmon et al. (2009) Molecular Therapy 17(10):1667-1676; Power and Bell (2007) Mol. Ther. 15(4):660-665). However, one drawback of using CIK cells is that their generation requires the use of cytokines to expand primary leukocytes in vivo (Kim et al. (2015) Viruses 7:6200-6217).

Macrophages represent yet another potential class of carrier cells for OV. Tumors normally secrete monocyte chemoattractant protein-1, macrophage colony-stimulating factor, and VEGF, so monocytes naturally migrate to the tumor site, localize to hypoxic areas, differentiate into tumor-associated macrophages, and This can enhance tumor growth inhibition (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). As a result, macrophages have been investigated preclinically for the delivery of oncolytic adenovirus and measles virus. In addition to the other types of immune cells discussed, myeloid-derived suppressor cells have also been investigated as carrier cells for delivering oncolytic VSV.

Cancer Cells Cancer cells, which are usually inactivated with gamma irradiation before administration for safety, have also been used as carrier cells for OVs. Gamma irradiation can prevent tumorigenicity but maintain virus production. Another safety measure includes engineering OVs to express suicide genes such as thymidine kinase (i.e., they are not killed) to ensure that cancer cells do not remain within the subject indefinitely. , no longer immortal). Alternatively, allogeneic cancer cells, which are typically eliminated by the recipient's immune system, can be used (Power and Bell (2007) Mol. Ther. 15(4):660-665).

Cancer cells are available in large quantities and can exhibit higher levels of viral infectivity and amplification than normal cells (Guo et al. (2010) Gene Ther. 17(12):1465-1475; Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). Additionally, some tumor cells migrate specifically to certain organs, as seen in metastatic disease. For example, myeloma cells express high levels of the chemokine receptor CXCR4, lead to bone marrow metastases, and have been used to deliver oncolytic measles virus (Roy and Bell (2013) Oncolytic Virotherapy 2:47-56). A variety of transformed cell lines have been shown to deliver oncolytic parvovirus, measles virus and vesicular stomatitis virus in immunocompetent and immunodeficient animals. For example, cancer cells infected with VSV or adenovirus have been used to effectively deliver virus to lung metastases in mice (Willmon et al. (2009) Molecular Therapy 17(10):1667-1676; Power and Bell (2007) Mol. Ther. 15(4):660-665). However, cells derived from solid tumors have been shown to accumulate in the lungs of mice after IV administration due to their large diameter. As a result, cancer cells of hematopoietic/blood origin may be a better alternative as they are more widely distributed in the body and OVs can be delivered to anatomical locations outside the lungs (Power and Bell (2007) Mol. Ther. 15(4):660-665).

Examples of allogeneic human hematological malignancy cell lines that can be used as carrier cells include leukemia cells (e.g., KASUMI-1, HL-60, THP-1, K-562, RS4;11, MOLT-4, CCRF-CEM, T cell leukemia cells (e.g. HM-2, CEM-CM3, Jurkat/Jurkat clone E6-1, J ．CaM1.6, BCL2 Jurkat, BCL2 S87A Jurkat, BCL2 S70A Jurkat, Neo Jurkat, BCL2 AAA Jurkat, J.RT3-T3.5, J45.01, J.γ1, J.γ1.WT, JK28, P116, P116 .cl39, A3, JX17, D1.1, I 9.2, I 2.1, etc.); myelomonocytic leukemia cells (e.g. MV-4-11); lymphoma cells (e.g. HT, BC-3, CA46, Raji, Daudi, GA-10-Clone-4, HH, H9); non-Hodgkin lymphoma cells (e.g., SU-DHL-1, SU-DHL-2, SU-DHL-4, SU-DHL-5, SU-DHL-6, SU-DHL-8, SU-DHL-10, SU-DHL-16, NU-DUL-1, NCEB-1, EJ-1, BCP-1, TUR, U-937, etc.); Burkitt lymphoma cells (e.g. Ramos/RA 1, Ramos.2G6.4C10, P3HR-1, Daudi, ST486, Raji, CA46, human gammaherpesvirus 4/HHV-4 buccal tumor from Burkitt lymphoma patients, DG- 75, GA-10, NAMALWA, HS-Sultan, Jiyoye, NC-37, 20-B8, EB2, 1G2, EB1, EB3, 2B8, GA-10 clone 20, HKB-11/kidney-B cell hybrid); diffuse large B-cell lymphoma cells (e.g., Toledo, Pfeiffer); mantle cell lymphoma cells (e.g., JeKo-1, JMP-1, PF-1, JVM-2, REC-1, Z-138, Mino, MAVER) -1); AML cells (e.g. AML-193, BDCM, KG-1, KG-1a, Kasumi-6, HL-60/S4); CML cells (e.g. K562, K562-r, K562-s, LAMA84 -r, LAMA84-s, AR230-r, AR230-s); ALL cells (e.g., N6/ADR, RS4; 11, NALM6 clone G5, Loucy, SUP-B15, CCRF-SB); erythroleukemia cells (e.g., IDH2-mutant strain-TF-1 isogenic cell line); myelomonoblastic leukemia cells (e.g., GDM-1); malignant non-Hodgkin's NK lymphoma cells (e.g., NK-92, NK-92MI); myeloma / plasmacytoma cells (eg, U266B1/U266, HAA1, SA13, RPMI8226, NCI-H929, MC/CAR); multiple myeloma cells (eg, MM. 1R, IM-9, MM. 1S); and macrophage cell lines (eg, MD, SC, WBC264-9C).

Commercially available allogeneic cell lines include, for example, mesenchymal stem cells such as APCETH-201, APCETH-301 (APCETH), Cx601 (TIGENIX), TEMCELL, MSC-100-IV, Prochymal (MESOBLAST); for example, ToleraCyte (Fate Induced pluripotent stem cells (iPSCs), such as (Therapeutics); Fibroblasts, e.g. CCD-16Lu, WI-38; Tumor-associated fibroblasts, e.g. Malme-3M, COLO 829, HT-144, Hs 895. T, hTERT PF179T CAF; endothelial cells, e.g. HUVEC, HUVEC/TERT 2, TIME; embryonic epithelial cells, e.g. HEK-293, HEK-293 STF, 293T/17, 293T/17 SF, HEK-293.2sus ; embryonic stem cells, such as hESC BG01V; and epithelial cells, such as NuLi-1, ARPE-19, VK2/E6E7, Ect1/E6E7, RWPE-2, WPE-stem, End1/E6E7, WPMY-1, NL20, Includes NL20-TA, WT 9-7, WPE1-NB26, WPE-int, RWPE2-W99, BEAS-2B.

Autologous or allogeneic whole tumor cell vaccines include, for example, GM-CSF-secreting whole tumor cells such as GVAX Prostate (based on PC3/LNCaP) from Cell Genesys/BioSante/Aduro Biotech; GVAX Pancreas; GVAX Lung; and GVAX Renal Cell. Includes vaccines (GVAX).

Allogeneic human tumor cell lines include, for example, the NCI-60 panel (BT549, HS 578T, MCF7, MDA-MB-231, MDA-MB-468, T-47D, SF268, SF295, SF539, SNB-19, SNB- 75, U251, Colo205, HCC 2998, HCT-116, HCT-15, HT29, KM12, SW620, 786-O, A498, ACHN, CAKI, RXF 393, SN12C, TK-10, UO-31, CCRF-CEM, HL-60, K562, MOLT-4, RPMI-8226, SR, A549, EKVX, HOP-62, HOP-92, NCI-H226, NCI-H23, NCI-H322M, NCI-H460, NCI-H522, LOX IMVI , M14, MALME-3M, MDA-MB-435, SK-MEL-2, SK-MEL-28, SK-MEL-5, UACC-257, UACC-62, IGROV1, OVCAR-3, OVCAR-4, OVCAR -5, OVCAR-8, SK-OV-3, NCI-ADR-RES, DU145, PC-3). Other allogeneic human tumor cell lines include, for example, a fibrosarcoma cell line (HT-1080); a liver cancer cell line (Hih-7); a prostate cancer cell line (LAPC4, LAPC9, VCaP, LuCaP, MDA PCa 2a/2b, C4, C4-2, PTEN-CaP8, PTEN-P8); breast cancer cell lines (HCC1599, HCC1937, HCC1143, MDA-MB-468, HCC38, HCC70, HCC1806, HCC1187, DU4475, BT-549, Hs 578T, MDA- MB-231, MDA-MB-436, MDA-MB-157, MDA-MB-453, HCC1599, HCC1937, HCC1143, MDA-MB-468, HCC38, HCC70, HCC1806, HCC1187, DU4475, BT-549, Hs 578T , MDA-MB-231, MDA-MB-436, MDA-MB-157, MDA-MB-453, BT-20, HCC1395, MDA-MB-361, EMT6, T-47D, HCC1954); Head and neck cancer Cell lines (A-253, SCC-15, SCC-25, SCC-9, FaDu, Detroit 562); Lung cancer cell lines (NCI-H2126, NCI-H1299, NCI-H1437, NCI-H1563, NCI-H1573, NCI -H1975, NCI-H661, Calu-3, NCI-H441); Pancreatic cancer cell line (Capan-2, Panc 10.05, CFPAC-1, HPAF-II, SW1990, BxPC-3, AsPC-1, MIA PaCa- 2, Hs 766T, Panc 05.04, PL45); Ovarian cancer cell line (PA-1, Caov-3, SW626, SK-OV-3); Bone cancer cell line (HOS, A-673, SK-PN- DW, U-2 OS, Saos-2); Colon cancer cell lines (SNU-C1, SK-CO-1, SW1116, SW948, T84, LS123, LoVo, SW837, SNU-C1, SW48, RKO, COLO 205) , SW1417, LS411N, NCI-H508, HT-29, Caco-2, DLD-1); Gastric cancer cell lines (KATOIII, NCI-N87, SNU-16, SNU-5, AGS, SNU-1); Gynecological Cancer cell lines (SK-LMS-1, HT-3, ME-180, Caov-3, SW626, MES-SA, SK-UT-1, KLE, AN3-CA, HeLa); Sarcoma cell lines (SW684, HT-1080, SW982, RD, GCT, SW872, SJSA-1, MES-SA/MX2, MES-SA, SK-ES-1, SU-CCS-1, A-673, VA-ES-BJ, Hs 822 ．． T, RD-ES, HS 132. T, Hs 737. T, Hs 863. T, Hs 127. T, Hs 324. T, Hs 821. T, Hs 706. T, Hs 707(B). Ep, LL 86/LeSa, Hs 57. T, Hs 925. T, GCT, KHOS-312H, KHOS/NP R-970-5, SK-LMS-1, HOS); melanoma cell lines (SK-MEL-1, A375, G-361, SK-MEL-3, SH -4, SK-MEL-24, RPMI-7951, CHL-1, Hs 695T, A2058, VMM18, A375.S2, Hs 294T, VMM39, A375-P, VMM917, VMM5A, VMM15, VMM425, VMM17, VMM1, A375 -MA1, A375-MA2, SK-MEL-5, Hs 852.T, LM-MEL-57, A101D, LM-MEL-41, LM-MEL-42, MeWo, LM-MEL-53, MDA-MB- 435S, C32, SK-MEL-28, SK-MEL-2, MP38, MP41, C32TG, NM2C5, LM-MEL-1a, A7/M2A7); squamous cell carcinoma cell line (SiHa, NCI-H520, SCC-15) , NCI-H226, HCC1806, SCC-25, FaDu, SW 954, NCI-H2170, SCC-4, SW 900, NCI-H2286, NCI-H2066, SCC-9, SCaBER, SW579, SK-MES-1, 2A3 , UPCI: SCC090, UPCI: SCC152, CAL 27, RPMI 2650, UPCI: SCC154, SW756, NCI-H1703, ME-180, SW962); hepatocellular carcinoma cell line (Hep G2, Hep 3B2.1-7/Hep 3B , C3A, Hep G2/2.2.1, SNU-449, SNU-398, SNU-475, SNU-387, SNU-182, SNU-423, PLC/PRF/5); Bladder cancer cell line (5637 , HT-1197, HT-1376, RT4, SW780, T-24, TCCSUP, UM-UC-3); Renal cell carcinoma cell line (ACHN, 786-O/786-0, 769-P, A-498) , Hs 891.T, Caki-2, Caki-1); embryonic carcinoma/testicular teratoma cell line (NTERA-2 cl. D1, NCCIT, Tera-2, Tera-1, Cates-1B); glioblast astrocytoma cell lines (LN-229, U-87 MG, T98G, LN-18, U-118 MG, M059K, M059J, U-138 MG, A-172); astrocytoma cell lines (SW1088, CCF-STTG1, SW1783, CHLA-03-AA); brain cancer cell lines (PFSK-1, Daoy); thyroid cancer cell lines (TT, MDA-T68, MDA-T32, MDA-T120, MDA-T85, MDA-T41) and Includes mesothelioma cell lines (NCI-H28, NCI-H226, NCI-H2452, NCI-H2052, MSTO-211H).

Compatible Cells Any cell used in the systems provided herein, e.g., the cells described above, has a compatibility of matching with the virus and/or the subject to which the virotherapy is administered, i.e., for the cell and/or the associated virus. Cells can be tested for their ability to overcome or ameliorate innate and/or adaptive immune responses. Selection of cells that are compatible with the subject can further increase the therapeutic efficacy of the systems provided herein. Optimal cell-virus combinations (e.g., the ability of cells to promote viral amplification) and methods of screening for cells that are compatible with a subject are described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073. Are listed. Also provided herein are modified cell vehicles that have been sensitized and/or engineered in one or more ways for improved cell delivery (see, eg, the section below).

Modified Cellular Vehicles with Improved Delivery and/or Matching Capabilities Cellular vehicles (carrier cells) whose properties are modified to facilitate delivery of oncolytic viruses to a subject and/or improve matching with a subject ) are also provided herein. Any of the cellular vehicles provided herein (eg, stem cells, immune cells, cancer cells) can be modified in this manner. Such properties include, but are not limited to, improved facilitation of viral amplification in cellular delivery vehicles, improved ability to evade cellular media and/or immune responses to the virus, and/or improved immunity. Can include suppression. In embodiments, the immunomodulatory capacity (e.g., evasion of the immune response, suppression of the immune response) can be local and/or transient, and can be localized and/or transient, inhibiting viral delivery, accumulation, and present to the extent necessary to promote infection.

In some embodiments, the suitability of the modified cellular vehicles provided herein as cellular vehicles for the delivery of oncolytic viruses to a particular subject and/or to a particular cancer/tumor type is confirmed. Matching assays such as those described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073 can be used for screening. In embodiments, a plurality/panel of modified cell media can be screened by matching assays as described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073; They can be ranked in order of matching ability. In some examples, a panel of cell media can include unmodified cell media.

Briefly, as described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073, a method of adapting a carrier cell to a subject comprises performing one or more of the following steps: Including:

1. In a co-culture containing cell media, oncolytic virus and cells derived from the subject:
(a) reduced levels of one or more markers for T cell activation compared to otherwise equivalent conditions except in the absence of cellular media;
(b) reduced levels of one or more markers for NK cell activation compared to otherwise equivalent conditions except in the absence of cellular media; and (c) in the absence of cellular media. By detecting decreased levels of one or more markers for NKT cell activation, compared to otherwise equivalent conditions, the cellular medium is immunized in the subject. Determining whether the barrier is overcome and the cell medium is compatible with the subject if one or more of (a), (b) and (c) are met.

2. (a) measuring the amount of viral amplification obtained when the virus and cell media are incubated with cells derived from the subject;
(b) measuring the amount of viral amplification obtained when the virus and cell media are incubated under comparable conditions, except in the absence of cells derived from the subject; and (c) (a) and (b). ), the cell medium is compatible with the subject if the amplification measured in (a) is at least 20% of the amplification measured in (b); .

3. Identifying identical alleles in the cellular medium and subject at one or more major histocompatibility complex (MHC) and/or killer cell inhibitory receptor (KIR) loci, and e.g. Identifying the cell medium as a match to the subject if 50% or more is identical.

The modified cellular media provided herein can include one or more of the modifications set forth in this section and elsewhere herein, as described below:

(i) Sensitized/protected cell media for improved viral amplification and/or immunomodulation for use in producing the CAVES systems provided herein and in the methods provided herein. The modified cell media (carrier cells) for the purpose of the present invention may include one or more of the following embodiments. In embodiments, the cell medium can be sensitized to enhance its virus amplification capacity by pre-treating/loading the cell medium with one or more of the following: IL-10, TGFβ, VEGF. , FGF-2, PDGF, HGF, IL-6, GM-CSF, growth factors, RTK/mTOR agonists, wnt protein ligands and GSK3 inhibitors/antagonists (eg, Tideglusib, Valporic acid). In other embodiments, for example, the cellular media may be used to interfere with IFN type I/II receptors and/or to inhibit IFNAR1/IFNAR2 signaling, IFNGR1/IFNGR2 signaling, STAT1/2 signal transduction, Jak1 signaling (e.g. tofacitinib, ruxolitinib, baricitinib), Jak2 signaling (e.g. SAR302503, LY2784544, CYT387, NS-018, BMS-911543, AT9283), IRF3 signaling, IRF7 signaling, By pre-treatment/loading with small molecules or protein inhibitors that interfere with downstream signaling including IRF9 signaling, TYK2 signaling (e.g. BMS-986165), TBK1 signaling (e.g. BX795, CYT387, AZ13102909). Cellular media can be sensitized to block induction of an antiviral state.

In some embodiments, the cellular medium can be pretreated/loaded with HDAC inhibitors to disrupt/deregulate IFN signaling/responsiveness; such inhibitors may be but not vorinostat, romidepsin, chidamide, panobinostat, belinostat, valporic acid, mocetinostat, abexinostat, entinostat, SB939, resminostat, gibinostat, xinostat, HBI-8000, kevethrin, CUDC- 101, AR-42, CHR-2845, CHR-3996, 4SC-202, CG200745, ACY-1215, ME-344, sulforaphane and/or trichostatin. In other embodiments, the cellular media may be used to detect viral sensing mediated by STING, PKR, RIG-1, MDA-5, OAS-1/2/3, AIM2, MAVS, RIP-1/3, DAI (ZBP1). and/or can be pretreated/loaded with antagonists of antiviral defense pathways; such antagonists include, but are not limited to, K1, E3L, K3L proteins (vaccinia), NS1/NS2 proteins (influenza). , NS3-4A (hepatitis C), NP and Z proteins (arenavirus), VP35 (Ebola virus), US11, ICP34.5, ICP0 (HSV), M45 (MCMV) and X protein (BDV: Borna disease virus) can include one or more of the following: In embodiments, cells are treated with MHC antagonists of viral origin, such as A40R MHCI antagonist (vaccinia), Nef and TAT (HIV), E3-19K (adenovirus), ICP47 (HSV-1/2), CPXV012 and CPXV203 (cowpox). ), ORF66 (VZV), EBNA1, BNLF2a, BGLF5, BILF1 (EBV), US2/gp24, US3/gp23, US6/gp21, US10, US11/gp33 (hCMV), Rh178/VIHCE (RhCMV), U21 (HHV- 6/7), LANA1, ORF37/SOX, kK3/MIR1, kK5/MIR2 (KSHV), mK3 (MHV-68), UL41/vhs (a-herpesvirus, HSV, BHV-1, PRV), UL49.5 (Baricerovirus, BHV-1, EHV-1/4, PRV) and by pretreatment/loading with one or more of m4/gp34, m6/gp48, m27, m152/gp40 (mCMV), etc. Cell media can be protected from allogeneic inactivation/rejection determinants.

In embodiments, the modified cell media can be pretreated/loaded with a B2M antagonist of viral origin, such as UL18 (HCMV). In other embodiments, the cell media can be pretreated/loaded with an antagonist of MIC-A and MIC-B (NKG2D ligands), such as kK5 (KHSV). In some embodiments, the cellular media may include, but are not limited to, inhibitors of immune FAS/TNF/granzyme B-induced apoptosis (e.g., ectromelia/vaccinia virus SP1-2/CrmA), IL-1/NFkB /IRF3 antagonists (e.g., vaccinia virus encoded N1), IL-1 and TLR antagonists (e.g., IL-18 binding protein, A46R, A52R), IL-1β antagonists (e.g., B15R/B16R), TNFα blockers (e.g. , vaccinia virus CmrC/CmrE), IFNα/β blockers (e.g. vaccinia virus B18R/B19R) and IFNγ blockers (e.g. vaccinia virus B8R). In embodiments, the cell media can be pretreated/loaded with small molecule inhibitors of TAP1/2 and/or tapasin.

In embodiments, the modified cellular media is complement-enhanced, for example, by pre-treating/loading the cellular media with small molecule inhibitors of complement factors (e.g., C1, C2, C3, C4, C5, MBL). such inhibitors include, but are not limited to, VCP (vaccinia virus complement control protein), B5R (vaccinia virus complement inhibitor), scFv anti-CD1q/CD1r/CD1s, anti-C3, anti-C5 (e.g. eculizumab), peptide C3 inhibitors of the complement family (e.g. Cp40), human soluble membrane (s/m) proteins (e.g. s/mCR1 (CD35), s/mCR2 (CD21) , s/mCD55, s/mCD59), human complement factor H and derivatives, cobra venom factor and one or more derivatives having complement inhibiting activity.

In the above embodiments, instead of loading or treating cells with these factors, the virus can be modified to express these products, or by the methods herein, the virus can be incubated with carrier cells. In some cases, these products are expressed in carrier cells.

Sensitized cell media can be produced by methods known in the art. For example, the cell media may be administered for at least 10 minutes to 48 hours or more, e.g., for about or at least 10, 15, 20, 25 hours prior to cell banking, viral infection, or administration to a subject. , 30, 35, 40, 45, 50, 55 or 60 minutes or about or at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47 or 48 hours or more. To enhance cellular loading of protein/lipid-insoluble small molecules, use Lipofectamine or alternative protein transfection reagents, such as Xfect (Takara), Pierce Pro-Ject (ThermoFisher), Pro-DeliverIN (OZ Biosciences), TurboFect (Fermentas) etc. can be used.

(ii) sensitized for resistance to virus-mediated killing (for extended survival and improved local immunosuppression)
In some embodiments, the modified cell media can be pretreated/loaded with one or more agents that render the cell media resistant to virus-mediated killing. For example, in some embodiments, cell media can be pretreated with type I and/or type II interferon. In other embodiments, the cellular media can be pretreated with an agonist/inducer of antiviral status (eg, STING, PKR, RIG-I, MDA-5). To create such "protected" cell media, any autologous or allogeneic cell media can be combined with interferon type I (e.g., IFNα/β) and/or type II (e.g., IFNγ) and/or or agonists of the STING, PKR, RIG-I, MDA-5, OAS-1/2/3, AIM-2, MAVS, RIP-1/3, DAI (ZBP1) pathway, without or with viral infection. 30 minutes to up to 48 hours or more, such as about or at least 30 minutes or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, Can be processed for 42, 43, 44, 45, 46, 47 or 48 hours or more.

These "protected" cell media can be administered in separate compositions at the same time as unprotected, virus-containing, matched/sensitized/engineered cell media; Protected cell media can provide extended survival and/or improved local immunosuppression. In some embodiments, the protected cell medium is removed, e.g., for about 10, 15, 15 days, before or after administration of the matched/sensitized/engineered cell medium, which is unprotected in this way and contains the virus. 20, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 or It can be administered within 48 hours or 1, 2, 3, 4 or 5 days.

(iii) Cellular Media Engineered to Improve Viral Amplification and/or Immunomodulation In some embodiments, engineered cellular media for use in the systems and methods provided herein are engineered for permanent or persistent expression or suppression to promote viral amplification and/or improved immune regulation. Cell media can be manipulated in one or more of the following embodiments. Any of the cellular media provided herein may be modified using one or a combination of the embodiments for sensitizing, protecting, and/or manipulating the cellular media provided herein. Can be done.

In some embodiments, the cellular medium can be engineered to not respond to the antiviral state induced by interferon (IFN). For example, cellular media may be used, for example, for type I/II interferon receptor expression; IFNα/β, IFNγ receptor expression; IFNAR1/IFNAR2 receptor expression; IFNGR1/IFNGR2 receptor expression; STAT1/2 receptor expression; 2 receptor expression; IRF3 receptor expression; IRF7 receptor expression; IRF9 receptor expression; It can be engineered for temporary or permanent suppression of transmission (eg, excision of the locus).

In embodiments, the cell media includes, but is not limited to, PKR, RIG-I, MDA-5, cGAS, STING, TBK1, IRF3, OAS-1/2/3, AIM2, MAVS, RIP-1/ 3 and DAI (ZBP1) can be engineered for transient or permanent suppression of elements of the cytosolic viral DNA/RNA sensing and antiviral defense mechanisms, including one or more of DAI (ZBP1). In other embodiments, the cellular media are mediated by, for example, STING, PKR, RIG-1, MDA-5, OAS-1/2/3, AIM2, MAVS, RIP-1/3, DAI (ZBP1). Can be engineered for transient or permanent expression of antagonists of virus sensing and antiviral defense pathways; these include, but are not limited to, K1, E3L, K3L (vaccinia); NS1/NS2 (influenza A); NS3-4A (hepatitis C); NP, Z protein (arenavirus); VP35 (Ebola virus); US11, ICP34.5, ICP0 (HSV); M45 (MCMV); and X protein (BDV : Borna disease virus).

In some embodiments, modified cell media can be engineered to avoid allogeneic recognition by T cells and NKT cells. For example, cellular media can be engineered for transient or permanent suppression of the expression of: MHC class I molecules (HLA-A, B, C); MHC class II molecules (HLA-DP, DQ, DR); MHC-like molecules (CD1a/b/c/d); or regulators of transcription or expression of MHC class I, MHC class II, MHC-like molecules (e.g., TAP1/2, tapasin, beta-2 microglobulin); , CIITA, RFXANK, RFX5 and RFXAP). In other examples, cellular media can be engineered for the transient or permanent expression of: B2M antagonists of viral origin (e.g., UL18 (HCMV); and/or MHC antagonists of viral origin ( For example, A40R MHCI (vaccinia); Nef, TAT (HIV); E3-19K (adenovirus); ICP47 (HSV-1/2); CPXV012, CPXV203 (cowpox); EBNA1, BNLF2a, BGLF5, BILF1 (EBV); ORF66 (VZV); US2/gp24, US3/gp23, US6/gp21, US10, US11/gp33 (hCMV); rh178/VIHCE (RhCMV); U21 (HHV-6/7); LANA1, ORF37/SOX, kK3/ MIR1, kK5/MIR2 (KHSV); mK3 (MHV-68); UL41/vhs (a-herpesvirus, HSV, BHV-1, PRV); UL49.5 (baricellovirus, BHV-1, EHV-1/ 4, PRV); and one or more of m4/gp34, m6/gp48, m27, m152/gp40 (mCMV)).

In embodiments, the cellular medium can be engineered to avoid allogeneic recognition by NK cells. For example, cellular media can be engineered for transient or permanent suppression of expression of one or more of the following: membrane-bound MICA/B (NKG2D ligand); membrane-bound PVR (DNAM-1 Ligand); Membrane-bound Nectin-2 (DNAM-1 ligand). In other examples, cellular media can be engineered for transient or permanent expression of: antagonists of MIC-A and MIC-B (NKG2D ligands) (e.g., kK5 (KHSV)); Antagonists of NKG2D receptors (e.g. cowpox OMCP); antagonists of NCR targeting NKp30, NKp44, NKp46 receptors (e.g. HA (hemagglutinin - vaccinia and other viruses)); NK inhibitory receptors ( KIR) (e.g., HLA-Bw4; HLA-C2); and NK inhibitory receptors (NKG2a/CD94) (e.g., by generating alone or HLA-E-binding peptides to inhibit HLA-E surface expression. HLA-E and derivatives in combination with 21M HLA-B ligand for stabilization).

In certain embodiments, the cellular media can be engineered to express immunosuppressive factors of human or viral origin (eg, to prevent/inhibit allogeneic anti-cellular media or anti-viral immune responses). This can be achieved by encoding them in the cellular and/or viral genome. Factors of human origin include, but are not limited to, IDO, arginase, TRAIL, iNOS, IL-10, TGFβ, VEGF, FGF-2, PDGF, HGF, IL-6, sMICA, sMICB, sHLA-G , HLA-E, PD-L1, FAS-L, B7-H4, and single chain antibodies (scFv) that target or deplete NK and/or NKT cells. Factors of viral origin include, but are not limited to, ectromelia/vaccinia virus SPI-2/CrmA (inhibitor of immune FAS/TNF/granzyme B-induced apoptosis); vaccinia virus-encoded N1 (IL-1 /NFkB/IRF3 antagonist); HA (NCR antagonist targeting NKp30, NKp44, NKp46); IL-18 binding protein; A40R; A46R; A52R; B15R/B16R; TNFα blocker (e.g., vaccinia virus CmrC/CmrE) ; IFNα/β blockers (e.g., vaccinia virus B18R/B19R); IFNγ blockers (e.g., vaccinia virus B8R); and other IL-1/IL-1β/NFKB/IRF3/NCR/MHCI/TLR/NKG2D antagonists is included.

In some embodiments, the cellular media can be engineered to express cancer- or stem cell-derived factors that promote viral infection of otherwise intolerant cellular media and/or tumor cells. For example, the cellular medium can be engineered to express one or more of the following: cancer-associated antigens (e.g., cancer testis antigens (MAGE-A1, MAGE-A3, MAGE-A4, NY- ESO-1, PRAME, CT83, SSX2, BAGE family, CAGE family); carcinoembryonic antigen (AFP, CEA); oncogene/tumor suppressor (myc, Rb, Ras, p53, telomerase); differentiation antigen (MELAN, Tyrosinase, TRP-1/2, gp100, CA-125, MUC-1, ETA); GM-CSF; IL-10; TGFβ; VEGF; FGF-2; PDGF; HGF; IL-6; Growth factors; RTK/ mTOR agonists; and wnt protein ligands.

In embodiments, the modified cellular medium is engineered to express factors that interfere with complement and/or neutralizing antibody function, including, but not limited to, one or more of the following: Can: protein antagonists of complement factors (C1, C2, C3, C4, C5, MBL); vaccinia virus complement control protein (VCP); vaccinia virus complement inhibitor (B5R); scFv anti-CD1q/CD1r/ CD1s; anti-C3, anti-C5 (e.g. eculizumab); peptide C3 inhibitors of the compstatin family (e.g. Cp40); human soluble membrane (s/m) proteins (e.g. s/mCR1 (CD35), s/mCR2 ( CD21), s/mCD55, s/mCD59); human complement factor H and derivatives, and cobra venom factor and derivatives with complement inhibitory activity.

(iv) a cellular medium engineered to express an angiogenesis inhibitor for vascular normalization/tumor vascular reprogramming; can be engineered to encode an angiogenesis inhibitor that stabilizes and/or normalizes tumor blood vessels). Details of such inhibitors are provided below in section 2. Viruses, which describes such modifications of the viruses that are a component of the CAVES provided herein. As described, angiogenesis inhibitors induce vascular normalization and disrupt tumor vasculature by restoring the balance of the signal cascade initiated by the interaction of tumor cells with their local cellular environment. Can be repaired (tumor vascular reprogramming). This can lead to enhanced tumor perfusion and reduced intratumoral hypoxia, which in turn can lead to improved reduction in primary tumor growth, ascites and metastases.

CAVES compositions and related methods of use and treatment provided herein inhibit angiogenesis, including those that downregulate proangiogenic factors and/or upregulate antiangiogenic factors. The cellular media can include a cell medium encoding a molecule that Alternatively, or in addition, the CAVES compositions provided herein can be administered in combination with an angiogenesis inhibitor and/or a virus encoding an angiogenesis inhibitor.

(v) Cellular media engineered to express transgenes for conditional cell immortalization In some embodiments, the cellular media for the CAVES compositions and related methods provided herein are , conditional cell immortalization (e.g., review by Wall et al., Cell Gene Therapy Insights, 2(3):339-355 (2016), herein incorporated by reference in its entirety, and references cited therein). (see literature). Conditional immortalization is an induction process when the transgene is active, e.g. under the control of an operator, to produce cells that can be expanded to clinical quantities in a stable and consistent manner to obtain the desired target cells. They use transgene technology but can be inactivated if necessary so they return to their normal post-mitotic state. This allows for the delivery of consistently reproducible, stable, and scalable cell preparations ( For example, CAVES) can be safely delivered. The ability to obtain a large number of cell media of consistent quality in a scalable, cost-effective, yet safe manner for administration to a subject makes cell-based compositions such as, for example, CAVES provided herein. It is desirable to develop "off-the-shelf" allogeneic cells for clinical use.

Conditional immortalization of cells can be performed using methods known to those skilled in the art and can vary depending on, for example, the type of cell and the species from which it is obtained. For example, stress activation of the p53 and pRB pathways is a common cause of aging in mice, and by growing mouse cells under optimal media and oxygen conditions, we can inhibit or silence these genes and This can relieve stress. On the other hand, human cells, in addition to silencing the p53 and pRB genes, also require telomere maintenance, for example by telomerase rearrangement. Exemplary genes that can be controllably (conditionally) activated/inactivated for cell division include, for example, oncogenes and telomerase. Exemplary techniques for conditional immortalization include, but are not limited to:

E6/E7
Oncoproteins from human papillomavirus type 16 (HPV16), E6 and E7 cooperate in mediating cell immortalization by inactivating tumor suppressors such as p53 and pRB. Conditional immortalization can therefore be achieved by conditional inactivation of these tumor suppressors when proliferation is desired, followed by their activation when proliferation is to be arrested. (eg, prior to therapeutic administration; see, eg, Storey et al., Oncogene, 11:653-661 (1995)).

Myc gene
The c-myc gene, along with its viral homologue v-myc, exerts regulatory control over a variety of cellular functions. In particular, it drives cell cycle entry and cell division, making it an attractive target for generating stable immortalized cell lines. Mutations in the myc gene that result in constitutive expression of the myc gene are associated with oncogenic transformation and result in cancer. Therefore, regulated expression of c-myc, preferably under operator control, is desired for conditional immortalization.

The conditional immortalization technology c-MycER ^TAM is a fusion gene encoding a chimeric protein containing c-myc and an N-terminally truncated hormone binding domain of a mutant mouse estrogen receptor (G525R). Mutant strain G525R is no longer able to bind 17β-estradiol and estrogen, but responds to activation in the presence of the synthetic estrogenic agonist 4-hydroxytamoxifen (4-OHT). Therefore, culturing cells in the presence of 4-OHT promotes c-myc activity and subsequent cell division, whereas in the absence of 4-OHT, cells return to a non-activated state, similar to normal cells. can undergo maturation/differentiation.

Synthesis of c-MycER ^TAM does not affect cell phenotype, and this conditional immortalization technique has been used to develop human stem cell lines from cortical neuroepithelium, which are used to treat ischemic stroke and limb ischemia. It has been investigated in preclinical animal studies and is currently being investigated in clinical trials as a treatment for stroke disorders (phases 1 and 2) and in clinical limb ischemia phase 1 trials.

Among the myc oncogenes, the avian virus homolog v-myc has also been shown to effectively immortalize human neural stem cells (hNSCs). The p110gag-myc protein encoded by the avian myelocytomatosis virus genome is naturally downregulated after differentiation. Like their cellular counterparts, the growth and differentiation of v-myc-transduced hNSCs is dependent on mitogenic stimulation by growth factors. Spontaneous downregulation of avian v-myc was observed after 24-48 hours of engraftment in neonatal mice, indicating promise as a conditional immortalized cell vehicle. Established v-myc hNSC cell lines have shown potential as delivery vehicles for selective gene therapy due to their tumor-tropic properties. Preclinical testing of an hNSC line genetically modified to express cytosine deaminase (HB1.F3.CD) resulted in tumor site conversion of 5-fluorocytosine to the chemotherapeutic agent 5-fluorouracil. A phase 1 clinical trial is currently underway to study the dosage and side effects of this anti-cancer strategy (ID: 13401 NCI-2013-02346 13401).

Thermosensitive simian virus SV40 T antigen
SV40 is a double-stranded DNA virus derived from rhesus macaques. SV40 has a number of antigens, including large tumor antigens (Tag). Tag regulates cell signaling pathways that induce cells to enter S phase and undergo a DNA damage response that promotes viral DNA replication. Tag also binds to and inactivates p53 and pRB family proteins, potent tumor suppressors involved in cell cycle progression and apoptosis, creating an ideal environment permissive for viral replication. Early studies on rodent cells showed that Tag immortalized these cells and acquired unlimited proliferative capacity. Subsequent inactivation of Tag resulted in rapid and irreversible loss of proliferative capacity in the G1 and G2 phases of the cell cycle, demonstrating that Tag is continuously required to maintain the proliferative state. . These attributes made Tag an ideal candidate for developing controllable cell lines.

Inactivated Tag was first isolated in 1975 and was found to behave as wild type at permissive temperatures (33.5°C), but to be biologically inactive at nonpermissive temperatures of 39°C. was achieved using a large Tag temperature-sensitive mutant strain (SV40-tsA58). Thus, conditional immortalization can be achieved by growing cells at a permissive temperature and then promoting differentiation by increasing the temperature of the cells to a non-permissive temperature. ReNeuron Ltd. (UK) / Preclinical study by University College London conducted for the treatment of retinitis pigmentosa using a human fetal retinal cell line (hRPC) conditionally immortalized using the SV40 large tumor antigen. has been done.

Telomerase In human somatic cells, the progressive shortening of telomeres, short repeating sequences at the ends of chromosomes, with each cell division has been proposed to be the mitotic clock. Human telomeres contain multiple tandem repeats of TTTAGG located at the ends of chromosomes. Human telomeres depend on the enzyme telomerase to maintain their length, but human somatic cells do not express telomerase at sufficient levels to maintain telomeres, so they shorten by about 50 base pairs with each cell division. Taken together, telomere loss associated with lack of telomerase activity is the mitotic clock responsible for limiting the number of divisions before senescence.

The catalytic subunit hTERT of human telomerase reverse transcriptase catalyzes the synthesis of 6-bp repeats to elongate telomeres. Since basal levels of telomerase in primary human cells are not sufficient for unlimited lifespan, transduction of exogenous hTERT can result in lifespan extension.

Although it was originally proposed that reconstitution of telomerase activity using hTERT would be sufficient to immortalize primary human cells, we found that reconstitution of telomerase alone may not be sufficient, and in these instances, Secondary inactivation of regulatory pathways such as p16 and pRB was required.

Although constitutive activation was assessed in the above studies, telomerase has proven successful in supporting conditional immortality in combination with other conditional transgenes (O'Hare et al. Proc. Natl Acad. Sci. USA, 98(2):646-651 (2001)). For example, the U19 Tag mutant strain of SV40 is defective in binding to the SV40 origin of replication and, when delivered with a recombinant retrovirus encoding the U19 Tag, renders rodent cells more immortal than the wild-type Tag. It was more efficient to convert A vector incorporating both the tsA58 (temperature-sensitive Tag mutation, see discussion above) and the U19 mutation was constructed to generate a mouse oligodendrocyte progenitor cell line capable of in vitro differentiation (Almazan et al., Brain Res ., 579:234-245 (1992)). It was found that the U19tsA58 Tag can generate a conditionally immortal cell line from rat neonatal optic nerves that can differentiate into oligodendrocytes (Barnett et al., Eur. J. Neurosci., 5:1247-1260). 1993)). The U19tsA58 Tag was also used to study the heterogeneity of candidate regenerating olfactory ensheathing cells from the olfactory bulb and lamina propria (Franceschini et al., Dev. Biol., 173(27):327-343 (1996) ). A study by O'Hare et al. showed that ectopic expression of hTERT or U19tsA58 Tag alone is insufficient to immortalize freshly isolated human cells, but that the combination of genes in the order in which they were introduced (O'Hare et al., Proc. Natl Acad. Sci. USA, 98(2):646-651 (2001)).

Cre-loxP system bacteriophage p1 Cre is an enzyme that promotes recombination at specific sites called loxP. Once the two 33 bp loxP sequences are oriented, recombination occurs, resulting in cleavage and removal of the intervening sequence. The application of reversible immortalization with Cre-loxP holds promise for both autologous and allogeneic cell therapy. Biopsies and primary cultures can be immortalized with a recombinant oncogene flanked by loxP sites. Transfection with Cre then results in excision of the immortalization gene. After oncogene removal, the cells should be identical to the primary culture population, but have increased in number.

The Cre-loxP system has been applied to human hepatocytes and myogenic cells from rat adrenal cells with hTERT and Tag as immortalizing genes (see discussion above). To exclude any cells that may not have deleted the transgene, as a negative control for recombination, place a small portion of refractory immortalized cells in the presence of ganciclovir (GCV) after Cre transfection. The herpes simplex virus 1-thymidine kinase (HSV-TK) suicide gene was included to kill the virus. Tamoxifen-dependent Cre recombinase has also been incorporated to achieve controlled excision of oncogenes.

Tet-On and Tet-Off
Conditional immortalization has also been achieved through the use of transcriptional regulatory systems. The most widely used are those induced using the prokaryotic tetracycline inhibition system. The transcriptional regulatory system utilizes the tet repressor (tetR) protein, which binds to a sequence called the tetracycline operator (tetO) in the absence of antibiotics (tetracycline or doxycycline). If the antibiotic is present, it binds to the repressor, thereby inhibiting its binding to tetO.

The first system available for conditional immortalization was called "Tet-Off" and was developed in HeLa cells. In this system, a tet repressor binding site is inserted between the promoter and the transcription start site such that binding of the repressor sterically blocks transcription. However, steric hindrance is overcome by the addition of small amounts of tetracycline and doxycycline, which prevent the binding of tetR to tetO, thereby inducing reporter gene expression.

Alternatively, a "Tet-On" system was created by fusing tetR with the C-terminal activation domain of virion protein 16 (VP16) from herpes simplex virus (HSV), thereby fused to the tetO sequence. We created a hybrid transcription activator (tTA) that stimulates the promoter. Four amino acid modifications resulted in a reverse tetracycline transactivator (rtTA) that binds to tetO only in the presence of tetracycline or doxycycline. Oncogenes (c-Myc and Tag) and telomerase (hTERT) were first identified in a Tet-based immortalization system in mouse embryonic fibroblasts (MEFs), mouse kidney cells (293T), mouse embryonic stem cells, and human endothelial cells. was tested. Additionally, mesenchymal stromal cells (MSCs) have been immortalized with a tetracycline-inducible system. Tetracycline-inducible hTERT-expressing MSC cell lines were found to retain pluripotency, and immortalization was dependent on telomere elongation. Conditionally immortalized MSC lines were generated by lentiviral transfection of Tag-hTERT in combination with a doxycycline/tetracycline inducible (Tet-On) system (Koch et al., Genome Res., 2013; 23:248-259 (2013) ). These cells were used to study changes in senescence-associated DNA methylation (SA-DNAm) and could be maintained in culture for 80 days without signs of senescence. Removal of doxycycline in the medium immediately stopped proliferation and further expression of senescence-associated β-galactosidase. When cells were exposed to antibiotics and unaffected by SA-DNAm, telomere length was significantly increased.

Methods of Modifying Cell Media Several methods of manipulating cells are known in the art, such as to create the engineered cell media described above. Such methods include, but are not limited to:

(a) CRISPR-CAS9 targeted silencing (permanent gene/locus deletion). Cellular media can be transfected with a DNA plasmid expressing both the CAS9 protein and a guide RNA (gRNA) specific for the gene of interest. gRNA-CAS9-mediated cleavage of the genome can be repaired using a donor DNA plasmid, resulting in specific deletion of the targeted gene and permanent and complete loss of the gene-encoded protein. Loss of protein expression can be verified using any protein assay such as PCR (DNA level), Northern blot/FISH (RNA level), or Western blot or flow cytometry.

(b) CRISPR-CAS9 targeted expression (permanent gene/locus insertion)
Using this method, a gene of interest can be inserted into a specific location in the cell-mediated genome. Cellular media can be transfected with a DNA plasmid expressing both the CAS9 protein and a guide RNA (gRNA) specific for a particular insertion site. gRNA-CAS9-mediated breaks in the genome can be repaired using a donor DNA plasmid, which carries the inserted gene of interest flanked by sequences of the cell-mediated genome on either side of the location of the DNA cut/double-strand break. , causing homologous recombination-mediated insertion of the gene of interest into a specific, rather than random, genomic location. Successful insertion and protein expression can be verified using PCR (DNA level), Northern blot/FISH (RNA level), or any protein assay such as, for example, Western blot or flow cytometry.

(c) RNA interference (retroviral/lentiviral/transposon-mediated transduction of shRNA/microRNAs) (permanent gene silencing) by designing shRNAs/microRNAs that target specific genes/proteins of interest into the cell-mediated genome. can be cloned into retroviral/lentiviral/transposon vectors for stable integration. Cell media can be transduced with the vector, and a vector-encoded selectable marker can be used to select transduced cells. shRNA-mediated suppression of a gene of interest can be assessed using, for example, Northern blots and protein assays.

(d) Lentivirus/γ-retrovirus-mediated random/multicopy gene insertion. Design and/or engineer specific genes/proteins of interest into retroviral or lentiviral vectors for stable random integration into the cell-mediated genome Can be cloned. Cellular media can be transduced with viral vectors, and vector-encoded selectable markers can be used to select transduced cells. shRNA-mediated repression of the gene of interest is assessed using Northern blots, as well as any protein assay, such as Western blots and flow cytometry.

(e) Transposon-Mediated Random/Multi-copy Gene Insertion Specific genes/proteins of interest can be designed and/or cloned into mammalian transposon vector systems such as PiggyBac (SBI System Biosciences) or equivalent. Cell media can be co-transfected with a transposon vector containing the gene of interest (cDNA) flanked by inverted terminal repeat (ITR) sequences and a transposase vector. Transposase enzymes can mediate the transfer of the gene of interest to the TTAA chromosomal integration site. Transduced cells can optionally be selected using a vector-encoded selection marker. Insertion and protein expression can be verified using PCR (DNA level), Northern blot/FISH (RNA level), or any protein assay such as, for example, Western blot or flow cytometry.

(f) Transient gene silencing of the expression of a protein of interest can be achieved, for example, via RNA interference. The siRNA/microRNA can be delivered by any of the established methodologies known in the art, such as: calcium chloride transfection; lipofection; Cell media can be transfected.

(g) Transient gene expression is achieved, for example, by cloning the gene of interest into a suitable mammalian plasmid expression vector that can be transfected into a cellular medium carrying plasmid DNA encoding the desired product. be able to. Alternatively, mRNA encoding the gene/protein of interest can be directly transfected into the cellular medium. Transfection can be performed using any of the established methodologies, such as: calcium chloride transfection; lipofection; Xfect; electroporation; sonoporation and cell expression (e.g. to introduce siRNA). .

2. Viruses Carrier cells selected and/or modified as described above can be used for virotherapy with any virus identified as having oncolytic properties. Exemplary oncolytic viruses that can be used in the methods, combinations and compositions provided herein are:

Types of Viruses Oncolytic viruses are primarily characterized by tumor cell-specific replication, leading to tumor cell lysis and efficient tumor regression. Oncolytic viruses effect treatment by colonizing or accumulating tumor cells, including metastatic tumor cells, such as circulating tumor cells, and replicating there. The methods, compositions and combinations can be practiced with any anti-cancer vaccine or virus. For example, oncolytic viruses include, but are not limited to, vaccinia virus, poxvirus, herpes simplex virus, adenovirus, adeno-associated virus, measles virus, reovirus, vesicular stomatitis virus (VSV), coxsackie virus, and semliki virus. Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, poliovirus, parvovirus, retrovirus, lentivirus, alphavirus, flavivirus, rhabdovirus, papillomavirus, influenza virus, mumps virus, It can be any naturally occurring or engineered recombinant virus, such as gibbon leukemia virus and Sindbis virus. Tumor selectivity is often an inherent property of viruses such as vaccinia virus and other oncolytic viruses. Generally, oncolytic viruses effect treatment by replicating in tumors or tumor cells, resulting in lysis.

In some embodiments, attenuated strains derived from pathogenic viruses are used to produce live vaccines. Non-limiting examples of vaccinia viruses include, but are not limited to, Lister (also known as Elstree), New York City Department of Health (NYCBH), Dairen, Ikeda, LC16M8, Western Reserve (WR), Copenhagen (Cop), Tashkent, Tian Tan, Wyeth, Dryvax, IHD-J, IHD-W, Brighton, Ankara, Modified Vaccinia Ankara (MVA), Dairen I, LIPV, LC16M0, LIVP, WR 65-16, EM63, Bern , Paris, CVA382, NYVAC, ACAM2000, ACAM1000, and Connaught strains. The virus can be a clonal strain of an oncolytic virus. A sequence of nucleotides encoding a chromophore-producing enzyme can be inserted into or in place of a non-essential gene or region within the genome of an unmodified oncolytic virus, or a heterologous sequence within the genome of an unmodified oncolytic virus. Inserted into or in place of a nucleic acid encoding a gene product.

In some embodiments, the vaccinia virus used with the cells and in the methods of the invention is an attenuated New York City Department of Health (NYCBOH) strain. In some embodiments, the NYCBOH strain of vaccinia virus can be ATCC VR-118 or CJ-MVB-SPX.

In some embodiments, the vaccinia virus is selected from Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve or Modified Vaccinia Ankara (MVA). In some embodiments, the oncolytic virus is not deficient in any genes present in one or more of these strains.

In some embodiments, the virus or vaccine is a replication competent virus. In some embodiments, the virus or vaccine is replication defective. In some embodiments, the virus or vaccine is not attenuated. In other embodiments, the virus or vaccine is attenuated.

Other unmodified oncolytic viruses include GLV-1h68, JX-594, JX-954, ColoAd1, MV-CEA, MV-NIS, ONYX-015, B18R, H101, OncoVEX GM-CSF, Reolysin, NTX- 010, CCTG-102, Cavatak, Oncorine and TNFerade.

Oncolytic viruses for use in the methods provided herein include some that are well known to those of skill in the art, such as vesicular stomatitis virus, e.g., U.S. Patent No. 7,731,974; No. 6,653,103 and U.S. Patent Application Publications No. 2010/0178684, 2010/0172877, 2010/0113567, 2007/0098743, 20050260601, 20050220818 and European Patent Applications See U.S. Pat. No. 6,428,968 and U.S. Patent Application Publication Nos. 2011/0177032, 2011/0158948, 2010/0092515, 2009/0274728, 2009/0285860, 2009/0215147, See US Pat. No. 2009/0010889, US Pat. No. 2007/0110720, US Pat. 5,851,529, 5,716,826, 5,716,613 and U.S. Patent Publication No. 20110212530; and adeno-associated viruses, such as U.S. Pat. No. 7,927,585, No. 7,811,814, No. 7,662,627, No. 7,241,447, No. 7,238,526, No. 7,172,893, No. 7,033,826, No. 7,001,765, No. 6,897,045, and No. 6,6 See No. 32,670 is included.

Newcastle disease virus Newcastle disease virus (NDV) is an avian paramyxoid with a single-stranded RNA genome of negative polarity that infects poultry and is generally non-pathogenic to humans, but can cause influenza-like symptoms. It is a virus (Tayeb et al. (2015) Oncolytic Virotherapy 4:49-62; Cheng et al. (2016) J. Virol. 90:5343-5352). Their cytoplasmic replication, lack of host genome integration and recombination, and high genomic stability make NDV and other paramyxoviruses more susceptible to other oncolytic viruses, such as retroviruses or some DNA viruses. offering a safe and attractive alternative (Matveeva et al. (2015) Molecular Therapy-Oncolytics 2, 150017). NDV exhibits tumor selectivity, replicating 10,000 times more in tumor cells than normal cells and causing tumor lysis through direct cytopathic effects and induction of immune responses (Tayeb et al. (2015; Lam et al. (2011) ) Journal of Biomedicine and Biotechnology, Article ID 718710).The mechanism of NDV tumor selectivity is not completely clear, but defects in interferon production and response to IFN signaling in tumor cells allow the virus to replicate and spread. (Cheng et al. (2016); Ginting et al. (2017) Oncolytic Virotherapy 6:21-30).The high affinity of paramyxoviruses for cancer cells also suggests that they can be used to treat cancer cell surfaces containing sialic acids. It can be due to overexpression of viral receptors (Cheng et al. (2016); Matveeva et al. (2015); Tayeb et al. (2015)).

Non-engineered NDV strains are classified as long-latency (non-pathogenic), sub-pathogenic (moderate) or short-latent (pathogenic) based on their pathogenicity in chickens; short-latent and subpathogenic. strains can replicate in (and lyse) multiple human cancer cells, but long-latency strains cannot (Cheng et al. (2016); Matveeva et al. (2015)). NDV strains are also classified as lytic or non-lytic, with only lytic strains capable of producing viable and infectious progeny (Ginting et al. (2017); Matveeva et al. (2015)). On the other hand, the oncolytic effect of non-lytic strains is mainly due to their ability to stimulate immune responses leading to anti-tumor activity (Ginting et al. (2017) Oncolytic Virotherapy 6:21-30). Subpathogenic lytic strains commonly used in tumor therapy include PV701 (MK107), MTH-68/H and 73-T; commonly used long-latency non-lytic strains include Includes HUJ, Ulster and Hitchner-B1 (Tayeb et al. (2015); Lam et al. (2011); Freeman et al. (2006) Mol. Ther. 13(1):221-228).

The use of NDV as an oncolytic virus was first reported in the early 1950s when adenovirus and NDV were injected directly into uterine cancers, causing partial necrosis. Tumor regrowth was observed, possibly due to suppression of oncolytic activity by the production of neutralizing antibodies against the virus (Lam et al. (2011) Journal of Biomedicine and Biotechnology, Article ID 718710). Recently, NDV strain PV701 showed activity against colorectal cancer in a phase 1 trial (Laurie et al. (2006) Clin. Cancer Res. 12(8):2555-2562), and NDV strain 73-T showed activity against colorectal cancer in a phase 1 study (Laurie et al. (2006) Clin. In vitro oncolytic activity against various human cancer cell lines including sarcoma, osteosarcoma, neuroblastoma and cervical cancer, as well as human neuroblastoma, fibrosarcoma xenografts, and colon, lung, and breast cancer and demonstrated in vivo therapeutic efficacy in mice bearing several cancer xenografts, including prostate cancer xenografts (Lam et al. (2011)). NDV strain MTH-68/H resulted in significant regression of tumor cell lines including PC12, MCF7, HCT116, DU-145, HT-29, A431, HELA and PC3 cells and inhibited progression when administered by inhalation. demonstrated favorable responses in patients with cancer (Lam et al. (2011)). The non-lytic strain Ulster demonstrated cytotoxic effects against colon cancer, and the lytic strain Italien effectively killed human melanoma (Lam et al. (2011)). The long-latency NDV strain HUJ demonstrated oncolytic activity against recurrent glioblastoma multiforme when administered intravenously to patients, and the long-latency strain LaSota extended survival in colorectal cancer patients. (Lam et al. (2011); Freeman et al. (2006) Mol. Ther. 13(1):221-228), non-small cell lung cancer (A549), glioblastoma (U87MG and T98G), breast adenocarcinoma (MCF7 and MDA-MB-453) and hepatocellular carcinoma (Huh7) cell lines and were able to kill them (Ginting et al. (2017) Oncolytic Virotherapy 6:21-30).

Genetically engineered NDV strains have also been evaluated for oncolytic therapy. For example, the IFN antagonist influenza NS1 gene was introduced into the genome of the NDV strain Hitchner-B1, resulting in enhanced oncolytic effects in various human tumor cell lines and a mouse model of B16 melanoma (Tayeb et al. (2015) )). The antitumor/immunostimulatory effects of NDV were enhanced by the introduction of IL-2 or GM-CSF genes into the viral genome (Lam et al. (2011)).

In addition to the use of free virus, studies evaluated the use of NDV tumor lysates, NDV-infected cell-based vehicles, and combination therapy with other non-cancer agents for cancer treatment. In several clinical trials, NDV tumor lysate demonstrated oncolytic activity against malignant melanoma (Lam et al. (2011)). The use of NDV-infected cell-based carriers has also been demonstrated. Autologous tumor cell lines infected with NDV were used against colorectal cancer, breast cancer, ovarian cancer, kidney cancer, head and neck cancer, and glioblastoma (Lam et al. (2011)). Bone marrow, adipose, and umbilical cord-derived MSCs infected with NDV strain MTH-68/H delivered virus to co-cultured A172 and U87 glioma cells and glioma stem cells and showed a dose-dependent effect in glioma cells. It resulted in cell death, low levels of apoptosis and inhibition of self-renewal in glioma stem cells, and higher levels of apoptosis than direct infection with naked virus (Kazimirsky et al. (2016) Stem Cell Research & Therapy 7:149). Combination therapy using intratumoral NDV injection and systemic CTLA-4 antibody administration resulted in efficient rejection of pre-established distant tumors (Matveeva et al. (2015)).

Marabavirus Marabavirus was first isolated from the Amazonian phlebotomine in Brazil and has never been detected outside of South America. Phylogenetically, Marabavirus belongs to the genus Vesiculovirus in the family Rhabdoviridae and is genetically distinct from the prototypical vesicular stomatitis virus (VSV), but shares some homology. (See Pol et al., Oncolytic Virother., 7:117-128 (2018) and references cited therein, the contents of which are incorporated herein by reference in their entirety.)

Among the 20 rhabdoviruses screened for oncolytic Marabavirus, it showed the broadest tumor tropism. The virus was tested in all human and mouse cell lines derived from the various cancer types tested (i.e., breast cancer, brain cancer, colon cancer, skin cancer, lung cancer, ovarian cancer, breast cancer, prostate cancer and kidney cancer). cancer), it was the only candidate to complete the lytic cycle. Marabaviruses (such as VSV) utilize the ubiquitous low-density lipoprotein receptor (LDLR) for entry into target cells, including, but not limited to, one explanation for the wide range of malignant cellular hosts they infect. I will provide a. Consistent with this, reduced expression of LDLR was associated with reduced susceptibility to Maraba virus entry and killing in several cell lines derived from ascites of ovarian cancer patients.

To enhance Maraba virus replication in malignant cells, we genetically engineered its genome. Two single mutations were introduced that translated into L123W and Q242R substitutions in the M and G protein sequences, respectively. In vitro, the resulting strain (designated MG1) exhibited faster replication, larger burst size, and increased killing efficacy in tumor cells compared to wild-type (wt) and other mutant strains of Maraba virus. showed that. Conversely, MG1 was strongly attenuated in normal primary cells, confirming its cancer selectivity (Brun et al., Mol. Ther. 18(8):1440-1449 (2010)).

In vitro, MG1 oncolytic activity has been validated against multiple adherent cancer cell lines of human, canine and murine origin (e.g. central nervous system cancer, sarcoma, breast and colon cancer origins). . Additionally, MG1 was found to be able to infect, replicate, and induce cell death in ovarian cancer cells regardless of stage (Tong et al., Mol. Ther. Oncolytics, 2(): 15013). . Ex vivo, the MG1 strain was found to exhibit productive infection and significant cytopathic effects on resected tissue derived from prostate cancer, head and neck squamous cell carcinoma, or sarcoma. In vivo, MG1 can be safely delivered systemically, allowing treatment of localized as well as disseminated cancerous lesions. The oncolytic activity of MG1 has been confirmed in multiple syngeneic mouse tumor models and in xenograft models using human cancer cell lines or patient-derived tumors transplanted into immunodeficient mice (e.g., in mice: Colon cancer (CT26, CT26lacZ), leukemia (L1210), lung cancer (TC1), breast cancer (EO771, EMT6, 4T1), prostate cancer (TRAMP-C2), sarcoma (S180), skin cancer (B16F10, B16F10Ova, B16lacz); in humans: breast cancer (HCI-001, HCI-003) and ovarian cancer (ES2, OVCAR4).

The activity of the MG1 strain of Maraba vesiculovirus depends not only on direct cytotoxicity but also on the induction of both innate and adaptive antitumor immunity. Therefore, Marabavirus can function as both a selective tumor-killing oncolytic virus and an immunostimulatory T-cell vaccine. Leaving healthy cells unaffected, the Maraba platform directly attacks cancer cells and alters the tumor microenvironment, making cancers more susceptible to targeted vaccine-induced immune responses. The technology was developed by Turnstone Biologics (Ottawa, Ontario), a clinical-stage immuno-oncology company, which recently completed research into an exclusive option to license up to three of Turnstone's next-generation oncolytic viral immunotherapies. Option and license agreement signed with AbbVie (North Chicago, IL).

parvovirus
H-1 parvovirus (H-1PV) is a small non-enveloped single-stranded DNA virus that belongs to the family Parvoviridae, and its natural host is the rat (Angelova et al. (2017) Front. Oncol. 7 :93; Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). H-1PV is non-pathogenic to humans and is attractive as an oncolytic virus due to its favorable safety profile, lack of pre-existing H-1PV immunity in humans, and lack of host cell genomic integration. (Angelova et al. (2015)). H-1PV has broad tumor suppression against both solid tumors, including preclinical forms of breast, gastric, cervical, brain, pancreatic, and colorectal cancers, and hematologic malignancies, including lymphoma and leukemia. (Angelova et al. (2017) Front. Oncol. 7:93; Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). H-1PV stimulates anti-tumor responses through increased presentation of tumor-associated antigens, maturation of dendritic cells, and release of pro-inflammatory cytokines (Moehler et al. (2014) Frontiers in Oncology 4:92). H-1PV also affects cellular replication and transcription factor availability, overexpression of cellular proteins that interact with the NS1 parvovirus protein, and metabolic pathways involved in the functional regulation of NS1 in tumor cells but not in normal cells. exhibits tumor selectivity that is thought to be due to activation (Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). Due to the harmless nature of H-1PV, wild-type strains are often used, negating the need for genetically engineered attenuation (Angelova et al. (2015)).

Study shows that oncolytic H-1PV infection of human glioma cells results in efficient cell killing, and a high-grade glioma stem cell model is also permissive to lytic H-1PV infection . Enhanced killing of glioma cells was observed when the virus was applied immediately after tumor cell irradiation, indicating that this protocol can be useful for unresectable recurrent glioblastoma (Angelova et al. 2017) Front. Oncol. 7:93; Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). Intracerebral or systemic H-1PV injections result in regression of gliomas without toxic side effects in immunocompetent rats bearing orthotopic RG-2 tumors as well as immunodeficient animals transplanted with human U87 gliomas. (Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). Del H-1PV is a compatible mutant that is highly infectious and spreads in human transformed cell lines, and has demonstrated oncolytic effects in vivo in pancreatic and cervical cancer xenograft models (Geiss et al. 2017) Viruses 9, 301). H-1PV has also been tested in a panel of five human osteosarcoma cell lines (CAL 72, H-OS, MG-63, SaOS-2, U-2OS) (Geiss et al. (2017) Viruses 9, 301) and human melanoma. Oncolytic activity against cells (SK29-Mel-1, SK29-Mel-1.22) (Moehler et al. (2014) Frontiers in Oncology 4:92) was also demonstrated. In another study, nude rats bearing cervical cancer xenografts demonstrated dose-dependent tumor growth arrest and regression after treatment with H-1PV (Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55) . Intratumoral and intravenous administration of H-1PV also demonstrated significant growth inhibition in human breast cancer xenografts in immunodeficient mice (Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55). Intratumoral H-1PV injection into mice bearing human gastric cancer or human Burkitt's lymphoma resulted in tumor regression and growth inhibition (Angelova et al. (2015) Frontiers in Bioengineering and Biotechnology 3:55).

The first phase I/IIa clinical trial of oncolytic H-1PV (ParvOryx01) in patients with recurrent glioblastoma multiforme was completed in 2015 (clinical trial NCT01301430), with favorable progression-free survival, clinical safety demonstrated efficacy and patient tolerability by intratumoral or intravenous injection (Angelova et al. (2017); Geiss et al. (2017) Viruses 9, 301; Geletneky et al. (2017) Mol. Ther. 25(12): 2620 -2634). This study demonstrated that H-1PV crosses the blood-brain barrier in a dose-dependent manner and produces an immunogenic antitumor response characterized by leukocyte infiltration primarily by CD8+ and CD4+ T lymphocytes, as well as perforin, granzyme B, IFNγ, IL- 2, demonstrated the ability to establish detection in locally treated tumors of several markers of immune cell activation, including CD25 and CD40L (Geletneky et al. (2017) Mol. Ther. 25(12): 2620-2634 ).

H-1PV also demonstrated efficient killing of highly aggressive pancreatic ductal adenocarcinoma (PDAC) cells in vitro, including those resistant to gemcitabine, and intratumoral injection of H-1PV resulted in tumor regression and prolonged animal survival in a topical rat model (Angelova et al. (2017); Angelova et al. (2015)). Similar results, including selective tumor targeting and lack of toxicity, were observed in an immunodeficient nude rat PDAC model (Angelova et al. (2015)). Combining H-1PV with cytostatic (cisplatin, vincristine) or targeted (sunitinib) drugs results in synergistic induction of apoptosis in human melanoma cells (Moehler et al. (2014)). The combination of H-1PV and the HDAC inhibitor valproic acid resulted in synergistic cytotoxicity against cervical and pancreatic cells (Angelova et al. (2017)), and the therapeutic efficacy of gemcitabine was demonstrated in a two-step protocol. It was significantly improved when combined with H-1PV (Angelova et al. (2015)). Like other viruses, H-1PV can be engineered to express anti-cancer molecules. For example, studies have shown that parvovirus H1-derived vectors expressing apoptin are more capable of inducing apoptosis than wild-type H-1PV (Geiss et al. (2017)).

Like other oncolytic viruses, the therapeutic potential of parvoviruses is limited by nonspecific uptake due to ubiquitous expression of cell surface receptors that recognize parvoviruses, and the development of neutralizing antibodies after repeated administration. Ru. H-1PV circumvented these potential challenges and demonstrated antitumor efficacy when combined with cell-based vehicles. In one study, autologous MH3924A rat hepatoma cells were used for targeted delivery of H-1PV and inhibition of metastases formed by the same cells (Raykov et al. (2004) Int. J. Cancer 109:742-749 ). Hepatoma cells were inactivated by gamma irradiation 24 hours after H-1PV infection, but this only reduced the yield of progeny virus by more than two-fold. Compared to direct virus injection, vehicle cell-based therapy results in improved suppression of metastasis and production of fewer neutralizing antibodies, supporting the use of carrier cells for systemic delivery of oncolytic parvoviruses ( Raykov et al. (2004)).

Measles virus Measles virus (MV) is an enveloped single-stranded RNA virus with a negative-sense genome that belongs to the family of Paramyxoviruses (Aref et al. (2016) Viruses 8:294; Hutzen et al. (2015) Oncolytic Virotherapy 4:109-118). Its non-segmented genome is stable with a low risk of mutating back to a pathogenic form, and its cytoplasmic replication eliminates the risk of insertional DNA mutagenesis in infected cells (Aref et al. (2016); Hutzen (2015)). MV was first isolated from a patient called Edmonston in 1954 and developed into a live vaccine with an excellent safety profile, which has been used worldwide in 50 years due to attenuation after multiple in vitro passages. (Aref et al. (2016) Viruses 8:294; Hutzen et al. (2015) Oncolytic Virotherapy 4:109-118). A derivative of this strain, designated MV-Edm, is the most commonly used MV strain in oncolytic therapy research. The Schwarz/Moraten measles vaccine strain is more attenuated and more immunogenic than Edm-derived strains, making it safer and more immunomodulatory (Veinalde et al. (2017) Oncoimmunology 6(4): e1285992). The oncolytic effects of wild-type MV were described in the 1970s, with improvement reported in patients with acute lymphoblastic leukemia, Burkitt's lymphoma, and Hodgkin's lymphoma (Aref et al. (2016)).

MVs use three major receptors to enter target cells: CD46, Nectin-4 and Signaling Lymphocyte Activation Molecule (SLAM) (Aref et al. (2016); Hutzen et al. (2015)). SLAM, expressed on activated B and T cells, immature thymocytes, monocytes, and dendritic cells, is the main receptor for the wild-type strain, whereas the attenuated tumor-selective MV-Edm strain Primarily targets the CD46 receptor, a regulator of complement activation that is overexpressed in many tumor cells (Aref et al. (2016); Hutzen et al. (2015); Jacobson et al. (2017)) Oncotarget 8 (38) : 63096-63109; Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4)). Nectin-4, which is primarily expressed in the respiratory epithelium, is used by both wild-type and attenuated MV strains (Aref et al. (2016); Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4) ). Similar to other oncolytic viruses, defective IFN antiviral responses of tumor cells also promote tumor selectivity of MV (Aref et al. (2016); Jacobson et al. (2017) Oncotarget 8(38):63096–63109 MV is in clinical use for the treatment of several cancers including multiple myeloma (NCT02192775, NCT00450814), head and neck cancer (NCT01846091), mesothelioma (NCT01503177) and ovarian cancer (NCT00408590, NCT02364713). being studied in trials.

MVs are designed to express immunostimulatory and immunomodulatory genes, including, for example, genes encoding IL-13, INF-β, GM-CSF, and Heliobacter pylori neutrophil activation protein (NAP). (Aref et al. (2016), Hutzen et al. (2015); Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4)). Combination therapy using oncolytic MVs with anti-CTLA4 and anti-PD-L1 antibodies has been shown to be effective in melanoma mouse models (Aref et al. (2016); Hutzen et al. (2015)). Due to extensive vaccination or previous natural infection, most patients have previous immunity to MV, which impedes its therapeutic potential. To circumvent this, MVs are delivered to tumors in carrier cells such as mesenchymal stem cells, effectively evading host neutralizing antibodies, and in preclinical models of acute lymphoblastic leukemia, hepatocellular carcinoma and ovarian cancer. It has been found to be effective (Aref et al. (2016)). U-937 monocytic cell line, immature and mature primary dendritic cells, PMBC, activated T cells, primary CD14+ cells, multiple myeloma MM1 cell line and others including blood outgrowth endothelial cells. Several cell carriers have demonstrated results for the delivery of MVs (Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4)). A clinical trial (NCT02068794) has investigated the use of oncolytic MV-infected mesenchymal stem cells in the treatment of patients with recurrent ovarian cancer. Another strategy to overcome pre-existing immunity involves the combination of MV therapy and immunosuppressive agents such as cyclophosphamide (Hutzen et al. (2015)).

MV-CEA
MV-CEA, which is genetically engineered to express the tumor marker carcinoembryonic antigen (CEA), releases CEA into the patient's bloodstream after infection of cancer cells, and the detection of CEA levels and thus the in vivo viral infection. (Aref et al. (2016); Hutzen et al. (2015)). The therapeutic potential of MV-CEA has been preclinically demonstrated and investigated in a Phase I clinical trial (NCT00408590) for the treatment of ovarian cancer.

MV-NIS
MV-NIS is another traceable oncolytic MV of the Edmonston vaccine lineage that has been engineered to express the sodium-iodine cotransporter (NIS) and is a nucleocapsid (N ) placement of the NIS transgene downstream of the hemagglutinin (H) gene in the MV genome instead of upstream of the gene shows superior virus amplification compared to MV-CEA (Aref et al. (2016); Galanis et al. 2015) Cancer Res. 75(1):22-30). Radioactive isotopes such as ¹²³ I, ¹²⁴ I, ¹²⁵ I, ¹³¹ I and ^99m Tc are transported via NIS expressed in MV-NIS infected cells and can be detected using e.g. PET, SPECT/CT and gamma camera. (Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4)). Expression of NIS can also improve the efficacy of oncolytic MVs by promoting the entry of β-emitting radioisotopes, such as I-131, into tumor cells for radioviral therapy and multiple myeloma. , has demonstrated preclinical results in multiple glioblastoma, head and neck cancer, anaplastic thyroid cancer, and prostate cancer models (Aref et al. (2016); Hutzen et al. (2015); Msaouel et al. (2013)) ). To investigate the use of MV-NIS in multiple myeloma (NCT00450814, NCT02192775), mesothelioma (NCT01503177), head and neck cancer (NCT01846091), and ovarian cancer (NCT02068794) using virus-infected MSCs. Several Phase I/II clinical trials were conducted.

Reovirus Respiratory enteric orphan viruses, commonly known as reoviruses, are non-enveloped double-stranded RNA viruses of the family Reoviridae that are nonpathogenic to humans. Wild-type reovirus is ubiquitous throughout the environment, resulting in seropositivity of 70-100% in the general population (Gong et al. (2016) World J. Methodol. 6(1):25-42). There are three serotypes of reovirus: Lang type 1, Jones type 2, Abney type 3, and Dearing type 3 (T3D). T3D is the naturally occurring oncolytic reovirus serotype most commonly used in preclinical and clinical studies.

Oncolytic reovirus is tumor selective due to activated Ras signaling characteristic of cancer cells (Gong et al. (2016)); Zhao et al. (2016) Mol. Cancer Ther. 15(5):767-773). Activation of the Ras signaling pathway subverts cellular antiviral responses by inhibiting the phosphorylation of dsRNA-dependent protein kinase (PKR), a protein normally responsible for preventing viral protein synthesis (Zhao et al. (2016) )). Ras activation also enhances viral uncoating and disassembly, enhances viral progeny production and infectivity, and promotes progeny release through enhanced apoptosis (Zhao et al. (2016)). It is estimated that approximately 30% of all human tumors exhibit aberrant Ras signaling (Zhao et al. (2016)). For example, the majority of malignant gliomas have an activated Ras signaling pathway, and reovirus affects 83% of malignant glioma cells in vitro, as well as in human malignant glioma models in vivo, and ex vivo. demonstrated antitumor activity in 100% of tumor specimens (Gong et al. (2016) World J. Methodol. 6(1):25-42). Furthermore, pancreatic adenocarcinomas have a very high incidence of Ras mutations (approximately 90%), and reovirus exhibits potent cytotoxicity in 100% of pancreatic cell lines tested in vitro and in a subcutaneous tumor mouse model in vivo. induced regression in 100% of cases (Gong et al. (2016)).

Reovirus is associated with cancer across a range of malignancies including colon, breast, ovarian, lung, skin (melanoma), nerve, blood, prostate, bladder and head and neck cancers. It has demonstrated extensive anticancer activity preclinically (Gong et al. (2016)). Reovirus therapy has now been tested in combination with radiotherapy, chemotherapy, immunotherapy and surgery. The combination of reovirus and radiotherapy has been found to be beneficial in the treatment of head and neck, colorectal and breast cancer cell lines in vitro, and colorectal cancer and melanoma models in vivo (Gong et al. (2016) )). Reovirus and gemcitabine and the combination of reovirus, paclitaxel and cisplatin have been found to be successful in mouse tumor models (Zhao et al. (2016)). Preclinical studies in a B16 melanoma mouse model showed that the combination of oncolytic reovirus and anti-PD-1 therapy improved anticancer efficacy compared to reovirus alone (Gong et al. (2016) ); Zhao et al. (2016); Kemp et al. (2015) Viruses 8, 4).

A number of clinical trials are being conducted using reovirus. Reolysin® Reovirus Oncolytics Biotech Inc. ) showed anticancer activity against malignant tumors alone and in combination with other therapeutic agents. For example, a Phase I clinical trial of Reolysin® Reovirus for the treatment of recurrent malignant glioma (NCT00528684) found that Reovirus was well tolerated and Studies show that Reolysin® can kill tumor cells without damaging normal cells in patients with ovarian epithelial cancer, primary peritoneal cancer, and fallopian tube cancer who have not responded to platinum-based chemotherapy. We showed that it is possible (NCT00602277). A Phase II clinical trial of Reolysin® Reovirus showed it to be safe and effective in treating patients with metastatic bone and soft tissue sarcoma to the lungs (NCT00503295). Reolysin® reovirus in combination with FOLFIRI and bevacizumab is in clinical trials for patients with metastatic colorectal cancer (NCT01274624). A phase II clinical trial of Reolysin® reovirus in combination with the chemotherapy drug gemcitabine was conducted in patients with advanced pancreatic adenocarcinoma (NCT00998322), and a phase II clinical trial was conducted in patients with metastatic castration-resistant prostate cancer. The therapeutic potential of Reolysin® reovirus in combination with docetaxel was investigated in patients with advanced/metastatic breast cancer (NCT01619813), and a phase II clinical trial investigated the combination of Reolysin® reovirus and paclitaxel in patients with advanced/metastatic breast cancer. (NCT01656538). A Phase III clinical trial investigated the efficacy of Reolysin® reovirus in combination with paclitaxel and carboplatin in platinum-refractory head and neck cancer (NCT01166542), and a Phase II clinical trial using this combination therapy were conducted in patients with non-small cell lung cancer (NCT00861627) and metastatic melanoma (NCT00984464). A Phase I clinical trial of Reolysin® reovirus in combination with carfilzomib and dexamethasone in patients with relapsed or refractory multiple myeloma is ongoing (NCT02101944).

Due to the presence of neutralizing antibodies in a large proportion of the population, systemic administration of reovirus has limited therapeutic potential, which can be overcome by coadministration of reovirus and immunosuppressants such as cyclosporine A or cyclophosphamide. (Gong et al. (2016)). Administration of GM-CSF before IV administration of reovirus significantly reduced B16 melanoma tumors and prolonged survival in mice (Kemp et al. (2015) Viruses 8, 4). Carrier cells have also demonstrated success in protecting viruses from pre-existing immunity. For example, lymphokine-activated killer cells (LAK) and DCs were used as cell carriers for reovirus in an ovarian cancer model and protected the virus from neutralizing antibodies (Zhao et al. (2016)). PMBCs containing NK cells have been shown not only to transport reovirus but also to be stimulated by reovirus to kill tumor targets (Zhao et al. (2016)). Another study showed that both DCs and T cells are effective carriers of reovirus in vitro in the absence of human serum, but only DCs deliver virus to melanoma cells in the presence of neutralizing serum. (Ilett et al. (2011) Clin. Cancer Res. 17(9):2767-2776). DCs were also able to deliver reovirus in mice with lymph node B16tk melanoma metastases, but neat reovirus was completely ineffective (Ilett et al. (2009) Gene Ther. 16(5):689 -699).

Vesicular stomatitis virus (VSV)
Vesicular stomatitis virus (VSV) is a member of the genus Vesiculovirus in the family Rhabdoviridae. Its genome contains single-stranded RNA with negative-sense polarity and contains 11,161 nucleotides, including nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and large polymerase protein. (L) (Bishnoi et al. (2018) Viruses 10(2), 90). VSV is transmitted by insect vectors, and disease is restricted to natural hosts including horses, cattle, and pigs, with mild and asymptomatic infection in humans (Bishnoi et al. (2018) Viruses 10(2), 90) . VSV is a potent and rapid inducer of apoptosis in infected cells and has been shown to sensitize chemoresistant tumor cells. VSV has been shown to infect tumor vasculature, resulting in loss of blood flow to the tumor, blood clotting, and lysis of neovasculature. This virus is also capable of replicating and inducing cytopathic effects and cell lysis in hypoxic tissues. Furthermore, WT VSV grows to high titers in a variety of tissue culture cell lines, facilitates large-scale virus production, has a small and easily manipulated genome, and can be isolated from the cytoplasm without the risk of host cell transformation. (Bishnoi et al. (2018); Felt and Grdzelishvili (2017) Journal of General Virology 98:2895-2911). These factors, along with the fact that this virus is not pathogenic to humans and there is generally no pre-existing human immunity to VSV, make this virus an excellent candidate for viral tumor therapy.

Although VSV can attach to ubiquitously expressed cell surface molecules and become "pantropic," WT VSV is sensitive to type I IFN responses, suggesting defects in type I IFN signaling in tumors. or exhibit tumor selectivity based on inhibition (Felt and Grdzelishvili (2017)). VSV can cause neuropathogenesis due to its infectivity of normal cells, but can be attenuated by modifying matrix proteins and/or glycoproteins. For example, the matrix protein can be deleted, or the methionine residue at position 51 of the matrix protein can be deleted or replaced with arginine (Bishnoi et al. (2018); Felt and Grdzelishvili (2017)). Another approach replaces the glycoprotein of VSV with the glycoprotein of lymphocytic choriomeningitis virus (LCMV) (rVSV-GP) (Bishnoi et al. (2018); Felt and Grdzelishvili (2017)). VSV can be modified to contain suicide genes such as herpesvirus thymidine kinase (TK) or immunostimulatory cytokines such as IL-4, IL-12, IFNβ, or granulocyte-macrophage-colony stimulating factor 1 (GM-CSF1). ) can also be genetically modified to express costimulatory factors to enhance oncolytic activity (Bishnoi et al. (2018). - IFNβ-NIS) is being tested in several Phase I clinical trials (see, eg, ClinicalTrials.gov for trials NCT02923466, NCT03120624, and NCT03017820).

Vesicular stomatitis virus (VSV) is an effective oncolytic therapeutic agent when administered intravenously (IV) in various murine cancer models. In one study, VSV-GP was successful in intratumoral treatment of subcutaneously implanted G62 human glioblastoma cells as well as intravenous treatment of orthotopic U87 human glioma cells in an immunodeficient mouse model. Intratumoral injection of VSV-GP was also effective against intracranial CT2A mouse glioma cells (Muik et al. (2014) Cancer Res. 74(13): 3567-3578). We found that VSV-GP did not elicit detectable neutralizing antibody responses and that this genetically engineered oncolytic virus was insensitive to human complement and remained stable throughout the experiment (Muik et al. (2014) )). In another example, intratumoral administration of VSV-GP was found to effectively infect and kill human A375 melanoma cells transplanted into a mouse model, as well as the murine B16 melanoma cell line (Kimpel (2018) Viruses 10, 108). Intravenous injection of oncolytic virus was not successful, and even in the intratumoral group, all tumors ultimately grew due to type I IFN responses (Kimpel et al. (2018)). In another study, a subcutaneous xenograft mouse model containing A2780 human ovarian cancer cells was treated with intratumoral injection of VSV-GP, and tumor remission was initially observed without neurotoxicity, but the remission was temporary. Yes, the tumor recurred. This was found to be due to a type I IFN response, and by combining VSV-GP with the JAK1/2 inhibitor ruxolitinib, a reversal of the antiviral state was observed (Dold et al. (2016) Molecular Therapy - Oncolytics 3, 16021). Inhibition of type I IFN responses is usually not possible with attenuated mutants of wild-type VSV in vivo due to safety concerns, necessitating alternative solutions.

Studies have shown that humoral immunity generates antiviral antibodies and limits the therapeutic potential of VSV. Repeated administration of VSV in carrier cells to animals with metastatic tumors was found to result in much higher therapeutic efficacy compared to injection of naked virions (Power et al. (2007) Molecular Therapy 15(1): (123-130) have demonstrated the ability of carrier cells to evade circulating antibodies. Syngeneic CT26 mouse colon cancer cells were easily infected with VSV and upon delivery of VSV to infect mouse lung tumors, they rapidly accumulated in lung tumors after intravenous administration, but not in surrounding normal lung tissue. cell-mediated delivery of VSV is achieved using immunologically incompatible cells (Power et al. (2007)) that do not accumulate and release virus and remain until undergoing lysis within 24 hours (Power et al. (2007)). L1210 murine leukemia cells also delivered VSV to lung tumors as well as subcutaneous tumors located in the posterior flank of mice (Power et al. (2007). There was no detectable virus replication in normal tissues, indicating tumor selectivity.

In another study, VSV-δ51, which lacks the matrix protein methionine 51 and is therefore unable to block nuclear transport of IFN-encoding mRNA, specifically transduces the SIINFEKL epitope of the ovalbumin antigen expressed by B16ova tumors. loaded onto OT-I CD8+ T cells expressing the genetic T cell receptor (Qiao et al. (2008) Gene Ther. 15(8):604-616). This oncolytic virus/cell-based vehicle combination was used against B16ova tumors in the lungs of immunocompetent C57B1/6 mice and showed a significant increase in therapeutic efficacy compared to the use of virus or T cells alone. brought about. Although there was no detectable replication of VSV in OT-I cells, after co-culturing infected T cells with B16ova cells, virus was released, effectively infected, and replicated within tumor cells, killing tumor cells. Killed or injured. Loading of T cells with VSV was shown to increase T cell activation in vitro and T cell trafficking to tumors in vivo (Qiao et al. (2008)).

Adenovirus Adenovirus (Ads) is a non-enveloped ds-DNA virus with a linear genome that was first discovered by Wallace Rowe and colleagues in 1953 and tested in 1956 for the treatment of cervical cancer. (Choi et al. (2015) J. Control. Release 10(219): 181-191). Human Ads are ubiquitous in the environment and are classified into 57 serotypes (Ad1-Ad57) based on cross-susceptibility and seven subgroups (A-G) based on virulence and tissue tropism. Adenovirus serotype 5 (Ad5) is the most commonly used adenovirus for oncolytic virotherapy. Infections in humans are mild and result in cold-like symptoms (Yokoda et al. (2018) Biomedicines 6, 33), and systemic administration can result in liver tropism and hepatotoxicity (Yamamoto et al. (2017) Cancer Sci 108:831-837), Ads are considered safe for therapeutic purposes. Ads attach to coxsackievirus and adenovirus receptors (CARs) and subsequently through interactions between αvβ3 and αvβ5 integrins on the cell surface and the Arg-Gly-Asp tripeptide motif (RGD) of the adenovirus penton base. invade cells (Jiang et al. (2015) Curr. Opin. Virol. 13:33-39). Although CAR is expressed on the surface of most normal cells, expression is highly variable between cancer cell types. On the other hand, RGD-related integrins are highly expressed by cancer cells, but at much lower levels in normal cells (Jiang et al. (2015)). As a result, Ads are typically targeted to cancer cells via RGD motifs.

Ads are characterized by high transduction efficiency in transformed cells, lack of integration into the host genome/lack of insertional mutagenesis, genomic stability, ability to insert large therapeutic genes into the genome, and tumor tissue-selectivity of viral promoters. It is attractive as an oncolytic virus because of its ability for tumor selectivity through genetic manipulation such as promoter substitution (Yokoda et al. (2018) Biomedicines 6, 33; Choi et al. (2015) J. Control. Release 10 (219): 181-191).

Examples of oncolytic Ads using tumor-specific promoters include CV706 for the treatment of prostate cancer by the adenovirus early region 1A (E1A) gene under the control of the prostate-specific antigen promoter, and for the regulation of E1A gene expression. One example is OBP-301, which uses the telomerase reverse transcriptase (TERT) promoter for this purpose (Yamamoto et al. (2017) Cancer Sci. 108:831-837). Another method to induce tumor selectivity is to introduce mutations in the E1 region of the Ad genome, where the missing gene is linked to abnormalities in the retinoblastoma (Rb) pathway or p53 mutations. It is functionally complemented by genetic mutations commonly found in tumor cells, such as (Yamamoto et al. (2017) Cancer Sci. 108:831-837). For example, oncolytic Ads ONYX-015 and H101 have a deletion of the E1B55K gene that inactivates p53. These mutant strains fail to block the normal apoptotic defense pathway and confer tumor selectivity through infection of neoplastic cells with a defective p53 tumor suppressor pathway (Yamamoto et al. (2017) Cancer Sci. 108:831-837 ; Uusi-Kerttula et al. (2015) Viruses 7:6009-6042). E1AΔ24 is an oncolytic Ad that contains a 24bp mutation in the E1A gene, disrupting the Rb binding domain and promoting viral replication in cancer cells with Rb pathway mutations. ICOVIR-5 is an oncolytic Ad that combines E1A transcriptional regulation by the E2F promoter, the Δ24 mutation of E1A, and RGD-4C insertion into adenoviral fibers (Yamamoto et al. (2017) Cancer Sci. 108:831- 837; Uusi-Kerttula et al. (2015)). Delta24-RGD, or DNX-2401, is an oncolytic Ad with a modified Δ24 backbone by insertion of an RGD motif and demonstrated enhanced oncolytic effects in vitro and in vivo (Jiang et al. (2015)).

An alternative strategy to improve tumor selectivity involves overcoming the physical barrier of solid tumors by targeting the extracellular matrix (ECM). For example, VCN-01 is an oncolytic Ad that expresses hyaluronidase in vivo to enhance viral spread in tumors. Ads have also been engineered to express relaxin to disrupt the ECM (Yamamoto et al. (2017) Cancer Sci. 108:831-837; Shaw and Suzuki (2015) Curr. Opin. Virol. 21:9 -15). Ads expressing suicide genes such as cytosine deaminase (CD) and HSV-1 thymidine kinase (TK) are enhanced in vivo, as are Ads expressing immunostimulatory cytokines such as ONCOS-102 expressing GM-CSF. has antitumor efficacy (Yamamoto et al. (2017) Cancer Sci. 108:831-837; Shaw and Suzuki (2015) Curr. Opin. Virol. 21:9-15). A Δ24-based oncolytic Ad expressing anti-CTLA4 antibody showed results in preclinical studies (Jiang et al. (2015)).

Adenovirus H101 (Oncorine® adenovirus) was the first oncolytic Ad approved for clinical use in China in combination with chemotherapy to treat patients with advanced nasopharyngeal cancer in 2005. Met. Many clinical trials have investigated the use of oncolytic adenoviruses to treat a wide variety of cancers. For example, ongoing and past clinical trials include Ad5 encoding IL-12 (NCT03281382) in patients with metastatic pancreatic cancer; Immunostimulatory Ad5 (LOAd703) expressing TMX-CD40L and 41BBL (NCT03225989); LOAd703 in combination with gemcitabine and nab-paclitaxel in pancreatic cancer patients (NCT02705196); Oncolysis encoding human PH20 hyaluronidase (VCN-01) used adenovirus in combination with gemcitabine and Abraxane® in patients with advanced solid tumors including pancreatic adenocarcinoma (NCT02045602; NCT02045589); human telomerase reverse transcriptase (hTERT) promoter in patients with hepatocellular carcinoma Telomelysin® (OBP-301) (NCT02293850), an oncolytic Ad with tumor selectivity, containing E1B gene deletion Ad5 in combination with hepatic arterial chemoembolization (TACE) in patients with hepatocellular carcinoma (NCT01869088); CG0070, an oncolytic Ad that expresses GM-CSF and contains a cancer-specific E2F-1 promoter driving E1A expression (NCT02365818; NCT01438112); colon cancer in patients with bladder cancer Enadenotucirev (Colo-Ad1), an Ad11p/Ad3 chimeric group B oncolytic virus (NCT02053220), in patients with non-small cell lung cancer, bladder cancer, and renal cell carcinoma; and temozolomide (NCT02053220) in patients with glioblastoma. Studies involving DNX-2401 (Ad5 E1AΔ24RGD) in combination with NCT01956734) or IFNγ (NCT02197169) are included. CAR-T cells are often only marginally effective as therapeutic agents, particularly against solid tumors, due to factors such as poor T cell migration and the immunosuppressive environment of solid tumors. can. In a murine neuroblastoma tumor model, combination therapy using CAR-T cells with the oncolytic Ad virus Ad5Δ24 with the chemokine RANTES and the cytokine IL-15 inhibits CAR-T cell migration and survival to the tumor site. It was found to increase Adenovirus had a strong dose-dependent cytotoxic effect on tumor cells and accelerated the caspase pathway in tumor cells exposed to CAR-T cells without damaging CAR-T cells (Nishio et al., Cancer Res., 74(18):5195-5205 (2014)). Furthermore, intratumoral release of RANTES and IL-15 attracts CAR-T cells to the tumor site and promotes their local survival, respectively, thereby reducing overall tumor-bearing mice compared to treatment with CAR-T alone. increased survival (Nishio et al., Cancer Res., 74(18):5195-5205 (2014)).

Like other oncolytic viruses, Ads suffer from low therapeutic efficacy when administered systemically due to the development of neutralizing antibodies, and due to high seroprevalence, as much as 90% of Ads in some populations (Uusi-Kerttula et al. (2015) Viruses 7:6009-6042). Furthermore, nonspecific hepatic sequestration of Ads results in hepatotoxicity (Choi et al. (2015)). Polymers such as PEG, positively charged arginine-grafted bioreducible polymers (ABP), PAMAMG5 and other nanomaterials have been used to hide viral capsid proteins and reduce antiviral immune responses and nonspecific liver accumulation. can increase tumor accumulation (Choi et al. (2015)). Other approaches to evade the immune system involve the use of carrier vehicle cells to deliver oncolytic Ads. For example, T cells were used to deliver delta24-RGD Ad to glioblastoma cells in vitro and in vivo in an orthotopic glioma stem cell (GSC)-based xenograft mouse model (Balvers et al. (2014) Viruses 6:3080-3096). Systemic administration of virus-loaded T cells resulted in intratumoral virus delivery (Balvers et al. (2014)). Clinical trials investigating delivery of Ad by carrier/vehicle cells include neural stem cells loaded with oncolytic Ad to treat malignant gliomas (NCT03072134); These include the use of infected autologous dendritic cells (NCT00197522); and autologous mesenchymal stem cells (MSCs) infected with ICOVIR5 in children and adults with metastatic and refractory solid tumors (NCT01844661).

Poliovirus Poliovirus (PV) belongs to the genus Enterovirus in the family Picornaviridae and has a positive-sense single-stranded RNA genome. PV infection results in a severe neurological syndrome, acute poliomyelitis, due to the tropism of PV to the spinal cord and motor neurons (Brown and Gromeier (2015) Discov. Med. 19(106):359-365). PV retains robust replication capacity and cytotoxicity in the presence of active antiviral IFN responses, allowing several rounds of viral replication to amplify the immune-stimulating viral cytotoxic effect, thus making it useful for clinical applications. (Brown and Gromeier (2015) Discov. Med. 19(106): 359-365). PV also does not integrate into the host cell genome (Yla-Pelto et al. (2016) Viruses 8, 57).

PV host cell entry is mediated by the Ig superfamily cell adhesion molecule CD155, also known as the PV receptor (PVR), and nectin-like molecule 5 (Necl5), which is widely overexpressed in solid tumors such as glioblastoma ( Brown and Gromeier (2015) Curr. Opin. Virol. 13:81-85). CD155 is also expressed in colorectal cancer, lung adenocarcinoma, breast cancer and melanoma, and on antigen presenting cells (APCs) such as macrophages and dendritic cells (Brown et al. (2014) Cancer 120(21): 3277-3286).

The internal ribosome entry site (IRES) of PV is responsible for promoting translation initiation of the PV RNA genome and is involved in PV neuropathogenesis. Live attenuated PV vaccines derived from the Sabin serotype have a critical attenuating point mutation in the IRES (Brown and Gromeier (2015) Curr. Opin. Virol. 13:81-85). Highly attenuated polio/rhinovirus recombinant PVSRIPO, a live attenuated type 1 (Sabin) PV vaccine in which the cognate PV IRES is replaced with that of human rhinovirus 2 (HRV2), is a neurotransmitter compared to the parental PV. exhibits no toxicity/neuropathogenicity but retains the cytotoxicity and specificity of cancer cells towards GBM cells (Brown and Gromeier (2015) Curr. Opin. Virol. 13:81-85; Brown and Gromeier (2015) Discov. Med. 19(106):359-365). PVSRIPO causes tumor regression by inducing an anti-tumor immune response rather than direct lysis of bulk tumor and has been used to treat recurrent glioblastoma (GBM) (NCT01491893) (Brown and Gromeier (2015) ) Curr. Opin. Virol. 13:81-85; Brown and Gromeier (2015) Discov. Med. 19(106):359-365). A Phase 1b clinical trial investigated the use of PVSRIPO to treat recurrent malignant gliomas in children (NCT03043391), and a Phase 2 clinical trial investigated the use of PVSRIPO to treat recurrent malignant gliomas in adult patients with recurrent malignant gliomas. investigated the use of PVSRIPO and in combination with the chemotherapy drug lomustine (NCT02986178).

Herpes Simplex Virus Herpes simplex virus (HSV) belongs to the Herpesviridae family and has a large linear double-stranded DNA genome containing many genes that are not essential for viral replication, making it an ideal candidate for genetic manipulation. It becomes. Other advantages include the ability to infect a wide range of cell types, sensitivity to antiviral drugs such as acyclovir and ganciclovir, and lack of insertional mutations (Sokolowski et al. (2015) Oncolytic Virotherapy 4:207-219; Yin (2017) Front. Oncol. 7:136). There are two types of HSV: HSV type I (HSV-1) and type II (HSV-2), and the majority of oncolytic HSV is derived from HSV-1. In humans, HSV-1 causes herpes simplex disease and infects epithelial cells, neurons, and immune cells by binding to nectins, glycoproteins, and herpesvirus entry mediators (HVEMs) on the cell surface (Kohlhapp and Kaufman 2016) Clin. Cancer Res. 22(5):1048-1054).

To date, many different oncolytic HSV-1 viruses have been produced. For example, HSV-1 has been engineered to express the anti-HER-2 antibody trastuzumab, which targets tumors that overexpress HER-2, such as breast and ovarian cancer, gastric cancer, and glioblastoma. The gene encoding trastuzumab was inserted into two regions within the HSV-1 gD glycoprotein gene, creating two oncolytic HSVs, R-LM113 and R-LM249. R-LM113 and R-LM249 demonstrated preclinical activity against human breast and ovarian cancer and mouse models of HER2+ glioblastoma. R-LM249 was systemically administered using mesenchymal stem cells (MSCs) as carrier cells and exhibited therapeutic effects against ovarian and breast cancer lung and brain metastases in mouse models (Campadelli-Fiume et al. 2016) Viruses 8, 63). Another oncolytic HSV-1, dlsptk HSV-1, contains a deletion of the unique long 23 (UL23) gene encoding the viral homolog of thymidine kinase (TK), and the hrR3 HSV-1 mutant strain Contains a LacZ insertion mutation in the large subunit of ribonucleotide reductase (RR), also known as ICP6, encoded by the gene UL39. As a result, dlsptk and hrR3 HSV-1 mutant strains can only replicate in cancer cells that overexpress TK and RR, respectively (Sokolowski et al. (2015) Oncolytic Virotherapy 4:207-219).

HF10 is a naturally mutant oncolytic HSV-1 that lacks genes encoding UL43, UL49.5, UL55, UL56 and latency-associated transcripts, and overexpresses UL53 and UL54. HF10 demonstrated high tumor selectivity, high viral replication, potent antitumor activity, and a favorable safety profile (Eissa et al. (2017) Front. Oncol. 7:149). Clinical trials investigating HF10 include a phase I trial (NCT01017185) in patients with refractory head and neck cancer, squamous cell carcinoma of the skin, breast cancer, and malignant melanoma, as well as chemotherapy in patients with unresectable pancreatic cancer. Includes a Phase I study (NCT03252808) of HF10 in combination with (gemcitabine, Nab-paclitaxel, TS-1). HF10 was also combined with the anti-CTLA-4 antibody ipilimumab to improve treatment efficacy in patients with stage IIIb, IIIc, or IV unresectable or metastatic melanoma (NCT03153085). Phase II clinical trials are investigating the combination of HF10 and the anti-PD-1 antibody nivolumab (NCT03259425) in patients with resectable stage IIIb, IIIc and IV melanoma, and ipilimumab in patients with unresectable or metastatic melanoma. We investigated the combination (NCT02272855). Combination therapy of paclitaxel and HF10 resulted in superior survival in a peritoneal colorectal cancer model compared to either treatment alone, and combination treatment of HF10 and erlotinib resulted in better survival in vitro than either HF10 or erlotinib alone. and improved activity against pancreatic xenografts in vivo (Eissa et al. (2017) Front. Oncol. 7:149).

Talimogene Laherparepvec (Imlygic®, T-VEC), formerly known as OncoVEX ^GM-CSF , is produced from the JS1 strain of HSV-1 and is a granulocyte-macrophage stimulating factor (GM-CSF). ) is an FDA-approved oncolytic herpes simplex virus for the treatment of advanced melanoma (Aref et al. (2016) Viruses 8:294). In T-VEC, GM-CSF expression enhances antitumor cytotoxic immune responses, deletion of both copies of the infected cell protein 34.5 (ICP34.5) gene suppresses replication in normal tissues, and the ICP47 gene deletion increases the expression of MHC class I molecules, allowing antigen presentation on infected cells (Eissa et al. (2017)). T-VEC exhibits tumor selectivity by binding to nectin on the surface of cancer cells, disrupting oncogenic and antiviral signaling pathways, particularly protein kinase R (PKR) and type I IFN. It replicates preferentially in tumor cells by exploiting this pathway. In normal cells, PKR is activated by viral infection, which then phosphorylates and inactivates the eukaryotic initiation factor-2A protein (eIF-2A), which in turn inhibits cellular protein synthesis and Blocks proliferation and prevents viral replication. Wild-type HSV evades antiviral responses and restores protein synthesis in infected cells by expressing the ICP34.5 protein, which activates a phosphatase that dephosphorylates eIF-2A. Therefore, deletion of ICP34.5 eliminates viral replication of T-VEC in normal cells. However, the PKR-eIF-2A pathway in cancer cells is disrupted, allowing continued cell proliferation and uninhibited viral replication (Kohlhapp and Kaufman (2016) Clin. Cancer Res. 22(5):1048-1054 ; Yin et al. (2017) Front. Oncol. 7:136). GM-CSF expression improves T-VEC immunogenicity by causing dendritic cell accumulation, promoting antigen presentation, and priming T cell responses (Kohlhapp and Kaufman (2016) Clin. Cancer Res .22(5):1048-1054).

T-VEC has shown preferential replication in a variety of cancer cell lines including breast cancer, colorectal adenocarcinoma, melanoma, prostate cancer and glioblastoma. Clinical trials include, for example, pancreatic cancer (NCT03086642, NCT00402025), recurrent breast cancer (NCT02658812), advanced non-CNS tumors in children (NCT02756845), non-melanoma skin cancer (NCT03458117), and non-muscle invasive bladder cancer. T-VEC in transitional cell carcinoma (NCT03430687), and malignant melanoma (NCT03064763), and in combination with atezolizumab in patients with metastatic triple-negative breast cancer and metastatic colorectal cancer with liver metastases (NCT03256344), triple-negative breast cancer (NCT02779855) in combination with paclitaxel in patients with refractory lymphoma or nivolumab in patients with advanced/refractory non-melanoma skin cancer (NCT02978625), and cisplatin and radiotherapy in patients with advanced head and neck cancer. (NCT01161498), and investigating T-VEC in combination with pembrolizumab in patients with liver tumors (NCT02509507), head and neck cancer (NCT02626000), sarcoma (NCT03069378) and melanoma (NCT02965716, NCT02263508). .

In addition to GM-CSF, numerous other immunostimulatory genes, including those encoding IL-12, IL-15, IL-18, TNFα, IFNα/β and fms-like tyrosine kinase 3 ligands, are associated with oncolytic HSV. have been inserted into the body, resulting in increased therapeutic efficacy (Sokolowski et al. (2015); Yin et al. (2017)).

Another oncolytic HSV-1, R3616, contains a deletion of both copies of the RL1 (also known as γ ₁ 34.5) gene, which encodes ICP34.5, and drives cancer cells with disrupted PKR pathways. Target. NV1020 (or R7020) is an HSV-1 mutant strain containing deletions in the UL55, UL56, ICP4, RL1 and RL2 genes, resulting in reduced neurovirulence and cancer selectivity. NV1020 showed results in mouse models of head and neck squamous cell carcinoma, epidermoid carcinoma, and prostate adenocarcinoma (Sokolowski et al. (2015)). NV1020 is being investigated for the treatment of colorectal cancer that metastasizes to the liver (NCT00149396 and NCT00012155).

G207 (or MGH-1) is another HSV-1 mutant strain with a RL1 (γ ₁ 34.5) deletion and a LacZ-inactivating insertion in the UL39 neurovirulence gene. Clinical studies using G207 include investigating G207 alone or in conjunction with a single dose of radiation in children with advanced or recurrent supratentorial brain tumors (NCT02457845); These include investigating the safety and efficacy of G207 in patients with malignant glioblastoma (NCT00028158) and investigating the effects of G207 administration followed by radiotherapy in patients with malignant glioma (NCT00157703).

G207 was used to generate G47Δ, which contains an additional deletion in the gene encoding ICP47. Other HSV-1-derived oncolytic viruses include HSV1716, which contains a deletion of RL1 but has an intact UL39 gene and replicates selectively in actively dividing cells, and UL48 and RL2 genes. These include KM100 mutant strains with insertions that result in loss of immediate viral gene expression and cancer cell selectivity (Sokolowski et al. (2015); Yin et al. (2017) Front. Oncol. 7:136 ).

Since the majority of the population has pre-existing immunity to HSV-1, the use of carrier cells to deliver oncolytic HSV can improve their therapeutic potential. For example, human peritoneal mesothelial cells (MCs) were used as carrier cells for HF10 and resulted in efficient killing of ovarian cancer cells in vitro and in a mouse xenograft model of ovarian cancer (Fujiwara et al. 2011) Cancer Gene Therapy 18:77-86).

Oncolytic viruses are also derived from HSV-2. For example, FusOn-H2 is an HSV-2 oncolytic virus with a deletion of the N-terminal region of the ICP10 gene encoding the serine/threonine protein kinase (PK) domain. This PK is responsible for phosphorylating the GTPase-activating protein Ras-FAP, which activates the Ras/MEK/MAPK mitogenic pathway and induces and stabilizes c-Fos, which is required for efficient HSV-2 replication. do. Normal cells normally have an inactivated Ras signaling pathway. Thus, FusOn-H2 exhibits tumor selectivity by replicating only in tumor cells with activated Ras signaling pathway (Fu et al. (2006) Clin. Cancer Res. 12(10):3152-3157). FusOn-H2 has been shown to be effective in pancreatic cancer xenografts (Fu et al. (2006) Clin. Cancer Res. 12(10):3152-3157), Lewis lung cancer xenografts in combination with cyclophosphamide, and syngeneic murine mammary tumors. and demonstrated activity against neuroblastoma (Li et al. (2007) Cancer Res. 67:7850-7855).

Poxviruses Vaccinia Viruses Examples of vaccinia viruses include, but are not limited to, Lister (also known as Elstree), New York City Department of Health (NYCBH), Dairen, Ikeda, LC16M8, Western Reserve (WR), Copenhagen (Cop), Tashkent, Tian Tan, Wyeth, Dryvax, IHD-J, IHD-W, Brighton, Ankara, Modified Vaccinia Ankara (MVA), Dairen I, LIPV, LC16M0, LIVP, WR 65-16, EM63, Bern , Paris, CVA382, NYVAC, ACAM2000, ACAM1000 and Connaught strains. Vaccinia virus is an oncolytic virus with various characteristics that make it particularly suitable for use in wound and cancer gene therapy. For example, vaccinia is a cytoplasmic virus, so it does not insert its genome into the host genome during its life cycle. Unlike many other viruses that require the host's transcriptional machinery, vaccinia virus is able to support its gene expression in the cytoplasm of the host cell using enzymes encoded in the viral genome. Vaccinia virus also has a wide range of host and cell types. In particular, vaccinia virus can accumulate in immune privileged cells or tissues, including tumors and/or metastases, as well as wound tissue and cells. However, unlike other oncolytic viruses, vaccinia virus is typically more virulent than other viruses, such as adenoviruses, because it can be eliminated from the subject to which it is administered by the activity of the subject's immune system. It gets lower. Thus, although viruses can typically be eliminated from the subject to whom they are administered by the activity of the subject's immune system, such immune privileged areas are nevertheless isolated from the host's immune system. This allows the virus to accumulate, survive and multiply in immune privileged cells and tissues such as tumors.

Vaccinia virus can also be easily modified by inserting heterologous genes. This may result in attenuation of the virus and/or allow delivery of therapeutic proteins. For example, the vaccinia virus genome has a large carrying capacity for foreign genes and can insert up to 25 kb of exogenous DNA fragments (approximately 12% of the vaccinia genome size). The genomes of several vaccinia strains have been completely sequenced, and many essential and non-essential genes have been identified. Due to the high sequence homology between different strains, genomic information from one vaccinia strain can be used to design and generate modified viruses in other strains. Finally, the technology for producing modified vaccinia strains by genetic engineering is well established (Moss (1993) Curr. Opin. Genet. Dev. 3:86-90; Broder and Earl, (1999) Mol. Biotechnol. 13 :223-245; Timiryasova et al. (2001) Biotechniques 31:534-540).

Various vaccinia viruses have been demonstrated to exhibit antitumor activity. For example, in one study, a WR strain of vaccinia virus modified by deletion of vaccinia growth factor and having enhanced green fluorescent protein inserted at the thymidine kinase locus was administered to nude mice bearing non-metastatic colon adenocarcinoma cells. was injected systemically. Despite the lack of exogenous therapeutic genes in this modified virus, the virus was observed to have antitumor effects, including one complete response (McCart et al. (2001) Cancer Res. 1:8751 -8757). In another study, vaccinia melanoma tumor lysate (VMO) was injected into a site near a melanoma-positive lymph node in a phase III clinical trial in melanoma patients. As a control, New York City Department of Health strain vaccinia virus (VV) was administered to melanoma patients. Melanoma patients treated with VMO had better survival than untreated patients but similar to those treated with VV control (Kim et al. (2001) Surgical Oncol. 10:53-59) .

The LIVP strain of vaccinia virus has also been used in the diagnosis and therapy of tumors and in the treatment of wounds and inflamed tissues and cells (e.g. Zhang et al. (2007) Surgery 142:976-983; Lin et al. (2008) J. Clin. Endocrinol. Metab. 93:4403-7; Kelly et al. (2008) Hum. Gene Ther. 19:774-782; Yu et al. (2009) Mol. Cancer Ther. 8:141-151; Yu et al. ) Mol. Cancer 8:45; US Patent No. 7,588,767; see US Patent No. 8,052,968 and US Patent Application Publication No. 2004/0234455). For example, when administered intravenously, LIVP strains have been demonstrated to accumulate in internal tumors at various loci in vivo, including but not limited to breast tumors, thyroid tumors, pancreatic tumors, and pleural tumors. It has been demonstrated to effectively treat human tumors of various tissue origins, including metastatic tumors of mesothelioma, squamous cell carcinoma, lung cancer and ovarian tumors. The LIVP strain of vaccinia, which contains an attenuated form, exhibits lower toxicity than the WR strain of vaccinia virus and results in increased and longer survival of treated tumor-bearing animal models (e.g., U.S. Patent Application Publication No. 2011/2011). (See issue 0293527). Wyeth strains of vaccinia virus, such as JX-594, also exhibit low toxicity and are used to treat cancer.

Because vaccinia is a cytoplasmic virus, it does not insert its genome into the host genome during its life cycle. Vaccinia virus has a linear double-stranded DNA genome approximately 180,000 base pairs in length, composed of a single continuous polynucleotide strand (Baroudy et al. (1982) Cell 28:315-324). This structure is due to the presence of a 10,000 base pair inverted terminal repeat (ITR). ITRs are involved in genome replication. Genome replication involves self-priming, leading to the formation of high molecular weight concatemers (sequestered from infected cells), which are then cleaved and repaired to form the viral genome (e.g., Traktman, P., Chapter 27, Poxvirus DNA Replication, pp. 775-798, DNA Replication in Eukaryotic Cells, Cold Spring Harbor Laboratory Press (1996)). The genome contains approximately 250 genes. In general, non-segmented non-infectious genomes have centrally located genes that are essential for viral replication (and are therefore conserved), while genes near the two ends are responsible for more peripheral functions such as host range and virulence. Placed to influence. Vaccinia viruses practice differential gene expression by using open reading frames (ORFs) arranged in non-overlapping sets as a general rule.

Vaccinia virus has a variety of characteristics for use in cancer gene therapy and vaccination, including a broad host and cell type range, and low toxicity. For example, although most oncolytic viruses are natural pathogens, vaccinia virus has a unique history of widespread application as a smallpox vaccine, resulting in an established track record of safety in humans. Toxicity associated with vaccinia administration occurs in less than 0.1% of cases and can be effectively managed with immunoglobulin administration. Furthermore, vaccinia virus has a large carrying capacity for foreign genes (exogenous DNA fragments of up to 25 kb, approximately 12% of the vaccinia genome size, can be inserted into the vaccinia genome), and for designing and producing modified viruses of other strains. with high sequence homology between different strains. The technology for producing modified vaccinia strains by genetic engineering is well established (Moss (1993) Curr. Opin. Genet. Dev. 3:86-90; Broder and Earl (1999) Mol. Biotechnol. 13:223-245). ; Timiryasova et al. (2001) Biotechniques 31:534-540). Vaccinia virus strains have been shown to specifically colonize solid tumors without infecting other organs (e.g., Zhang et al. (2007) Cancer Res. 67:10038-10046; Yu et al. (2004) ) Nat. Biotech. 22:313-320; Heo et al. (2011) Mol. Ther. 19:1170-1179; Liu et al. (2008) Mol. Ther. 16:1637-1642; Park et al. (2008) Lancet Oncol. 9 :533-542).

ACAM2000
In an exemplary embodiment, the vaccinia virus for use in the CAVES system provided herein and used in related methods is the ACAM2000 vaccinia virus strain, which is the clonally isolated Dryvax vaccine licensed in the United States. It is. ACAM2000 has the sequence shown in SEQ ID NO:70. After propagating it, ACAM2000 is a mutant strain of SEQ ID NO: 70 containing a 6 base short left ITR, a 197 base short right ITR, and a single SNP at position 32 (non-coding region and part of the ITR sequence) , has the sequence shown in SEQ ID NO: 71 (referred to herein as "CAL1" or "WT1"). Exemplary CAVES systems containing vaccinia virus include ACAM2000 or CAL1 or modified strains thereof as oncolytic viruses, and subpopulations of mesenchymal stem cells, adipose stromal cells, fibroblasts, and adipose stromal cells, e.g. Contains stem cells such as epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) or pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-) do.

In embodiments, the ACAM2000 virus or the CAL1 virus is attenuated, such as to make it safer for systemic administration, such as attenuation of the F1L and/or B8R loci, and/or with therapeutic genes and/or selection markers. modified to express markers such as

Coxsackievirus Coxsackievirus (CV) belongs to the genus Enterovirus and family Picornaviridae and has a positive-sense single-stranded RNA genome that does not integrate into the host cell genome. CV is classified into groups A and B based on its prevalence in mice and can cause mild upper respiratory tract infections in humans (Bradley et al. (2014) Oncolytic Virotherapy 3:47-55). Coxsackieviruses for oncolytic virotherapy include, but are not limited to, attenuated coxsackievirus B3 (CV-B3), CV-B4, CV-A9, and CV-A21 (Yla-Pelto et al. 2016) Viruses 8, 57). CV-A21 is found at much higher levels in tumor cells, including melanoma, breast cancer, colon cancer, endometrial cancer, head and neck cancer, pancreatic cancer, and lung cancer, as well as multiple myeloma and malignant glioma. cells through the ICAM-1 (or CD54) and DAF (or CD55) receptors expressed in CV-A21 has been shown to be effective against malignant myeloma, melanoma, prostate cancer, lung cancer, head and neck cancer, and breast cancer cell lines in vitro, and in mice bearing human melanoma xenografts in vivo, as well as against primary cancer in mice. It has shown preclinical anticancer activity against breast cancer tumors and their metastases (Yla-Pelto et al. (2016); Bradley et al. (2014)). A derivative of CV-A21, CV-A21-DAFv, also known as CAVATAK™, is a derivative of CV-A21 that is serially passaged in ICAM-1 negative rhabdomyosarcoma (RD) cells expressing DAF. was generated from the wild-type Kuykendall strain and has enhanced oncolytic properties compared to the parent strain. CAVATAK™ binds exclusively to DAF receptors and can contribute to enhanced tropism against cancer cells (Yla-Pelto et al. (2016)).

CV-A21 has also been studied in combination with doxorubicin hydrochloride, which showed enhanced potentiation compared to treatment alone against human breast, colorectal, and pancreatic cancer cell lines, as well as in a xenograft mouse model of human breast cancer. The tumor lysis efficiency has been shown to be high (Yla-Pelto et al. (2016)). Because a significant portion of the population has already developed neutralizing antibodies against CV, CV-A21 therapy has been combined with immunosuppressive agents such as cyclophosphamide (Bradley et al. (2014)), as described herein. Media can be used for cell-mediated delivery, as described in .

Clinical trials have tested a virus called CAVATAK™ virus (NCT01636882; NCT00438009; NCT01227551) in patients with stage IIIc or IV malignant melanoma, and alone or low-dose mitomycin in patients with non-muscle-invasive bladder cancer. The use of CAVATAK™ (NCT02316171) in combination with C was investigated. Clinical trials are also investigating the effects of intravenous administration of CV-A21 in the treatment of solid tumors including melanoma, breast cancer and prostate cancer (NCT00636558). CAVATAK™ alone or in combination with pembrolizumab to treat patients with non-small cell lung cancer (NCT02824965, NCT02043665) and bladder cancer (NCT02043665), as well as patients with uveal melanoma and liver metastases (NCT03408587) and CAVATAK™ virus in combination with ipilimumab in patients with advanced melanoma (NCT02307149); and CAVATAK™ virus in combination with pembrolizumab (NCT02565992) in patients with advanced melanoma in clinical trials. It's inside.

Seneca Valley Virus Seneca Valley Virus (SVV) is a member of the Senecavirus genus in the Picornaviridae family, which has a positive-sense single-stranded RNA genome and is associated with neuroblastoma, rhabdomyosarcoma, and rhabdomyosarcoma. , selective for neuroendocrine cancers including medulloblastoma, Wilms tumor, glioblastoma and small cell lung cancer (Miles et al. (2017) J. Clin. Invest. 127(8):2957-2967; Qian et al. (2017) J. Virol. 91(16):e00823-17; Burke, M.J. (2016) Oncolytic Virotherapy 5:81-89). Studies have identified anthrax toxin receptor 1 (ANTXR1) as a receptor for SVV, which is frequently expressed on the surface of tumor cells compared to normal cells, but previous studies have shown that sialic acid , has also been shown to be a component of the SVV receptor in pediatric glioma models (Miles et al. (2017)). SVV isolate 001 (SVV-001) is a potent oncolytic virus that can target and penetrate solid tumors after intravenous administration, due to its lack of insertional mutations as well as its selective tropism towards cancer cells. and is attractive because of its non-pathogenicity in humans and animals. Furthermore, previous exposure in humans is rare and pre-existing immunity rates are low (Burke, M.J. (2016) Oncolytic Virotherapy 5:81-89).

SVV-001 has demonstrated in vitro activity against small cell lung cancer, adrenocortical carcinoma, neuroblastoma, rhabdomyosarcoma and Ewing's sarcoma cell lines, as well as pediatric GBM, medulloblastoma, retinoblastoma, rhabdomyosarcoma and neurological has shown in vivo activity in an orthotopic xenograft mouse model of blastoma (Burke (2016)). NTX-010, an oncolytic SVV-001 developed by Neotropix®, is viable alone or in combination with cyclophosphamide to treat pediatric patients with relapsed/refractory solid tumors. Although found to be acceptable, the development of neutralizing antibodies has limited its therapeutic efficacy (Burke et al. (2015) Pediatr. Blood Cancer 62(5):743-750). Clinical trials include SV-001 (NCT00314925) in patients with solid tumors with neuroendocrine features, relapsed or refractory neuroblastoma, rhabdomyosarcoma, Wilms tumor, retinoblastoma, adrenocortical carcinoma or carcinoid tumor. studies using NTX-010/SVV-001 in combination with cyclophosphamide (NCT01048892) in patients with small cell lung cancer and NTX-010/SVV-001 (NCT01017601) in patients with small cell lung cancer following chemotherapy.

Methods of Modifying Viruses Several methods of manipulating viruses are known in the art, including methods of manipulating cellular media as described above. The technology for producing modified vaccinia strains by genetic engineering is well established (Moss, Curr. Opin. Genet. Dev. 3 (1993), 86-90; Broder and Earl, Mol. Biotechnol. 13 (1999), 223 -245; Timiryasova et al., Biotechniques 31 (2001), 534-540). Methods of engineering oncolytic viruses include, but are not limited to:

(1) Homologous recombination requires the use of a donor vector containing the transgene flanked by two DNA regions homologous to the recipient viral DNA where the transgene is desired to be inserted (Kaufman, H.L., F. J. Kohlhapp and A. Zloza, Oncolytic viruses: a new class of immunotherapy drugs. Nat Rev Drug Discov, (2015) 14(9): 642-62). The recombinant virus is then transiently transfected with TK positive/negative, dominant selection markers such as beta-galactosidase, green fluorescent protein (GFP or eGFP), blue fluorescent protein (BFP) or TurboFP635, or phosphoribosyltransferase (gpt). Can be selected by several approaches, including by dominant selection (TDS).

The CRE/lox system, derived from the P1 bacteriophage, is a site-specific recombinase technology used to perform deletions, insertions, translocations, and inversions at specific sites in a cell's DNA (Kleinstiver, B. P., et al., High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature 529(7587): 490-495 (2016)). This tool works in both eukaryotes and prokaryotes, is well established, and has generated a variety of transgenic animal models (Ran, F.A., et al., Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell, 2013. 154(6): p. 1380-9). This system is based on a site-specific Cre recombinase (approximately 1 kb) that requires a 34 bp specific loxP sequence that can be easily incorporated into any target DNA. One of the advantages of the Cre/lox recombination system is that there is no need for additional cofactors or sequence elements for efficient recombination regardless of the cellular environment (Schaefer, K.A., et al. , Unexpected mutations after CRISPR-Cas9 editing in vivo. Nat Methods, 2017. 14(6): p. 547-548). The analysis showed that mutations in loxP sequences, such as m2, m3, m7, m11, and lox5171, readily recombined with themselves, but recombination with the wild-type site was significantly lower. These sequences can therefore be used with high efficiency fidelity and site-specifically for gene insertion by recombinase-mediated cassette exchange (RMCE) (Oberstein, A., et al., Site-specific transgenesis by Cre-mediated recombination in Drosophila. Nat Methods, (2005) 2(8):583-5). Nakano and colleagues used RMCE to transform adenoviruses by replacing specific genes in the replicating adenovirus genome with genes of interest using nuclear Cre recombinase and the incompatible loxP and loxP 2272 systems. It was demonstrated that a vector can be produced (Kuhn, R. and RM Torres, Cre/loxP recombination system and gene targeting. Methods Mol Biol, 2002. 180: p. 175-204).

(2) CRISPR/Cas9 has been used to create new recombinant vaccinia viruses. CRISPR/Cas9 has recently emerged as a method for editing genomes from a variety of organisms due to the ability of the Cas9 protease to cut at predetermined sites in the DNA genome marked by signal guide RNA (Wyatt, L.S., P. L. Earl and B. Moss, Generation of Recombinant Vaccinia Viruses. Curr Protoc Mol Biol, 2017. 117: p. 16.17.1-16.17.18). Introducing a double-strand break with Cas9 into the target DNA facilitates insertion of the desired gene. Yuan and colleagues demonstrated improved efficiency in the generation of new recombinant viruses (over 50 rounds) by using the CRISPR/Cas9 system compared to homologous recombination approaches (Falkner, F.G. and B. Moss, Transient dominant selection of recombinant vaccinia viruses. J Virol, 1990. 64(6): p. 3108-11). To overcome off-target induced mutations in mammalian cells, several mutations in Cas9 nuclease have been introduced: N497A, R661A, Q695A and Q926A (Cas9 High Fidelity), which results in more precise cleavage. Mali, P., K. M. Esvelt and G. M. Church, Cas9 as a versatile tool for engineering biology. Nat Methods, 2013. 10(10): p. 957-63) or providing single-strand breaks. , D10A mutant Cas9 (Yuan, M., et al., A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors. J Vis Exp, 2016 (116).

Engineered Viruses In embodiments, the CAVES systems provided herein can be produced using genetically engineered oncolytic viruses. Oncolytic viruses can be engineered by methods known in the art or provided herein. The virus was purified by recombinant expression of selectable markers including, but not limited to, EGFP, EmGFP, mNeonGreen, EBFP, TagBFP, EYFP, TPet, GFP, BFP or TurboFP635, and/or cytokines (GM-CSF, IL2, IL10, IL12, IL-15, IL-17, IL-18, IL-21, TNF, MIP1a, FLt3L, IFN-b, IFN-g), chemokines (CCl5, CCl2, CCL19, CXCL11, RANTES), costimulation Drugs (OX40L, 41BBL, CD40L, B7.1/CD80, GITRL, LIGHT, CD70), BITE, therapeutic antibodies, immune checkpoint inhibitors, single chain antibodies (e.g. VEGF, e.g. VEGFA, VEGFB, PGF, VEGFR2, PDGFR , Ang-1, Ang-2, ANGPT1, ANGPT2, against HGF), and immune checkpoint inhibitors (e.g., PD-1, PD-L1, CTLA4, TIM-3, prodrug activators (lacZ, cytosine can be engineered for recombinant expression of therapeutic proteins, including deaminase enzymes), human sodium-iodine symporter-hNIS and aquaporin 1-for AQP1). Viruses can be engineered to express one, two or more of the above recombinant proteins under different viral promoters (eg, Pel, pL). The virus may contain combinations of therapeutic proteins for example against regulators of angiogenesis and immune system co-stimulators or checkpoints, such as anti-VEGFA and VEGFB and PGF; anti-VEGF and anti-ANGPT2; anti-VEGF, anti-ANGPT-2 and anti- Can be engineered to express CTL4; anti-VEGF and OX40L; anti-VEGF, anti-ANGPT2 and anti-PD-1.

Engineered Vaccinia Virus In embodiments, the engineered virus is an engineered vaccinia virus. In embodiments, the vaccinia virus is one produced by propagating ACAM2000 and derivatives thereof, such as the virus. In embodiments, the vaccinia virus has a genome comprising the sequence shown in SEQ ID NO: 70 (ACAM2000) or SEQ ID NO: 71 (CAL1). Sequencing analysis of ACAM2000 genomic DNA identified 241 different open reading frames (ORFs) encoding viral structures, enzymes, immunomodulatory proteins, and proteins with unidentified functions. In certain embodiments, selectable markers and/or therapeutic genes can be inserted at non-essential loci well known to those skilled in the art. In some embodiments, insertions are made in the intergenic region between ORF_157 and ORF_158 without changing the original properties of the virus. Other loci such as intergenic regions of OFR_174 and ORF_175 or truncated ORFs (e.g., 72, 73, 156, 157, 157, 159, 160, 174, 175) can also be used without altering the original viral properties. can be employed to insert a transgene. Viruses can be further attenuated by inactivation of genes such as thymidine kinase (TK), hemagglutinin (HA), interferon alpha/beta blocker receptors, and other immunomodulators. In some embodiments, the F1L locus, or a portion thereof, may be replaced with a selectable or detectable marker and/or therapeutic gene of interest, or may be interrupted (i.e., inhibiting endogenous mitochondrial apoptosis). Elimination of F1L function, which is a strong inhibitor). In other embodiments, the anti-interferon gamma gene B8R, or a portion thereof, is replaced with a selectable marker and/or therapeutic gene of interest. Attenuated viruses, in addition to being vehicles for carrying exogenous genes such as therapeutic genes, may be safer for systemic administration.

In some embodiments, vaccinia or ACAM2000 is modified to enhance EEV (extracellular enveloped virus) production. In one embodiment, enhanced EEV production is achieved by replacing glycine with glutamic acid at amino acid 151 of the A34R protein (K151E). Vaccinia virus produces four different types of virus particles from each infected cell called intracellular mature virus (IMV), intracellular enveloped virus (IEV), cell-associated enveloped virus (CEV) and extracellular enveloped virus (EEV) do. EEV is optimized to rapidly and efficiently expand solid tumors locally and to regional or distant tumor sites. The K151E mutation increases EEV shedding while maintaining the infectivity of the released virus.

Provided herein are unmodified ACAM2000 viruses and/or modified ACAM2000 viruses containing one or more other modifications known to those of skill in the art. Introducing any one or more of the therapeutic genes and/or selectable markers described herein and/or known to those skilled in the art to generate engineered ACAM2000 viruses provided herein. be able to. In an embodiment, the unmodified ACAM2000 virus has the sequence shown in SEQ ID NO:70. In other embodiments, the unmodified ACAM2000 virus has the sequence shown in SEQ ID NO:71. Any modified or unmodified ACAM2000 virus can be used to generate the CAVES systems provided herein.

Exemplary Immunomodulators and Therapeutic Proteins The CAVES systems provided herein contain oncolytic viruses for a sufficient period of time to express at least one virus-encoded immunomodulatory protein and/or recombinant therapeutic protein. produced by incubating with suitable carrier cells. Exemplary viral immunomodulators and therapeutic proteins are described and provided below.

Immunomodulators Viruses, including vaccinia virus (VACV), exhibit several host-range immunomodulators that block early antiviral responses in the tumor microenvironment and protect infected cells from neutralization by complement and natural killer (NK) cells. Code matter. These immunomodulators can be intracellular (non-secreted) or extracellular (secreted). For example, infected cells secrete proteins that bind to and disrupt the function of complement, interferons (IFNs), cytokines, and chemokines, and interfere with semaphorin signaling. Secreted (extracellular) immunomodulators can prevent interactions between chemokines on leukocytes and their host receptors and impede migration of leukocytes to areas of infection and inflammation. Extracellular immunomodulators can also counteract the proinflammatory cytokine-induced antiviral state, for example, by disrupting TNF-α-induced apoptosis in virus-infected cells. Intracellular immunomodulators inhibit apoptosis, modulate the antiviral effects of IFN, and interfere with innate immune signaling and host gene transcription. For example, intracellular immunomodulators inhibit signaling pathways that lead to the production of interferons and pro-inflammatory chemokines and cytokines (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134; Smith et al. (2013) Journal of General Virology 94:2367-2392). Because different vaccinia strains encode different immunomodulators, each virus strain interacts differently with host cells. The viruses herein can be genetically engineered to express intracellular and/or extracellular immunomodulatory substances to increase their virulence, or they can be attenuated by deletion of genes encoding immunomodulatory proteins. be able to.

Extracellular poxvirus immunomodulators that can be expressed by the viruses herein include: chemokine inhibitor/binding protein A41; TNF inhibitor/binding protein CrmB, CrmC, CrmD and CrmE; MHC-like TNF-α inhibitor TPXV2; IL-18 binding protein C12; VACV CC chemokine inhibitor (vCCI), which prevents leukocyte recruitment; IFN-γ binding protein (IFN-γBP), which blocks the binding of IFN-γ to its receptor; IL-1β binding protein B15; type I IFN binding protein B18; type II IFN binding protein B8; complement control protein VCP (C21/B27); and semaphorin 7A mimetic A39 (Bahar et al. (2011) J. Struct. Biol. 175 (2) -2): 127-134; Sumner et al. (2016) Vaccine 34: 4827-4834; Nichols et al. (2017) Viruses 9, 215; Albarnaz et al. (2018) Viruses 10, 101).

Intracellular poxvirus immunomodulators that can be expressed by the viruses herein include hemagglutinin (HA, A56); thymidine kinase (TK); B5 (promotes viral dissemination); N1 (apoptotic Bcl- 2-like inhibitors and inhibitors of NF-κB/IRF3 activation); B14 and A52 (Bcl-2-like inhibitors of NF-κB); K7 (Bcl-2-like inhibitors of NF-κB and IFN-β) ; F1 and M11 (Bcl-2-like anti-apoptotic drugs); E3 (inhibitor of PKR activation, dsRNA binding protein); K3 (inhibits PKR-mediated phosphorylation of eIF2α); C4 (inhibits NF-κB activation); C6 (IRF3/7 and JAK/STAT inhibitor); VH1 (dephosphorylates STAT1 and blocks IFN-induced gene expression); A35 (inhibitor of MHC class II antigen presentation); Inhibits B13 (SPI-2/CrmA) and B22 (SPI-1); N2 (IRF3 inhibitor); D9 and D10 (decapping enzymes); C16 (inhibitor of DNA sensing and promoter of hypoxic response); A49, K1 and M2 (inhibitors of NF-κB activation); protein 169 (translation inhibitor); vGAAP (inhibitor of apoptosis); A44 (3β-hydroxysteroid dehydrogenase); and A46 (TLR signaling, NF-κB , IRF3 and MAPK inhibitors) (Bahar et al. (2011) J. Struct. Biol. 175(2-2):127-134; Sumner et al. (2016) Vaccine 34:4827-4834; Nichols et al. (2017) Viruses 9, 215; Albarnaz et al. (2018) Viruses 10, 101).

VCP (C3L)
Vaccinia virus complement control protein (VCP; encoded by C3L, C21L) is the major protein secreted by cells infected with vaccinia virus and interacts with heparan sulfate proteoglycans (HSPGs) on the surface of uninfected cells. do. VCP can also be expressed on the surface of VACV-infected cells independently of HSPGs. Surface expression of VCP is dependent on interaction with another viral protein, A56 (also known as hemagglutinin), present on the surface of vaccinia virus-infected cells and extracellular enveloped virus (EEV) particles. VCP complements classical and alternative complements by accelerating the decay of C3 and C5 convertases, which is irreversible, and by acting as a cofactor for factor I-mediated cleavage and inactivation of C3b and C4b. (Girgis et al. (2008) J. Virol. 82(8):4205-4214; Smith et al. (2013) Journal of General Virology 94:2367-2392). A deletion mutant lacking the C21L gene encoding VCP was attenuated in rabbits and was associated with increased infiltration of CD4+ and CD8+ T cells, decreased viral titers, and increased antibodies against VACV (Albarnaz et al. (2018) Viruses 10, 101).

Studies have shown that engineering VCP to contain a transmembrane domain expressed on the cell surface can protect cells from complement-mediated lysis, with a three-fold increase in lysis in the presence of VCP. (Rosengard et al. (1999) Mol. Immunol. 36(10):685-697). By protecting vaccinia-infected cells from lysis, surface-bound VCP prolongs virus production, resulting in increased virus titer. Reduced complement activation on the cell surface also reduces the production of pro-inflammatory peptides such as C3a and C5a, which reduce local inflammation and immune system activation (Girgis et al. (2008) J. Virol. 82(8). ):4205-4214).

B5
B5 (encoded by B5R), a member of the complement protein family, is a type I integral membrane glycoprotein present on the outer envelope of extracellular enveloped viruses (EEVs), and is required for EEV formation and is essential for virus formation. (Smith et al. (2013) Journal of General Virology 94:2367-2392).

Thymidine kinase (TK)
VACV thymidine kinase (TK), encoded by the early VACV J2R gene, is a virulence factor that when deleted from the viral genome results in an attenuated vaccinia virus strain (Yakubitskiy et al. (2015) Acta Naturae 7(4):113-121). It is.

HA (A56)
Natural killer (NK) cells, which play a key role in immune defense against orthopox family members such as vaccinia virus (VACV or VV), are regulated through inhibitory and activatory signaling receptors. Activating signaling receptors include NKG2D and natural cytotoxic receptors (NCRs) such as NKp46, NKp44 and NKp30. NCR is an important activating receptor for antiviral and antitumor activity of NK cells (Jarahian et al. (2011) PLoS Pathogens 7(8): e1002195).

Hemagglutinin (HA), also known as A56 (encoded by A56R), is a protein that mediates virus attachment to host cells, inhibits infected cell fusion, and promotes proteolytic activation of infectivity. Yes (Yakubitskiy et al. (2015) Acta Naturae 7(4): 113-121). HA, expressed as a late product on the surface of VACV-infected cells, is a viral ligand for the activating receptors NKp30 and NKp46. HA/A56 has been shown to block activation triggered by NKp30, resulting in reduced susceptibility of infected cells to NK lysis at late time points of VACV expression, when HA expression is prominent. Therefore, HA is a conserved ligand of NCR, leading to immune evasion through its blocking effect on NKp30-mediated activation at late stages of infection (Jarahian et al. (2011) PLoS Pathogens 7(8): e1002195) .

Deletion of A56R from the VACV genome reduced the _LD50 in mice by 40-fold compared to the parental strain. Therefore, inactivation of the HA gene in VACV results in significant attenuation (Yakubitskiy et al. (2015) Acta Naturae 7(4): 113-121).

B18
The VACV protein B18 (encoded by B18R) binds type I interferon, exhibits activity as a "decoy IFN receptor" in solution, and when associated with the cell surface via glycosaminoglycans (GAGs). It is a soluble extracellular immunomodulatory protein that captures type I IFN, particularly IFN-α, produced by uninfected cells. If B18 binds to the cell surface and prevents the induction of an IFN-mediated antiviral state in uninfected cells, cells remain susceptible to viral infection and replication (Smith et al. (2013) Journal of General Virology 94:2367 -2392; Albarnaz et al. (2018) Viruses 10, 101).

B8
B8 (encoded by B8R) is a soluble VACV decoy type II IFN receptor that binds IFN-γ extracellularly. Deletion of B8, a homologue of the extracellular domain of the IFN-γ receptor, resulted in attenuation of VACV compared to wild-type VACV in mouse infection studies (Yakubitskiy et al. (2015) Acta Naturae 7(4) :113-121). Unlike cellular IFN-γR, B8 can dimerize in the absence of IFN-γ (Smith et al. (2013) Journal of General Virology 94:2367-2392).

B15
VACV protein B15 (encoded by B15R) is a soluble IL-1R secreted by infected cells that binds IL-1β with high affinity and prevents it from binding to its natural receptor. Studies have shown that viruses lacking the B15R gene exhibit reduced virulence (Smith et al. (2013) Journal of General Virology 94:2367-2392).

A39/A39R
A39/A39R is a secreted immunomodulatory glycoprotein that is similar in amino acid sequence to carbohydrate phosphatidylinositol-linked cell surface semaphorins. A39R is expressed late in infection and has been shown to have proinflammatory properties and influence the outcome of infection in a murine intradermal model (Gardner et al. (2001) J. Gen. Virol. 82:2083 -2093).

CrmA/B13/SPI-2
Cytokine response regulator A (CrmA) (also known as B13/B13R or serine proteinase inhibitor 2 (SPI-2)) is an orthopoxvirus protein that is expressed early in the viral infection process and remains inside the host cell. be. CrmA binds to caspase-1 and blocks IL-1β cleavage to IL-1β, a proinflammatory cytokine important in controlling poxvirus infections. CrmA/B13 also inhibits apoptosis by inhibiting the activation of multiple caspases (eg, caspase 1, caspase 8). B13 further inhibits the formation of mature IL-18 (Smith et al. (2013) Journal of General Virology 94:2367-2392; Nichols et al. (2017) Viruses 9, 215).

SPI-1/B22R
Vaccinia virus SPI-1 (also known as B22 or B22R) is an intracellular immunomodulatory protein similar to SPI-2/CrmA that inhibits caspase activity. Studies showed that mutant VACV lacking the SPI-1/B22R gene showed lower viral replication in A549 cells. Infected cells are susceptible to TNF-induced apoptosis, indicating that SPI-1 plays an important role in virulence (Nichols et al. (2017) Viruses 9, 215).

Viral TNF receptor (vTNFR)
The viral TNF receptor (vTNFR) is a soluble, secreted decoy receptor that binds TNFα and prevents its binding to its natural receptor, reducing its antiviral effect. vTNFRs, including cytokine response regulator B (CrmB), CrmC, CrmD and CrmE (A53), mimic the extracellular domains of the cellular TNF receptors TNFR1 and TNFR2 and differ in their ligand affinities and expression in orthopoxviruses . Studies have shown that vTNFR enhances the virulence of recombinant VACV. For example, a USSR mutant strain of VACV strain lacking CrmE was attenuated, whereas a recombinant strain of VACV WR expressing CrmE showed increased virulence (Nichols et al. (2017) Viruses 9, 215; Smith et al. 2013) Journal of General Virology 94:2367-2392; Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134).

C12
C12 (encoded by C12L) is a soluble orthopoxvirus protein that binds IL-18 in solution and prevents its interaction with its natural receptor IL-18R. C12 increases VACV virulence by inhibiting IL-12-induced production of IFN-γ, which inhibits NK cells and VACV-specific CD8 ⁺ T cell responses (Smith et al. (2013) Journal of General Virology 94:2367-2392). Deletion of the C12L gene results in attenuated virus, increased levels of IL-18 and IFN-γ, and has been shown to enhance NK cell cytotoxicity and CTL responses after intranasal infection in mice. (Albarnaz et al. (2018) Viruses 10, 101).

VACV CC chemokine inhibitor (vCCI)
Chemokines are small chemoattractant cytokines that recruit leukocytes to sites of infection and inflammation. Chemokines bind to GAGs on the surface of adjacent endothelial cells, creating a concentration gradient that recruits circulating leukocytes by binding to their chemokine receptors. VACV CC chemokine inhibitor (vCCI), also known as VACV chemokine binding protein (vCKBP), secreted by virus-infected cells during the early stages of infection, binds to CC chemokines and inhibits their binding to their receptors. prevent. This prevents the recruitment of leukocytes to the site of infection and reduces inflammation (Smith et al. (2013) Journal of General Virology 94:2367-2392).

A41
Most viral CC chemokine inhibitors bind to chemokines at their receptor binding sites, preventing interaction with them and recruitment of leukocytes to sites of inflammation, but A41 (encoded by A41L) They are extracellular VACV immunomodulatory proteins that bind chemokines at their GAG-binding sites rather than at their GAG-binding sites (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134). A41 is also secreted by infected cells during the early stages of infection, but binds chemokines with lower affinity than vCCI and does not prevent chemokines from binding to their respective chemokine receptors. Instead, A41 disrupts endothelial cell surface chemokine concentration gradients that are important for leukocyte recruitment (Smith et al. (2013) Journal of General Virology 94:2367-2392; Albarnaz et al. (2018) Viruses 10, 101).

VH1
VACV VH1 inhibits the transcription factors STAT1 (signal transducer and activator of transcription 1) and STAT2 by dephosphorylation, inhibits signal transduction from all IFN receptors, and prevents the expression of antiviral genes. It is an immunomodulatory protein (phosphatase) (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134; Smith et al. (2013) Journal of General Virology 94: 2367-2392).

K3
K3 is a VACV intracellular immunomodulatory protein that inhibits PKR-mediated phosphorylation of eIF2α. In virus-infected cells, STAT1 induces the expression of dsRNA-dependent protein kinase (PKR), which detects dsRNA produced during VACV transcription and phosphorylates the host protein translation factor eIF2α (eukaryotic translation initiation factor 2 alpha). Oxidizes and inhibits synthesis of host and viral proteins in infected cells, leading to apoptosis. K3 is a viral mimic of the N-terminal 88 amino acids of eIF2α that binds to PKR by acting as a nonphosphorylatable pseudosubstrate and inhibits PKR-induced apoptosis by inhibiting the phosphorylation of eIF2α by PKR. (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134; Smith et al. (2013) Journal of General Virology 94: 2367-2392).

N1
B-cell lymphoma 2 (Bcl-2) protein can be pro-apoptotic or anti-apoptotic and regulates the release of pro-apoptotic molecules from mitochondria. Several viruses, including herpesviruses, adenoviruses and VACV, express anti-apoptotic Bcl-2 and Bcl-2-like proteins to avoid host cell death. For example, N1 (encoded by N1L) is a VACV virulence factor that functions as an intracellular immunomodulator and is structurally similar to the anti-apoptotic Bcl-2 protein. N1 binds to the BH3 motif of proapoptotic proteins and inhibits apoptosis in VACV-infected cells. N1 has been shown to interact with host pro-apoptotic Bcl-2 proteins such as Bid, Bad, Bak and Bax, and binds to the IκB kinase (IKK) complex and TANK-binding kinase 1 (TBK1); It has been shown to inhibit innate immune signaling pathways by inhibiting nuclear factor (NF)-κB and IRF3 activation (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134).

F1
F1 (encoded by F1L) is a poxvirus Bcl-2-like family protein and a VACV intracellular immunomodulator that inhibits apoptosis of virus-infected cells. F1 binds to the BH3 motif of pro-apoptotic Bcl-2 proteins and, unlike N1 found in the cytosol, localizes to the mitochondrial membrane where host pro-apoptotic proteins such as Bak and Bax initiate apoptosis at the mitochondrial membrane. Interacts with Bcl-2 protein (Bahar et al. (2011) J. Struct. Biol. 175(2-2): 127-134). F1 also reduces inflammatory responses by binding to NLRP-1, an upstream activator of caspase-1 (Smith et al. (2013) Journal of General Virology 94:2367-2392), and by binding to caspase-9. (Albarnaz et al. (2018) Viruses 10, 101).

Bcl-2-like proteins that inhibit the NF-κB pathway Nuclear factor (NF)-κB is a transcription factor complex that stimulates innate and adaptive immune responses to infection. Receptors for pro-inflammatory cytokines such as TNFα and IL-1, as well as Toll-like receptors (TLRs) that recognize pathogen-associated molecular patterns (PAMPs) activate signaling pathways that lead to NF-κB activation. VACV encodes several Bcl-2-like proteins including N1, A52, B14 and K7 that inhibit the NF-κB signaling pathway. N1 inhibits apoptosis, but A52, B14 and K7, which lack the BH3 binding groove, do not. B14 acts at the IKK complex by inhibiting NF-κB activation, binding to IKKβ, and preventing its phosphorylation and the phosphorylation of IκBα. A52 and K7 inhibit signaling upstream of B14 by inhibiting TLR-induced signaling (through binding to TRAF6 and IRAK2) and TLR- and IL-1β-mediated NF-κB activation. K7 (encoded by K7L) also forms a complex with human DEAD box RNA helicase 3 (DDX3) to antagonize IFN-β promoter induction and inhibit proinflammatory cytokine production Bahar et al. (2011) J ．． Struct. Biol. 175(2-2):127-134; Smith et al. (2013) Journal of General Virology 94:2367-2392; Albarnaz et al. (2018) Viruses 10, 101).

A46
A46 (encoded by A46R) is an intracellular VACV immunomodulatory protein that binds Toll/IL-1R (TIR) domain-containing adapter molecules (e.g., MyD88, MAL, TRIF, and TRAM) that associate with the cytoplasmic tail of TLRs. be. This, in turn, inhibits the activation of MAP kinases, NF-κB and IRF3, and inhibits the induction of IFN-β (Smith et al. (2013) Journal of General Virology 94:2367-2392). The VACV WR A46R deletion mutant strain was found to be attenuated compared to the control virus (Albarnaz et al. (2018) Viruses 10, 101).

Other proteins that inhibit NF-κB activation
A49 is an intracellular VACV protein that stabilizes phosphorylated IκBα (inhibitor of κB) by preventing its recognition and degradation, so that IκBα remains bound to NF-κB in the cytoplasm. Intracellular VACV protein C4 inhibits NF-κB activation at or downstream of the IKK complex, but the mechanism remains unclear. VACV protein E3 (encoded by E3L) inhibits NF-κB activation by PKR-dependent and -independent mechanisms and by antagonizing the RNA polymerase III-dsDNA sensing pathway. E3 binds to cellular pattern recognition receptors (PRRs) and captures dsRNA, preventing cells from identifying viral dsRNA. In addition to E3, VACV uncapping enzymes D9 and D10 prevent dsRNA accumulation by uncapping viral mRNA and prevent activation of PKR and dsRNA-induced antiviral pathways. VACV protein K1 inhibits NFκB activation by preventing the degradation of IκBα. Protein M2 reduces phorbol myristate acetate-induced phosphorylation of extracellular signal-regulated kinase 2 (ERK2) and prevents p65 nuclear translocation (Smith et al. (2013) Journal of General Virology 94:2367-2392; Nichols et al. (2017) Viruses 9, 215; Albarnaz et al. (2018) Viruses 10, 101).

C6
C6 (encoded by C6L) enhances virulence and inhibits activation of IRK3 and IRF7 by binding to the upstream kinases TANK-binding kinase 1 (TBK1) and adapter proteins required to activate IKKε It is an intracellular immunoregulatory protein. This results in inhibition of type I IFN production. C6 also inhibits activation of the JAK/STAT signaling pathway after type I IFN binds to their receptors and prevents transcription of interferon-stimulated genes (ISGs). Deletion of C6L has been shown to enhance CD8 ⁺ and CD4 ⁺ T cell responses (Albarnaz et al. (2018) Viruses 10, 101).

C16
C16, an intracellular immunoregulatory protein, inhibits DNA sensing leading to IRF3-dependent innate immunity by binding to proteins Ku70 and Ku80, subunits of the DNA-PK complex (DNA sensor). C16 also binds to the oxygen sensor prolyl hydroxylase domain-containing protein 2 (PHD2) and prevents hydroxylation of hypoxia-inducible transcription factor (HIF)-1α. This prevents HIF-1α ubiquitination and degradation, and the stabilized HIF-1α induces transcription of genes that lead to hypoxic responses. Deletion of C16 has been shown to result in faster pulmonary recruitment and activation of CD8+ and CD4+ T cells (Albarnaz et al. (2018) Viruses 10, 101).

N2
Protein N2 is an intracellular immunomodulatory protein with Bcl-2 that inhibits IRF3 activation by an unknown mechanism. Deletion of N2 from VACV strain WR resulted in decreased virulence and increased pneumocyte infiltration (Albarnaz et al. (2018) Viruses 10, 101).

protein 169
Protein 169 is an intracellular immunomodulatory protein that suppresses immune responses by inhibiting the initiation of cap-dependent and cap-independent translation (Albarnaz et al. (2018) Viruses 10, 101).

protein A35
Protein A35, encoded by A35R, is an intracellular immunomodulatory protein that limits antigen presentation to T cells via MHC class II molecules. The A35R deletion mutant was attenuated, resulting in lower VACV-specific antibodies, decreased IFN-γ secretion and decreased lysis by splenocytes (Albarnaz et al. (2018) Viruses 10, 101).

protein A44
Protein A44 is 3β-hydroxysteroid dehydrogenase (3β-HSD), an intracellular immunomodulator that promotes virulence. The VACV strain WR mutant, which lacks protein A44, resulted in enhanced inflammatory responses, increased IFN-γ levels, rapid recruitment of CD8+ and CD4+ T cells, and stronger cytolytic T cell responses against VACV-infected cells ( Albarnaz et al. (2018) Viruses 10, 101).

vGAAP
Viral Golgi anti-apoptotic protein (vGAAP) is a hydrophobic protein that primarily localizes to the Golgi and inhibits apoptosis. VACV vGAAP inhibits both the intrinsic and extrinsic apoptotic pathways induced by staurosporine, TNFα/cycloheximide (CHX), Fas antibody, doxorubicin, cisplatin and C2 ceramide, as well as apoptosis induced by overexpression of Bax. inhibit. vGAAP forms an ion channel that leads to the leakage of Ca ²⁺ and reduces its concentration in the Golgi apparatus, influencing the apoptotic pathway mediated by Ca ²⁺ release (Nichols et al. (2017) Viruses 9, 215).

Therapeutic Proteins The oncolytic viruses used to produce the CAVES provided herein can also be engineered to express recombinant therapeutic proteins. Exemplary therapeutic proteins are described below, and these proteins can also be administered separately as combination therapy with the CAVES system provided herein.

Immune Checkpoints Immune checkpoints are involved in the regulation of the immune system and prevention of autoimmunity and include stimulatory and inhibitory pathways. Viral infections stimulate immune and inflammatory pathways and responses, but tumors have evolved to evade the immune system, for example by activating inhibitory immune checkpoint pathways and inhibiting anti-tumor immune responses. There is. Modification of the viruses herein by adding genes encoding molecules that induce desirable immunostimulatory anti-tumor responses or inhibit immune checkpoint pathways that promote tumor immune evasion may improve the viral anti-tumor response. Activity can be improved. This can be achieved by agonism of costimulatory pathways, antagonism of coinhibitory pathways, or both. For example, the viruses herein are engineered to express costimulatory molecules, or agonists of costimulatory molecules, or inhibitors of immune checkpoint pathways that tumors use for immune evasion, to improve anti-tumor immune responses. Can be modified.

Immune Checkpoint Inhibitors Immune checkpoint inhibitors are immunosuppressive antagonists that are important in maintaining self-tolerance but can be overexpressed by tumors as a means of evading detection by the immune system (Meyers et al. (2017) ) Front. Oncol. 7:114). Programmed cell death protein 1 (PD-1; also known as CD279) and its cognate ligand programmed death ligand 1 (PD-L1; also known as B7-H1 and CD274) downregulate immune responses. These are two examples of the many inhibitory "immune checkpoints" that function by regulating the immune system. For example, upregulation of PD-1 on T cells and its binding to PD-L1, which is expressed on both antigen-presenting cells (APCs) and tumor cells, interferes with the CD8 ⁺ T cell signaling pathway and increases CD8 ⁺ Impairs T cell proliferation and effector function and induces T cell tolerance. Anti-PD-1 antibodies (e.g., pembrolizumab, nivolumab, pidilizumab) and anti-PD-L1 antibodies (e.g., atezolizumab, BMS-936559, avelumab (MSB0010718C) and durvalumab) are used herein to enhance anti-tumor effects. can be expressed by many viruses.

Another inhibitory immune checkpoint is cytotoxic T-lymphocyte-associated protein 4 (CTLA-4; also known as CD152), which is expressed on T cells and is associated with receptors on APCs such as CD80 or CD86. It binds to and inhibits stimulatory receptors, outcompeting costimulatory cluster differentiation 28 (CD28), which binds to the same receptor but with lower affinity. This blocks stimulatory signals from CD28, but inhibitory signals from CTLA-4 are transmitted and prevent T cell activation (Phan et al. (2003) Proc. Natl. Acad. Sci. U.S.A. 100 :8372-8377). Inhibition of CTLA-4 enhances the immune response mediated by CD4 ⁺ T helper cells and results in inhibition of the immunosuppressive effects of Tregs (Pardoll, D.M. (2012) Nat. Rev. Cancer 12(4) :252-264). Anti-CTLA-4 antibodies such as ipilimumab and tremelimumab can be encoded by the viruses herein to enhance anti-tumor effects.

Lymphocyte activation gene 3 (LAG3; also known as CD223) is another T cell-associated inhibitory molecule expressed by T cells and NK cells after MHC class II ligation and has a negative effect on T cell function. It has a regulating effect. Monoclonal antibodies against LAG-3 can be used to inhibit LAG-3. Additionally, LAG-3-Ig fusion protein (IMP321, Immuntep®), a soluble form of LAG-3, upregulates costimulatory molecules, increases IL-12 production, and enhances tumor immune responses. , has been shown to increase tumor-reactive T cells in clinical trials (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

T-cell immunoglobulin and mucin domain-containing 3 (TIM-3, also known as hepatitis A virus cell receptor 2 (HAVCR2), TIM-3) is expressed on NK cells and macrophages and is responsible for the proliferation of myeloid-derived suppressor cells (MDSCs). It is a direct negative regulator of T cells that promotes immunosuppression by inducing . Monoclonal antibodies against TIM-3, such as MBG453, can increase T cell proliferation and cytokine production (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39.

V-domain Ig suppressor of T cell activation (VISTA), also known as programmed death-1 homolog (PD-1H), suppresses T cell activation and proliferation and cytokine production. Studies have shown that blocking VISTA increases TIL activation and enhances tumor-specific T cell responses. Monoclonal antibodies against VISTA (eg, JNJ-61610588) and inhibitors (eg, oral inhibitor CA-170) are being investigated in clinical trials (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

B7-H3 (also known as CD276) is expressed on APCs, NK, B cells and T cells and inhibits T cell activation and proliferation and cytokine production. B7-H3 is overexpressed in several types of cancer including melanoma, NSCLC, prostate, pancreatic, ovarian and colorectal cancer. Enobrituzumab (MGA271), a humanized monoclonal antibody against B7-H3, and 8H9, a radioiodine-labeled anti-B7-H3 antibody, showed antitumor activity (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11 :39).

B and T lymphocyte attenuator (BTLA, or CD272), when bound by its ligand, herpesvirus entry mediator (HVEM), blocks B and T cell activation, proliferation, and cytokine production is an inhibitory receptor expressed by the majority of lymphocytes (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Killer cell immunoglobulin-like receptor (KIR, also known as CD158) is expressed by NK and T cells and reduces lymphocyte activation, cytotoxic activity and cytokine release. Antibodies against KIR include rililumab and IPH4102 (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Indoleamine 2,3-dioxygenase (IDO) is a tryptophan-degrading enzyme that is involved in immunosuppression and is overexpressed in several tumor types including melanoma, chronic lymphocytic leukemia, ovarian cancer, CMC, and sarcoma. . IDO inhibitors can be used in immune checkpoint therapy and include BMS-986205, indoximod and epacadostat (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Furthermore, the adenosine receptor A2aR has been shown to inhibit T cell responses and its deletion enhances the inflammatory response to infection. A2aR can be inhibited by antibodies that block adenosine binding or by adenosine analogs (Pardoll, DM (2012) Nat. Rev. Cancer 12(4):252-264).

Other inhibitory immune checkpoint molecules that can be targeted for viral cancer immunotherapy herein include, but are not limited to, signal regulatory protein alpha (SIRPα), programmed death ligand 2 (PD -L2), indoleamine 2,3-dioxygenase (IDO) 1 and 2, galectin-9, T cell immune receptor with Ig and ITIM domains (TIGIT), herpesvirus entry mediator (HVEM), CTNNB1 (β- catenin), TIM1, TIM4, CD39, CD73, B7-H4 (also called VTCN1), B7-H6, CD47, CD48, CD80 (B7-1), CD86 (B7-2), CD112, CD155, CD160, CD200, These include CD244 (2B4), as well as carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1, or CD66a).

Although immune checkpoint inhibitors have demonstrated successful anticancer therapy in responding patients, many patients do not respond, likely due to the lack of active tumor-specific T cells in the TME. Oncolytic virus therapy has been combined with immune checkpoint inhibitors because it induces anti-tumor adaptive immunity. For example, the combination of T-VEC and CTLA-4 inhibition has been shown to result in the treatment of melanoma (Meyers et al. (2017) Front. Oncol. 7:114).

The viruses described herein and the vaccinia viruses provided herein can be engineered to express inhibitors of immune checkpoints. Such inhibitory targets include, but are not limited to, CTLA-4, PD-1, PD-L1, TIM-3 and LAG-3. Immune checkpoint inhibitors include, for example, anti-PD-1 antibodies (e.g., pembrolizumab, nivolumab), anti-PD-L1 antibodies (e.g., atezolizumab, avelumab, and durvalumab), anti-CTLA-4 antibodies (e.g., ipilimumab), Antibodies include TIM-3 antibodies (eg, MBG453), and anti-LAG-3 antibodies (eg, leratlimab/BMS-986016).

Co-stimulatory molecules Inhibitory pathways attenuate the immune system, whereas co-stimulatory molecules enhance the immune response against tumor cells. Therefore, costimulatory pathways are inhibited by tumor cells and promote tumorigenesis. The viruses described and provided herein contain costimulatory molecules such as CD27, CD70, CD28, CD30, CD40, CD40L (CD154), CD122, CD137 (4-1BB), 4-1BBL, OX40 (CD134). , OX40L (CD252), CD226, glucocorticoid-induced TNFR family-related genes (GITR), herpes-virus entry mediator (HVEM), LIGHT (also known as TNFSF14), B7-H2, and inducible T cell co-stimulation can be engineered to express the factor ICOS (also known as CD278). For example, it has been shown that expression of 4-1BBL in mouse tumors enhances immunogenicity and intratumoral injection of dendritic cells (DCs) with increased expression of OX40L can result in tumor rejection in mouse models. There is. The study also showed that injection of adenovirus expressing recombinant GITR into B16 melanoma cells promoted T cell infiltration and reduced tumor volume.

Stimulatory antibodies against molecules such as 4-1BB, OX40 and GITR can also be encoded by viruses to stimulate the immune system. For example, agonistic anti-4-1BB monoclonal antibodies have been shown to enhance anti-tumor CTL responses, and agonistic anti-OX40 antibodies have been shown to increase anti-tumor activity in transplantable tumor models. There is. Additionally, agonistic anti-GITR antibodies have been shown to enhance anti-tumor responses and immunity (Peggs et al. (2009) Clinical and Experimental Immunology 157:9-19).

OX40 (CD134) is a member of the TNF receptor superfamily and, together with its ligand (OX40L), leads to T cell activation, enhancement, proliferation and survival, and regulation of NK cell function. Agonistic monoclonal antibodies can be used to activate OX40 and increase anti-tumor activity by the immune system. These include, for example, MOXR0916, PF-04518600 (PF-8600), MEDI6383, MEDI0562, MEDI6469, INCAGN01949 and CSK3174998 (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Glucocorticoid-induced TNFR family-related protein (GITR) is a costimulatory cell surface receptor expressed by T cells and NK cells, and whose expression increases after T cell activation. Its ligand, GITRL, is expressed by APCs and endothelial cells and plays a role in immune system upregulation, leukocyte adhesion and migration. Agonistic GITR antibodies include TRX-518, BMS-986156, AMG228, MEDI1873, MK-4166, INCAGN01876 and GWN323 (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Inducible T cell costimulatory factor (ICOS; also known as CD278) is primarily expressed by CD4 ⁺ T cells and is a costimulator of proliferation and cytokine production. Agonist antibodies for ICOS include JTX-2011, GSK3359609, and MEDI-570 (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

4-1BB (CD137) is an inducible costimulatory receptor expressed by T cells, NK cells, and APCs that binds to its ligand 4-1BBL, causing immune cell proliferation and activation. Anti-4-1BB agonists have been shown to increase immune-mediated antitumor activity and include utomilumumab (PF-05082566) and urelumumab (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

CD27 is a member of the TNF receptor family that, after binding to its ligand CD70, leads to activation and differentiation of T cells into effector and memory cells and a boost of B cells. Agonist CD-70 antibodies include ARGX-110 and BMS-936561 (MDX-1203), and agonist CD27 antibodies include valilumab (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

CD40 is another member of the TNF receptor family. CD40 is expressed by APCs and B cells, and its ligand CD154 (CD40L) is expressed by activated T cells. The interaction between CD40 and CD154 stimulates B cells to produce cytokines, leading to T cell activation and tumor cell death. Monoclonal antibodies against CD40 include CP-870893 (agonist), APX005M (agonist), ADC-1013 (agonist), lucatumumab (antagonist), Chi Lob 7/4 (agonist), dacetuzumab (partial agonist), SEA-CD40 ( agonist) and RO7009789 (agonist) (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

Other Expression Products In addition to immunomodulatory proteins, immune checkpoint inhibitors and co-stimulatory molecules (and their agonists), the viruses herein may also contain other molecules to enhance their anti-tumor effects, such as prostaglandin E2/COX-2 inhibitors, nutrient-depleting enzymes (e.g., arginase, arginine desiminase, asparaginase), cytokines (e.g., GM-CSF, IL-2, IL-7, IL-10, IL-12, IL-15, IL-18, IL-21, IFN-γ, IFN-α, IFN-β, TNF-α, TGF-β), chemokines (e.g., CCL2, CCL5, CCL19, CXCL11, RANTES), BiTE ( For example, blinatumomab (MT-103), solitomab (MT110), MT-111, BAY2010112 (AMG112), katumaxomab), tumor neoantigens and tumor-associated antigens (e.g., alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, cancer testis antigen (CTA), New York esophageal squamous cell carcinoma-1 (NY-ESO-1), E6/E7, SV40, MART-1, PRAME, CT83, SSX2, BAGE family, CAGE family, epithelial tumor antigen (ETA), prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), melanoma-associated antigen (MAGE), tyrosinase, CD19, GP100, telomerase, cyclin B1, survivin, mesothelin, EPHA2, HER2), angiogenesis inhibitors, such as bevacizumab, gefitinib, thalidomide (Immunoprin), lenalidomide, sorafenib (Nexavar®), sunitinib, axitinib (Inlyta®), for tumor vascular reprogramming )), temsirolimus (Torisel®), pazopanib, cabozantinib, everolimus, ramucirumab (Cyramza®), regorafenib, vandetanib, tanibirumab, olaratuzumab (Lartruvo®), nesvacumab, AMG780, MEDI3617, vanicizumab, rilotumumab (AMG102), ficlatuzumab, TAK-701, onartuzumab (MetMab), emibetuzumab, aflibercept, imatinib), and other therapeutic antibodies (e.g., alemtuzumab (Campath®), trastuzumab (Herceptin®) ), cetuximab (Erbitux®), panitumumab (Vectibix®), ofatumumab (Arzerra®), rituximab (Rituxan®/MabThera®), gemtuzumab ozoga Mycin (Mylotarg®), brentuximab vedotin (Adcetris®), tositumomab, daratumumab (Darzalex®), dinutuximab (Unituxin®), elotuzumab (Empliciti®), It can be engineered to express necitumumab (Portrazza(TM)), obinutuzumab (Gazyva(R)) and pertuzumab (Perjeta(R)), and the like. Viruses can be engineered to express reporter genes and imaging molecules, such as, but not limited to, fluorescent proteins, photoproteins, NIS, and aquaporin 1.

Prostaglandin E2 Blockade Cyclooxygenase (COX- ₂ )-mediated production of prostaglandin E2 (PGE2) has been shown to result in MDSC tumor invasion, maintenance of an immunosuppressive phenotype, and inhibition of CTL activity. . Blocking the COX-2/PGE ₂ pathway has been shown to enhance tumor immune responses. For example, an oncolytic vaccinia virus expressing the prostaglandin-inactivating enzyme hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD) resulted in a reduction in the number of MDSCs in tumors in a non-toxic manner. Expression of HPGD was found to enhance T cell attraction and sensitize resistant tumors to various immunotherapies, including anti-PD-1 antibodies. Another study showed that the use of aspirin to block COX-2 activity sensitized tumors to anti-PD-1 therapy. PGE2-depleting antibodies, such as celecoxib (Celebrex®), and agonists of the PGE2 receptors EP2 and EP4, can also be used for PGE2 inhibition/blockade to enhance cancer immunotherapy (Hou et al. (2016) ) Cancer Cell 30:108-119; Miao et al. (2017) Oncotarget 8(52):89802-89810).

Nutrient-depleting enzymes Cancer is characterized by uncontrolled growth, and tumor cells have specific auxotrophic requirements, which are higher than normal cells, resulting in the use of nutrient-depleting enzymes in anticancer therapy. Can be done. For example, tumor cells can be depleted of asparagine, arginine and glutamine, resulting in caspase-dependent apoptosis or autophagic cell death.

Asparaginase Asparagine is involved in cellular respiration and protein synthesis, and also acts as a neurotransmitter in neuroendocrine tissues. Studies have also shown that asparagine can inhibit apoptosis in cancer cells. Asparaginase is an enzyme that converts asparagine to aspartic acid. Depletion of L-asparagine by L-asparaginase can induce apoptosis and may be useful in the treatment of several cancers. For example, asparaginase is used in the treatment of childhood acute lymphoblastic leukemia (ALL) to deplete extracellular asparagine, which ALL cells cannot synthesize. Therapeutic asparaginase can be derived from E. coli or Erwinia chrysanthemi and also exists as a PEGylated formulation. However, bacterially derived asparaginase often results in adverse immune reactions due to the production of anti-asparaginase antibodies, which can range from localized rashes to life-threatening anaphylaxis. These adverse reactions significantly hinder treatment in adults. PEGylated asparaginase has a longer serum half-life, allows less frequent doses to be administered, and produces fewer adverse reactions than bacterial asparaginase preparations (Fung and Chan (2017) Journal of Hematology & Oncology 10: 144; Koprivnikar et al. (2017) OncoTargets and Therapy 10:1412-1422).

L-asparaginase can be loaded onto red blood cells (RBCs) for therapy, and this formulation is being tested in several early-stage clinical trials. The enzyme remains encapsulated in RBCs, preventing antibody binding and slowing clearance from the body, reducing the risk of adverse reactions. Studies have shown that patients receiving RBC-encapsulated asparaginase have fewer allergic reactions than those injected with E. coli asparaginase (Koprivnikar et al. (2017) OncoTargets and Therapy 10:1412-1422).

Bacterial L-asparaginase has also been shown to degrade L-glutamine to L-glutamate, resulting in glutamine depletion. Cancer cells have a high demand for glutamine, which can be used to synthesize nucleotides and glutathione, synthesize other amino acids, or generate ATP for energy. Glutamine depletion leads to MYC-mediated apoptosis in cancer cells (Fung and Chan (2017) Journal of Hematology & Oncology 10:144).

Arginine Depletion Arginine is a precursor of cancer-related factors such as nitric oxide (NO), which can be tumorigenic at nanomolar concentrations. Arginine depleting agents include PEGylated arginine deiminase (ADI) and PEGylated arginase I. ADI converts arginine to citrulline. It is not produced by human cells, but is derived from microorganisms, making it a foreign protein that can produce harmful immune responses. PEGylation to produce ADI-PEG20, for example, has been shown to reduce immunogenicity and increase half-life. ADI-PEG20 was found to effectively suppress tumor growth and induce apoptosis and autophagy in various cancer types in preclinical studies. Furthermore, clinical studies using ADI-PEG20 for the treatment of melanoma, hepatocellular carcinoma, and mesothelioma have shown that it is well tolerated in patients (Fung and Chan (2017) Journal of Hematology & Oncology 10:144).

PEGylated human arginase I (PEG-ARG I), which converts arginine to ornithine, is under clinical investigation for the treatment of cancer. Preclinical studies using PEG-ARG I have shown that it suppresses tumor cell proliferation and induces apoptosis in hepatocellular carcinoma; induces necrotic cell death in acute myeloid leukemia (AML) cells; Induces apoptosis; suppresses subcutaneously transplanted melanoma in mice; induces autophagy in prostate cancer cells; induces apoptosis in pancreatic cancer cells and suppresses tumor growth in a subcutaneously transplanted pancreatic cancer mouse model ; and was shown to inhibit mesothelioma cell proliferation and induce mesothelioma cell apoptosis in vivo. A clinical trial investigating the use of PEGylated arginase I in the treatment of hepatocellular carcinoma showed that the drug was well tolerated and no neutralizing antibodies were detected in patients' serum (Fung and Chan (2017) Journal of Hematology & Oncology 10:144).

Cytokines and Chemokines In some embodiments, the viruses herein include, but are not limited to, GM-CSF, IL-2, IL-7, IL-10, IL-12, IL-15, IL-18, IL -21, can be engineered to express cytokines to stimulate the immune system, including IFN-γ, IFN-α, IFN-β, TNF-α, and TGF-β. Cytokines stimulate immune effector cells and stromal cells at the tumor site and enhance tumor cell recognition by cytotoxic cells. In some embodiments, the virus can be engineered to express chemokines, such as RANTES, CCL2, CCL5, CCL19 and CXCL11. Chemokines are involved in the migration of immune cells to sites of inflammation, as well as in immune cell maturation and generation of adaptive immune responses.

GM-CSF
Granulocyte-macrophage colony stimulating factor (GM-CSF) is used in the treatment of cancer, for example in cancer vaccines such as sipuleucel-T (for prostate cancer). Oncolytic viruses expressing GM-CSF, such as talimogene laherparepvec (T-VEC, Imlygic®) and JX-594, have also been shown to provide cancer treatment. Single agent GM-CSF exhibits antitumor activity in melanoma after direct injection into metastatic lesions. GM-CSF promotes the differentiation of monocytes into DCs and promotes antigen presentation on DC surfaces after virus-induced oncolysis, leading to the recruitment of NK cells and induction of tumor-specific cytotoxic T cells. (Meyers et al. (2017) Front. Oncol. 7:114; Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).

Interleukin (IL)
Interleukin-2 (IL-2), which was the first cytokine approved for the treatment of cancer, activates and promotes CTL proliferation, generates lymphokine-activated killer (LAK) cells, and proliferates Treg cells. and activation of the immune system by several mechanisms, including promotion of proliferation, stimulation of TILs, and promotion of proliferation and differentiation of T cells, B cells, and NK cells. Recombinant IL-2 (rIL-2) has been approved by the FDA for the treatment of metastatic renal cell carcinoma (RCC) and metastatic melanoma (Sheikhi et al. (2016) Iran J. Immunol. 13(3):148-166). Approved.

IL-10 is a cytokine that leads to inhibition of the secretion of pro-inflammatory cytokines such as IFNγ, TNFα, IL-1β and IL-6, as well as inhibition of the expression of MHC and costimulatory molecules leading to inhibition of T cell function. . Studies have shown that IL-10 induces CD8 activation and proliferation, resulting in antitumor effects. A study using AM0010, a PEGylated recombinant human IL-10, in combination with pembrolizumab (an anti-PD-1 antibody) in melanoma patients (Marin-Acevedo et al. (2018) Journal of Hematology & Oncology 11:39).

IL-12 secreted by antigen-presenting cells promotes the secretion of IFN-γ by NK cells and T cells, inhibits tumor angiogenesis, and increases the activation and proliferation of NK, CD8 ⁺ T cells, and CD4 ⁺ T cells. , promotes the differentiation of CD4 ⁺ Th0 cells into Th1 cells, and promotes antibody-dependent cell-mediated cytotoxicity (ADCC) against tumor cells (Sheikhi et al. (2016) Iran J. Immunol. 13(3): 148-166). IL-12 has been shown to exhibit antitumor effects in mouse models of melanoma, colon cancer, breast cancer, and sarcoma (Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).

IL-15 enhances anti-tumor immunity by activating NK and CD8 ⁺ T cells and induces long-term anti-tumor immunity by activating memory T cells (Sheikhi et al. (2016) Iran J. Immunol 13(3):148-166).

IL-21 is produced by activated CD4 ⁺ T cells, promotes the proliferation of CD4 ⁺ and CD8 ⁺ T cells, and enhances the cytotoxicity of CD8 ⁺ T cells and NK cells. IL-21 has shown antitumor effects in mouse models of melanoma (Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).

Interferon (IFN)
Type I interferons (IFNs), including IFN-α and IFN-β, are secreted by almost all cell types and are potent immunomodulators with antiproliferative and proapoptotic effects on tumors. Type I IFN induces the expression of MHC class I molecules on the tumor cell surface, mediates DC maturation, activates cytotoxic T lymphocytes (CTLs), NK and macrophages, and exerts anti-inflammatory properties against tumor neovascularization. It can have angiogenic effects and can exert cytostatic and apoptotic effects on tumor cells (Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).

IFN-α (Intron®/Roferon®-A) is approved for the treatment of hairy cell leukemia, malignant melanoma, AIDS-related Kaposi's sarcoma, and follicular non-Hodgkin's lymphoma; It is also used to treat leukemia (CML), renal cell carcinoma, neuroendocrine tumors, multiple myeloma, nonfollicular non-Hodgkin lymphoma, desmoid tumors, and cutaneous T-cell lymphoma.

IFN-γ, a type II IFN, is secreted by NK cells, NKT, CD4+ T cells, CD8+ T cells, APCs and B cells. IFN-γ activates macrophages, induces the expression of MHC class I and II molecules on APCs, promotes Th1 differentiation of CD4+ T cells, and activates the JAK/STAT signaling pathway. Furthermore, IFN-γ has been shown to have anti-angiogenic properties and to be cytotoxic to some malignant cells, and is mediated by other cytokines such as IL-2 and IL-12. Anti-tumor activity can be modulated (Lee, S. and Margolin, K. (2011) Cancers 3:3856-3893).

TNF-α
Tumor necrosis factor alpha (TNF-α) is produced by activated macrophages, T cells, and NK cells and induces apoptosis by binding to tumor cell surface receptors, blocks T-Reg cells, and inhibits macrophages and NK cells. activation, disruption of tumor vasculature and prevention of angiogenesis, attraction and stimulation of neutrophils and monocytes, promotion of tumor-associated macrophages to the M1 anti-tumor stage, and reduction of IL-13 expression by eosinophil-like cells. It exhibits antitumor activity through inhibition of the differentiation of regulatory and tumor-induced monocytes toward an immunosuppressive phenotype. Although clinical trials using systemically administered TNF-α have been limited by dose-limiting toxicity, studies using intratumoral administration of TNF-α have been successful, for example, in the treatment of Kaposi's sarcoma and liver metastases (Josephs (2018) J. Transl. Med. 16:242).

TGF-β
TGF-β is a cytokine that can promote the differentiation of inflammatory T cells, such as T-helper 17 (Th17), Th9 and resident memory T cells (Trm), and promote the survival of CD4+ and CD8+ T cells. (Dahmani and Delisle (2018) Cancers 10, 194).

Bispecific T cell induction (BiTE®)
Bispecific T cell inducing (BiTE®) constructs are a class of engineered bispecific monoclonal antibodies used in cancer immunotherapy in which one scFv targets CD3 on the surface of cytotoxic T cells. It is formed by joining two single chain variable fragments (scFv) such that one binds to a specific tumor-associated antigen and the other binds to a specific tumor-associated antigen. BiTE® therefore targets T cells to tumor cells and stimulates T cell activation, cytokine production and tumor cytotoxicity independently of MHC class I or costimulatory molecules. BiTE® in clinical trials include blinatumomab (MT-103), which targets CD19 and is being investigated for the treatment of non-Hodgkin's lymphoma and acute lymphoblastic leukemia; Solitomab (MT110), which targets carcinoembryonic antigen (CEA) and is being studied in the treatment of gastrointestinal adenocarcinoma, is being studied for treatment and targets the EpCAM antigen; as well as prostate-specific membrane antigen ( BAY2010112 (AMG112), which targets PSMA) and is being investigated for the treatment of prostate cancer. Katumaxomab (Removab®) is a bispecific rat-mouse hybrid monoclonal antibody that targets CD3 and EpCAM and has been used to treat malignant ascites. Other BiTEs in development include those targeting EGFR, EphA2, Her2, ADAM17/TACE, prostate stem cell antigen (PSCA) and melanoma-associated chondroitin sulfate proteoglycans (MCSP) (Huehls et al. (2015) Immunol. Cell Biol. 93(3):290-296).

Tumor-associated antigens and tumor neoantigens Tumor-associated antigens (TAAs), which can be targeted by cancer vaccines, are overexpressed in tumor cells, but also expressed by normal tissues. As a result, TAA-targeted therapies can lead to low therapeutic efficacy, central and peripheral immune tolerance, and autoimmunity. Tumor-specific neoantigens, on the other hand, are derived from random somatic mutations in tumor cells and are not found in non-cancerous cells. Therefore, cancer vaccines that target tumor neoantigens have the potential to increase specificity, efficacy, and safety, and may be effective against several cancers, including melanoma, pancreatic cancer, colorectal cancer, sarcoma, breast cancer, and lung cancer. have demonstrated results in preclinical and early clinical trials in the treatment of cancer types (Guo et al. (2018) Front. Immunol. 9:1499; Bendjama and Quemeneur (2017) Human Vaccines & Immunotherapeutics 13(9):1997- 2003).

Neoantigen-based vaccines include peptide-based, nucleic acid (mRNA/DNA)-based, human cell-based (eg, in vitro/ex vivo pulsed dendritic cells) and live vector-based (viral or bacterial) vaccines. Live vectors can target antigen-presenting cells (APCs) more efficiently and present an attractive delivery system that is easier and less expensive to prepare than dendritic cell-based vaccines. For example, an attenuated form of Listeria monocytogenes is being developed by Advaxis (Princeton, NJ) for neoantigen vaccine delivery. Adenoviruses (e.g., Exovax; NousCom, Basel, Switzerland), alphaviruses, poxviruses, and lentiviruses (e.g., ZVex®; ImmuneDesign, Seattle, WA) have also been used for the delivery of neoantigen vaccines. . Poxviruses, such as modified virus Ankara (MVA), have large genomes that are amenable to genetic manipulation, allowing the insertion of large numbers of protein antigens. For example, MVA-based vaccines include TG4001 (Tipapkinogene sovacivec), which targets the E6 and E7 antigens from the human papillomavirus and has been used to treat high-grade cervical intraepithelial neoplasms. Other MVA-based tumor neoantigen vaccines include TG4010 (Mesmulogene ancovacivec), which has successfully treated non-small cell lung cancer in addition to stimulating cytokines (LFA-3, ICAM-1 and B7.1); Includes Prostvac® (Rilimogene galvacirepvec), which expresses prostate-specific antigen (PSA) and has been shown to provide treatment for prostate cancer (Bendjama and Quemeneur (2017) Human Vaccines & Immunotherapeutics 13(9): 1997 -2003).

The viruses described and provided herein can encode tumor-associated antigens (TAA) or tumor-specific antigens (neoantigens), including, but not limited to, alpha-fetoprotein ( AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, cancer testis antigen (CTA), New York esophageal squamous cell carcinoma-1 (NY-ESO-1), E6/E7, SV40, MART- 1, PRAME, CT83, SSX2, BAGE family, CAGE family, epithelial tumor antigen (ETA), prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), melanoma-associated antigen (MAGE), TACE/ADAM17, tyrosi Includes tyrosinase, CD19, GP100, telomerase, cyclin B1, survivin, mesothelin, EPHA2, B cell antigen (BMCA) and HER2.

Angiogenesis Inhibitor/Tumor Vascular Reprogramming/Vascular Normalization In some embodiments, the viruses provided herein can encode an angiogenesis inhibitor (e.g., for tumor vascular reprogramming). can. Angiogenesis is a well-known contributor to cancer progression, and angiogenesis inhibitors prevent the formation of new blood vessels during cancer treatment, especially when used in combination with other anti-cancer treatments. It can be used to cut off the supply of nutrients and/or oxygen to the tumor. Proteins that act as angiogenesis activators and can be targeted by angiogenesis inhibitors include vascular endothelial growth factor (VEGF; e.g. (VEGFA, VEGFB), vascular endothelial growth factor receptor (VEGFR2), fibroblast growth factor (bFGF, FGF2), angiogenin, transforming growth factor (TGF)-α, TGF-β, tumor necrosis factor (TNF)-α, platelet-derived endothelial growth factor, granulocyte colony-stimulating factor ( GM-CSF), interleukin-8 (IL-8), hepatocyte growth factor (HGF), angiopoietins (e.g., ANGPT-1, ANGPT-2), placenta-derived growth factor (PDGF) and PDGF receptor (PDGFRa) , and epidermal growth factor (EGF) (Rajabi, M. and Mousa, S.A. (2017) Biomedicines 5, 34; Kong et al. (2017) Int. J. Mol. Sci. 18, 1786).

Studies have shown that in addition to blocking angiogenesis, cancer immunotherapy using angiogenesis inhibitors can be enhanced by their effects on stabilizing and/or normalizing tumor vasculature. (such doses can be lower than doses that block angiogenesis) (e.g., Huang et al., Cancer Res., 73(10): 2943, the entire contents of which are incorporated herein by reference). -2948 (2013); Matuszewska et al., Clin. Cancer Res., 25(5):1624-1638 (2019); Lanitis et al., Curr. Opin. Immunol., 33:55-63 (2015); and Bykov et al. Clin. Cancer Res., 25(2): 1446-1448 (2019)). To meet oxygen and nutrient demands, tumors initiate a version of angiogenesis by secreting factors such as VEGF in response to hypoxia, loss of oncogenes and tumor suppressor genes. The resulting blood vessels are characterized by structural abnormalities such as irregular branching, loss of basement membrane integrity, and insufficient or absent pericytes, leading to inefficiency in the delivery of cancer therapy to the tumor core. bring about. Furthermore, limited vascular perfusion in tumors can select hypoxia and acidity in the tumor microenvironment, limit the efficacy of therapeutic agents, and exacerbate metastasis (e.g., Matuszewska et al., Clin. Cancer Res. ., 25(5):1624–1638 (2019) and references cited therein). Additionally, endothelial cells lining blood vessels can suppress T cell activity, target them for destruction, and prevent them from entering tumors through deregulation of adhesion molecules (Lanitis et al., Curr. . Opin. Immunol., 33:55-63 (2015).

Recent studies have demonstrated that the efficacy of OV (oncolytic virus) therapy can be increased by downregulating/inhibiting angiogenesis and/or upregulating antiangiogenesis. Although administration of OV therapy as a single agent can be effective in reducing tumor growth, administration of virus initiates vascular blockade. Previously, blockade was viewed as a potential benefit to maximize oncolysis directly by promoting viral capture. However, OV therapy is often administered in multiple doses for optimal efficacy, and induced vascular disruption can impair uptake of subsequent doses of OV. Additionally, delivery of immune cells to the tumor site can be impaired (see, e.g., Matuszewska et al., Clin. Cancer Res., 25(5):1624-1638 (2019) and references cited therein). . Matuszewska et al. (Clin. Cancer Res., 25(5):1624-1638 (2019)) tested oncolytic virus (NDV; Newcastle disease virus) with the anti-angiogenic protein 3TSR in an in vivo mouse model of ovarian cancer. Coadministration with protein enhances tumor perfusion, normalizes vasculature, and reduces intratumoral hypoxia, resulting in decreased primary tumor growth, ascites, and metastasis when compared to either treatment alone. It has been found that improved reduction results.

CAVES compositions and related methods of use and treatment provided herein inhibit angiogenesis, including those that downregulate proangiogenic factors and/or upregulate antiangiogenic factors. It can include a virus encoding the molecule. Alternatively, or in addition, the CAVES compositions provided herein can be administered in combination with an angiogenesis inhibitor. Angiogenesis inhibitors can induce vascular normalization and repair tumor vasculature by restoring the balance of the signal cascade initiated by the interaction of tumor cells with their local cellular environment (tumor vascular reprogramming).

Direct inhibitors of angiogenesis that target endothelial cells of the growing vasculature include angiostatin, endostatin, arrestin, canstatin, and tanstatin. Indirect angiogenesis inhibitors that target tumor cells or tumor-associated stromal cells act by blocking the expression or activity of proangiogenic proteins. For example, gefitinib is a small molecule EGFR tyrosine kinase inhibitor (TKI) used to treat colon, breast, ovarian, and gastric cancers. Bevacizumab (Avastin®) is a recombinant humanized monoclonal antibody against VEGF that blocks tumor-derived VEGF-A, prevents new blood vessel development, and results in tumor growth inhibition. Other angiogenesis inhibitors include thalidomide (Immunoprin), imatinib, lenalidomide, sorafenib (Nexavar®), sunitinib, axitinib (Inlyta®), temsirolimus (Torisel®), pazopanib, carbozantinib , everolimus, ramucirumab (Cyramza®), regorafenib, vandetanib, tanivirumab, olaratuzumab (Lartruvo®), nespacumab, AMG780, MEDI3617, vanicizumab, rilotumumab (AMG102), ficlatuzumab, TAK-701, onartuzumab (MetMab) , emibetuzumab and aflibercept (Eylea, Zaltrap®) (Rajabi, M. and Mousa, S.A. (2017) Biomedicines 5, 34; Kong et al. (2017) Int. J. Mol. Sci. .18, 1786).

VEGF is a potent angiogenic activator in neoplastic tissues and plays an important role in tumor angiogenesis. For example, studies have shown that: VEGF receptor (VEGFR) is expressed in leukemia, non-small cell lung cancer (NSCLC), gastric cancer, and breast cancer; high levels of VEGF mRNA are expressed in NSCLC. VEGF-A expression in breast cancer promotes breast cancer cell proliferation, survival and metastasis; overexpression of VEGF-A and VEGF-C in gastric cancer is associated with poor prognosis; , VEGF-A and VEGF-C silencing significantly inhibits proliferation and tumor growth. Bevacizumab (Avastin®), a recombinant humanized immunoglobulin G (IgG) antibody that inhibits the formation of VEGF-A and VEGFR-2 complexes, is used in the treatment of metastatic colorectal cancer in combination with chemotherapy. Approved by the FDA in 2004, it has been used to treat a variety of other cancers, including metastatic non-squamous NSCLC, metastatic renal cell carcinoma, breast cancer, epithelial ovarian cancer, and glioblastoma. . Aflibercept (Zaltrap®) is an Fc fusion protein that inhibits the activity of VEGF-A, VEGF-B and P1GF and is used in metastases that are resistant to treatment with oxaliplatin or that have progressed after treatment. It was approved by the FDA in 2012 for the treatment of colorectal cancer. Ramucirumab (Cyramza®), a fully human monoclonal antibody that inhibits the interaction of VEGFR-2 with VEGF ligand, was introduced in 2014 for the treatment of advanced gastric or gastroesophageal junction adenocarcinoma and metastatic NSCLC. was approved by the FDA. Tanivirumab binds to VEGFR-2 and blocks its interaction with ligands such as VEGF-A, VEGF-C and VEGF-D (Kong et al. (2017) Int. J. Mol. Sci. 18, 1786) It is a fully human monoclonal antibody.

In addition to promoting tumor angiogenesis, VEGF is immunosuppressive and can inhibit T cell function, increase the recruitment of Tregs and MDSCs, and prevent DC differentiation, maturation and activation. VEGFA was found to enhance the expression of inhibitory checkpoints such as PD-1, CTLA-4, TIM-3 and LAG-3, which was reversed by antibodies against VEGFR2. Therefore, anti-tumor immunity can be enhanced by targeting VEGF/VEGFR. For example, targeting VEGF/VEGFR has been shown to promote T cell infiltration in the TME. Treatment with bevacizumab was found to increase B-cell and T-cell compartments in patients with metastatic colorectal cancer and improve cytotoxic T lymphocyte responses in patients with metastatic NSCLC. Bevacizumab was also found to increase the number of DCs and promote their activation. Axitinib, a small molecule inhibitor of VEGFR1, VEGFR2 and VEGFR3, was found to reduce the number and suppressive capacity of MDSCs and induce differentiation of MDSCs towards an antigen-presenting phenotype. In particular, sorafenib, a multikinase inhibitor targeting VEGFR2, VEGFR3 and PDGFRβ, was found to restore DC differentiation. Sunitinib, a tyrosine kinase inhibitor that blocks VEGFR1, VEGFR2, VEGFR3, platelet-derived growth factor receptors α and β, stem cell factor receptor, and Flt3, inhibits IL-10, Foxp3, PD-1, CTLA-4 in mice. and BRAF expression, increased the proportion of CD4 ⁺ and CD8 ⁺ TILs, decreased the number of Tregs, and increased cytotoxic T cell activity against tumor cells. Sunitinib was also found to reduce the number of MDSCs in various tumor models. Therefore, sunitinib can be used to modify the TME and change the expression profile of cytokines and costimulatory molecules, leading to favorable T cell activation and Th1 responses. Sunitinib in combination with oncolytic reovirus was shown to significantly reduce tumor burden and extend lifespan in a preclinical mouse model of renal cell carcinoma, whereas the combination of sunitinib with oncolytic VSV was found to eliminate malignant tumors of the prostate, breast, and kidney in patients (Meyers et al. (2017) Front. Oncol. 7:114; Yang et al. (2018) Front. Immunol. 9:978). These results indicate that combination therapy including oncolytic viruses and angiogenesis inhibitors can improve anticancer treatment efficacy.

PDGF/PDGFR signaling is associated with angiogenesis, tumor growth and decreased patient survival; PDGFR and/or PDGF overexpression is observed in, for example, colorectal cancer, prostate cancer and glioblastoma. Small molecules that target PDGFR include imatinib, sunitinib, regorafenib, and pazopanib, which inhibit activation of PDGFR and other kinases such as VEGFR and FGFR. These molecules have been approved for the treatment of metastatic colorectal cancer, metastatic renal cell carcinoma, and gastrointestinal stromal tumors. Antibodies targeting PDGF and PDGFR include olaratuzumab (Lartruvo™), which targets PDGFRα and is approved by the FDA for the treatment of soft tissue sarcomas (Kong et al. (2017) Int. J. Mol. Sci .18, 1786).

Hepatocyte growth factor (HGF), a motility and morphogenetic factor, interacts with c-MET and results in various biological responses such as embryonic development, epithelial branching morphogenesis, wound healing and tumorigenesis. Therefore, HGF/c-MET signaling is a target for cancer therapy. Rilotumumab, a fully human monoclonal antibody, binds to HGF and blocks its interaction with c-MET, resulting in antitumor effects such as tumor growth inhibition, tumor regression, and suppression of apoptosis and cell proliferation. Other humanized monoclonal antibodies against HGF include ficlatuzumab and TAK-701 (L2G7), and humanized monoclonal antibodies against c-MET include onartuzumab (MetMab) and emibetuzumab (LY-2875358) (Kong (2017) Int. J. Mol. Sci. 18, 1786).

Other Therapeutic Antibodies Monoclonal antibodies can be used to target antigens expressed by cancer cells for cancer treatment. In certain embodiments, the viruses herein include, in addition to the angiogenesis inhibitors, BiTEs and immune checkpoint inhibitors/stimulators described above, such as, but not limited to, alemtuzumab (Campas®). ; anti-CD52), trastuzumab (Herceptin®; anti-HER2), cetuximab (Erbitux®; anti-EGFR), panitumumab (Vectibix®; anti-EGFR), ofatumumab (Alzera®) ; anti-CD20), rituximab (Rituxan®/Mabthera®; anti-CD20), gemtuzumab ozogamicin (Mylotarg®; anti-CD33), brentuximab vedotin (Adcetris® anti-CD30), tositumomab (anti-CD20), daratumumab (Darzalex®; anti-CD38); dinutuximab (Unituxin®; anti-GD2); elotuzumab (Emplicity®; anti-SLAMF7); Others, including humanized or chimeric monoclonal antibodies such as necitumumab (Portrazza®; anti-EGFR); obinutuzumab (Gazyva®; anti-CD20); and pertuzumab (Perjeta®; anti-HER2) Can be engineered to express therapeutic anti-cancer antibodies.

Monoclonal antibodies have been successful in treating several types of cancer, both alone and in combination therapy. For example, rituximab, also known as IDEC-C2BB, was the first monoclonal antibody approved by the FDA and is used to treat non-Hodgkin's lymphoma and chronic lymphocytic leukemia. Trastuzumab is an FDA-approved monoclonal antibody used to treat HER2 ⁺ breast cancer. Additionally, cetuximab is used to treat colorectal cancer, metastatic NSCLC, and head and neck cancer; panitumumab is used to treat metastatic colorectal cancer; alemtuzumab is used to treat chronic lymphocytic leukemia (CLL); ), used to treat cutaneous T-cell lymphoma and T-cell lymphoma; ofatumumab, used to treat CLL; gemtuzumab ozogamicin, used to treat acute myeloid leukemia; brentuximab Vedotin is used to treat relapsed or refractory Hodgkin lymphoma, systemic anaplastic large cell lymphoma, and cutaneous T-cell lymphoma; tositumomab is used in combination with iodine-labeled tositumomab (Bexxar) to treat chemotherapy- and rituximab-resistant Used to treat non-Hodgkin lymphoma; daratumumab used to treat multiple myeloma, diffuse large B-cell lymphoma, follicular lymphoma, and mantle cell lymphoma; dinutuximab used to treat childhood neuroblastoma used; elotuzumab is used to treat multiple myeloma; necitumumab is used to treat metastatic squamous NSCLC; obinutuzumab is used to treat chronic lymphocytic leukemia and follicular lymphoma; and pertuzumab is used to treat HER2 ⁺ breast cancer.

Other antibodies include D1 (A12), which targets the TACE ectodomain and has been shown to inhibit cancer cell proliferation and motility in head and neck squamous cell carcinoma; Fsn0503h, which has been shown to suppress angiogenesis and metastasis); urokinase plasminogen activator receptor (uPAR), which has been shown to inhibit invasion, metastasis and tumor growth, and induce apoptosis An example is ATN-658 (Neves and Kwok (2015) BBA Clinical 3:280-288), which is an antibody against.

Reporter Genes In certain embodiments, the virus contains magnetic resonance, ultrasound, or tomography imaging, including, for example, fluorescent proteins (e.g., GFP, YFP, RFP, TurboFP635); luminescent proteins (e.g., luciferase); and radionuclides. Reporter genes can be engineered to express imaging molecules/agents such as agents. The viruses herein can also be engineered to express the human sodium-iodine cotransporter (hNIS) or aquaporin 1 (AQP1), which can be used for deep imaging such as PET, SPECT/CT, gamma camera or MRI. Facilitate detection of the virus through tissue non-invasive imaging techniques.

NIS
The Na ⁺ / ^I- cotransporter (NIS) is a transmembrane sugar that mediates the transport of iodide anions into cells, such as the thyroid gland and other tissues, such as the salivary glands, stomach, kidneys, placenta, lactating mammary glands, and small intestine. It is a protein. Radioactive isotopes such as ¹²³ I, ¹²⁴ I, ¹²⁵ I, ¹³¹ I and ^99m Tc, when encoded by viruses, are transported via NIS expressed on the surface of infected cells, e.g. PET, SPECT/CT and non-invasive imaging using gamma cameras, etc. (Msaouel et al. (2013) Expert Opin. Biol. Ther. 13(4)).

NIS accumulates radiolabeled substrates, can be used to concentrate and amplify the signal, monitor the delivery of other genes, and, when expressed in tumors, can be used to diagnose tumor size using scintigraphic imaging. It is useful as a reporter gene because it can be used to monitor For example, when an adenovirus expressing human NIS (hNIS) was delivered intranasally to the lungs of rats, ¹²⁴ I ^- PET signals were detectable up to 17 days after administration. Single-photon emission computed tomography using ^99m TcO ₄ ^- or ¹²⁴ I ^- (Portulano et al. (2014) Endocr. Rev. 35(1):106-149) using a lentiviral vector expressing NIS. Transplanted rat heart-derived stem cells were detected using (PET) imaging.

NIS-expressing viruses can be used to combine oncolytic therapy with radiotherapy, which has been shown preclinically to enhance oncolytic efficacy. For example, an adenoviral vector expressing NIS under the CMV promoter was injected into the portal vein of liver cancer-bearing rats, and after ¹³¹ I ^- therapy, strong inhibition of tumor growth and prolonged survival were observed. Administration of an adenoviral vector expressing NIS under the MUC1 promoter to mice with pancreatic cancer resulted in significant tumor regression after ¹³¹ I ^- treatment (Portulano et al. (2014) Endocr. Rev. 35(1): 106- 149). Vaccinia virus encoding the human NIS gene (VV-NIS) can be used to treat and monitor endometrial cancer, pancreatic cancer, malignant pleural mesothelioma, colorectal cancer, undifferentiated thyroid cancer, prostate cancer, and gastric cancer. is being researched for. VV-NIS has also been used as a reporter gene to identify positive surgical margins of breast cancer in mouse models using ^{124I -} microPET imaging (Ravera et al. (2017) Annu Rev Physiol. 79:261-289). .

Oncolytic measles virus (MV) expressing NIS (MV-NIS) for radioviral therapy with I-131 is also used in multiple myeloma, glioblastoma multiforme, head and neck cancer, and undifferentiated thyroid cancer. Results have been demonstrated preclinically in cancer, ovarian, pancreatic, mesothelioma, hepatocellular carcinoma, osteosarcoma, endometrial and prostate cancer models. Several Phase I/II clinical trials have been conducted in multiple myeloma (NCT00450814, NCT02192775), mesothelioma (NCT01503177), head and neck cancer (NCT01846091), and ovarian cancer (NCT02068794) using virus-infected MSCs. We investigated the use of MV-NIS in

Aquaporin 1 (AQP1)
Aquaporins are integral membrane proteins that mediate the transport of water across the plasma membrane within cells. Human aquaporin 1 (AQP1) can be used as a genetically encoded reporter for diffusion-weighted MRI and is advantageous due to its nontoxicity, metal-free nature, and sensitivity. Since it is a self-reporter gene, there is no risk of immunogenicity. Studies have shown that AQP1 enables gene expression imaging in tumor xenografts (Mukherjee et al. (2016) Nature Communications 7:13891).

C. Production, Formulation, Storage and Transport of CAVES The CAVES systems provided herein can be used to transport any of the carrier cells provided herein, including modified carrier cells, to at least one virus-encoded immunizer. such as those engineered to express the recombinant therapeutic protein at times and temperatures appropriate for cell loading, infection, and viral replication such that the regulatory protein and/or recombinant therapeutic protein is expressed. can be produced by incubating with any of the oncolytic viruses provided herein, including modified viruses of. In embodiments, the incubation time is the time necessary to express the virus-encoded immunomodulatory and/or recombinant therapeutic proteins, e.g., the time necessary to generate progeny viral particles, including EEV particles. It can be longer than . The incubation temperature can be, for example, room temperature or 32-42°C, such as 35-40°C. In embodiments, the incubation temperature is 37°C. Loading of virus into cells can be at an MOI of 0.001 to 200, 300, 400 or 1000 or more. In embodiments, the MOI is an MOI of about 0.001 to 10, such as 0.01 to 1.0, or 1.0.

The generation of CAVES generally involves more than 2 hours, generally from about 3 hours to more than 72 hours, such as generally at least or about 3, 4, 5 or 6 hours, or from more than about 4 hours to at least or about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, An incubation time of 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or 72 hours or more is required, such as from about 6 hours to 18 hours, or from about 12 hours to 48 hours. It's time. The time and temperature that promotes such expression can depend on the type of oncolytic virus and/or cells used in the system, such as carrier cells, or combinations thereof. For example, in the VSV viral replication cycle, the time required to express recombinant proteins, such as virus-encoded immunomodulatory and/or therapeutic proteins, is generally relatively short, on the order of 2 to 3 hours; The time taken to express virally encoded immunomodulatory proteins and/or recombinant therapeutic proteins is generally longer, 6-12 hours or more. In embodiments where the oncolytic virus is vaccinia, the incubation time is at least or about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 , 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 , 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or 72 It can be for an hour or more, such as about 6 hours to 18 hours, or about 12 hours to 48 hours, or about 30 to 36 hours. In some embodiments, the vaccinia virus is ACAM2000, which has the sequence shown in SEQ ID NO:70. In other embodiments, the vaccinia virus is CAL1 having the sequence set forth in SEQ ID NO:71. In some embodiments where the oncolytic virus is a vaccinia virus, such as ACAM2000 having the sequence set forth in SEQ ID NO: 70 or CAL1 having the sequence set forth in SEQ ID NO: 71, the carrier cells are stem cells or cells derived from SVF. , such as MSCs, SA-ASCs or pericytes.

The systems provided herein can be stable and stored indefinitely under frozen or cryopreserved conditions (eg, -20 to -80°C), and can be thawed as needed before administration. For example, the systems provided herein can be stored at −80° C. for at least or about several hours, such as 1, 2, 3, 4, or 5 hours, or at least about several years or about several hours, before thawing for administration. for example, at least or about 1, 2, 3 or more years, such as from at least or about 1, 2, 3, 4 or 5 hours to at least or about 6, 7, 8, 9, 10, 11; 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 61, 62, 63, 64, 65, 66, 67, 68, 69, 60, 70, 71 or 72 hours, or 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or 30 days, or 1. 5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, It can be stored for 10, 10.5, 11, 11.5 or 12 months, or 1, 2, 3, 4 or 5 years or more. The systems provided herein can also be stably stored under refrigerated conditions, e.g. 0-5°C, e.g. 4°C, and/or transported on ice to the site of administration for treatment. . For example, the systems provided herein can be stored at 4° C. or on ice for at least or about several hours, e.g., from 1, 2, 3, 4, or 5 hours to at least or about 6, 7 hours prior to administration for treatment. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 or more than 48 hours.

D. Pharmaceutical Compositions, Combinations and Kits Provided herein are pharmaceutical compositions, combinations and kits containing the CAVES systems provided herein. The pharmaceutical composition can include CAVES containing any of the carrier cells and any of the oncolytic viruses provided herein, and a pharmaceutical carrier. The pharmaceutical composition can be at room temperature to about 37°C, refrigerated temperature, eg 0-5°C, eg 4°C, or frozen or cryopreserved conditions, eg -20 to -80°C. In embodiments, the pharmaceutical composition is at -80°C. The combination can include, for example, a carrier cell, an oncolytic virus; and at least one immunomodulatory and/or recombinant therapeutic protein encoded by the oncolytic virus. The combination includes any of the carrier cells provided herein, an oncolytic virus, a virus-encoded immunomodulatory protein and/or a recombinant therapeutic protein, and a detectable compound; CAVES and an additional therapeutic compound; and a viral expression modulating compound, or any combination thereof. A kit includes one or more pharmaceutical compositions or combinations provided herein, and one or more components, such as instructions for use, a device for administering the pharmaceutical composition or combination to a subject, a therapeutic or It can include a device for administering a diagnostic compound to a subject or a device for detecting a virus in a subject.

The carrier cells contained in the pharmaceutical composition, combination or kit can include any of the carrier cells provided herein. The oncolytic virus contained in the pharmaceutical composition, combination or kit can include any virus provided herein.

1. pharmaceutical composition
A pharmaceutical composition comprising CAVES, any of the carrier cells provided herein, an oncolytic virus provided herein, and at least one expressed virus-encoded immunomodulatory agent. and/or a pharmaceutical composition comprising a recombinant therapeutic protein and a suitable pharmaceutical carrier. Pharmaceutically acceptable carriers include solid, semi-solid or liquid materials that act as media carriers or vehicles for the virus. The pharmaceutical compositions provided herein can be formulated in a variety of forms, such as solid, semisolid, aqueous, liquid, powder, or lyophilized. Exemplary pharmaceutical compositions containing any carrier cells (including primed, sensitized, engineered cells) or oncolytic viruses in the CAVES system provided herein include: Examples include, but are not limited to, sterile injectable solutions, sterile packaged powders, eye drops, tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (solid or liquid media). ), ointments, soft and hard gelatin capsules, and suppositories.

Examples of suitable pharmaceutical carriers are known in the art and include, but are not limited to, water, buffered solutions, saline, phosphate buffered saline, various types of wetting agents, sterile solutions, alcohol. , gum arabic, vegetable oils, benzyl alcohol, gelatin, glycerin, carbohydrates such as lactose, sucrose, dextrose, amylose or starch, sorbitol, mannitol, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oils, fatty acid mono- and diglycerides, penta Examples include erythritol fatty acid ester, hydroxymethyl cellulose, and powder. The pharmaceutical compositions provided herein include, for example, antioxidants, preservatives, analgesics, binders, disintegrants, colorants, diluents, excipients, fillers, lubricants, solubilizers, stabilizers, etc. agents, tonicity agents, vehicles, viscosity agents, flavoring agents, sweeteners, emulsions such as oil/water emulsions, emulsifying agents and suspending agents such as acacia, agar, alginic acid, sodium alginate, bentonite, carbomer, carrageenan, carboxylic acid. Methylcellulose, cellulose, cholesterol, gelatin, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, methylcellulose, octoxynol 9, oleyl alcohol, povidone, propylene glycol monostearate, sodium lauryl sulfate, sorbitan ester, stearyl alcohol, tragacanth, xanthan gum and derivatives thereof, solvents, and miscellaneous ingredients such as, but not limited to, crystalline cellulose, microcrystalline cellulose, citric acid, dextrin, liquid glucose, lactic acid, lactose, magnesium chloride, potassium metaphosphate, starch. Other additives may be included, including. Such carriers and/or excipients can be formulated by conventional methods and administered to a subject in appropriate doses. Stabilizers such as lipids, nuclease inhibitors, polymers and chelating agents can protect the composition from degradation within the body. Other suitable formulations for use in pharmaceutical compositions can be found, for example, in Remington: The Science and Practice of Pharmacy (2005, 21st edition, edited by Gennaro & Gennaro, Lippencott Williams and Wilkins).

Pharmaceutical formulations comprising the CAVES systems provided herein for injection or mucosal delivery typically include an aqueous solution of virus provided in a buffer suitable for injection or mucosal administration; Contains a lyophilized form of the virus for reconstitution with a suitable buffer. Such formulations may optionally contain one or more pharmaceutically acceptable carriers and/or excipients as described herein or known in the art. Liquid compositions for oral administration generally include aqueous solutions, suitably flavored syrups, aqueous or oily suspensions, and flavored oils, such as corn oil, cottonseed oil, sesame oil, coconut oil or peanut oil. emulsions, as well as elixirs and similar pharmaceutical vehicles.

The pharmaceutical compositions provided herein are formulated to provide rapid release, sustained release, or delayed release of the CAVES systems described herein by using procedures known in the art. can do. For preparing solid compositions, such as tablets, the CAVES systems provided herein are mixed with a pharmaceutical carrier to form the solid composition. Optionally, the tablet or pill is coated or compounded to provide a dosage form that confers the benefit of long-term action in the subject. For example, a tablet or pill is in the form of an envelope containing an inner dosing component and an outer dosing component, the latter covering the former. The two components can be separated, for example, by an enteric layer that serves to resist disintegration in the stomach and allow the internal components to enter the duodenum intact or to delay release. A variety of materials are used for such enteric layers or coatings, including, for example, some polymeric acids and mixtures of polymeric acids with materials such as shellac, cetyl alcohol, and cellulose acetate.

Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents, or mixtures thereof, and powders. These liquid or solid compositions may optionally contain suitable pharmaceutically acceptable excipients and/or additives as described herein or known in the art. Such compositions are administered, for example, by the oral or nasal respiratory route for local or systemic effect. Compositions in pharmaceutically acceptable solvents are nebulized by using an inert gas. Nebulized solutions are inhaled, for example, directly from a nebulizing device, through an attached face mask tent, or from an intermittent positive pressure breathing simulator. Solution, suspension or powder compositions are administered, eg, orally or nasally, from a device that delivers the formulation in a suitable manner, such as, eg, using an inhaler.

The pharmaceutical compositions provided herein can be formulated for transdermal delivery via a transdermal delivery device (“patch”). Such transdermal patches are used to provide continuous or discontinuous infusion of the viruses provided herein. Construction and use of transdermal patches to deliver pharmaceuticals is performed according to methods known in the art (see, eg, US Pat. No. 5,023,252). Such patches are constructed for continuous, pulsatile, or on-demand delivery of carrier cells and/or viruses provided herein.

Colloidal dispersion systems that can be used for virus delivery include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions (mixtures), micelles, liposomes, and lipoplexes. An exemplary colloidal system is a liposome. Organ-specific or cell-specific liposomes can be used to achieve delivery only to the desired tissue. Targeting of liposomes can be carried out by those skilled in the art by applying commonly known methods. This targeting can be achieved by passive targeting (using the natural tendency of liposomes to distribute to cells of the reticuloendothelial system (RES) of organs, including sinusoids) or active targeting (e.g., by attaching the liposomes to specific ligands, such as antibodies, receptors, sugars, glycolipids and proteins, by methods known in the art. Monoclonal antibodies can be used to target liposomes to specific tissues, eg, tumor tissue, eg, via specific cell surface ligands.

2. Combinations Combinations of carrier cells, oncolytic viruses, and at least one expressed virally encoded immunomodulatory and/or recombinant therapeutic protein are provided. The combination can include a third or fourth agent, such as a second virus or other therapeutic or diagnostic agent. The combination can include a pharmaceutical composition containing a CAVES system provided herein. The combination can also include any agent for treatment or diagnosis according to the methods provided herein, such as, for example, antiviral agents or chemotherapeutic agents. The combination can also contain compounds used in modulating gene expression from endogenous or heterologous genes encoded by viruses.

The combinations provided herein can contain a CAVES system and a therapeutic compound. The therapeutic compound of the compositions provided herein can be, for example, an anti-cancer compound or a chemotherapeutic compound. Exemplary therapeutic compounds include, but are not limited to, cytokines, growth factors, photosensitizers, radionuclides, toxins, siRNA molecules, enzyme/proE drug pairs, antimetabolites, signal transducers. Included are modulators, anti-cancer antibiotics, anti-cancer antibodies, angiogenesis inhibitors, chemotherapeutic compounds, antimetabolite compounds or combinations of any of these.

The CAVES system provided herein can be combined with anti-cancer compounds such as platinum coordination complexes. Exemplary platinum coordination complexes include, for example, cisplatin, carboplatin, oxaliplatin, DWA2114R, NK121, IS3 295 and 254-S. Exemplary chemotherapeutic agents include, but are not limited to, methotrexate, vincristine, adriamycin, non-sugar-containing chloroethylnitrosourea, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, flagillin, megramine GLA , valrubicin, carmustine, polyfeprozan, MM1270, BAY 12-9566, RAS farnesyltransferase inhibitor, farnesyltransferase inhibitor, MMP, MTA/LY231514, lometerexol/LY264618, Glamolec, CI-994, TNP-470, hycamucin/topotecan , PKC412, Valspodar/PSC833, Novantrone/Mitoxantrone, Metaret/Suramin, BB-94/Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX -710, VX-853, ZD0101, IS1641, ODN 698, TA 2516/Marimastat, BB2516/Marimastat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, Valrubicin/AD 32, Strontium-89/Metastron, Temodar/Temozolomide, Yewtaxan/Paclitaxel, Taxol/Paclitaxel, Paxex/Paclitaxel, Cyclopax/Oral Paclitaxel, Xeloda/Capecitabine, Fluturon/Doxifluridine, Oral Taxoid, SPU-077/cisplatin, HMR 1275/flavopiridol, CP-358(774)/EGFR, CP-609(754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT (tegafur/uracil), ergamisole / Levamisole, Campto / Levamisole, Eniluracil / 776C85 / 5FU Enhancer, Camptosar / Irinotecan, Tomdex / Laltitrexed, Leustatin / Cladribine, Caelyx / Liposomal Doxorubicin, Myoset / Liposomal Doxorubicin, Doxil / Liposomal Doxorubicin, Evacet / Liposome Doxorubicin, fludara/fludarabine, farmorubicin/epirubicin, DepoCyt, ZD1839, LU 79553/bis-naphthalimide, LU 103793/dolastatin, Gemzar/gemcitabine, ZD 0473/AnorMED, YM 116, iodine species, CDK4 and CDK2 inhibitors, PARP inhibitors D4809/dexifosfamide, Ifex/Mesnex/Ifosfamide, Vumon/Teniposide, Paraplatin/Carboplatin, Platinol/Cisplatin, VePesid/Eposin/Etopofos/Etoposide, ZD 9331 , taxotere/docetaxel, prodrugs of guanine arabinoside, taxane analogs, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, aminoglutethimide, asparaginase, busulfan, carboplatin, chlorambucil, cytarabine HCl, dac Tinomycin, daunorubicin HCl, estramustine sodium phosphate, etoposide (VP16-213), floxuridine, fluorouracil (5-FU), flutamide, hydroxyurea (hydroxycarbamide), ifosfamide, interferon alpha-2a, interferon alpha- 2b, leuprolide acetate (LHRH releasing factor analogue), lomustine (CCNU), mechlorethamine HCl (nitrogen mustard), mercaptopurine, mesna, mitotane (o,p'-DDD), mitoxantrone HCl, octreotide, plicamycin, Procarbazine HCl, streptozocin, tamoxifen citrate, thioguanine, thiotepa, vinblastine sulfate, amsacrine (m-AMSA), azacitidine, erythropoietin, hexamethylmelamine (HMM), interleukin 2, mitoguazone (methyl-GAG; methylglyoxal bisguanylhydrazone) ;MGBG), pentostatin (2'deoxycoformycin), semustine (methyl-CCNU), teniposide (VM-26) and vindesine sulfate. Additional exemplary therapeutic compounds for use in the pharmaceutical compositions and combinations provided herein can be found elsewhere herein (e.g., exemplary cytokines, growth factors, Section E on photosensitizers, radionuclides, toxins, siRNA molecules, enzyme/prodrug pairs, antimetabolites, signal transduction modulators, anti-cancer antibiotics, anti-cancer antibodies, angiogenesis inhibitors and chemotherapy compounds reference).

In some examples, the combination includes, for example, a compound that is a substrate for an enzyme encoded and expressed by a virus, or other compounds provided herein or known in the art to act in concert with a virus. Additional therapeutic compounds can be included, such as therapeutic compounds. For example, viruses can express enzymes that convert prodrugs into active chemotherapeutic drugs for killing cancer cells. Accordingly, the combinations provided herein can contain therapeutic compounds such as prodrugs. An exemplary virus/therapeutic compound combination can include a virus encoding herpes simplex virus thymidine kinase and the prodrug ganciclovir. Additional exemplary enzyme/prodrug pairs for use in the combinations provided include, but are not limited to, varicella zoster thymidine kinase/ganciclovir, cytosine deaminase/5-fluorouracil, purine nucleoside phosphorylase/6 - Methylpurine deoxyriboside, beta-lactamase/cephalosporin-doxorubicin, carboxypeptidase G2/4 - [(2-chloroethyl)(2-mesyloxyethyl)amino]benzoyl-L-glutamic acid, cytochrome P450/acetaminophen, Western Horseradish peroxidase/indole-3-acetic acid, nitroreductase/CB1954, rabbit carboxylesterase/7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin (CPT-11), mushroom tyrosinase/Bis -(2-chloroethyl)amino-4-hydroxyphenylaminomethane 28, beta-galactosidase/1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo[e]indole, beta-glucuronidase/epirubicin-glucuronide, Includes thymidine phosphorylase/5'-deoxy-5-fluorouridine, deoxycytidine kinase/cytosine arabinoside, beta-lactamase and linamerase/linamarin. Additional exemplary prodrugs for use in combination can also be found elsewhere herein (see, eg, Section E). Any of a variety of known combinations provided herein or known in the art can be included in the combinations provided herein.

In some examples, a combination can include a compound that can kill or inhibit viral growth or virulence. Such compounds can be used to alleviate one or more harmful side effects that can result from a viral infection (see, eg, US Patent Application Publication No. 2009-016228A1). The combinations provided herein can contain antibiotic, antifungal, antiparasitic or antiviral compounds to treat infectious diseases. In some examples, the antiviral compound is a chemotherapeutic agent that inhibits viral proliferation or toxicity.

Exemplary antibiotics that can be included in combination with the carrier cells and viruses provided herein include, but are not limited to, ceftazidime, cefepime, imipenem, aminoglycosides, vancomycin, and anti-pseudomonal beta-lactams. included. Exemplary antifungal agents that can be included in combination with the carrier cells and viruses provided herein include, but are not limited to, amphotericin B, dapsone, fluconazole, flucytosine, griseofulvin, itraconazole, ketoconazole, Includes miconazole, clotrimazole, nystatin and combinations thereof. Exemplary antiviral agents that can be included in combination with the carrier cells and viruses provided herein include, but are not limited to, cidofovir, alkoxyalkyl esters of cidofovir (CDV), cyclic CDV, and (S)-9-(3-hydroxy-2phosphonylmethoxypropyl)adenine, 5-(dimethoxymethyl)-2'-deoxyuridine, isatin-β-thiosemicarbazone, N-methanocarbatymidine, brivudine, 7 - Deazanplanocin A, ST-246, Gleevec, 2'-β-fluoro-2',3'-dideoxyadenosine, indinavir, nelfinavir, ritonavir, nevirapine, AZT, ddI, ddC and combinations thereof. Typically, the combination with an antiviral agent contains an antiviral agent known to be effective against the viruses of the combination. For example, a combination can contain vaccinia virus and an antiviral compound such as cidofovir, alkoxyalkyl esters of cidofovir, ganciclovir, acyclovir, ST-246, Gleevec and derivatives thereof.

In some examples, the combination can include a detectable compound. The detectable compound can, for example, interact with and/or bind specifically to a protein or RNA encoded and expressed by the virus or carrier cell, and can be detected by tomography, spectroscopy, magnetic resonance or other methods. Ligands, substrates or other compounds capable of providing a detectable signal, such as a signal detectable by known techniques. In some instances, the protein or RNA is an exogenous protein or RNA. In some examples, a protein or RNA expressed by the virus or carrier cell modifies a detectable compound, and the modified compound emits a detectable signal. An exemplary detectable compound can be or contain a contrast agent, such as a magnetic resonance, ultrasound, or tomography contrast agent that includes a radionuclide. The detectable compound can include any of a variety of compounds provided elsewhere herein or known in the art. Exemplary protein and detectable compound combinations that can be expressed by the virus or carrier cell used for detection include, but are not limited to, luciferase and luciferin, β-galactosidase and (4,7, 10-tri(acetic acid)-1-(2-β-galactopyranosyl ethoxy)-1,4,7,10-tetraazacyclododecane) gadolinium (Egad), and other combinations known in the art. included.

In some examples, the combination can include a gene expression modulating compound that modulates the expression of one or more genes encoded by the virus or carrier cell. Compounds that modulate gene expression are known in the art and include, but are not limited to, transcriptional activators, inducers, transcriptional repressors, RNA polymerase inhibitors, and RNA binding compounds such as siRNA or ribozymes. including. Any of a variety of gene expression modulating compounds known in the art can be included in the combinations provided herein. Typically, the gene expression modulating compound included with the virus in the combinations provided herein will bind to one or more compounds that are active in gene expression, such as a transcription factor or RNA of the virus or carrier cell of the combination. , a compound that can inhibit or react with it. Exemplary virus or carrier cell/expression regulator combinations have the yeast GAL4 DNA-binding domain, a mutant human progesterone receptor fused to the activation domain of the herpes simplex virus protein VP16, and the adenovirus major late E1B TATA box. can be a virus or a carrier cell encoding a chimeric transcription factor complex that also contains a synthetic promoter containing a series of GAL4 recognition sequences upstream of the gene, where the compound can be RU486 (e.g., Yu et al. (2002) Mol Genet Genomics 268:169-178). Various other virus or carrier cell/expression modulator combinations known in the art can also be included in the combinations provided herein.

In some examples, the combination can contain nanoparticles. Nanoparticles can be designed to carry one or more therapeutic agents provided herein. Additionally, nanoparticles can be designed to carry molecules that target the nanoparticles to tumor cells. In one non-limiting example, nanoparticles can be coated with a radionuclide and, optionally, an antibody immunoreactive with a tumor-associated antigen.

In some instances, the combination includes one or more additional therapeutic and/or diagnostic viruses or other therapeutic and/or diagnostic microorganisms (e.g., therapeutic and/or diagnostic microorganisms) for diagnosis or treatment. (bacteria) can be contained. Exemplary therapeutic and/or diagnostic viruses are known in the art and include, but are not limited to, therapeutic and/or diagnostic poxviruses, herpesviruses, adenoviruses, adeno-associated viruses, and rheoviruses. Contains viruses. Exemplary oncolytic viruses are described herein above.

3． Kits The CAVES, pharmaceutical compositions or combinations provided herein can be packaged as a kit. Kits can optionally include one or more components such as instructions for use, equipment and additional reagents, and components such as tubing, containers and syringes for carrying out the methods. Exemplary kits can include a CAVES system provided herein, and optionally instructions for use, a device for detecting carrier cells and/or viruses in a subject, and for administering the CAVES to a subject. or a device for administering additional drugs or compounds to the subject.

In one example, the kit can include instructions. The instructions typically include specific language describing the CAVES system and, optionally, other components included in the kit, as well as the appropriate conditions of the subject, appropriate conditions for administering the carrier cells and virus. Methods of administration, including methods of determining dosages and appropriate methods of administration. The instructions can also include guidance for monitoring the subject over the course of treatment.

In another example, a kit can include a device for detecting carrier cells and/or viruses in a subject. Devices for detecting carrier cells and/or viruses in a subject include, for example, low-light imaging devices for detecting light emitted from luciferase or fluoresced from fluorescent proteins, such as green or red fluorescent proteins. , magnetic resonance measurement equipment such as MRI or NMR equipment, tomography scanners such as PET, CT, CAT, SPECT or other related scanners, ultrasound equipment, or proteins expressed by carrier cells and/or viruses within the subject. Other devices that can be used for detection may be included. Typically, the kit's device will be able to detect one or more proteins expressed by the kit's carrier cells and/or viruses. A variety of carrier cells, viruses and detection devices, including carrier cells or viruses expressing luciferase and a low light imager, or carrier cells or viruses expressing a fluorescent protein such as green or red fluorescent protein and a low light imager. Any of the kits can be included in the kits provided herein.

The kits provided herein can also include a device for administering the CAVES system to a subject. Any of a variety of devices known in the art for administering medicaments, pharmaceutical compositions, and vaccines can be included in the kits provided herein. Exemplary devices include, but are not limited to, hypodermic needles, intravenous needles, catheters, needleless injection devices, inhalers, and liquid dispensers such as eye drops. For example, a CAVES system that is delivered systemically, eg, by intravenous injection, can be included in a kit that includes a hypodermic needle and syringe. Typically, the device for administering the CAVES of the kit will be compatible with the carrier cells and viruses of the kit; for example, a needle-free injection device, such as a high-pressure injection device, will provide CAVES that are not damaged by high-pressure injection. However, they are not typically included in kits containing CAVES, which are damaged by high-pressure injection.

The kits provided herein can also include devices for administering additional agents or compounds to a subject. Any of a variety of devices known in the art for administering pharmaceutical agents to a subject can be included in the kits provided herein. Exemplary devices include, but are not limited to, hypodermic needles, intravenous needles, catheters, needleless injection devices, inhalers, and liquid dispensers such as eye drops. Typically, the device for administering the compound of the kit will be compatible with the desired method of administering the compound. For example, compounds to be delivered systemically or subcutaneously can be included in a kit that includes a hypodermic needle and syringe.

The kits provided herein can also include any device for applying energy, such as electromagnetic energy, to a subject. Such devices include, but are not limited to, lasers, light emitting diodes, fluorescent lamps, dichroic lamps and light boxes. The kit can also include a device that provides internal exposure of energy to the target, such as an endoscope or fiber optic catheter.

E. COMBINATION (ADD) THERAPY ADMINISTRATED WITH CAVES CONTAINING THE CAVES PROVIDED HEREIN FOR DELIVERING ONCOLYTIC VIRUS EXPRESSION/REPLICATION SYSTEM TO A SUBJECT IN NEED OF VIROTHERAPY. The composition or kit can be used alone or in further combination with other therapies or treatments. Any of the therapeutic proteins described in Section B for modifying oncolytic viruses, such as therapeutic antibodies and immune checkpoint inhibitors, can also be administered in addition to or in place of separate treatments. . Further co-formulation or co-administration of the combinations or compositions provided herein with, before, intermittently, or after treatments such as other therapeutic or pharmacological agents or procedures. can do. For example, such agents may include, but are not limited to, other biologics, anti-cancer drugs, small molecule compounds, dispersants, anesthetics, checkpoint inhibitors, vasoconstrictors, surgery, radiation. , chemotherapeutic agents, biological agents, polypeptides, antibodies, peptides, small molecules, gene therapy vectors, viruses and DNA, and combinations thereof. Such agents can also include one or more agents to ameliorate, reduce or prevent side effects. In some cases, combination therapy can be used in combination with one or more cancer treatments that remove the primary tumor or immunosuppress the subject prior to treatment. For example, additional chemotherapy or radiation therapy can be used in addition to the combination therapy provided herein. Such additional therapy can have the effect of weakening the subject's immune system. In other instances, surgical removal and/or immune system weakening therapy may not be necessary. Exemplary other methods that can be combined therein include treating tumors or neoplasms without weakening the immune system (e.g., by administering tumor suppressor compounds or by administering tumor cell-specific compounds). This includes administering a compound that reduces the rate of cell proliferation or administering an angiogenesis inhibiting compound.

The second agent or treatment preparation can be administered at once or can be divided into several smaller doses for administration at timed intervals. The selected agent/treatment preparation can be administered in one or more doses over the course of the treatment time, eg, over hours, days, weeks or months. In some cases, continuous administration is useful. It is understood that the precise dosage and course of administration will depend on the indication and patient tolerance. Generally, dosing regimens for the second agent/treatment herein are known to those skilled in the art.

For example, combination therapies provided herein include, but are not limited to, immune costimulatory agonists (e.g., B7 family (CD28, ICOS); TNFR family (4-1BB, OX40, GITR, CD40, CD30); , CD27); LIGHT, LTα); BiTE; CAR-T cells targeting tumor-specific antigens, adaptive T cell therapies, e.g. NK-92 cell lines, and TCR transgenic T cells; co-stimulatory molecules, single chain Therapeutic antibodies, including antibodies, Avastin, aflibercept, vanicizumab, dual antibodies, antibody-drug conjugates, checkpoint inhibitors (targets include PD-1, PD-2, PD-L1, PD-L2, CTLA -4, IDO 1 and 2, CTNNB1 (β-catenin), SIRPα, VISTA, LIGHT, HVEM, LAG3, TIM3, TIGIT, Galectin-9, KIR, GITR, TIM1, TIM4, CEACAM1, CD27, CD40/CD40L, CD48 , CD70, CD80, CD86, CD112, CD137 (4-1BB), CD155, CD160, CD200, CD226, CD244 (2B4), CD272 (BTLA), B7-H2, B7-H3, B7-H4, B7-H6, ICOS, A2aR, A2bR, HHLA2, ILT-2, ILT-4, gp49B, PIR-B, HLA-G, ILT-2/4 and OX40/OX-40L, MDR1, Arginase 1, iNO, IL-10, TGF -β, pGE2, STAT3, VEGF, KSP, HER2, Ras, EZH2, NIPP1, PP1, TAK1 and PLK1a); and chemotherapeutic compounds and antibodies.

Exemplary chemotherapeutic compounds and antibodies for administration in addition to the virotherapy provided herein include cytokines, chemokines, growth factors, photosensitizers, toxins, anticancer antibiotics, chemotherapeutic compounds, Radionuclides, angiogenesis inhibitors, signal transduction modulators, antimetabolites, anticancer vaccines, anticancer oligopeptides, mitotic inhibitor proteins, antimitotic oligopeptides, anticancer antibodies, anticancer Antibiotics and immunotherapeutic agents may be included.

Exemplary anti-cancer agents and agents for treating cancer patients that may be administered after, concurrently with, or prior to administration of the combination therapies herein include, but are not limited to: , acivicin; avicin; aclarubicin; acodazole; acronin; adzelesin; aldesleukin; alemtuzumab; alitretinoin (9-cis-retinoic acid); allopurinol; altretamine; albocidib; ambazone; ; anastrozole; anaxilone; ancitabine; anthramycin; apadicone; argimesna; arsenic trioxide; asparaginase; asperlin; atrimustine; azacitidine; azetepa; azotomycin; vanoxantrone; vatabulin; batimastat; bexarotene; bevacizumab; bicalutamide; vietaserpine; bicodar; bisantrene; bisantrene; bisnafide dimesylate; vizelesin; bleomycin; bortezomib; brequinal; carmofur; carmustine and polyfeprosan; carmustine; carubicin; carzelesin; cedefingol; celecoxib; cemadin; chlorambucil; sioteronel; sirolemycin; cisplatin; cladribine; clanfenul; clofarabine; Tinomycin; darbepoetin alfa; daunorubicin liposome; daunorubicin/daunomycin; daunorubicin; decitabine; denileukin diftitox; dexnigludipine; dexonnaplatin; dexrazoxane; Docetaxel; Dofequidar; Doxifluridine; Doxorubicin liposome; Doxorubicin HCL; Doxorubicin HCL liposome injection; Doxorubicin; Droloxifene; Dromostanolone propionate; Duazomycin; Ecomustine; Edatrexate; Edotecarin; Eflornithine; Elacridar; Elinafide; Elliott Solution B; elsamitrucin; emitefur; enloplatin; enpromate; enzastaurin; epipropidine; epirubicin; epoetin alfa; eptaloprost; elbrozole; esorbicin; estramustine; etanidazole; etoglucide; Etpurine; Exemestane; Exislinde; Fadrozole; Fazarabine; Fenretinide; Filgrastim; Floxuridine; Fludarabine; Fluorouracil; 5-fluorouracil; Fluoxymesterone; Flurocitabine; Fosquidone; Garocitabine; Gemcitabine; Gemtuzumab/Ozogamycin; Gelokinol; Gimatecan; Gimeracil; Gloxazone; Glufosfamide; Goserelin acetate; Hydroxyurea; Ibritumomab/tiuxetan; Interferon alpha-2a; Interferon alpha-2b; Interferon alpha; Interferon beta; Interferon gamma; Interferon; Interleukin-2 and other interleukins (including recombinant interleukins); Intoprisin; Iobenguan [131-I]; Iproplatin; Irinotecan; Irsogladine; Ixabepilone; Ketotrexate; L-alanosine; Lanreotide; Lapatinib; Redoxantrone; Letrozole; Leucovorin; Leuprolide; Leuprorelin (Leuprorelide); Levamisole; Lexacalcitol; Liarozole; Lobaplatin; Lometrexol lomustine/CCNU; lomustine; lonafarnib; rosoxantrone; raltotecan; mafosfamide; mannosulfan; marimastat; masoprocol; maytansine; mechlorethamine; mechlorethamine/nitrogen mustard; megestrol acetate; megestrol; melengestrol; melphalan; melphalan lL-PAM; menogalil; mepithiostane; mercaptopurine; 6-mercaptopurine; mesna; methecinde; methotrexate; metoxsalen; metomidate; metoprine; metledepa; miboplatin; miproxifen; misonidazole; mitindomide; mitocalcin; mitoguazone; mitomarsine; mitomycin C; mitomycin; mitonafide; mitoxidone; mitosper; mitotane; mitoxantrone; mitozolomide; mibobulin; Nocodazole; Nofetumomab; Nogaramycin; Noratrexed; Nortopixantrone; Octreotide; Oprelvequin; Ormaplatin; Ortataxel; Periomycin; Peritrexol; Pemetrexed; Pentamustine; Pentostatin; Pepromycin; Perfosfamide; Perifosine; Picoplatin; Pinafide; Pipobroman; Piposulfan; Pirfenidone; Piroxantrone; Pixantrone; Previtrexed; ; promestane; porfimer sodium; porfimer; porphyromycin; prednimustine; procarbazine; propamidine; prospidium; pumitepa; puromycin; pyrazofrine; quinacrine; ranimustine; rasburicase; sabarubicin; safingole; sargramostim; satraplatin; sebriplatin; semustine; simtrazene; schizophyllan; sobuzoxan; sorafenib; sparphosate; sparfosic acid; ; streptovaricin; streptozocin; sfosfamide; slofenur; sunitinib malate; 6-thioguanine (6-TG); tasedinaline; talc; Temoporfin; temozolomide; teniposide/VM-26; teniposide; teloxylon; testolactone; thiamipurine; thioguanine; thiotepa; thiamipurine; thiazofrine; tyromisole; tyrolone; (ecteinacidin 743); trastuzumab; trestron; tretinoin/ATRA; triciribine; trilostane; trimetrexate; triplatine tetranitrate; triptorelin; trophosfamide; tubrozole; ubenimex; uracil mustard; uredepa; Vindesine; Vinepidine; Vinflunine; Vinformide; Vingricinate; Vinleucinol; Vinleucin; Vinorelbine; Vinlosidine; Vintriptol; Vinzolidine; Vorozole; ) [2-H]; dinostatin; zoledronate; zorubicin; and zosuquidar, e.g.

aldesleukin (e.g., PROLEUKIN®); alemtuzumab (e.g., CAMPATH®); alitretinoin (e.g., PANRETIN®); allopurinol (e.g., ZYLOPRIM®); altretamine (e.g., HEXALEN®); amifostine (e.g. ETHYOL®); anastrozole (e.g. ARIMIDEX®); arsenic trioxide (e.g. TRISENOX®); asparaginase (e.g. ELSPAR BCG raw (e.g. TICE® BCG); bexarotene (e.g. TARGRETIN®); bevacizumab (AVASTIN®); bleomycin (e.g. BLENOXANE®); Intravenous busulfan (e.g., BUSULFEX®); Oral busulfan (e.g., MYLERAN®); Calsterone (e.g., METHOSARB®); Capecitabine (e.g., XELODA®); Carboplatin (e.g. , PARAPLATIN®); carmustine (e.g. BCNU®, BiCNU®); carmustine and polyfeprosan (e.g. GLIADEL® Wafer); celecoxib (e.g. CELEBREX®) ); chlorambucil (e.g. LEUKERAN®); cisplatin (e.g. PLATINOL®); cladribine (e.g. LEUSTATIN®, 2-CdA®); cyclophosphamide (e.g. CYTOXAN®, NEOSAR®); cytarabine (e.g. CYTOSAR-U®); cytarabine liposomes (e.g. DepoCyt®); dacarbazine (e.g. DTIC-Dome): dactinomycin ( For example, COSMEGEN®); darbepoetin alfa (e.g. ARANESP®); daunorubicin liposomes (e.g. DANUOXOME®); daunorubicin/daunomycin (e.g. CERUBIDINE®); denileukin diffti Tox (e.g., ONTAK®); Dexrazoxane (e.g., ZINECARD®); Docetaxel (e.g., TAXOTERE®); Doxorubicin (e.g., ADRIAMYCIN®, RUBEX®); Doxorubicin liposomes, including doxorubicin HCL liposome injections (e.g., DOXIL®); dromostanolone propionate (e.g., DROMOSTANOLONE® and MASTERONE® injections); Elliott B solutions (e.g., Elliott B fluids) )); Epirubicin (e.g. ELLENCE®); Epoetin alfa (e.g. EPOGEN®); Estramustine (e.g. EMCYT®); Etoposide phosphate (e.g. ETOPOPHOS®) ); etoposide VP-16 (e.g., VEPESID®); exemestane (e.g., AROMASIN®); filgrastim (e.g., NEUPOGEN®); floxuridine (e.g., FUDR®); )); fludarabine (e.g., FLUDARA®); fluorouracil containing 5-FU (e.g., ADRUCIL®); fulvestrant (e.g., FASLODEX®); gemcitabine (e.g., GEMZAR®); Gemtuzumab/ozogamicin (e.g., MYLOTARG®); Goserelin acetate (e.g., ZOLADEX®); Hydroxyurea (e.g., HYDREA®); Ibritumomab/tiuxetan (e.g., ZEVALIN®); Idarubicin (e.g., IDAMYCIN®); Ifosfamide (e.g., IFEX®); Imatinib mesylate (e.g., GLEEVEC®); Interferon alpha-2a (e.g., ROFERON-A ( Interferon alpha-2b (e.g., INTRON A®); Irinotecan (e.g., CAMPTOSAR®); Letrozole (e.g., FEMARA®); Leucovorin (e.g., WELLCOVORIN®); LEUCOVORIN®); levamisole (e.g. ERGAMISOL®); lomustine/CCNU (e.g. CeeBU®); mechlorethamine/nitrogen mustard (e.g. MUSTARGEN®); acetic acid megestrol (e.g. MEGACE®); melphalan/L-PAM (e.g. ALKERAN®); mercaptopurines including 6-mercaptopurine (6-MP; e.g. PURINETHOL®) ; mesna (e.g., MESNEX®); methotrexate; methoxsalen (e.g., UVADEX®); mitomycin C (e.g., MUTAMYCIN®, MITOZYTREX®); mitotane (e.g., LYSODREN®); mitoxantrone (e.g., NOVANTRONE®); nandrolone phenylpropionate (e.g., DURABOLIN-50®); nofetumomab (e.g., VERLUMA®); oprelvequin (e.g., NEUMEGA®); ); Oxaliplatin (e.g., ELOXATIN®); Paclitaxel (e.g., PAXENE®, TAXOL®); Pamidronate (e.g., AREDIA®); Pegademase (e.g., ADAGEN Peg-asparagase (e.g. ONCASPAR®); Pegfilgrastim (e.g. NEULASTA®); Pentostatin (e.g. NIPENT®); Pipobromane (e.g. VERCYTE Plicamycin/mithramycin (e.g. MITHRACIN®); Porfimer sodium (e.g. PHOTOFRIN®); Procarbazine (e.g. MATULANE®); Quinacrine (e.g. ATABRINE ®); rasburicase (e.g., ELITEK®); rituximab (e.g., RITUXAN®); sargramostim (e.g., PROKINE®); streptozocin (e.g., ZANOSAR®) ; sunitinib malate (e.g. SUTENT®); talc (e.g. SCLEROSOL®); tamoxifen (e.g. NOLVADEX®); temozolomide (e.g. TEMODAR®); teniposide/ VM-26 (e.g., VUMON®); testolactone (e.g., TESLAC®); thioguanine, including 6-thioguanine (6-TG); thiotepa (e.g., THIOPLEX®); topotecan ( For example, HYCAMTIN®); toremifene (e.g., FARESTON®); tositumomab (e.g., BEXXAR®); trastuzumab (e.g., HERCEPTIN®); tretinoin/ATRA (e.g., VESANOID ); uracil mustard; barbicin (e.g., VALSTAR®); vinblastine (e.g., VELBAN®); vincristine (e.g., ONCOVIN®); vinorelbine (e.g., NAVELBINE®) ); and zoledronate (eg, ZOMETA®).

As used herein, exemplary checkpoint inhibitors that can be administered after, concurrently with, or prior to administration of a therapy include, but are not limited to, anti-CTLA4 agents, anti-PF-1 Exemplary agents include the following:

Additional treatments administered in combination for virotherapy provided herein include one or more immunosuppressants, e.g., glucocorticoids (e.g., prednisone, dexamethasone, hydrocortisone); calcineurin inhibitors (e.g., cyclosporine, tacrolimus); mTOR inhibitors (e.g. sirolimus, everolimus); methotrexate; lenalidomide; azathioprine; mercaptopurine; fluorouracil; cyclophosphamide; TNFα blocking antibodies (e.g. infliximab/Remicade, etanercept/Enbrel, adalimumab/Humira) and fludarabine.

F. Modes of Administration of CAVES for Treatment The cell-assisted viral expression systems (CAVES) provided herein can be administered to subjects, including subjects having tumors or having neoplastic cells, for treatment. . The CAVES administered can be the CAVES provided herein or any other CAVES produced using the methods provided herein. In some instances, the carrier cells/cell medium used in CAVES are autologous (i.e., derived from the patient) or allogeneic cells (i.e., not derived from the patient) that are stem cells, immune cells, or cancer cells. be. Carrier cells can be sensitized, for example, to enhance viral amplification capacity, block the induction of an antiviral state, protect against allo-inactivation/rejection determinants, protect against complement, or carrier cells for example, to target poorly permissive tumor cells that do not respond to the antiviral state induced by interferon, that evade allogeneic recognition by T cells, NK cells, and NKT cells, that express immunosuppressive factors of human or viral origin. It can be engineered to express cancer- or stem cell-derived factors that sensitize to oncolytic virus infection, as well as to express factors that interfere with the function of complement and neutralizing antibodies. In some instances, the administered virus has attenuated pathogenicity, low toxicity, preferential accumulation in tumors, the ability to activate an immune response against tumor cells, high immunogenicity, replication capacity and exogenous protein ( Viruses include features such as the ability to express immunomodulatory and immunotherapeutic proteins (including antibodies to checkpoint inhibitors, and agonists of co-stimulatory molecules), and combinations thereof.

a. Administration of irradiated or non-irradiated CAVES
Carrier cells used in CAVES can be irradiated before or after infection with oncolytic viruses. In order to use transformed cells as cell carriers for oncolytic virus therapy, uninfected cells must be prevented from establishing new metastatic growth after administration. This can be achieved by gamma irradiation of carrier cells before or after viral infection and before administration; gamma irradiation eliminates tumorigenic potential but maintains metabolic activity and inhibits virus production/amplification and release. No effect. For example, carrier cells can be irradiated up to 24 hours prior to viral infection, or up to 24 hours after viral infection.

The amount of radiation can be selected by one of skill in the art depending on any of a variety of factors, including the nature of the carrier cells and viruses in the CAVES. The radiation dose can be sufficient to inactivate carrier cells and prevent tumor formation without affecting viral infection, amplification and release. For example, the amount of radiation can be about 5Gy, 10Gy, 15Gy, 20Gy, 25Gy, 30Gy, 35Gy, 40Gy, 45Gy, 50Gy, 100Gy, 120Gy, 150Gy, 200Gy, 250Gy, 500Gy or more.

b. Route of administration
CAVES can be delivered or administered to a subject locally or systemically. For example, modes of administration include, but are not limited to, systemic, parenteral, intravenous, intraperitoneal, subcutaneous, intramuscular, transdermal, intradermal, intraarterial (e.g., hepatic artery infusion), intravesicular perfusion, intrapleural, intraarticular, topical, intratumoral, intralesional, endoscopic, multipuncture (e.g. used in smallpox vaccines), inhalation, transdermal, subcutaneous, intranasal, intratracheal, oral, Intracavitary (eg, administration to the bladder via catheter, administration to the intestines via suppositories or enemas), vaginal, rectal, intracranial, intraprostatic, intravitreal, otic, ocular or topical administration.

One skilled in the art can select any mode of administration that is compatible with the subject and the CAVES, which also reduces the likelihood that the CAVES will reach and invade target cell types or tissues, such as tumors and/or metastases. is high. The route of administration can be selected by one of skill in the art depending on any of a variety of factors, including the nature of the disease, the characteristics of the target cells or tissues (eg, tumor type), and the particular CAVES being administered. Administration to a target site can be carried out by ballistic delivery, for example as a colloidal dispersion, or systemic administration can be carried out by injection into an artery.

c. Devices Any of the various devices known in the art for administering pharmaceuticals, pharmaceutical compositions, and vaccines can be used to administer CAVES. Exemplary devices include, but are not limited to, hypodermic needles, intravenous needles, catheters, needleless injection devices, inhalers, and liquid dispensers such as eye drops. For example, a Qaudra-Fuse™ multi-pronged injection needle (Rex Medical, Conshohocken, PA) can be used.

Typically, devices for administering CAVES are compatible with CAVES; for example, needle-free injection devices, such as hyperbaric injection devices, can be used with CAVES that are not damaged by high-pressure injection. , typically not used with CAVES, which are damaged by high-pressure injection. Also provided herein are devices for administering additional agents or compounds to a subject. Any of a variety of devices known in the art for administering pharmaceuticals to a subject can be used. Exemplary devices include, but are not limited to, hypodermic needles, intravenous needles, catheters, needleless injection devices, inhalers, and liquid dispensers such as eye drops. Typically, the device for administering the compound will be compatible with the desired method of administering the compound. For example, compounds delivered systemically or subcutaneously can be administered with a hypodermic needle and syringe.

d. Dosages of Administration Dosage regimens can be in any of a variety of ways and amounts and can be determined by one of skill in the art according to known clinical factors. As is known in the medical field, the dosage for any given patient depends on the species, size, body surface area, age, sex, immune capacity and general health of the subject, the particular CAVES being administered, the duration and route of administration. may depend on many factors, including the type and stage of the disease, eg, tumor size, and other treatments or compounds, such as chemotherapy drugs, that are administered at the same time. In addition to the factors listed above, such levels can be influenced by the infectivity and amplification capacity of the virus and the nature of the CAVES, as can be determined by one skilled in the art.

In this method, the appropriate minimum dosage level and dosing regimen of CAVES can be at a level sufficient for the CAVES to deliver the virus to the target site and for the virus to survive, grow and replicate in the tumor or metastasis. Generally, between 100,000 and 1 billion unmodified, sensitized, protected or genetically engineered allogeneic or autologous carrier cells at a multiplicity of infection (MOI) of 0.01 or greater are used for the co-culture screening and analysis provided herein. CAVES are generated by infecting ex vivo with any suitable oncolytic virus, including those selected based on the method. For example, the carrier cells may have an MOI of at least or about 0.01 to at least or about 10.0, or from at least or about 0.01, 0.02, 0.03, 0.04 or 0.05 to at least or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 , 0.9, 1.0, 2.0, 3.0, 4.0 or 5.0, such as at least or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, Infected at MOI of 0.7, 0.8, 0.9, 1.0 or higher. The infected carrier cells are then incubated for a period of at least or about 6 hours to at least or about 72 hours or more to produce CAVES. For example, incubation times to generate CAVES range from at least or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 hours to at least or about 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or may be 72 hours or more. In some embodiments, the MOI is 0.1 and the incubation time to generate CAVES is at least or about 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 or 48 hours or more. For example, the MOI is 0.1 and the incubation time to generate CAVES is about 38 to about 42 hours, such as about 38, 39, 40, 41 or 42 hours. In exemplary embodiments, the MOI is 0.1 and the incubation time to generate CAVES is approximately 28 hours; in some embodiments, the MOI is 0.5 and the incubation time to generate CAVES is approximately 28 hours; The incubation time is about 18 to about 24 hours, such as about 18, 19, 20, 21, 22, 23 or 24 hours. In any of the foregoing embodiments, the cell carrier is a stem cell, e.g. MSC cells or cultured AD-MSC (derived from CD34+ SA-ASC), or epiadventitial adipose stromal cells (SA-ASC; CD235a- /CD45-/CD34+/CD146-/CD31-) or pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-) or subpopulations thereof. In further embodiments, the virus is vaccinia virus (VACV), such as ACAM1000 or ACAM2000; in some embodiments, the VACV is ACAM2000 having the sequence set forth in SEQ ID NO: 70, or CAL1 virus with the sequence shown.

In the compositions and methods provided herein, cell carriers/CAVES are selected that produce at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pfu/cell. For example, cell carriers/CAVES are selected that produce at least or at least about 10, at least or at least about 100, at least or at least about 1,000 or more pfu/cell. Generally, the virus is administered at least once over the administration cycle in an amount that is at least or about or exactly 1 x ¹⁰⁵ pfu. Exemplary minimum levels for administering the virus to a 65 kg human are at least about 1 x 10 ⁵ plaque forming units (pfu), at least about 5 x 10 ⁵ pfu, at least about 1 x 10 ⁶ pfu, at least about 5 ×10 ⁶ pfu, at least about 1 × 10 ⁷ pfu, at least about 1 × 10 ⁸ pfu, at least about 1 × 10 ⁹ pfu, or at least about 1 × 10 ¹⁰ pfu. For example, the virus may be administered at least once over the cycle of administration, at least or about or exactly 1 x ¹⁰⁵ pfu, 1 x ¹⁰⁶ pfu, 1 x ¹⁰⁷ pfu, 1 x ¹⁰⁸ pfu, 1 x ¹⁰⁹ pfu, 1 x 10 Administered in an amount that is ¹⁰ pfu, ^1x1011 pfu, ^1x1012 pfu, ^1x1013 pfu, or ^1x1014 pfu.

e. Regimens In dosing regimens, the amount of CAVES can be administered as a single dose or multiple times over a dosing cycle. Accordingly, the methods provided herein can include a single administration of CAVES to a subject or multiple administrations of CAVES to a subject. In some instances, a single administration is sufficient to deliver and establish the virus within the tumor, where the virus can proliferate and cause or enhance an anti-tumor response in the subject; such methods , does not require additional administration of CAVES to cause or enhance the anti-tumor response in question, e.g. inhibiting tumor growth, inhibiting metastasis growth or formation, reducing tumor size, eliminating tumors or metastases, neoplasia It can inhibit or prevent disease recurrence or new tumor formation, or provide other cancer therapy effects.

In other examples, CAVES can be administered on different occasions, typically separated in time by at least one day. For example, CAVES can be administered two, three, four, five, or six or more times with one or more days, two or more days, one week or more, or one month or more between administrations. Separate administration can increase the likelihood of delivering the virus to the tumor or metastases if previous administration was ineffective in delivering the virus to the tumor or metastases. Separate administration can increase the location on the tumor or metastases where viral propagation can occur, or can increase the titer of virus that accumulates in the tumor, thereby increasing the host's antitumor immune response. inducing or enhancing the magnitude of release of antigen or other compounds from a tumor and optionally increasing the level of viral-based oncolysis or tumor cell death. Separate administration of CAVES can further expand the subject's immune response to viral antigens, thereby expanding the host's immune response to tumors or metastases in which the virus has accumulated, and potentially allowing the host to mount an anti-tumor immune response. can increase sex.

If separate administrations are performed, each administration can be the same or different dosages compared to the dosages of the other administrations. In one example, all doses are the same. In other examples, the first dose is a greater dose than the one or more subsequent doses, such as at least 10 times greater, at least 100 times greater, or at least 1000 times greater than the subsequent dose. Can be done. An example of a method of separate administration in which the first dose is greater than one or more subsequent doses, wherein all subsequent doses are the same or less than the first dose. Can be done.

Separate administrations can include any number of administrations greater than or equal to 2, including 2, 3, 4, 5 or 6 administrations. Those skilled in the art will be able to determine the number of doses to perform one or more additional doses or to perform the same according to methods known in the art for monitoring treatment methods and other monitoring methods provided herein. The desirability of doing so can be easily determined. Accordingly, the methods provided herein include methods of providing one or more doses of CAVES to a subject, where the number of doses is determined by monitoring the subject and providing one or more additional doses based on the results of the monitoring. This can be determined by determining whether to provide administration. The decision to provide one or more additional doses depends on, but is not limited to, signs of tumor growth or inhibition of tumor growth, emergence of new metastases or inhibition of metastases, and the subject's antiviral antibody potency. based on a variety of monitoring results, including the subject's anti-tumor antibody titer, the subject's overall health, the subject's weight, the presence of the virus only in tumors and/or metastases, and the presence of the virus in normal tissues or organs. be able to.

The period between administrations can be any of a variety of periods. The period between administrations depends on various factors, including monitoring steps described with respect to the number of doses, the period during which the subject mounts an immune response, the period during which the subject clears the virus from normal tissues, or the period of viral multiplication in tumors or metastases. can be any function. In one example, the period of time can be a function of the period of time during which the subject mounts an immune response; for example, the period of time is longer than the period during which the subject mounts an immune response, such as more than about 1 week, more than about 10 days, It can be more than about 2 weeks, or more than about 1 month; in another example, the period of time is less than the period of time during which the subject mounts an immune response, such as less than about 1 week, less than about 10 days, about 2 It can be less than a week, or less than about a month. In another example, the period of time can be a function of the period of time during which the subject clears the virus from normal tissue; for example, the period of time is longer than the period during which the subject clears the virus from normal tissue, e.g., more than about one day. , more than about 2 days, more than about 3 days, more than about 5 days, or more than about 1 week. In another example, the time period can be a function of the period of viral proliferation in the tumor or metastasis; for example, the time period results in a detectable signal in the tumor or metastasis following administration of a virus expressing a detectable marker. For example, about 3 days, about 5 days, about 1 week, about 10 days, about 2 weeks, or about 1 month.

For example, an amount of CAVES is administered two, three, four, five, six or seven times over a dosing cycle. This amount of CAVES is administered on the first day of the cycle, on the first and second days of the cycle, on each of the first three consecutive days of the cycle, on each of the first four consecutive days of the cycle, and on each of the first five consecutive days of the cycle. It can be administered on each of the first 6 consecutive days or on each of the first 7 consecutive days of the cycle. Generally, dosing cycles are 7, 14, 21 or 28 days. Depending on the patient's response or prognosis, cycles of administration are repeated over months or years.

In general, an appropriate maximum dose level or dosing regimen for CAVES is a level that is not toxic to the host, does not cause more than 3-fold splenomegaly, and that causes viral colonization of normal tissues or organs after about 1 day, or about 3 days, or about 7 days. or at a level that does not result in plaque.

G. Treatment Methods and Monitoring in Conjunction with Treatment Administering the cell-assisted viral expression systems provided herein to facilitate the delivery of virus, or CAVES, to treat a subject with a proliferative or inflammatory disease or condition. Provided herein are methods of treatment by treating. In particular, the condition is associated with immune privileged cells or tissues. Diseases or conditions associated with immune-privileged cells or tissues include, for example, cancerous cells, neoplasms, tumors, metastases, cancer stem cells, and other immune-privileged cells or tissues, such as the treatment of wounds and wound or inflamed tissue. Includes proliferative disorders or conditions, including (such as inhibition). In certain examples of such methods, the CAVES provided herein are administered by intravenous administration for systemic delivery. In other examples, the CAVES provided herein are administered by intratumoral injection. In embodiments, the subject has cancer. Any of the CAVES provided herein can be used to provide virotherapy to a subject in need thereof, including sensitized cell media, protected cell media, engineered cell media. and CAVES containing compatible cell media, which are further screened by matching assays as described in U.S. Provisional Patent Application No. 62/680,570 and U.S. Patent Application No. 16/536,073. can include.

The CAVES provided herein can be administered by a single injection, multiple injections, or sequentially. For example, CAVES can be administered by slow infusion, including using an intravenous pump, syringe pump, intravenous drip, or slow injection. For example, continuous administration of CAVES can occur for a period of minutes to hours, eg, just or about 1 minute to 1 hour, eg, 20 to 60 minutes.

Cancers amenable to the treatment and detection methods described herein also include cancers that metastasize. It is understood by those skilled in the art that metastasis is the spread of cells from a primary tumor to non-contiguous sites, usually via the bloodstream or lymphatics, establishing secondary tumor growth. Examples of cancers for which treatment is contemplated include, but are not limited to, solid tumors and hematologic malignancies such as melanoma, including choroidal and cutaneous melanoma, bladder cancer, non-small cell lung cancer, small cell Lung cancer, lung cancer, head and neck cancer, breast cancer, pancreatic cancer, gum cancer, tongue cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, ovarian cancer, cervical cancer , gastrointestinal cancer, lymphoma, brain cancer, colon cancer, rectal cancer, choriocarcinoma, glioma, carcinoma, basal cell cancer, biliary tract cancer, central nervous system (CNS) cancer, connective tissue cancer. Cancers of the digestive system, endometrial cancer, esophageal cancer, eye cancer, gastric cancer, intraepithelial neoplasia, kidney cancer, laryngeal cancer, leukemia, and liver cancer. Hodgkin lymphoma, non-Hodgkin lymphoma, myeloma, neuroblastoma, oral cancer, retinoblastoma, rhabdomyosarcoma, respiratory system cancer, sarcoma, skin cancer, stomach cancer, Testicular cancer, thyroid cancer, uterine cancer, urinary system cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma , myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, hepatocellular carcinoma, mesothelioma, astrocytoma, glioblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma Cytoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, sexually transmitted disease tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, cornea Squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, gastric tumor, adrenal carcinoma, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, hepatocellular carcinoma, lung Adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliosis, nephroblastoma, B cell lymphoma, lymphocytic leukemia, retinoblastoma, liver neoplasm, lymphosarcoma plasmacytoid leukemia, swim bladder sarcoma (fish), caseation lymphadenitis, lung carcinoma, insulinoma, sarcoma, neuroma, islet cell tumor, gastric MALT lymphoma, gastric adenocarcinoma, squamous cell carcinoma of the lung, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma, ulcerative squamous cell carcinoma Cancer, foreskin cancer, connective tissue neoplasms, and any other tumor or neoplasm that has metastasized or is at risk of metastasis.

The subject of the methods provided herein can be any subject, such as an animal or plant subject, including mammalian or avian species. For example, an animal subject can be a human or non-human animal, including, but not limited to, domestic animals and farm animals such as pigs, cows, goats, sheep, horses, cats, or dogs. In certain examples, the animal subject is a human subject. In a particular example, the human subject is a pediatric patient.

The methods provided herein can further include one or more of monitoring the subject, monitoring the tumor, and/or monitoring CAVES/virus administered to the subject. Monitoring includes, but is not limited to, monitoring tumor size, monitoring anti-(tumor antigen) antibody titers, monitoring the presence and/or size of metastases, monitoring the subject's lymph nodes, monitoring the subject's weight or blood or urine markers. various health indicators, including monitoring anti-(viral antigen) antibody titers, monitoring viral expression of detectable gene products, and direct monitoring of viral titers in tumors, tissues or organs of interest. Any monitoring step can be included in the methods provided herein.

The purpose of monitoring may be to assess the health status of the subject or the progress of the subject's therapeutic treatment, or to determine whether further administration of the same or a different CAVES/virus is warranted, or to administer the compound. The compound may act to increase the effectiveness of the therapeutic method, or the compound may be administered to the subject in order to determine when or whether to administer the compound to the subject. It can act to reduce the pathogenicity of the virus.

The size of tumors and/or metastases may be monitored by any of a variety of methods known in the art, including external assessment methods such as the detection methods described herein or tomographic or magnetic imaging methods. can. Additionally, for example, the methods provided herein for monitoring gene expression (eg, viral gene expression) can be used to monitor the size of tumors and/or metastases.

Monitoring tumor size over several time points can provide information regarding the effectiveness of the treatment methods provided herein. Additionally, monitoring an increase or decrease in the size of a tumor or metastasis can also provide information regarding the presence (i.e., detection and/or diagnosis) of additional tumors and/or metastases in a subject. Monitoring tumor size over several time points can provide information regarding the development of a neoplastic disease in a subject, including the effectiveness of treatments for the neoplastic disease in the subject, such as treatments provided herein.

The methods provided herein can also include monitoring antibody titers in the subject, including antibodies produced in response to administration of CAVES. For example, CAVES/viruses administered in the methods provided herein can elicit an immune response against endogenous viral antigens. CAVES/viruses administered in the methods provided herein can also elicit an immune response against exogenous genes expressed by the CAVES/viruses. CAVES/viruses administered in the methods provided herein can also elicit an immune response against tumor antigens. Monitoring antibody titers against viral antigens, exogenous gene products expressed by viruses, or tumor antigens can be used as a method for monitoring viral toxicity, monitoring the effectiveness of treatment methods, or for producing and producing gene products or antibodies. / or can be used in methods of monitoring harvest.

In one example, monitoring antibody titers can be used to monitor viral virulence. Antibody titers against viruses can vary over a period of time after administration of CAVES/virus to a subject, and at certain times low anti-(viral antigen) antibody titers can be indicative of high toxicity, while others At this point, high anti-(viral antigen) antibody titers can indicate high toxicity. The viruses used in the methods provided herein can be immunogenic and thus can elicit an immune response immediately after administering the CAVES/virus to a subject.

In general, a virus that allows a subject's immune system to quickly mount a strong immune response can be a virus that has low virulence if the subject's immune system is able to clear the virus from all normal organs or tissues. Therefore, in some instances, high antibody titers against viral antigens immediately after administering CAVES/virus to a subject can indicate low toxicity of the virus. In contrast, viruses that are not highly immunogenic can infect host organisms without eliciting strong immune responses, resulting in high virulence of the virus to the host. Thus, in some instances, high antibody titers against viral antigens immediately after administering CAVES/virus to a subject can indicate low toxicity of the virus.

In other examples, monitoring antibody titers can be used to monitor the effectiveness of treatment methods. In the methods provided herein, antibody titers, such as anti-(tumor antigen) antibody titers, can be indicative of the effectiveness of a therapeutic method, such as a therapeutic method for treating a neoplastic disease. The therapeutic methods provided herein can include eliciting or enhancing an immune response against the tumor and/or metastases. Thus, by monitoring anti-(tumor antigen) antibody titers, it is possible to monitor the effectiveness of therapeutic methods in eliciting or enhancing an immune response against tumors and/or metastases.

The methods of treatment provided herein can also include administering to the subject CAVES that can accumulate in tumors and that can elicit or enhance antiviral or anticellular media/anti-CAVES immune responses. can. It is therefore possible to monitor the ability of the host to mount an immune response against viruses or CAVES accumulated in tumors or metastases, which can indicate that the subject has also mounted an anti-tumor immune response, or may indicate that the subject is likely to mount an anti-tumor immune response, or may indicate that the subject is capable of mounting an anti-tumor immune response.

The methods provided herein can also include methods of monitoring the health of a subject. Some of the methods provided herein are methods of treatment, including methods of treating neoplastic diseases. As is known in the art, monitoring of a subject's health can be used to determine the effectiveness of a treatment method. The methods provided herein can also include administering to a subject a CAVES provided herein. Monitoring of the subject's health can be used to determine the pathogenicity of the virus in the CAVES when administered to the subject. Any of a variety of health diagnostic methods for monitoring diseases such as neoplastic diseases, infectious diseases or immune-related diseases can be monitored, as is known in the art. For example, a subject's weight, blood pressure, pulse, respiration, color, temperature, or other observable condition can be indicative of the subject's health. Additionally, the presence or absence or level of one or more components in a sample from a subject can be indicative of the subject's health. Typical samples can include blood and urine samples, where the presence or absence or level of one or more components can be determined, for example, by performing a blood panel or urine panel diagnostic test. can. Exemplary components indicative of a subject's health include, but are not limited to, white blood cell count, hematocrit, or reactive protein concentration.

H. Types of Cancers Treated The systems (CAVES) and methods provided herein can be used to treat any type of cancer or metastasis, including solid tumors and hematological malignancies. Tumors that can be treated by the methods disclosed herein include, but are not limited to, bladder tumors, breast tumors, prostate tumors, carcinomas, basal cell carcinomas, biliary tract cancers, bladder cancers, Bone cancer, brain cancer, CNS cancer, glioma tumor, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophagus Cancer, eye cancer, head and neck cancer, gastric cancer, intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, Neuroblastoma, oral cavity cancer, ovarian cancer, pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer Cancer, thyroid cancer, uterine cancer, and cancers of the urinary system, such as lymphosarcoma, osteosarcoma, mammary gland tumors, mastocytoma, brain tumors, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchus. Adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma , neuroblastoma, osteoclastoma, oral neoplasm, fibrosarcoma, osteosarcoma and rhabdomyosarcoma, genital squamous cell carcinoma, venereal disease tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangioectiocytoma, Histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma , cystadenoma, follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma, and squamous cell carcinoma of the lung, leukemia, hemangioectiocytoma, ocular neoplasm, foreskin fibrosarcoma, ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, Mast cell tumor, hepatocellular carcinoma, lymphoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma, liver neoplasm, Includes lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, lymphoma, sarcoma, salivary gland tumor, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma.

In some embodiments, the tumor is metastatic melanoma; esophageal and gastric adenocarcinoma; cholangiocarcinoma (any stage); pancreatic adenocarcinoma (any stage); gallbladder cancer (any stage); Mucinous appendiceal cancer (any stage); high-grade gastrointestinal neuroendocrine cancer (any stage); mesothelioma (any stage); soft tissue sarcoma; prostate cancer; renal cell carcinoma; small cell lung cancer non-small cell lung cancer; head and neck squamous cell carcinoma; colorectal cancer; ovarian cancer; hepatocellular carcinoma; and glioblastoma. In some embodiments, the tumor is selected from glioblastoma, breast cancer, lung cancer, prostate cancer, colon cancer, ovarian cancer, neuroblastoma, central nervous system tumors, and melanoma.
I. Example

The following examples are included for illustrative purposes only and are not intended to limit the scope of the subject matter.

Example 1
Vaccinia virus has tumor selectivity and can be used as a scaffold to express recombinant viruses with therapeutic genes

This example demonstrates that CAL1 virus, a vaccinia virus obtained by amplifying ACAM2000, is tumor selective and can be used to engineer recombinant viruses expressing therapeutic genes.

Materials and methods (1) Virus and cell culture
CAL1 was amplified from ACAM2000 according to a previously described method using CV-1 cells (Monath et al., Int. J. of Infect. Dis. 8 (2004)). CAL2, in which TurboFP635 was inserted at the intergenic site, was genetically engineered from CAL1 as described in Example 8 below. PC3, DU145, E006AA, and HPrEC cells were purchased from ATCC (Manassas, VA). PC3 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS). DU145 cells were maintained in low glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 2mM L-glutamine and 10% FBS. E006AA cells were maintained in DMEM supplemented with 10% FBS. HPrEC cells were grown by addition of Prostate Epithelial Cell Growth Kit with 6mM L-glutamine, 0.4% Extract P, 1.0μM epinephrine, 0.5ng/mL rh TGF-α, 100ng/mL hydrocortisone, 5 μg/mL rh insulin and 5 μg/mL rh insulin. Maintained in Prostate Epithelial Cell Basal Medium supplemented with mL apo-transferrin. CV-1 cells were maintained in high glucose DMEM supplemented with 1% antibiotic solution (Life Technologies, Carlsbad, CA), 2mM L-glutamine, and 10% heat-inactivated FBS. Cells were grown in an incubator at 37°C, 5% _CO2 , and a humidified atmosphere.

(2) Virus amplification assay Cells were seeded at 90%-100% confluency in 0.5 mL of appropriate medium containing 2% FBS in 24-well dishes. Four to five hours after plating, cells were replicated and synchronously infected with CAL1 at MOIs of 0.01 and 0.1. At 24 h postinfection, infected cell samples from two MOI wells of each cell line were collected by scraping with the rubber head of a 1 mL syringe, transferred to 1.5 mL tubes, and stored at −20°C until analysis by plaque assay. The same process was repeated on dishes at 48, 72 and 96 hours. Samples were frozen and thawed three times before performing plaque assays.

(3) Plaque assay
CV-1 cells were seeded at 2×10 ⁵ cells/well in 24-well plates one day before the assay. Samples were serially diluted 1:10 in Dulbecco's modified Eagle's medium supplemented with 2% fetal calf serum (FCS) (DMEM2), and 200 μL of each dilution or DMEM2 alone was dispensed into wells in duplicate. After 1-2 hours of incubation, 1 mL of carboxymethylcellulose overlay medium was added to each well and the plates were incubated at 37°C and 5% _CO2 for 48+/-6 hours. Cells were stained using crystal violet for 1-4 hours. Once staining was complete, the staining solution was aspirated and the wells were washed twice for 1 min with 1 mL of water and air-dried. Plaques were quantified macroscopically or by microscopic evaluation as appropriate.

(4) CAL1 in a heterologous human prostate tumor model system
2.5×10 ⁶ PC3 cells were inoculated subcutaneously into the right flank of 4- to 6-week-old athymic nude male mice. Once the tumors reached an average volume of approximately 150 mm ³ (between 100 and 200 mm ³ ), mice were randomized based on tumor size to CAL1 treatment groups with 1 × 10 ⁶ or 1 × 10 ⁷ PFU, or PBS alone ( (n = 10/group). Treatment was delivered intratumorally and tumor size was measured twice weekly for 14 days. On day 15, animals were sacrificed, tissue samples were collected (e.g., blood, tumor, kidney (paired), liver, lung, intestine, prostate, testis, bladder, spleen, brain, and heart), and the samples were subjected to protease inhibition. (cOmplete ^™ Mini Protease Inhibitor Cocktail (Cat. No. 11836153001 Roche), Millipore Sigma, Burlington, MA) and then stored frozen in liquid nitrogen.

(5) Biodistribution analysis The cryopreserved samples were thawed at 37°C in a water bath, and the tissue samples were disrupted by vigorous vortexing. Samples from 5 animals per treatment dose (1×10 ⁶ or 1×10 ⁷ PFU of CAL1) and 3 mock-treated animals (negative control) were used for the following analysis. All samples were analyzed by plaque assay as described above. Samples were also prepared for qPCR according to the DNeasy Blood and Tissue kit protocol by Qiagen (Germantown, MD). The DNA concentration of the samples (Sigma-Aldrich, St. Louis, MO) was determined using a DNA quantification kit, a fluorescent assay. The prepared samples were used for the following qPCR analysis.

(6) Real-time semi-quantitative PCR
Prepared PC3 tumor xenograft samples were analyzed by real-time semi-quantitative PCR (qPCR) performed using a LightCycler® instrument (Roche, Penzberg, Germany). The Roche diagnostics SYBR Green kit manual was adapted for use with the PowerUp ^™ SYBR ^™ Green Master Mix (Thermo Fisher Scientific, Waltham, MA). Optimal settings were determined by PCR reactions at various settings using a reference plasmid containing the A56R gene from VACV with known limits of detection (LOD) and limits of quantification (LOQ). In addition to quantification, melting curve analysis was performed at the end of each run to distinguish between template amplification, matrix effects, or nonspecific reactions. Equal amounts of DNA from tissue samples were used in the reactions. All experimental reactions were performed in duplicate.

The pUC57 plasmid containing a single copy of the A56R ORF from ACAM2000 was used as a positive control to generate a standard curve for the qPCR assay and the A56R primers:
5'-CATCATCTGGAATTGTCACTACTAAA-3' (SEQ ID NO: 91) and
5'-ACGGCCGACAATATAATTAATGC-3' (SEQ ID NO: 92)
cDNA was amplified using

Quantification was performed using the LightCycler® Data Analysis software version 3.45 as described in the operator's manual (Roche, Penzberg, Germany).

(7) Guide RNA
Guide RNA (gRNA) target sequence (5'-CGAGGAAAAGCTGTAGTTAT-3'; SEQ ID NO: 95; target sequence of gRNA1 having the sequence shown in SEQ ID NO: 1) (target intergenic locus: between ORF-157 and ORF-158 ) was analyzed using online software (dna20.com/eCommerce/cas9/input). gRNA was constructed under the control of the U6 promoter in a lentiviral vector with antibiotic resistance to puromycin (Vector Builder, Shenandoah, TX).

(8) Donor Vector Construction of the donor vector is described in Example 8. The right (555 bp) and left (642 bp) homologous regions (HR) of the intergenic locus (271 bp) between ORF_157 and ORF_158 were selected based on the ACAM2000 DNA genome sequence (Genebank: AY313847). Multiple cloning sites were added to each end of each HR to allow insertion of the therapeutic gene of interest. TurboFP635 was flanked by the vaccinia virus early-late promoter (pEL) and the vaccinia outer signal. The three constructed fragments (HR-left, TurboFP635, and HR-right) were synthesized (GeneWiz, San Diego, CA) and cloned using the In-Fusion® Cloning Kit (Takara Bio USA, Mountain View, CA). Cloned into pUC18 vector. Donor plasmids were confirmed by Sanger sequencing (Retrogen, San Diego, CA).

(9) Cas9HFc vector
A plasmid containing the Cas9HF1 sequence was synthesized by Vector Builder (Shenandoah, TX) without nuclear localization (Kleinstiver et al., Nature 529:490-495 (2016)).

(10) Transfection and virus infection On the day before transfection, 2×10 ⁶ CV-1 cells were seeded in a 6-well plate. Cells at 60-70% confluence were transfected with Cas9HFc using 6 μl of TurboFectin 8.0 transfection reagent (Origene Technologies, Rockville, MD) in 250 μl of opti-DMEM (Thermo Fisher Scientific, Waltham, MA). and 1 μg of each of the plasmids encoding gRNA. 24 hours after transfection, cells were infected with CAL1 VACV at an MOI of 0.02 in high glucose DMEM supplemented with 2% FBS. Two hours after virus infection, cells were washed with PBS. 1.5 mL of DMEM was added to the wells and the plate was incubated with _CO2 at 37°C for 30 min before transfection with 2 μg of the donor vector described above. Cells were further incubated for 24 hours at 37°C, 5% _CO2 and a humidified atmosphere. The infected/transfected cell mixture was harvested and stored at -80°C until virus purification and screening.

(11) Virus purification The infected/transfected cell mixture was thawed and then sonicated three times on ice for 30 seconds at maximum volume to release the virus from the cells. 2 μl of released virus per plate was used to infect four confluent CV-1 cell layers in 6-well plates. Two days after infection, 4-6 positive (red) plaques were picked under a 2x fluorescence microscope and transferred to a cryovial containing 200 μl of serum-free DMEM. The purification process was repeated 2-4 times to obtain pure clones.

(12) PCR
Insertion of the transgene was confirmed as described in Example 8 below. To confirm the insertion of the transgene (TurboFP635) at the intergenic locus, a primer pair was designed to amplify the entire intergenic region:
Primers for reverse 5'-GACGAAGAAGCAAGAGATTGTGT-3' (SEQ ID NO: 41) located in the left and right HR; and forward 5'-ACCGTTTCCATTACCGCCA-3' (SEQ ID NO: 42).

PCR products of purified clones were analyzed by Sanger sequencing (Retrogen, San Diego, CA).

Results (1) CAL1 sequence The original clone vaccine ACAM2000 was amplified using CV-1 cells, and the obtained derivative was named CAL1. Next generation sequencing (NGS) was used to determine whether there are genetic differences between CAL1 and the parent ACAM2000 vaccine. The results show that i) within the non-coding region of the inverted terminal repeat (ITR) sequence at position 32 of the CAL1 genome, when compared with the published ACAM2000 sequence (SEQ ID NO: 70), GBAY313847, CAL1 (SEQ ID NO: 71); It had a single nucleotide polymorphism (SNP), ii) 6 bp shortened in the left ITR, and iii) 197 bp shortened in the right ITR.

(2) Tumor selectivity of CAL1 CAL1 virus amplification was measured using prostate cancer-derived human tumor cell lines PC3, DU145, and E006AA, and the non-tumor human primary prostate epithelial cell line HPrEC for comparison. The African green monkey kidney cell line CV-1 used to produce CAL1 was included as a positive control. Briefly, cells were infected with CAL1 at an MOI of 0.01 and 0.1. Amplification of live virus particles was examined in cell lines by plaque assay at 24, 48, 72, and 96 hours. After 96 hours, viral amplification in infected cells was compared and analyzed between tumor cells (e.g., PC3, DU145, and E006AA) and non-tumor cells (e.g., HPrEC). Analysis showed that all human tumor cell lines exhibited higher viral amplification at both the MOI and all times tested compared to non-tumor cell lines. Human tumor cell line E006AA showed the highest viral amplification of CAL1. PC3 and DU145 tumor cells showed similar levels of viral amplification, with amplification in PC3 cells being slightly (less than 2-fold) higher than in DU145. Non-tumor HPrEC cells showed the least amount of CAL1 amplification (approximately 5-10 times less than DU145 cells and approximately 50 times less than E006AA cells). These results demonstrate the finding of preferential amplification of CAL1 in tumor-derived cell lines compared to primary (non-tumor) cells derived from the same tissue.

(3) Intratumoral administration of CAL1 induces tumor regression A heterologous human prostate tumor model system was used to analyze the anticancer therapeutic potential of CAL1. Briefly, prostate tumors were generated by subcutaneous injection of 2×10 ⁶ invasive metastatic human prostate cancer PC3 cells into the right flank of 4-6 week old athymic nude mice. When the tumor volume was measured to be approximately ¹⁵⁰ mm on average (15 days after injection of PC3 cells; treatment day 0), mice were given 1 × 10 ⁶ or 1 × 10 ⁷ PFU of CAL1, or PBS as a control. Intratumoral injections (n=10/treatment). After injection, tumor volumes were measured twice a week for the duration of the experiment (up to day 15 after treatment). Results showed that a single intratumoral injection of CAL1 induced significant inhibition of human PC3 tumor growth, with 1 × 10 ⁶ PFU of CAL1 reducing tumor size of approximately 800 mm ³ and 1 × 10 ⁷ on day 15. The control tumor size was measured to be approximately 1450 mm ³ compared to the tumor size of approximately 550 mm ³ in PFU CAL1. Despite the immunocompromised background of the animals, therapeutic efficacy was found not to be associated with treatment-related mortality or decreased safety.

(4) Intratumorally injected CAL1 does not cause systemic viremia Analyze the biodistribution and viral amplification ability of CAL1 to determine tumor selectivity and assess whether there are negative effects on normal tissues did. The athymic nude mice described above were sacrificed 15 days after treatment. Twelve tissue samples were collected per animal (blood, tumor, brain, heart, kidneys (paired), liver, lungs, intestines, bladder, prostate, testis) and cryopreserved in liquid nitrogen. Samples were tested by plaque assay as well as real-time semi-quantitative PCR (qPCR). The presence of viral DNA or infectious particles was analyzed in animals treated with 1 x 10 ⁶ or 1 x 10 ⁷ PFU of CAL1 (n = 5 for each dose), with non-virus treated animals used as negative controls. (n=3). Analysis revealed a significant amount of virus in the PC3 tumors of all infected animals treated with CAL1 compared to normal tissues of the animals. Specifically, plaque assays showed live virus particles, while qPCR analysis showed high levels of viral DNA in treated PC3 tumors. The amount of virus in tumor tissue was significantly higher than in any of the other tissues or organs tested (10 ⁴ -10 ⁵ pfu/mg virus in treated PC3 tumors compared to 0 - 300 pfu/mg virus in normal tissue). mg virus; 10 ⁶ to 10 ⁸ copies of viral DNA per PC3 tumor sample compared to background levels in normal tissue samples), indicating an acceptable safety profile for CAL1 after intratumoral administration.

(5) Increased therapeutic potential in virus strains engineered from CAL1 High-fidelity cytosolic Cas9 protein (Kleinstiver, B.P., et al., High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects The 92bp fragment found in the intergenic region between ORF_157 and ORF_158 was replaced by TurboFP635 using a CRISPR/Cas9 system with .Nature 529(7587):490-495 (2016); see Example 8). The resulting recombinant virus was manipulated. PCR and Sanger sequencing confirmed the insertion of TurboFP635 in the resulting recombinant virus, which was named CAL2. Furthermore, microscopic analysis of clones derived from CV-1 transfected cells showed that TurboFP635 was successfully inserted into the engineered CAL2 recombinant VACV.

Co-infection of cells at MOI of 0.01 or 0.1 in prostate cancer-derived human tumor cell lines PC3, DU145 and E006AA and non-tumor human primary prostate epithelial cell line HPrEC, samples at 24, 48, 72 and 96 hours post infection. Viral amplification of CAL1 and CAL2 was compared by collection, freezing/thawing of samples, infection of CV-1 cells for 1-2 hours, and quantification of plaques on CV-1 cells. CV-1 cells used to produce CAL2 were used as a positive control. Human tumor cell lines showed very high viral amplification for both CAL1 and CAL2, with levels of >10 plaque-forming units per cell. No significant differences in virus amplification were observed based on the MOI used for infection in all three human tumor cell lines tested. HPrECs showed minimal viral amplification in CAL1 and CAL2 compared to human tumor cell lines tested. The results demonstrate that introduction of an exogenous gene (such as the exemplary TurboFP635) into the intergenic site between ORF_157 and ORF_158 does not impair the natural tumor selectivity of CAL1 virus, and CAL1 and CAL2 Both show similar preferential amplification in tumor cells compared to non-tumor primary cells derived from the same primary tissue. The results show that CAL1 can be used as a scaffold to engineer recombinant viruses with therapeutic genes.

Example 2
Inactivation of vaccinia virus with human and dog serum

After in vivo administration of oncolytic viruses, such as vaccinia virus (VACV or VV) to humans and animals, in patients with a complement system and pre-existing immunity, neutralizing antibodies inactivate the administered virus and Creates an immune barrier to viral therapy. As demonstrated below, this barrier is present in human and dog serum, but the size of the barrier varies between species.

A. Viral plaque assay (VPA) to measure vaccinia virus inactivation
Inactivation of vaccinia virus in the presence of serum was measured by viral plaque assay (VPA). VPA is used to measure the viral titer or concentration of virus in a sample. For example, VPA can be used to quantify virus particle amplification under various conditions, e.g., live virus recovery after exposing virus to serum compared to control conditions where virus is not incubated with serum. can do.

Virus-containing samples were stored at -80°C and subjected to three freeze (-80°C)/thaw (+37°C) cycles, followed by three sonications over ice-cold water at 1-minute intervals. Process. The sonicated samples are serially diluted in vaccinia virus infection medium (DMEM supplemented with 2% FBS, L-glutamine and penicillin/streptomycin). Plaque assays are performed in 24-well plates in duplicate wells. Briefly, 200,000 CV-1 monkey kidney cells are plated in 1 mL of D10 medium per well overnight. Aspirate the supernatant and apply 200 μL/well of 10-fold serial dilutions of the virus-containing sample to the CV-1 monolayer. Incubate the plate for 1 hour at 37°C (incubator) with manual shaking every 20 minutes. Gently overlay 1 mL of CMC medium on top of the cells and incubate the plate for 48 h. CMC overlay medium was autoclaved with 15 g of carboxymethylcellulose sodium salt (Sigma-Aldrich, C4888) and resuspended in 1 L DMEM supplemented with penicillin/streptomycin, L-glutamine and 5% FBS with stirring overnight at RT. Prepare by clouding and store for short periods at 4°C. Crystal violet solution (1.3% Crystal Violet (Sigma-Aldrich, C6158), 5% Ethanol (Pure Ethanol, Molecular Biology Grade, VWR, 71006-012), 30% Formaldehyde (37%) for 3-5 hours at room temperature. Cells were fixed by covering the tops of the wells with v/v formaldehyde (Fisher, Cat. No. F79-9) and double-distilled water), followed by washing the plates with tap water and drying overnight. After fixation, count the plaques. Virus titer is calculated in plaque forming units (PFU) per sample.

B. Human serum inactivates vaccinia virus-based cancer vaccines Human serum (h1) from healthy unvaccinated donors was used to assess the inactivation of VACV in humans by complement and neutralizing antibodies. and human serum (h2) from healthy vaccinated donors were incubated with clinically relevant doses of plaque-purified ACAM2000 (wild-type thymidine kinase (TK)-positive Wyeth strain of VACV). Serum from h1 contained only complement, and serum from h2 contained complement and neutralizing antibodies because the donor had been previously immunized by vaccination against smallpox using vaccinia virus.

Briefly, 1 × 10 ³ plaque-forming units (pfu) of VACV were incubated with 100 μL of DMEM culture medium containing 90% human serum from donor h1 or h2 for 1 h at 37 °C. This concentration corresponds to a clinically relevant viral dose of 5×10 ⁷ pfu when injected intravenously in an adult human with a weight of 75 kg and 5 liters of blood. DMEM culture medium alone (no serum) was used as a control. To assess the specific role of complement on serum-mediated virus inactivation, VACV was also incubated with heat-inactivated sera from donors h1 and h2, where complement was denatured/non-functional.

After 1 h of incubation with serum, plaque assays were performed as described above, and the amount of PFU obtained when virus was incubated with serum in monolayers of CV-1 cells was compared to the amount of PFU obtained when virus was incubated with serum. The percentage of live virus recovered compared to the control (virus incubated without serum) was recorded by comparing to a control that did not. Serial dilutions were performed such that less than 3% human serum was present in any given dilution in the plaque assay. The results are shown in Table X1 below.

Results show that human serum from non-vaccinated (h1) and vaccinated (h2) donors inactivates VACV strain ACAM2000. This indicates that human serum represents a significant barrier to therapeutic efficacy, especially when oncolytic viruses are administered intravenously (I.V.) or intratumorally (IT.). Serum from vaccinated donors h2, which contained neutralizing antibodies in addition to complement, inactivated VACV to a greater extent than serum from h1, which did not contain neutralizing antibodies.

Heat inactivation of H1 and H2 sera, which denatures complement proteins and destroys complement activity, significantly reduces the extent of viral inactivation compared to H1 and H2 sera that were not heat inactivated. I let it happen. This confirms that the complement system plays a role in serum-induced virus inactivation. After heat inactivation of h1 serum that does not contain neutralizing antibodies, the percentage of live VACV recovered was higher than the percentage of VACV recovered from non-heat inactivated h1 serum. In contrast, heat inactivation of serum from vaccinated donor h2 containing complement and neutralizing antibodies resulted in only a small increase in live VACV recovered. Therefore, the presence of neutralizing antibodies and/or other serum components, in addition to complement, also plays a role in serum-induced VACV inactivation.

These results demonstrate that VACV is inactivated by human serum after in vivo administration and suggest that systems that protect VACV may be used to provide or enhance the efficacy of delivery and treatment with oncolytic viruses. Demonstrates necessity.

C. Dog serum inactivates vaccinia virus-based cancer vaccines Similar to the effects seen in humans, viral vaccines injected into dogs encounter an initial immune barrier that reduces the effectiveness of delivery and treatment. To investigate the effect of serum on VACV inactivation in dogs, a genetically engineered VACV LIVP strain encoding the fluorescent protein TurboFP635 (TK insertion), a strain interchangeably referred to as L14 or CAL14, was tested in three different dogs. and incubated with serum samples from

1×10 ³ pfu of CAL14 was incubated for 1 hour at 37° C. with 100 μL of DMEM containing 90% dog serum from 3 different donors (c1, c2 and c3). This concentration corresponds to an intravenous injection of 2×10 ⁷ pfu of VACV into a dog weighing 25 kg and having 2 liters of blood. Virus incubated with human serum from donors h1 and h2 (described above) was used as a positive control, and virus incubated with DMEM culture medium alone (no serum) was used as a negative control. To analyze the role of complement in serum-mediated inactivation of the virus, CAL14 was also incubated with heat-inactivated serum from dog and human donors. After 1 hour of incubation, the percentage of live virus recovered compared to the control (virus incubated without serum) was recorded using the plaque assay described above. The results are shown in Table X2 below.

Compared to the non-serum control (DMEM + CAL14 virus), the percentage of live virus recovered after serum incubation was reduced in all human and canine serum samples. These results indicate that human and dog serum inactivates CAL14 vaccinia virus. Heat inactivation of all serum samples reduced the extent of virus inactivation, demonstrating that the complement system plays a role in serum-mediated inactivation of viruses, as exemplified in dogs and humans. Canine serum is used to initially inactivate VACV after in vivo viral administration (I.V. or I.T.) and is a protective system for VACV to increase the efficacy of delivery and treatment in canine and human patients. Demonstrates necessity.

Example 3
Protective effects of human and canine mesenchymal stem cells against human and canine serum-induced inactivation of vaccinia virus

Initial inactivation by serum of oncolytic viruses administered in vivo poses an obstacle to oncolytic virus therapy. This inactivation can be partially compensated for or counteracted by increasing the injected dose of virus and/or by treating the patient systemically with complement inhibitors. However, these approaches can result in undesirable side effects and toxicity.

By delivering oncolytic viruses in carrier cells such as mesenchymal stem cells (MSCs), they can be protected from complement and other inactivating agents present in the blood or tumor microenvironment. Human stromal vascular cell populations (SVF) derived from whole lipoaspirate, as well as epiadventitial adipose stromal cells (SA-ASC), are expanded in culture to provide carrier cells for vaccinia and other viruses. Contains other populations capable of generating adipose-derived mesenchymal stromal cells and/or stem cells (AD-MSCs) that can be used as a source. The use of fresh SVF and AD-MSCs as cell-based carriers to protect VACV from serum-induced inactivation was evaluated in humans and dogs.

A. Preparation of SVF SVF from whole lipoaspirate reduces the need for extensive processing of cells, minimizing the number of steps and thereby reducing the risk of contamination. SVF contains mononuclear cells derived from adipose tissue and is obtained by a simple isolation procedure in which the fat is lipoaspirated and subjected to enzymatic digestion. Human SVF contains several different cell populations, including CD34+ SA-ASCs, which can adhere to and proliferate on cell culture plastic (generation of AD-MSCs described below). Given the abundance of MSC SA-ASC (AD-MSC precursor) in SVF preparations, SVF can be used to provide a cellular carrier for oncolytic viruses such as vaccinia virus.

The following protocol was used to isolate and prepare adipocytes and adipose stromal vascular cell populations. A local anesthetic containing 0.5% lidocaine and 1:400,000 epinephrine and 8.4% HCO ₃ titrated to pH 7.4 (typically 5 cc HCO ₃ in a total volume of 60 cc) is applied to the fat removed administered to the subject. The subject is then subjected to liposuction using cell harvesting and a closed system harvesting and processing system sold under the trademark Time Machine® by Cell Surgical Network® (CSN; Beverly Hills, Calif.). received treatment. The system includes a lipotreatment unit (airtight syringe for liposuction) and a 2.5-3 mm cannula. After liposuction, Bachitracin ointment and Bandaid® bandage were fixed over the wound along with a compression bandage.

Stromal vascular cell populations (SVF) containing ADSCs were prepared in a closed system according to the following protocol:
a. Closed systems for harvesting and processing adipose stem cells, such as the CSN Time Machine® extract the adipose harvest into a 60cc TP-101 syringe (single-use sterile airtight fat processing syringe)
b. Centrifuge at 2800 rpm for 3 minutes
c. Removes free fatty acids and necrotic tissue debris (local/blood) via TP-109 closed system
d. Transfer 25cc of concentrated fat to TP-102 syringe (SVF processing syringe)
e. 12. Add 25 cc of prewarmed (38°C) Roche T-MAX® Time Machine Accelerator (GMP grade collagenase) containing 5 Wunsch units of enzyme (1 Wunsch unit = 1000 collagen degrading units (CDU))
f. Incubate for 30-45 minutes at 38°C
g. Centrifuge at 200g for 4 minutes
h. Remove the supernatant except for the bottom 3-10cc
i. Add 50cc D5LR (lactated Ringer's solution and 5% dextrose) as wash solution to remove collagenase residue and centrifuge at 200g for 4 minutes.
j. Repeat 2 more times for a total of 3 washes.
k. Remove all supernatant fluid leaving behind 3-10 cc of pellet collection - this is the interstitial vascular cell population.
l. Transfer SVF through a 100 micron filter to a labeled 20cc syringe
m. Collect the SVF sample and determine cell number, viability, and ensure that there are no aggregates or debris.
n. Resuspend the cells in 10 mL of D5LR and dilute an aliquot 1:6 in transport medium supplemented with platelet extract.

B. Preparation of AD-MSCs Unsorted SVF cells in culture can be used to generate MSCs. CD34+SA-ASCs rapidly attach to cell culture plastic and, once activated, rapidly proliferate and generate AD-MSCs. To generate AD-MSCs, SVF cells were cultured in tissue culture-treated plastic with DMEM supplemented with 2mM glutamine and 5% stimulation (platelet extract) at 37°C, 5% _CO2 and a humidified atmosphere. did. SA-ASCs and other MSC precursors that adhered to the tissue culture treated plastic were removed the next day, and all unattached cells were removed.

The medium was aspirated and the MSCs attached to the tissue culture plastic were washed once with complete medium. Fresh complete medium as above was then added and the MSCs were further cultured for 1-2 weeks at 37° C., 5% CO ₂ and a humidified atmosphere. After a few days, the attached cells acquired a mesenchymal phenotype (now called AD-MSCs) and the cells began to proliferate exponentially. After 1-2 weeks, passage 0 cultures are generated, which are derived from 20-100 mL of fat (adipose tissue) obtained from miniliposomeization. The total number of cells generated is patient-dependent and will vary based on the amount of SVF cells initially placed in culture, but typically, when starting with 2-10 mL of SVF preparation, 1 × 10 ranging from ⁶ to 1×10 ⁸ cells, derived from 20 to 100 mL of adipose tissue obtained from miniliposomeization. Cells can be grown further to reach up to 1×10 ¹⁰ to 1×10 ¹⁴ cells.

C. Human SVF as a carrier cell to protect virus from human serum inactivation and facilitate delivery to tumor cells
We evaluated the ability of fresh human SVF cells (SVF) to protect VACV from inactivation by human serum and to deliver protected VACV to tumor cells. Freshly isolated SVF cells from two different healthy donors (#1 and #2) were infected with CAL14 vaccinia at a multiplicity of infection (MOI) of 1, taking into account all cells present in the SVF preparation. Virus was added. Cells and virus were incubated for 1 hour at 37°C with continuous rotation at 20 RPM. The SVF/virus mixture was then incubated with DMEM supplemented with 2mM glutamine and 20% human serum on a self-setting basis for 30 minutes in a 37°C water bath, and the cells were then washed four times with PBS to remove any free virus. Removed. Free virus (not loaded onto cells) was incubated for 30 min at the same concentration as human serum as a control. Free virus that was not incubated with serum was used as a positive control.

After incubation with human serum, 40,000 pfu of free CAL14 virus loaded on 40,000 SVF cells (MOI 1) or 40,000 pfu of CAL14 virus was added to A549 human lung cancer cell monolayers in 24-well plates at an MOI of 0.1. and incubated for 24 h at 37 °C and 5% _CO2 in a humidified atmosphere. Fluorescence microscopy on a KEYENCE All-in-one BZ-X700 series fluorescence microscope to detect TurboFP635 protein expression (TRITC channel) using a red filter to detect the expression of virus-encoded TurboFP635 protein in A549 cells 24 hours after treatment. expression levels were used as a direct measure of the amount of viral amplification in tumor cells.

The results demonstrate that free virus was inactivated by human serum from both donors and was not amplified in tumor cells, as evidenced by the decrease in detected fluorescence. On the other hand, vaccinia virus loaded in SVF cells was protected from serum inactivation and efficiently delivered to tumor cells, where it inhibited viral replication by observing the expression of TurboFP635 fluorescent protein encoded by CAL14 virus. Detected. Free virus that was not incubated with serum (positive control) showed strong virus amplification in tumor cells, indicating that the decrease in fluorescence observed in free virus + serum samples was due to virus inactivation by serum and free It was confirmed that this was not because the virus was not delivered to the tumor cells or was unable to replicate in the tumor cells.

Therefore, SVF obtained from liposuction, containing high amounts of SA-ASC (mesenchymal stem cell precursors), harbors viruses, protects them from neutralization/inactivation by human serum, and protects them from can be efficiently delivered to targeted tumor cells.

D. Protective effect of human AD-MSC cells against human serum inactivation and delivery of vaccinia virus to tumor cells. evaluated. CAL14 VV was mixed with AD-MSC cells from healthy human donors at an MOI of 1 and incubated for 1 hour at 37°C with continuous rotation at 20 RPM. The AD-MSC/virus mixture was then incubated for 30 minutes with 20% serum from a healthy donor in a homogeneous environment. Cells were then washed four times with PBS to remove any free virus. Free virus was incubated for 30 min at the same concentration as human serum as a control, and free virus not incubated with serum was used as a positive control.

After incubation with human serum, various treatments (free virus or MSC/VV) were added to A549 tumor cell monolayers in 24-well plates. 40,000 pfu of free CAL14 virus loaded on 40,000 AD-MSC cells (MOI 1) or 40,000 pfu of CAL14 virus was added to A549 human lung cancer cell monolayers in 24-well plates at an MOI of 0.1 in a humidified atmosphere. Incubated for 24 hours at 37°C, 5% _CO2 . Fluorescence microscopy on a KEYENCE All-in-one BZ-X700 series fluorescence microscope to detect TurboFP635 protein expression (TRITC channel) using a red filter to detect the expression of virus-encoded TurboFP635 protein in A549 cells 24 hours after treatment. expression levels were used as a direct measure of the amount of viral amplification in tumor cells.

The results demonstrate that free virus was inactivated by human serum from both donors and was not amplified in tumor cells, as evidenced by the significant decrease in detected fluorescence. In comparison, vaccinia virus loaded on AD-MSC cells was protected from serum inactivation and efficiently delivered to tumor cells, where it was detected by observing the expression of TurboFP635 fluorescent protein encoded by CAL14 virus. Viral replication was detected. Free virus that was not incubated with serum (positive control) showed strong virus amplification in tumor cells, indicating that the decrease in fluorescence observed in free virus + serum samples was due to virus inactivation by serum and free It was confirmed that this was not because the virus was not delivered to the tumor cells or was unable to replicate in the tumor cells.

Therefore, cultured AD-MSCs can harbor viruses, protect them from neutralization/inactivation by human serum, and efficiently deliver them to target tumor cells.

E. Protective Effect of Canine AD-MSCs on Inactivation of Vaccinia Virus by Canine Serum As in humans, the negative influence of serum on the successful delivery of vaccinia virus to canine tumors can be reversed by increasing the injection dose or can be reduced by treating systemically with complement inhibitors, which can lead to unwanted toxic side effects. We therefore evaluated the ability of cultured canine MSCs to harbor vaccinia virus and protect against serum inactivation.

CAL14 vaccinia virus was added to adipose-derived MSCs (AD-MSCs) from two different canine donors (MSC3 and MSC4) at an MOI of 1, and the mixture was incubated for 1 hour at 37°C with continuous rotation at 20 RPM. MSCs loaded with 1,000 pfu of vaccinia virus in 1,000 cells were then incubated with 90% dog serum in DMEM-supplemented medium for 1 h at 37 °C and 5% _CO2 in a final volume of 100 μL (1,000 cells). per piece). This concentration corresponds to a dose of 2×10 ⁷ pfu of vaccinia virus injected into a 25 kg dog with 2 liters of blood. For comparison, 1,000 pfu of free CAL14 virus (unprotected) was also incubated with 90% dog serum under the same conditions. As a control, virus-loaded MSCs and free virus were each incubated with serum-free DMEM under the same conditions for 1 hour. After a 1 hour incubation period, the percentage of vaccinia virus recovered relative to a non-serum-free virus control was quantified in pfu by plaque assay on CV-1 cell monolayers as described above. Serial dilutions were made to have less than 3% dog serum at any given dilution in the plaque assay. Each live infected cell produces one plaque, and each live free vaccinia virus particle forms one plaque. The results are shown in Table X3 below.

The results show that in the absence of serum (control with serum-free DMEM), free virus and MSC-loaded virus were not inactivated. However, in the presence of dog serum, free, unprotected virus was significantly inactivated, whereas loading the virus onto MSCs prior to incubation with serum provided some protection against the virus. It was done. These results indicate that adipose-derived canine MSCs can hide vaccinia virus and protect it from canine serum-induced inactivation.

F. Cultured canine AD-MSCs can enhance the delivery of vaccinia virus to tumor cells. evaluated its ability to deliver protected virus to tumor cells. CAL14 vaccinia virus was loaded into dog adipose-derived MSCs (AD-MSCs) from three different dogs (MSC1, MSC2 and MSC3) at an MOI of 1 and incubated with 90% dog serum for 1 hour as described above. Free vaccinia virus (unprotected) was incubated with dog serum under the same conditions. After incubation with serum, virus-loaded cells or free virus were added to A549 tumor cell monolayers at an MOI of 0.5. The final serum concentration in the A549-containing wells was 2%. As a control, each vaccinia virus treatment was incubated in serum-free DMEM. After 72 hours of incubation with tumor cells, the amount of vaccinia virus amplified by tumor cells was quantified by plaque assay on CV-1 cell monolayers as described above. The results are shown in Table XX below.

Results showed that tumor cells treated with free vaccinia virus (not protected by MSCs) pre-exposed to dog serum showed reduced viral amplification compared to free vaccinia virus not pre-exposed to serum. Show that. These results support the observed initial inactivation of the virus by dog serum. On the other hand, tumor cells loaded with vaccinia virus and treated with any of the three canine MSCs pre-exposed to canine serum showed efficient vaccinia virus amplification, which was consistent with non-inactivated free virus (incubated with DMEM). , no serum control). These results demonstrate that cultured canine MSCs can be used to protect vaccinia virus from serum inactivation and efficiently deliver it to tumor cells.

Example 4
SVF cell populations associated with ACAM2000 delivery and amplification

To characterize the SVF-based delivery system for vaccinia virus, we investigated the specific cell populations derived from SVF that harbor and deliver the virus to tumor cells.

A. SFV cell population equipped with ACAM2000
SVFs from three different human non-cancer donors (RMSD042, BHSD060 and RMSD043) were incubated with ACAM2000 for 1 hour at 37°C at an MOI of 1 with continuous rotation at 20 RPM. After loading SVF cells with ACAM2000, cells were labeled with a panel of antibodies against each of CD235a, CD45, CD34, CD31 and CD146 and stained for viability with propidium iodide (PI). Then, based on the expression of cell surface markers CD235a, CD45, CD34, CD31 and CD146, as well as the International Federation of Adipose Therapy Sciences (IFATS) and the International Society for Cell Therapy (ISCT) (Bourin et al. (2013) Cytotherapy 15:641-648) SVF cells were sorted by flow cytometry using a FACSAria™ Fusion flow cytometer (BD Biosciences, San Jose, CA) according to the recommendations of . Only viable cells (propidium iodide (PI) negative) were selected. Seven distinct cell populations: red blood cells (CD235a+); epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-), the main MSC precursor in culture; Pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-), which are also MSC precursors; granulocytes (CD235a-/CD45 medium/high, side scatter (SSC) high); lymphocytes (CD235a- /CD45 high, SSC low); monocytes (CD235a-/CD45 high SSC medium); and endothelial progenitor cells (CD235a-/CD45-/CD34+/CD146+/CD31+) were identified and sorted. The composition (%) of the main cell populations in the three SVF samples is shown in Table X4. The main mononuclear cell populations and their respective percentages in the three SVF samples are shown in Table X5.

Individual cell populations sorted from the SVF were then seeded onto A549 tumor cell monolayers and incubated with a carboxymethyl cellulose (CMC) layer for 3 days, thereby quantifying the plaques formed by the sorted infected cells. We were able to. After 3 days of incubation, the number of plaques formed on A549 monolayers was measured after fixation and staining with crystal violet to determine the number of cells from each sorted population that harbored ACAM2000. As shown in Table X6 below, five different cell populations were screened by flow cytometry and found to have ACAM2000. The main cell populations from the three SVF fractions harboring ACAM2000 were identified as SA-ASCs (MSC precursors) and pericytes.

B. SVF Cell Population Enables ACAM2000 Amplification As described in Example 3 above, SVF can protect vaccinia virus from serum-induced inactivation. Further investigation identified SA-ASCs (MSCs) and pericytes as the main mononuclear cells in the SVF cell population harboring vaccinia virus. Next, we determined an SVF cell population that can efficiently amplify vaccinia virus.

The main mononuclear cell population from fresh SVF preparations was sorted as described above. Individual live sorted populations of SA-ASCs (MSC precursors), pericytes, granulocytes, lymphocytes and monocytes were then added to 48 wells coated with CTS™ CELLstart™ Substrate (ThermoFisher Scientific). Plates were seeded and cultured in DMEM supplemented with 10% FBS and 2mM glutamine at 37 °C and 5% _CO2 in a humidified atmosphere. Sorted cells were immediately infected with TurboFP635-labeled vaccinia virus (CAL14) at an MOI of 1 for 5 days in cell culture. Fluorescence microscopy was used to detect fluorescent protein expression as an indicator of viral amplification.

Accumulation of TurboFP635 was found only in AD-MSC cells derived from SA-ASC sorted cells that adhered to cell culture plastic and expanded in culture starting from day 2. Significant fluorescence accumulation was detected 5 days after infection in AD-MSCs. These data demonstrate that AD-MSCs generated from SVF and cultured for several days allow amplification of vaccinia virus, increasing the number of therapeutic viral particles that can be delivered to the tumor site and thus increasing therapeutic efficacy. Show that.

Example 5
Cultured human and canine MSCs promote vaccinia virus amplification and expression of virus-encoded proteins

As demonstrated in the examples above, the use of fresh SVF and cultured adipose-derived MSCs (AD-MSCs) to harbor, protect, and deliver vaccinia virus to tumor cells is superior to the therapeutic use of vaccinia virus alone. brings about improvements. Also, as provided herein and shown (see, e.g., Example 7), the therapeutic efficacy of oncolytic viruses is enhanced when the viruses are amplified by carrier MSCs prior to delivery to the tumor site. , can be further increased.

As mentioned above, unsorted SVF cells in culture can generate MSC cultures. CD34+SA-ASCs rapidly attach to cell culture plastic and upon activation rapidly proliferate, increasing the number of vaccinia virus carrier cells. It is shown in Example 3 that cultured human MSCs and canine MSCs are able to protect vaccinia virus from serum inactivation and deliver the virus to tumor cells. As described in Example 4 above, CD34+ SA-ASCs were identified as the major cell population isolated from vaccinia virus-carrying SVF and enter into cultures that acquired the MSC mesenchymal phenotype. , amplify vaccinia virus.

Next, expanded human and canine MSCs (AD-MSCs) were also shown to amplify the virus, in addition to protecting the virus from serum inactivation and delivering the virus to tumor cells. Genetically engineered CAL14 VVs were used to evaluate the amplification level of vaccinia virus by AD-MSCs.

A. Viral amplification and viral protein expression in human cultured adipose-derived MSCs (AD-MSCs)

First, we determined whether human AD-MSCs are permissive to express and accumulate the fluorescent virus-encoded TurboFP635 protein by detecting fluorescence in infected cells. To do this, human adipose-derived AD-MSCs from three different donors (#1, #2 and #3) were treated with two different concentrations of CAL14 vaccinia virus at an MOI of 0.1 or an MOI of 1. , mixed in DMEM supplemented with 2% fetal bovine serum (FBS) and 2 mM glutamine for 3 h at 37 °C and 5% CO in _a humidified atmosphere. After 3 hours, the cell culture medium containing free virus was removed and replaced with fresh DMEM supplemented with 10% FBS and 2mM glutamine for 48 hours. Fluorescent signals were analyzed 48 hours after infection. MSCs from three donors that were not infected with CAL14 virus were used as controls.

Fluorescence microscopy results showed that MSCs from all three donors were capable of expressing fluorescent proteins, also indicating active viral amplification. The amount of fluorescent protein expressed varied among the three MSC samples. MSCs from donor #2 showed the highest level of fluorescence at both MOI values of 0.1 and 1, while MSCs from donor #3 showed the lowest level of fluorescence and MSCs from donor #1 showed an intermediate level of fluorescence. showed that. Therefore, MSCs from some donors exhibit a higher capacity for vaccinia virus amplification and/or viral protein expression than other donors. No fluorescence was observed in untreated MSC samples.

The amount of vaccinia virus amplified by the MSCs and released into the culture medium (supernatant), as well as the number of virus particles amplified but not released by the cells, were then quantified by plaque assay as described above. The results (Table X7) show that MSCs from all three donors amplified and released vaccinia virus, as shown by the presence of virus in the cells and supernatant. MSCs from three donors amplified and released virus to varying degrees: cells from MSC donor #2 showed the highest level of fluorescence at 24 and 48 hours, and the highest level of virus at 48 hours. was secreted (Table X7). Overall, cells derived from MSC donor #2 showed the highest level of total viral amplification at 48 hours, whereas cells derived from MSC donor #1 showed the lowest level of total viral amplification. These results indicate that MSCs from different donors exhibit varying levels of vaccinia virus amplification and/or virus-encoded protein expression. Low and high levels of viral amplification and viral protein expression can be advantageous, and MSCs with low levels of viral amplification and viral protein expression remain in the circulation longer upon intravenous (I.V.) administration. MSCs that are able to survive, while having higher levels of viral amplification and viral protein expression, can deliver higher doses of vaccinia virus to tumor cells.

B. Viral amplification and viral protein expression in canine cultured adipose-derived MSCs (AD-MSCs) As shown in Example 3, canine cultured MSCs protect vaccinia virus from serum inactivation and deliver it to tumor cells. can improve treatment efficacy compared to unprotected viruses. Next, it was revealed that canine cultured MSCs allow efficient virus amplification before delivery to the tumor site, thereby further improving their therapeutic utility.

CAL14 VV was used to assess the expression and accumulation of the virus-encoded fluorescent TurboFP635 protein in infected canine MSCs by analyzing the fluorescent signal. MSCs from three different donors (#1, #2 and #3) were cultured in DMEM supplemented with 2% fetal bovine serum (FBS) and 2 mM glutamine for 3 h at 37 °C in a humidified atmosphere with 5% _CO2. Two different concentrations of CAL14 vaccinia virus were loaded at an MOI of 0.1 or an MOI of 1. After 3 hours, the cell culture medium containing free virus was removed and replaced with fresh DMEM supplemented with 10% FBS and 2mM glutamine for 48 hours. Fluorescent signals were analyzed 48 hours after infection. MSCs from three canine donors that were not infected with the virus were used as controls. MSCs from all three dogs were found to exhibit fluorescent protein expression, indicating active viral amplification. Similar to the results obtained with human MSCs, the expression of virus-encoded fluorescent proteins was found to vary among the three canine MSC samples, indicating that some canine MSCs interact with vaccinia virus while others do not. This shows that the amplification is greater than the actual value. At both MOI values of 0.1 and 1, MSCs from donor #3 showed the highest level of fluorescence, and MSCs from donor #1 showed the lowest level. MSCs from donor #2 showed greater intermediate levels of fluorescence at an MOI of 1. Untreated MSC controls did not show any fluorescence.

The amount of vaccinia virus amplified and released into the culture medium (supernatant) by canine MSCs, as well as the number of virus particles amplified but not released, was then assessed by plaque assay as described above. The results are shown in Table X8 below. MSCs from all three dogs were found to amplify and release virus 48 hours after infection, but to varying degrees. MSCs from dog donor #3 secreted the most virus at 48 hours and showed the highest levels of fluorescence at 24 and 48 hours. MSCs from canine donor #2 showed the highest overall level of viral amplification at 48 hours. MSCs from canine donor #1 showed the lowest levels of viral amplification and fluorescent protein expression. These results indicate that each MSC line exhibits varying levels of viral amplification and expression and secretion of virus-encoded proteins. Both high and low levels of viral amplification and viral protein expression/secretion can be advantageous, and MSCs harboring vaccinia virus (MSC1) with lower levels of viral amplification and protein expression can be used intravenously (I .V.) can survive longer in the circulation when injected, while MSCs (MSC2, MSC3) with higher levels of virus secretion are more likely to survive when injected intratumorally (I.T.). Vaccinia virus can be delivered faster.

Example 6
Preservation of cells loaded with vaccinia virus

Standardization of processing requires generation of large numbers of MSCs loaded with vaccinia virus. Due to the nature of therapeutic agents (ie, living biological therapeutics/biologics), storage and distribution requirements are stringent. Virus-loaded MSCs must be aliquoted and stored under conditions that preserve therapeutic efficacy after long-term storage. For domestic distribution, the biological drug/therapeutic must be maintained for 2-3 days at a temperature that maintains its potency and stability, whereas for international distribution, that period is typically 7 to 7 days. ~10 days. Oncolytic virus-loaded cells provide long-term storage and thus provide a convenient and readily available "off-the-shelf" therapeutic.

A. Evaluation of protein expression levels in vaccinia virus-loaded MSCs after storage at 4 °C or liquid nitrogen
4°C (e.g. for transport) and The effectiveness of storage in liquid nitrogen (-196°C; frozen storage for long-term storage) was evaluated. Canine adipose-derived MSCs (MSC4) were incubated with a mixture of WT1-eGFP (i.e., CAL2-eGFP) and L3-TurboFP635 in a 1:1 ratio and an MOI of 1 for 37 h with continuous rotation at 20 RPM. Loaded for 2 hours at ℃. Cells were then washed twice with PBS to remove free virus. Virus-loaded MSC samples were divided into three parts: a) 100,000 live cells seeded in 6-well plates immediately after infection (“fresh cells”) without storage, as a control; b) at 4 °C. After storage for 2 days, 100,000 live cells were seeded in 6-well plates; c) frozen at a concentration of 5 million cells/mL of cell cryopreservation medium (Cryostor® CS10, BioLife Solutions) and in liquid nitrogen; 100,000 viable cells were stored for 2 days in DMEM and then thawed in DMEM and seeded into 6-well plates. The percent viability of the cells immediately before plating them was 96%, 80% and 82% for a), b) and c), respectively. Cells were cultured at 37°C for 48 hours. MSCs from all three conditions attached to the plastic in less than 1 hour, indicating a high degree of cell viability. No fluorescent signal was detected upon cell attachment in any of the three sections, indicating no virus amplification during storage. Forty-eight hours after plating, all fluorescence channels (green for CAL2 virus expressing eGFP, red for L3 virus expressing TurboFP635) were exposed for 1 second and the fluorescence signal was analyzed.

Fluorescence microscopy results showed that the expression levels of the fluorescent proteins eGFP and TurboFP635 encoded by CAL2 and L3 viruses, respectively, were similar in fresh MSCs and MSCs stored in liquid nitrogen, and this This indicates that cells can be cryopreserved for long-term storage without affecting their ability to amplify the virus. MSCs stored at 4°C showed a comparatively lower degree of viral protein expression and reduced levels of viral amplification.

B. Evaluation of virus amplification in vaccinia virus-loaded MSCs after storage at 4°C or liquid nitrogen. The amount of live virus particles in each of the three samples above (a, b and c) was determined after 24 and 48 hours. It was later quantified by plaque assay as described above. The results, summarized in Table X9 below, showed that storage in liquid nitrogen did not affect the inherent expansion potential of carrier MSC4 cells when compared to fresh cells. When virus-loaded cells were stored at 4°C for 2 days, vaccinia virus was still able to amplify, but to a reduced extent, compared to fresh and cryopreserved cells. Virus-loaded cells can therefore be cryopreserved to produce a convenient "off-the-shelf" therapeutic agent.

C. Delivery of vaccinia virus-loaded MSCs to tumor cells after storage in liquid nitrogen Next, canine MSC4 cells loaded with CAL2-eGFP and L3-TurboFP635 and stored in liquid nitrogen exhibited their therapeutic potential after thawing. Determine whether it has been maintained. Cells were loaded with virus and frozen for 2 days in liquid nitrogen as described above. The frozen vials were thawed at 37°C and the samples were immediately washed with DMEM supplemented with 10% fetal bovine serum (FBS) and 2mM glutamine. 100,000 viable cells were added to a 6-well plate containing 1 × 10 ⁶ MTH52c canine breast cancer cells and incubated for 48 h at 37 °C, 5% CO ₂ in a humidified atmosphere. As a control, fresh (unfrozen) dog adipose-derived MSC4 cells were freshly loaded as described above. Cells were then washed twice with PBS to remove free virus, and 100,000 live unfrozen cells were added to the dog tumor cells under the same conditions as frozen cells. Fluorescent signals were analyzed after 48 hours in green and red channels to detect CAL2-eGFP and L3-TurboFP635, respectively.

Results showed that virus-loaded MSCs frozen in liquid nitrogen delivered similar amounts of vaccinia virus to canine tumor monolayers as fresh, non-frozen virus-loaded MSCs, and virus-loaded MSCs in liquid nitrogen delivered similar amounts of vaccinia virus to dog tumor monolayers. It has been demonstrated that long-term storage of carrier cells is feasible. As a result, live biological treatments can be cryopreserved, allowing standardization and distribution, and facilitating their use in more cancer patients.

Example 7
Ex vivo culture of mesenchymal stem cells harboring vaccinia virus overcomes the immune system barrier presented by tumor cells and increases therapeutic efficacy

As shown above, carrier cells (such as MSCs) can protect vaccinia virus from serum-induced inactivation. In autologous and allogeneic situations, infected carrier cells are recognized and eliminated by humoral and cell-mediated immunity. Therefore, in a clinical scenario, cellular carriers can be eliminated by the immune system before the viruses can be amplified or their encoded proteins expressed, reducing the delivered dose and effectiveness of the treatment. This example demonstrates a solution to this problem. Cell carriers can be incubated with virus ex vivo for a period of time that facilitates viral amplification and concomitant expression of one or more viral immunomodulatory proteins, which provides additional protection against humoral and cell-mediated immunity. I will provide a. Exemplary vaccinia virus viral immunomodulatory proteins are shown in Table X10 below:

A. Effect of long incubation times on the viability and functionality of virus-loaded MSCs Vaccinia virus strain CAL2-Opt1, a genetically engineered CAL1 strain encoding the fluorescent protein TurboFP635, was cultured from human adipose in DMEM supplemented with 2mM glutamine. MSCs (AD-MSCs) were incubated at MOI 1 in suspension at 37°C with continuous rotation at 20 RPM for 1, 2, 6 and 24 hours. AD-MSCs were then collected 1, 2, 6, and 24 hours post-infection and cryopreserved to create treatment lots as described below. The treated lots collected 1 and 2 hours after infection were named MSC/VV-1 and MSC/VV-2, respectively. Treatment lots collected 6 and 24 hours after treatment have sufficient time for the virus to express immunomodulators in MSCs (i.e., ex vivo in the cell medium and not at the site of tumor delivery) These lots, referred to in the specification as "CAVES" (cell-assisted viral expression system), were named CAVES-6 and CAVES-24, respectively.

To generate MSC/VV-1 treated lots, cells incubated with VV for 1 hour were washed twice with PBS, cryopreserved in Cryostor® CS10, and stored as vials in liquid nitrogen for 1 week. . To generate MSC/VV-2 treatment lots, cells incubated with VV for 2 hours were washed twice with PBS, cryopreserved in Cryostor® CS10, and stored as vials in liquid nitrogen for 1 week. . To create CAVES-6 and CAVES-24 treatment _lots , AD-MSCs were incubated with VV for 2 h in continuous rotation and then supplemented with 2 mM glutamine and 5% platelet extract at 37 °C and 5% CO in a humidified atmosphere. Cultured in DMEM supplemented with At 4 or 22 hours after seeding, cells were trypsinized, washed twice with PBS, cryopreserved in Cryostor® CS10, and stored as vials in liquid nitrogen for 1 week.

The frozen vials were thawed at 37°C and the contents immediately washed with DMEM supplemented with 10% fetal bovine serum (FBS) and 2mM glutamine. Cell viability was analyzed by trypan blue and determined to be greater than 90% for all treated lots. Fluorescence microscopy was then used to assess the expression of TurboFP635 detected in CAVES-24 treated lots immediately after thawing, indicating that the virus-encoded protein was already synthesized and present within the cells. This could increase the therapeutic efficacy of oncolytic viruses, since any virus-encoded immunomodulators are already expressed, thereby protecting the cells and virus from the patient's immune system and reducing the risk of viral infection in tumors. In addition to facilitating initial spread, any therapeutic proteins encoded by the virus are already present at the time of tumor cell infection, allowing viral amplification and protein synthesis to occur (initiated) at the tumor site more immediately or substantially This is because it can bring about rapid therapeutic effects. These results indicate that CAVES can maintain the ability to synthesize virus-encoded proteins after cryopreservation and thawing.

B. Effect of complement inhibition on therapeutic efficacy of MSC/VV and CAVES treated lots
To assess whether MSC/VV and/or CAVES are resistant to complement inhibition, 50,000 cells of MSC/VV-1, MSC/VV-2, CAVES-6 or CAVES-24 (equivalent to 50,000 pfu of free vaccinia virus (VV) used to generate MSC/VV and CAVES at an MOI of 1), 2 mM glutamine and 10% heat-inactivated fetal bovine serum (D10), 90% Incubated in 100 μl of DMEM solution supplemented with heat-inactivated fetal bovine serum (D90) or 90% human serum (H90). As a control, 50,000 free CAL1-Opt1 free viruses were incubated under the same conditions. After a 1-hour incubation period, vaccinia PFU (plaque The percentage of cPFU (virus forming) or cPFU (infectious cell plaque forming units) was quantified by a standard plaque assay using a monolayer of CV-1 cells and a layer of carboxymethylcellulose (CMC) medium, with each live infected cell forming one plaque. (cellular plaque forming units, cPFU), each live free vaccinia virus particle forms one plaque. Plaques were counted after fixation of cell monolayers and staining with Crystal Violet.

Results show that CAVES provides greater protection against complement inactivation of the virus in the presence of human serum compared to free virus or virus incubated with MSCs for a shorter period of 1-2 hours. It has been proven that. For CAVES-24, the amount of plaque recovered after incubation with human serum was the same as that recovered after incubation with 90% heat-inactivated fetal bovine serum, indicating that CAVES-24 is completely resistant to complement inactivation. It has been shown to provide adequate protection.

C. CAVES enhances the therapeutic effect of oncolytic viruses in tumor cells
We demonstrate that CAVES-6 and CAVES-24 can protect vaccinia virus from serum-induced inactivation and demonstrate the ability of CAVES to deliver protected virus to prostate tumor cells (PC3) under culture conditions. , evaluated in the constant presence of 20% human serum.

MSC/VV and CAVES treatments were thawed and washed once in PBS. Add 5,000 cells of MSC/VV-1, MSC/VV-2, CAVES-6 or CAVES-24 to a 24-well plate containing 500,000 PC3 human prostate cancer cells (MOI 0.01) for 20 % human serum and incubated with DMEM supplemented with 10% FBS. As a control, 5,000 free CAL2-Opt1 viruses were added to PC3 cells under the same conditions.

After 24 hours of treatment, the expression of virus-encoded TurboFP635 protein in PC3 cells was detected by fluorescence microscopy as an indicator of virus expression in PC3 cells. The results show that in the absence of serum, PC3 cells treated with free virus amplified the virus-encoded TurboFP635 protein (0.60 intensity/pixel). In the presence of 20% human serum, free virus was inactivated (0.18 intensity/pixel, 70% inhibition) as shown by a dramatic decrease in the fluorescence activity of virus-encoded proteins in tumor cells. . On the other hand, when the virus was loaded onto MSCs and incubated for 1, 2, 6 or 24 hours, the therapeutic efficacy of the virus remained intact in the presence of 20% human serum. The efficacy of MSC/VV and CAVES treatments was not reduced in the presence of 20% human serum when compared to equivalent conditions except in the absence of human serum.

In addition to the protective effects of MSC/VV and CAVES against human serum-mediated inactivation of the virus, MSC/VV and CAVES were found to exhibit higher levels of TurboFP635 expression in PC3 cells and tumor cells than free virus. demonstrated efficient transfer of oncolytic virus into cells and a head start during viral amplification (first in MSCs and subsequently in PC3 cells). CAVES-24 showed significantly higher levels of TurboFP635 expression under the same conditions, indicating that treatment with CAVES-24 resulted in efficient transfer of oncolytic virus into tumor cells in a short period of time, free virus alone, MSC/ It has been shown that it can provide a significant improvement in treatment efficacy over VV-1 or MSC/VV-2. The relative therapeutic efficacy of CAVES-24 treatment in vitro under conditions containing 20% human serum was over 5000% when compared to treatment with free virus.

D. MSC/VV and CAVES deliver and amplify oncolytic virus in the presence of peripheral blood mononuclear cells (PBMC) MSC/VV and CAVES deliver and amplify oncolytic virus in the presence of peripheral blood mononuclear cells (PBMC) VV and CAVES capacity was determined in vitro. Briefly, the MSC/VV and CAVES treated lots described above were thawed and washed once in PBS. 20,000 cells of MSC/VV-1, MSC/VV-2, CAVES-6 or CAVES-24 in a 96-well containing 250,000 human PBMCs from two different healthy donors in an allogeneic setting The plates were incubated with RPMI supplemented with 10% FBS, HEPES, 2mM glutamine and pyruvate.

At 2, 24 and 48 hours after seeding, expression of the virally encoded TurboFP635 protein was detected by fluorescence microscopy as an indicator of viral amplification in MSC cells. Results show that in the absence of PBMCs, MSC/VV-2 required 24 hours to achieve fluorescence levels similar to those achieved in CAVES-24 within 2 hours of thawing and seeding. shows. These results once again reveal that CAVES-24 is a more efficient process than MSC/VV. Fluorescent signal amplification in MSC/VV-2 was inhibited in the presence of donor 1-derived PBMCs, but not in the presence of donor 2-derived PBMCs, indicating that the presence of donor 1-derived PBMCs showed allogeneic rejection of MSC/VV-2 under However, in the presence of PBMCs from either donor 1 or 2, CAVES-24 fluorescence signal amplification was not inhibited (measured 24 hours after seeding). These data indicate that CAVES allows amplification in the presence of allogeneic PBMCs.

Data show that CAVES protects oncolytic viruses from humoral and cell-mediated immunity and further amplifies and enhances oncolytic virus therapy by promoting the initial spread of the virus inside the tumor.

E. Viral particles/cells and genome copies before administration after incubation and/or freezing Cells (MSCs or CAVES) were determined by three freeze (-80°C)/thaw (+37°C) cycles to determine the number of viral particles per cell. After disruption, sonication on ice-cold water three times at 1 minute intervals was followed by analysis by plaque assay. The number of viral genomes/cells (see below) was also determined since sonication can damage virus particles and affect accuracy.

CAL1 virus particles in frozen MSC/CAL1 (2 hours), CAVES (24 hours) or CAVES (48 hours) prepared using CAL1 virus and adipose-derived MSCs at MOI = 1 (time represents length of incubation) The amounts were as follows:

The amount of CAL2 virus particles (CAL2-OX40L or CAL2-41BBL) in frozen CAVES (after 24 hours incubation) prepared using CAL2 virus and adipose-derived MSCs at MOI = 0.1 was as follows:

The above PFU/cell values reflect the amount of infectious virus particles after destruction of infected cells or CAVES and sonication. These results demonstrate that CAVES contain 20-50 times more infectious capacity of viral particles compared to associated MSCs and viruses at shorter incubation times.

Characterization of processed lots (MSC/VV and CAVES)
To further characterize the treatment lots generated by MSC and vaccinia virus, the amount of viral genomic DNA copies per cell (MSC) per treatment was analyzed. Fresh frozen stocks of vaccinia virus-loaded MSCs (MSC/VV) and CAVES were generated. containing unmodified amplified/expanded ACAM2000 (CAL-01) or recombinant CAL-02. m1 and CAL-02. Treatments containing m2 were also generated.

Preparation of MSC/VV and CAVES Containing CAL-01 Vaccinia virus strain CAL-01 was cultured in cell culture with human adipose-derived MSCs (AD-MSCs) in DMEM supplemented with 5% FBS, 1% growth factors and 2mM glutamine. ) for 2 h (MOI of 1 or 10), 24 h (MOI of 1) or 42 h (MOI of 0.1) at 37°C. AD-MSCs were harvested 2 hours, 24 hours or 42 hours after infection and cryopreserved to create treatment lots as described below. The treated lot collected 2 hours after infection was named MSC/VV-2 (MOI 1 or 10) as described above. The treated lots collected at 24 or 42 hours were named CAVES-24 and CAVES-42, respectively. To generate MSC/VV-2 or CAVES-24 or CAVES-42 treated lots, cells incubated with VV for 2, 24 or 42 hours were washed twice with PBS and cryopreserved in Cryostor® CS10. and stored in liquid nitrogen as a vial.

Preparation of MSC/VV and CAVES containing CAL-02 Vaccinia virus strain CAL-02. m1 or CAL-02. m2 were incubated for 24 hours (MOI 1) or 42 hours (MOI 0.1) with human adipose-derived MSCs (AD-MSCs) in DMEM supplemented with 5% FBS, 1% growth factors and 2mM glutamine in cell culture. . AD-MSCs were then collected 24 or 42 hours post-infection and cryopreserved to generate treatment lots as described above. Processed lots collected in 24 or 42 hours were placed in CAVES-02. m1-24 and CAVES-02. m2-24 or CAVES-02. m1-42 and CAVES-02. It was named m2-42.

CAVES-02. m1-24 and CAVES-02. m2-24 or CAVES-02. m1-42 and CAVES-02. To generate m2-42 treatment lots, cells incubated with VV for 24 or 42 hours were washed twice with PBS, cryopreserved in Cryostor® CS10, and stored as vials in liquid nitrogen.

Quantification of viral genomic DNA copies per cell in treated lots The frozen vials were thawed at 37°C and the contents were immediately washed with PBS. Cell viability was analyzed by trypan blue and determined to be greater than 70% for all treated lots. Viral genome content per cell was determined by quantitative real-time PCR

DNA was extracted using Quick-gDNA™ Blood MidiPrep (Zymo Research, CA). Copy number of viral DNA copies on human cells was quantified by qPCR using PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientific, CA) and the following primers: Primer for virus: A56R -F (CAT CAT CTG GAA TTG TCA CTA CTA AA; SEQ ID NO: 91), A56R-R (ACG GCC GAC AAT ATA ATT AAT GC; SEQ ID NO: 92) and primers for human cells (MSCs): GAPDH1-F ( GGG AAG GTG AAG GTC GGAGT; SEQ ID NO: 93), GAPDH1-R (TCC ACT TTA CCA GAG TTA AAA GCAG; SEQ ID NO: 94). Data were recorded and analyzed using the QuantStudio 6 Flex Real-Time PCR System (ThermoFisher Scientific) and QuantStudio Real-Time PCR Software v1.3.

Genomic copies of viral DNA per cell are shown in Table X12. The data presented considers that all human cells have two copies of GAPDH1.

Genomic copies of viral DNA per cell provide a direct indication of the number of viruses that can potentially complete the replication cycle within the cell and begin to be released upon injection once viral particles are formed. do. The data show that the CAVES treatment contains a minimum of 1000 copies of viral DNA, compared to about 5 copies or less for MSC/CAL1. This indicates that the intracellular virus amplification cycle is more advanced compared to MSC/CAL1-2h. At an MOI of 0.1:1, the genomic copy number of viral DNA in CAVES ranges from a few thousand to about 10,000.

Example 8
Engineering recombinant oncolytic viruses with increased therapeutic potential

To enhance the therapeutic potential of oncolytic viruses for delivery according to the compositions and methods herein, recombinant viruses encoding therapeutic genes were constructed. Virally encoded therapeutic proteins can exert additional therapeutic effects. When a recombinant virus is used to produce CAVES as described in Example 7, the encoded therapeutic protein expressed prior to administration to a subject may be administered to a subject in need of such treatment. can sometimes act directly.

Vaccinia virus has been used as a platform to express therapeutic genes in tumor cells. Therapeutic genes are generally inserted into the viral genome in a manner that disrupts the expression of one or more viral genes, thereby attenuating the virus and improving tumor selectivity. Such attenuated viruses often lose the ability to replicate efficiently in tumor cells. For naturally attenuated viruses, further attenuation can reduce their therapeutic potential.

This example describes a new placement site in the ACAM2000 vaccinia virus that allows insertion of therapeutic genes without altering the functional viral open reading frame (ORF) in the resulting recombinant virus. A small intermediate fragment (92 bp) of the gap between ORF_157 and ORF_158 (271 bp; SEQ ID NO: 3) was chosen to be replaced by the gene of interest. The gene of interest was introduced into this intergenic region between ORF_157 and ORF_158 using the CRISPR/Cas9HFc (High Fidelity Cas9) system, as described below.

1. Cell culture African green monkey kidney fibroblast CV-1 cells were cultured with Dulbecco's modification supplemented with 1% antibiotic solution (Life Technologies), 2mM L-glutamine (Life Technologies) and 10% heat-inactivated fetal calf serum (Mediatech). Cultured in Eagle high glucose medium. Cells were grown in an incubator at 37°C, 5% _CO2 and a humidified atmosphere.

2. Guide RNA for targeting the intergenic locus between ORF_157 and ORF_158
Guide RNA (gRNA) sequences for CRISPR/Cas9 (SEQ ID NO: 1) were selected using online software (dna20.com/eCommerce/Cas9/input). Guide RNA was constructed under the control of the U6 promoter in a lentiviral vector (Lentivector). Antibiotic resistance to puromycin was included in the lentivector backbone (vector obtained from VectorBuilder, Inc., Shenandoah, Texas; SEQ ID NO: 2).

3． Construction of donor vector to generate recombinant VACV
The left and right homologous regions (HR) of the intergenic locus between ORF_157 and ORF_158 were selected based on the ACAM2000 vaccinia virus genome sequence (GenBank accession number: AY313847; SEQ ID NO: 70). The intergenic locus between ORF_157 and ORF_158 is a 271bp sequence (SEQ ID NO: 3), while the two HRs are a 555bp sequence (SEQ ID NO: 4) on the right side of the intergenic locus and a 642bp sequence (SEQ ID NO: 4) on the left side of the intergenic locus. Number 5). Within the intergenic locus is a 92 bp sequence (SEQ ID NO: 6) that is replaced by the therapeutic gene of interest.

Donor vector for TurboFP635 expression cassette (vector 1)
To construct a donor vector for VACV expressing TurboFP635, the following DNA fragments were synthesized (Genewiz, Inc., San Diego, CA):
(a) (upstream) MCS1 (multiple cloning site 1, MfeI, PstI) → HR (left) (SEQ ID NO: 7) (downstream);
(b) (Upstream) MCS2 (multi-cloning site 2, SacI, NcoI, BmtI) → loxP → DNA encoding the far-red fluorescent protein TurboFP635 and vaccinia transcription termination signal adjacent to VACV early/late promoter upstream (pEL) → loxP →MCS3 (multiple cloning site 3, BamHI, SphI, EcoRV, SwaI, NotI, SacI) (downstream) (SEQ ID NO: 8); and (c) HR (right) (SEQ ID NO: 4).

Using an in-fusion cloning kit (Takara Bio USA, Inc., Mountain View, CA), the fragments were inserted into the pUC18 vector (SEQ ID NO: 72) in the order (a) → (b) → (c) (upstream → downstream). The vector pIg-loxP-TurboFP635 (SEQ ID NO: 9) was obtained by cloning. The sequence of the resulting donor plasmid was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, Calif.).

Donor vector for generating recombinant VACV expressing anti-VEGF scAb (vector 3)
The donor vector was linearized using SphI restriction enzyme to generate an IgK signal peptide (SEQ ID NO: 11) to promote cellular secretion of the antibody, and a DNA encoding a FLAG tag (SEQ ID NO: 11) to facilitate detection. It was constructed by inserting DNA encoding a single chain antibody against VEGF (scAb (VEGF); SEQ ID NO: 10) linked to DNA encoding scAb (VEGF) (29). The IgK-scAb (VEGF)-FLAG sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia late promoter (pL; SEQ ID NO: 20). The resulting vector containing the loxP → pEL → TurboFP635 → loxP → pL → IgK → scAb (VEGF) → FLAG sequence (upstream → downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NO: 12) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

Donor vector (vector 4) to generate recombinant VACV expressing human sodium-iodine symporter (hNIS) and TurboFP635
To create the donor vector, vector 1 was linearized using SphI restriction enzyme, and DNA encoding the human sodium-iodine cotransporter (hNIS) (SEQ ID NO: 14) was inserted under the control of the vaccinia early promoter (pE). (SEQ ID NO: 15). The resulting vector containing the loxP→pEL→TurboFP635→loxP→pE→hNIS sequence (upstream→downstream) was transferred to Genewiz, Inc. It was synthesized by (SEQ ID NO: 13) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

Donor vector for producing recombinant VACV expressing checkpoint inhibitor and selection gene (TurboFP635) (1) Single chain antibody against human CTLA-4 and TurboFP635 (vector 5)
The donor vector was linearized using SphI restriction enzyme to generate an IgK signal peptide (SEQ ID NO: 18) to promote cellular secretion of the antibody, and a DNA encoding a FLAG tag (SEQ ID NO: 18) to facilitate detection. It was constructed by inserting DNA (SEQ ID NO: 16 or 17) encoding a single chain antibody against human CTLA-4 (h-scAb (CTLA-4)) linked to DNA encoding 29). The IgK-h-scAb (CTLA-4) sequence was codon-optimized for expression in vaccinia virus (idtdna.com/CodonOpt) and placed under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). . The resulting vector containing the loxP→pEL→TurboFP635→loxP→pEL→IgK→h-scAb (CTLA-4))→FLAG sequence (upstream→downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NO: 30, using the sequence of SEQ ID NO: 17 for h-scAb (CTLA-4)) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(2) Single chain antibody against mouse CTLA-4 and TurboFP635 (vector 6)
The donor vector encodes a DNA (SEQ ID NO: 29) encoding an IgK signal peptide to facilitate cellular secretion of the antibody, and a FLAG tag to facilitate detection by linearizing Vector 1 using the SphI restriction enzyme. It was constructed by inserting DNA (SEQ ID NO: 21) encoding a single chain antibody against mouse CTLA-4 (m-scAb (CTLA-4)) linked to DNA (SEQ ID NO: 18). The IgK-m-scAb (CTLA-4) sequence was codon-optimized for expression in vaccinia virus (idtdna.com/CodonOpt) and placed under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). . The resulting vector containing the loxP→pEL→TurboFP635→loxP→pEL→IgK→m-scAb (CTLA-4))→FLAG sequence (upstream→downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NO: 31) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(3) OX40L (mouse-vector 7, canine-vector 8 and human-vector 9) and TurboFP635
Donor vectors were generated by linearizing Vector 1 using SphI restriction enzyme and generating mouse OX40L (SEQ ID NO: 22), dog OX40L (SEQ ID NO: 23) or canine OX40L (SEQ ID NO: 23) under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). It was constructed by inserting DNA encoding human OX40L (SEQ ID NO: 24). The resulting vector containing the loxP→pEL→TurboFP635→loxP→pEL→OX40L (mouse, dog or human) sequence (upstream→downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NOs: 32, 33 and 34 for mouse (vector 7), dog (vector 8) and human (vector 9) OX40L, respectively) The sequences of the vectors were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(4) 4-1BBL (mouse-vector 10, dog-vector 11 and human-vector 12) and TurboFP635

Donor vectors were created by linearizing Vector 1 using SphI restriction enzyme and constructing mouse 4-1BBL (SEQ ID NO: 25), dog 4-1BBL (SEQ ID NO: 25) under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). No. 26) or human 4-1BBL (SEQ ID No. 27). The resulting vector containing the loxP→pEL→TurboFP635→loxP→pEL→4-1BBL (mouse, dog or human) sequence (upstream→downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NOs: 35, 36 and 37 for mouse (vector 10), dog (vector 11) and human (vector 12) 4-1BBL, respectively) The sequences of the vectors were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). ). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

Donor vector (TurboFP635) encoding two therapeutic genes and a selection gene
(1) 4-1BBL and OX40L (mouse-vector 13, dog-vector 14, human-vector 15)

Donor vectors were generated by linearizing vector 1 using SphI restriction enzyme and creating mouse 4-1BBL (SEQ ID NO: 25), dog 4-1BBL (SEQ ID NO: 25) under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). DNA encoding human 4-1BBL (SEQ ID NO: 26) or human 4-1BBL (SEQ ID NO: 27) and mouse OX40L (SEQ ID NO: 22), dog OX40L (SEQ ID NO: 22) under the control of the vaccinia early/late promoter (pEL) (SEQ ID NO: 74). No. 23) or human OX40L (SEQ ID No. 24). The resulting vectors encoding mouse, dog or human 4-1BBL and OX40L (loxP→pEL→TurboFP635→loxP→pEL→4-1BBL→pEL→OX40L) were named vectors 13, 14 and 15, respectively. The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(2) Single chain antibody against VEGF (scAb (VEGF)) and OX40L (mouse-vector 16, human-vector 17)

Donor vectors encoding two therapeutic genes: (a) single-chain antibody (scAb (VEGF )); (b) Mouse OX40L or human OX40L was constructed under the control of the vaccinia virus early/late promoter promoter (pEL; SEQ ID NO: 74) promoter.

The donor vector was constructed by linearizing Vector 1 using SphI restriction enzyme and inserting: (1) DNA encoding the IgK signal peptide (SEQ ID NO: 11) that promotes cellular secretion of antibody and detection (2) DNA encoding a single chain antibody against VEGF (scAb (VEGF); SEQ ID NO: 10) linked to DNA encoding a FLAG tag (SEQ ID NO: 29) that facilitates mouse OX40L (SEQ ID NO: 22); or DNA encoding human OX40L (SEQ ID NO: 24). The IgK-scAb (VEGF)-FLAG sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia late promoter (pL; SEQ ID NO: 20). The mouse or human OX40L gene was placed under the control of the vaccinia early/late promoter (pEL; SEQ ID NO: 74). The resulting vectors encoding scAb (VEGF) and mouse or human OX40L were named vectors 16 and 17, respectively. The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(3) Single chain antibody against VEGF (scAb (VEGF)) and 4-1BBL (mouse-vector 18, human-vector 19)

We constructed donor vectors encoding two therapeutic genes: (a) a single strand for VEGF linked to DNA encoding the IgK signal peptide and under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20); Antibody (scAb (VEGF)); (b) Mouse 4-1BBL or human 4-1BBL under the control of the vaccinia virus early/late (pEL; SEQ ID NO: 74) promoter.

The donor vector was constructed by linearizing Vector 1 using SphI restriction enzyme and inserting: (1) DNA encoding the IgK signal peptide (SEQ ID NO: 11) that promotes cellular secretion of antibody and detection (2) DNA encoding a single chain antibody against VEGF (scAb (VEGF); SEQ ID NO: 10) linked to DNA encoding a FLAG tag (SEQ ID NO: 29) that facilitates mouse 4-1BBL (SEQ ID NO: 29); 25) or DNA encoding human 4-1BBL (SEQ ID NO: 27). The IgK-scAb (VEGF)-FLAG sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia late promoter (pL; SEQ ID NO: 20). The mouse 4-1BBL or human 4-1BBL gene was placed under the control of the vaccinia early/late promoter (pEL; SEQ ID NO: 74). The resulting vectors encoding scAb (VEGF) and mouse or human 4-1BBL were named vectors 18 and 19, respectively. The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(4) Single chain antibody against VEGF (scAb (VEGF)) and hNIS (vector 20)
A donor vector (vector 20) was constructed encoding two therapeutic genes: (a) VEGF linked to DNA encoding the IgK signal peptide and under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20); (b) human NIS (hNIS) under the control of the vaccinia virus early/late promoter promoter (pEL; SEQ ID NO: 74).

The donor vector was constructed by linearizing Vector 1 using SphI restriction enzyme and inserting: (1) DNA encoding the IgK signal peptide (SEQ ID NO: 11) that promotes cellular secretion of antibody and detection (2) DNA encoding a single chain antibody against VEGF (scAb (VEGF); SEQ ID NO: 10) linked to DNA encoding a FLAG tag (SEQ ID NO: 29) that facilitates human hNIS (SEQ ID NO: 14); DNA that codes for. The IgK-scAb (VEGF)-FLAG sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20). The human hNIS gene was placed under the control of the vaccinia virus early/late promoter (pEL; SEQ ID NO: 74). The resulting vector (vector 20) containing loxP → pEL → TurboFP635 → loxP → pL → IgK → scAb (VEGF) → FLAG → pEL → hNIS sequences (upstream → downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NO: 38) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

(5) Single chain antibody against VEGF (scAb (VEGF)) and AQP1 (Vector 21)
A donor vector (vector 21) was constructed encoding two therapeutic genes: (a) VEGF linked to DNA encoding the IgK signal peptide and under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20); single chain antibody (scAb (VEGF)) against; (b) human aquaporin 1 (AQP1) under the control of the vaccinia virus early/late promoter promoter (pEL; SEQ ID NO: 74); Human AQP1 was first amplified from an open reading frame (ORF) cDNA (Origene Technologies, Rockville, MD) (SEQ ID NO: 28).

The donor vector (vector 21) was constructed by linearizing vector 1 using SphI restriction enzyme and inserting: (1) encoding an IgK signal peptide (SEQ ID NO: 11) that promotes cellular secretion of antibody; (2) DNA encoding a single chain antibody against VEGF (scAb (VEGF); SEQ ID NO: 10) linked to DNA encoding a FLAG tag (SEQ ID NO: 29) to facilitate detection; (2) human AQP1 ( DNA encoding SEQ ID NO: 28). The IgK-scAb (VEGF)-FLAG sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20). The human AQP1 gene was placed under the control of the vaccinia virus early/late promoter (pEL; SEQ ID NO: 74). The resulting vector (vector 21) containing the loxP → pEL → TurboFP635 → loxP → pL → IgK → scAb (VEGF) → FLAG → pEL → AQP1 (human) sequence (upstream → downstream) was transferred to Genewiz, Inc. It was synthesized by (SEQ ID NO: 39) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase.

Four. Cloning of Cas9HFc
Cas9HF1 plasmid was obtained from Addgene (Cambridge, MA; plasmid #72247). The Cas9HF cytosolic-encoded gene (Cas9HFc) was cloned into pST1374 (Addgene Plasmid ID #13426) under the control of the CMV promoter (SEQ ID NO: 40) without nuclear localization signals or Under the control of VectorBuilder, Inc. (Shenandoah, Texas) in a plasmid construct.

Five. Recombinant oncolytic virus encoding a therapeutic gene Transfection and viral infection 2 × 10 CV- ¹ cells were seeded in 6-well plates the day before transfection to achieve a confluency of 60–70%. . Cells at 60% to 70% confluence were transfected using 6 μl of TurboFectin 8.0 transfection reagent (Origene Technologies, Rockville, MD) in 250 μl of opti-DMEM (Thermo Fisher Scientific, Waltham, MA). Transfected with 1 μg each of plasmids encoding Cas9HFc and guide RNA. 24 hours after transfection, cells were infected with recipient vaccinia virus (ACAM2000) at an MOI of 0.02 in DMEM high glucose supplemented with 2% FBS. Two hours after virus infection, cells were washed once with PBS. 1.5 ml of DMEM growth medium was added and the cells were placed in a _CO2 incubator at 37 °C for 30 min before being transfected with 2 μg of donor plasmid selected from above. Cells were further incubated for 24 hours at 37°C, 5% _CO2 and a humidified atmosphere. A mixture of infected cells and supernatant was collected and stored at −80°C for virus purification and screening.

Virus Purification Infected cells were thawed and then sonicated on ice at maximum intensity for 30 seconds, 3 times on/off to release virus from the cells. Four monolayers of confluent CV-1 cells in 6-well plates were infected with released virus at 2 μl released virus per plate. Two days after infection, 4-5 green plaques (positive, reflecting eGFP expression) and control negative plaques (not expressing eGFP) were identified under a 2x fluorescence microscope containing 200 μl of serum-free DMEM. The cells were collected into cryovials and subjected to plaque purification 2 to 4 times until pure clones were obtained. Insertion of the desired therapeutic gene(s) at the appropriate locus (between ORF_157 and ORF_158) of the recombinant virus was confirmed by PCR and Sanger sequencing, details of which are provided below.

PCR and Sanger Sequencing To confirm the insertion of the transgene at the intergenic locus of the recipient virus, primer pairs were designed to amplify the intergenic region:
Reverse primer: 5'GACGAAGAAGCAAGAGATTGTGT 3' (SEQ ID NO: 41)
Forward primer: 5'ACCGTTTCCATTACCGCCA 3' (SEQ ID NO: 42).

The target sequences (complements) of the two primers are located on the HR-left and HR-right sides of vaccinia virus, respectively. Amplicons from the original virus before Cre/Lox recombination can be primers located HR left and HR right. The PCR amplicon from the original non-recombinant virus is 230 bp in length, and the new recombinant virus amplicon is the size of the inserted transgene plus 140 bp from a separate backbone. equal. The sequences of PCR products from all purified clones were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA).

Example 9
CAVES enhances the therapeutic potential of recombinant oncolytic viruses

As shown in Example 7, CAVES protects the virus from humoral and cell-mediated immunity, as well as exposing the therapeutic efficacy to delays as viral replication/expression of viral genes is initiated in vivo. The therapeutic efficacy of vaccinia virus is enhanced by providing expression of virus-encoded proteins, such as immunomodulatory proteins, before treatment is administered, such that it is immediate rather than delayed. CAVES can therefore be used to deliver therapeutic proteins immediately after administration using recombinant viruses that encode therapeutic proteins and express them in CAVES prior to administration. Virus-encoded therapeutic proteins can exert an initial therapeutic effect immediately after administration and are not dependent on tumor infection or viral amplification in the tumor. Furthermore, early therapeutic effects can be exerted independently of the nature of the tumor microenvironment. When initial expression of virally encoded therapeutic proteins occurs in vivo, the extent of expression often depends on the nature of the tumor microenvironment, such as the access of the protein synthesis machinery to nutrients in the tumor microenvironment. Because CAVES contain virus-encoded therapeutic proteins that have already been expressed (due to incubation of the oncolytic virus with the cell media for, e.g., 6 hours or more), the therapeutic proteins are a protein in the tumor microenvironment. It can be effective upon administration in a manner independent of synthesis. For example, the therapeutic efficacy of CAVES-24 or CAVES-48 (cell media and oncolytic virus incubated together for 24 or 48 hours, respectively) was significantly enhanced over 2 hours, for example, by virus-loaded MSCs (here, virus-encoded synthesis of therapeutic proteins has not begun or is very limited).

This example demonstrates how CAVES-48 (i.e., cell media and oncolytic cells incubated together for 48 hours) using an engineered oncolytic virus encoding a therapeutic protein (prepared as described in Example 8) We demonstrate that ex vivo production of a virus) provides viral amplification and expression of the desired virally encoded therapeutic protein(s). CAVES-48 can then be cryopreserved, refrigerated (1-2 days) for transport to the treatment site, or administered immediately.

Recombinant virus The following therapeutic genes: human OX40L (hOX40L), mouse OX40L (mOX40L), human 4-1BBL (h4-1BBL), mouse 4-1BBL (m4-1BBL) and single chain antibody against human CTLA-4 ( A recombinant virus containing scAb-hCTLA-4) was prepared as described in Example 8. The 92 bp gap between ORF_157 and ORF_158 of CAL-01 was replaced by TurboFP635 as a reporter gene upstream of one of the aforementioned therapeutic genes. The new recombinant virus based on CAL-01 is referred to in this example with the prefix "CAL-02".

Human adipose-derived MSCs were cultured continuously at 20 RPM in 1 ml of DMEM supplemented with 2% fetal bovine serum (FBS), 1% antibiotics (equivalent ampicillin and streptomycin) and 2 _mM glutamine in a CO incubator at 37 °C. With rotation, one of the recombinant viruses listed above was loaded at an MOI of 0.1 for 2 hours. Cells were then added to a 10 cm round dish filled with 10 ml of fresh growth medium (5% Stemulate® pooled human platelet lysate, 1% antibiotics and 2 mM glutamine). The virus and cell mixture was further incubated at 37°C in a _CO2 incubator for up to 2 days. Cells were washed with 1× PBS and detached with 1.5 ml of TrypLE enzyme (Thermo Fisher Scientific, Waltham, MA) for 6 min. All cells were then collected and centrifuged at 500g for 5 minutes. Cells were washed again with 1× PBS and stored frozen as described in Examples 6 and 7.

To confirm the expression of therapeutic proteins on the cell surface, AD-MSCs incubated with various recombinant viruses for 48 hours were stained with fluorescently labeled antibodies or isotype controls listed in Table X13. sc-hCTLA4 was fused with FLAG tag, and sc-hCTLA4 was detected using FLAG tag antibody.

After labeling CAVES-48, cell surface expression of therapeutic proteins was analyzed by flow cytometry in intact cells. The percentage of positive cells (CAVES-48) is listed in Table X14 below.

The data show that therapeutic proteins were present in the cell membranes of the CAVES produced. OX40L and 4-1BBL are cell membrane ligands and therefore these proteins should be found at high levels in the cell membrane, whereas sc-hCTLA4 is expressed as a secreted form and therefore is not retained at high levels at the cell membrane. Therefore, cytosolic detection using FLAG-tagged antibodies was performed to analyze the percentage of cells containing therapeutic sc-hCTLA4 protein. The percentage of positive signaling MSCs for sc-hCTLA4 was CAL-02. This increased to 87.7% after just 48 hours of incubation with h3 virus.

The results show that generation of CAVES-48 can have an immediate effect upon administration, independent of the tumor microenvironment, initial antiviral barrier, or tumor cell permissiveness of viral amplification and virus-encoded protein synthesis. It has been demonstrated that it enables the expression of therapeutic genes.

Example 10
CAVES increases the therapeutic efficacy of oncolytic viruses against tumors

(1) Prostate Cancer The anticancer therapeutic efficacy of naked CAL1 virus and MSC/CAL1 was compared with intratumorally delivered CAVES-24h and CAVES-40h, respectively, in a heterologous (human) prostate tumor model system. Frozen stocks of VV-loaded MSCs (2 hours) or CAVES were made and stored at −80° C. or in liquid nitrogen as described in Examples 6 and 7.

CAVES (24 h or 40 h incubation with MSCs) shows increased therapeutic efficacy compared to naked CAL1 virus or CAL1 virus incubated with MSCs for a short period of time (2 h incubation with MSCs).

Treatment of 1 × 10 cryopreserved CAVES (24 or 48 h incubation) compared to each of MSC/CAL1 ( ² h incubation) and naked CAL1 (cryopreserved lots) in a xenogeneic animal model. To analyze efficacy, prostate tumors were generated by subcutaneous injection of 2×10 ⁶ invasive metastatic human prostate cancer PC3 cells into the right flank of 4-6 week old athymic nude mice. When tumors reached an average volume of 150 mm ( ² weeks after tumor cell inoculation), mice were injected intratumorally with one of the following treatments: 1 × 10 ⁶ pfu naked CAL1 virus (n = 6); or 1 x 10 ⁷ pfu naked CAL1 virus (n = 5); or 1 x 10 ⁶ MSC loaded with CAL1 (MOI = 10) for 2 hours (n = 7); or CAVES-24 h (prepared with CAL1 MOI = 1); or CAVES-40h (prepared with CAL1 MOI = 0.1; n = 6) or PBS (n = 6). Tumor volumes were measured twice weekly during the experimental period. For single intratumoral injections, the data show that MSC-containing treatments were more therapeutically efficient than virus alone, with CAVES showing the most It was an efficient procedure. CAVES-40h was the most efficient treatment despite using 100 times less virus to manufacture the treatment.

Therapeutic efficacy of CAVES as a function of the amount of virus used
To further analyze the therapeutic efficacy of cryopreserved CAVES as a function of the amount of CAL1 virus added to the cells when creating the CAVES, we prepared the following three CAVES:
SNV-1a: 1×10 ⁷ pfu of CAL1 virus incubated with adipose-derived stem cells (MOI 0.1, 38-42 hours)
SNV-1b: 1 x ¹⁰⁶ pfu of CAL1 virus incubated with adipose-derived stem cells (MOI 0.1, 38-42 hours)
SNV-1c: 1×10 ⁵ pfu of CAL1 virus incubated with adipose-derived stem cells (MOI 0.1, 38-42 hours)

Incubation was performed in a CO ₂ incubator at 37°C. Upon harvest, all cells were infected with >60% viability. CAVES were cryopreserved at a concentration of 10 million cells/ml using CryoStore10 (or CryoStore5). Cryopreserved CAVES were tested for PFU/cell using plaque assay and selected with a minimum of approximately 3-10 pfu/cell, 2000-5000 DNA copies per cell.

Prostate tumors were generated by subcutaneous implantation of 2×10 ⁶ invasive metastatic human prostate cancer PC3 cells into the right flank of 4-6 week old athymic nude mice. When tumors reached an average volume of 150 ^mm3 (2 weeks after tumor cell inoculation), mice were injected intratumorally (day 0) with one of the following treatments (n=8 for all treatments):
No treatment (control - PBS)
1×10 ⁶ pfu naked CAL1 virus;
1×10 ⁷ pfu naked CAL1 virus;
1×10 ⁶ SNV-1a;
1×10 ⁶ SNV-1b;
1×10 ⁶ SNV-1c

Tumor volumes were measured twice a week (up to day 15) during the experimental period. For a single intratumoral injection, the data demonstrated that controls showed an approximately 20-fold increase in tumor volume at day 15. In comparison, treatment with 1×10 ⁶ pfu of naked CAL1 virus resulted in a 12-fold increase in tumor volume on day 15, and treatment with 1×10 ⁷ pfu of naked CAL1 virus resulted in a 12-fold increase in tumor volume on day 15. This resulted in a 7.5x increase. CAVES showed greater efficacy in delaying tumor progression, with treatment with SNV-1a showing an approximately 6.5-fold increase in tumor volume at day 15, and SNV-1b showing an approximately 5-fold increase in tumor volume at day 15. SNV-1c only showed an approximately 3.5- to 4-fold increase in tumor volume at day 15. Therefore, the results show that CAVES made using lower pfu (1×10 ⁵ pfu, i.e., SNV-1c) are more effective than CAVES made using lower pfu (1×10 ⁷ pfu, i.e., SNV-1a and 1×10 ⁶ pfu). , i.e., SNV-1b), further demonstrating increased therapeutic potential compared to treatment with CAVES generated using CAVES, i.e., SNV-1b). The table below shows significantly smaller tumor volumes after treatment with CAVES compared to control or treatment with naked virus:

Similar results were observed when CAVES treatment was started 13 days after tumor implantation and tumor volume was measured 14 days after the start of CAVES treatment. The results are shown in the table below:

Treatment with CAVES (SNV-1c) induces tumor regression in human prostate cancer In addition to slowing tumor progression, treatment with SNV-1c was found to induce tumor regression. Invasive metastatic PC3 cells were initiated from bone metastases of grade IV prostate adenocarcinoma from a 62-year-old male Caucasian (ATCC® CRL-1435 ^™ ). Prostate tumors were generated by subcutaneous injection of 2×10 ⁶ invasive metastatic human prostate cancer PC3 cells into the right flank of 4-6 week old athymic nude mice. When tumors reached an average volume of 150 mm ( ² weeks after tumor cell inoculation), mice were injected intratumorally (day 0) with one of the following treatments (n=5 per treatment group): No treatment (control-PBS) or 1×10 ⁶ SNV-1c.

Tumor volumes were measured twice a week (up to day 15) during the experimental period. For a single intratumoral injection, the data demonstrated that at day 15, controls exhibited a mean tumor volume of approximately 1150 ^mm3 . In comparison, treatment with SNV-1c resulted in a mean tumor volume of approximately 500 mm ³ at day 15. Furthermore, by day 30 after treatment, tumors in SNV-1c treated animals had shrunk to approximately 250 ^mm3 . The results demonstrate that CAVES can treat tumors by shrinking them in addition to slowing tumor growth.

Intratumorally injected SNV-1c does not cause systemic viremia We investigated the biodistribution and viral amplification potential of SNV-1c to determine tumor selectivity and assess whether there are deleterious effects on normal tissues. analyzed. The athymic nude mice described above were sacrificed 15 days after treatment. Eleven tissue samples were collected per animal (blood, tumor, brain, heart, kidney (paired), liver, lung, bladder, prostate, testis, spleen) and cryopreserved in liquid nitrogen. Samples were tested by plaque assay as well as real-time semi-quantitative PCR (qPCR) to detect the presence of viral DNA or infectious particles. Analysis revealed that virtually all the virus was localized to the tumor, with no detectable virus in non-tumor tissues.

SNV-1c treatment inhibits tumor progression and recruits adaptive immune cell populations in an immunocompetent prostate cancer in vivo model
The therapeutic efficacy of SNV-1c was tested in two immunocompetent mouse models of prostate cancer: TRAMPC2 (a slow growing tumor) and RM1 (a fast growing tumor). TRAMP-C2 and cell lines were derived from a 1996 heterogeneous 32-week primary tumor in the prostate of a PB-Tag C57BL/6 (TRAMP) mouse (ATCC-CRL-2731). RM1 is a Ras+Myc-induced prostate cancer developed from urogenital sinus mouse prostate reconstruction (ATCC® CRL-3310 ^™ ). Prostate tumors were generated by subcutaneous injection of 2×10 ⁶ TRAMPC2 or RM1 prostate cancer cells into the right flank of 4-6 week old athymic nude mice. For TRAMPC2, tumor cells were implanted subcutaneously in the right flank 20 days before CAVES treatment. For RM1, tumor cells were implanted subcutaneously in the right flank 5 days before CAVES treatment. CAVES treatment was initiated by three intratumoral injections of 1×10 ⁶ SNV-1c every 2 days. Control animals received no treatment (PBS) (n=5/treatment group).

The data demonstrated that 27 days after the initiation of intratumoral injection into TRAMPC2 tumors, control animals exhibited a mean tumor volume of approximately 500 ^mm3 . In comparison, treatment with SNV-1c showed little or no detectable tumor at day 27. The results are detailed in the table below.

For rapidly growing RM1 tumors, the data demonstrated that at day 7 after intratumoral injection, control animals exhibited a mean tumor volume of approximately 2500 ^mm3 . In comparison, treatment with SNV-1c was shown to result in a tumor volume of approximately 1000 ^mm3 . The results are detailed in the table below.

Furthermore, in RM1 tumors, treatment with SNV-1c was found to increase recruitment of adaptive T cell populations, thereby further increasing therapeutic efficacy. Treatment with SNV-1c provided a sustained increase in the CD8+ cytotoxic T cell population and some increase in the CD4+ population, measured as a percentage of cells/g tumor and viable cells. No increase was observed in the NK cell population. The improved frequency of the CD8+ T cell population is associated with an improved total CD8/Treg ratio (approximately 6 in SNV-1c treated samples compared to approximately 2 in control samples) and an improved CD4 Teff/Treg ratio (approximately 6 in control samples). 1.5) in SNV-1c-treated samples, compared to about 0.6 for SNV-1c-treated samples.

(2) Other cancer models
The therapeutic efficacy of SNV-1c was tested and found to be effective in several other cancer models.

Mouse colon cancer model (CT26)
Colon tumors were generated by subcutaneous injection of 2×10 ⁶ CT26 cells into the right flank of 4-6 week old athymic nude mice. CT26 is an N-nitroso-N-methylurethane (NNMU)-induced undifferentiated colon cancer cell line. Clone this and create CT26. A cell line called WT (ATCC CRL-2638) was created. Seven days after tumor cell injection, mice were given three intratumoral injections of 1 × 10 ⁶ SNV-1c, 1 × 10 ⁷ naked CAL1 viruses every 2 days or left untreated (tumor cells in PBS). intravenous injection) (n=8/treatment group).

The data demonstrated that 15 days after initiation of intratumoral injection into CT26 tumors, control animals exhibited a mean tumor volume of 1250-1500 ^mm3 . In comparison, treatment with naked virus resulted in an average tumor volume of approximately 1000 ^mm3 at day 15. Treatment with SNV-1c resulted in a significant delay in tumor progression, with a mean tumor volume of approximately 200 ^mm3 at day 15.

Furthermore, SNV-1c was found to delay tumor progression of distant, untreated tumors formed by the introduction of CT26 tumor cells into the left flank of mice (intratumoral injection of SNV-1c (It was within a tumor in the abdomen). Treatment with intratumoral injection of SNV-1c not only had a mean tumor volume in the right flank of approximately 200 ^mm3 at day 15 (versus controls of 1250-1500 ^mm3 , as above), but also The mean tumor volume in the untreated left flank was also only approximately 500 mm ³ compared to control values of 1250-1500 mm ³ . Results show that treatment with the exemplary CAVES, SNV-1c, is effective against both directly (proximally) treated tumors and distant tumors. The results are detailed in the table below.

Similar results were observed when CAVES treatment was started 13 days after tumor implantation and tumor volume was measured 20 days after the start of CAVES treatment. The results are shown in the table below:

Mouse melanoma model Melanoma tumors were injected into the right flank of 4- to 6-week-old athymic nude mice using 2 × 10 ⁶ B16-F10 cells (melanoma mouse tumor model ATCC (registered trademark) CRL-6475 (trademark)). and by subcutaneous injection into the left flank. Eight days after tumor cell injection, mice were given three intratumoral injections of 1×10 ⁶ SNV-1c or 1×10 ⁷ naked CAL1 virus in the right flank every 2 days (n=8 per treatment group).

The data demonstrated that on day 11 after intratumoral injection into B16 tumors, naked virus-treated animals exhibited a mean right flank tumor volume of approximately 1400 ^mm3 . Treatment with SNV-1c resulted in a significant delay in tumor progression, with a mean tumor volume of approximately 600 ^mm3 at day 11. The results are detailed in the table below.

SNV-1c was found to slow tumor progression of distant, untreated tumors formed by introduction of B16-F10 melanoma cells into the left flank of mice (intratumoral injection of SNV-1c (It was within the tumor on the right side of the abdomen). For treatment with a single intratumoral injection of SNV-1c, not only was the mean tumor volume in the right flank approximately 600 ^mm3 at day 11, but the mean tumor volume in the non-injected left flank was also approximately 1600 ^mm3 . compared to the control (naked virus treated) value of only about 700 ^mm3 . The results show that SNV-1c is effective against both directly (proximally) treated tumors and distant tumors, and is more effective at both compared to treatment with naked virus.

CAVES (SNV-2c: generated by incubating adipose-derived stem cells with 1 x 10 ⁵ pfu of CAL2 virus instead of CAL1 virus) using a CAL2 recombinant virus encoding a single-chain antibody against VEGF. ), the therapeutic efficacy of SNV-2c CAVES was found to be enhanced over SNV-1c, as shown by greater inhibition of tumor progression. The results are shown in the table below:

breast cancer model
The therapeutic efficacy of SNV-1c was tested in two breast cancer models: a mouse breast cancer model (EMT-6) and a human triple-negative breast cancer model (MDA-MB-231). EMT6 was established from transplantable murine mammary carcinomas that arose in BALB/cCRGL mice after transplantation of hyperplastic mammary alveolar nodules. The resulting tumor line (named KHJJ) was grown in BALB/cKa mice and adapted to tissue culture after the 25th animal passage, and the cell line was named EMT. EMT6 is a clonal isolate of EMT isolated at Stanford University in 1971 (ATCC® CRL-2755®). The MDA-MB-231 cell line is a highly invasive, invasive and poorly differentiated triple-negative breast cancer cell line that lacks estrogen receptor and progesterone receptor expression and HER2 amplification, which is associated with metastatic mammary adenocarcinoma. It was established from a pleural effusion in a 51-year-old Caucasian woman.

Four days before CAVE treatment, tumors were generated by subcutaneous injection of 2×10 ⁶ EMT-6 breast cancer cells into the right and left flanks of 4-6 week old athymic nude mice. 1×10 ⁶ SNV-1c was then intratumorally injected into the right flank only three times every two days. For MDA-MB-231 triple-negative breast cancer, cells were implanted subcutaneously into the left and right flanks 27 days before the CAVE procedure. Then, 1×10 ⁶ SNV-1c were intratumorally injected once into the right flank. Controls included intratumoral injection with 1×10 ⁷ naked CAL1 viruses or PBS (n=8/treatment group).

Data from the EMT-6 breast cancer model demonstrated that 14 days after intratumoral injection, control (PBS-treated) animals exhibited an average right flank tumor volume of approximately 950 ^mm3 . Treatment with SNV-1c resulted in a significant delay in tumor progression, with a mean tumor volume of approximately 350 ^mm3 at day 14. The results on day 18 are detailed in the table below:

Furthermore, SNV-1c was found to delay tumor progression of distant, untreated tumors formed by the introduction of mammary tumor cells into the left flank of mice (intratumoral injection of SNV-1c (It was within a tumor in the abdomen). For treatment with a single intratumoral injection of SNV-1c, not only was the mean tumor volume in the right flank approximately 350 ^mm3 at day 14, but the mean tumor volume in the non-injected left flank was also approximately 950 ^mm3 . compared to the control (naked virus treated) value of only about 450 ^mm3 . The results show that SNV-1c is effective against both directly (proximally) treated tumors and distant tumors, and is more effective at both compared to treatment with naked virus.

Similarly, for the triple-negative breast cancer model (MDA-MB-231), for a single intratumoral injection, data for the breast cancer model showed that on day 14 after intratumoral injection, naked virus-treated animals averaged approximately 950 ^mm3 . It was demonstrated that the right flank showed tumor volume. Treatment with SNV-1c resulted in a significant delay in tumor progression, with a mean tumor volume of approximately 350 ^mm3 at day 14. The results on day 46 are detailed in the table below.

SNV-1c was found to slow tumor progression of distant, untreated tumors formed by the introduction of mammary tumor cells into the left flank of mice (intratumoral injection of SNV-1c into the right flank (intratumor). For treatment with a single intratumoral injection of SNV-1c, not only was the mean tumor volume in the right flank approximately 350 ^mm3 at day 14, but the mean tumor volume in the non-injected left flank was also approximately 375 ^mm3 . compared to the control (naked virus treated) value of only about 150 ^mm3 . Results show that SNV-1c is effective against both directly (proximally) treated and distant tumors in a triple negative breast cancer model.

The results demonstrate that incubation of oncolytic viruses with stem cells, such as MSCs, for a sufficient period of time for immunomodulatory proteins to be expressed significantly improves the therapeutic efficacy of oncolytic viruses. This improvement is significant compared to the virus alone and to incubating the virus with the cells for a substantially shorter period of time (2-4 hours, or a period during which no virus-encoded immunomodulatory proteins were expressed).

Local administration of CAVEs in syngeneic tumor models induces local and distant tumor immune infiltrates and efficiently inhibits breast cancer tumor progression in locally treated and distant untreated tumors (abscopal effect).

To analyze whether CAVES induces both local therapeutic effects and systemic condition therapeutic effects after local administration, we tested the therapeutic effects of the treatment in a bilateral tumor mouse model. Balb/c mice were inoculated with EMT6 breast cancer tumor cells on both flanks, and once the tumors reached a size of 50 mm3, the mice were randomly divided for a total of ³ treatments with 3 million CAVES, every other day. It was administered directly to the right tumor. The left tumor was not treated. CAVES were generated by infecting stem cells with CAL1 virus at an MOI of 0.1 and harvested 28 hours after infection. The data provided in the table below (right tumor received local treatment; left tumor not treated) is shown by the delay in tumor progression at day 20 compared to control animals in both left and right tumors. As shown, treatment with CAVES induced significant local as well as systemic therapeutic effects (abscopal effect).

The immune infiltrates in both treated tumors (right) and distant untreated tumors (left) were then analyzed. Five days after treatment, tumors from 5 control and 5 treated animals were excised and TILs (tumor-infiltrating lymphocytes) were isolated by enzymatic digestion. Additionally, TILs were subjected to surface immunophenotyping and subsequent intracellular Foxp3 staining. Multiparameter flow cytometry analysis was performed to assess immune cell infiltration in control and treated tumors, as well as to investigate the underlying mechanism of the therapeutic abscopal effect observed in untreated distant tumors. Following doublet discrimination and gate-out of dead cells, the tumor-infiltrating population of CD45+CD11b-low/med TILs was further subdivided into CD3-NKp46+ NK cells, CD3+NKp46+ NKT cells and CD3+NKp46-T cells. T cells were further separated into single positive CD4+ or CD8+ T cells, and the CD4+ T cell compartment was further analyzed based on the expression of CD25 and Foxp3 to quantify CD25+Foxp3-CD4+Teff and CD25+Foxp3+Treg, respectively.

As shown in the table below, flow cytometry analysis demonstrated a statistically significant treatment-related proportional increase in the percentage of total infiltrating CD4 and CD8 T cells, and a decrease in the percentage of CD4+CD25+Foxp3+Tregs. Changes in the T cell compartment were further associated with improved ratios of CD25+Foxp3-CD4+Teff to Tregs and CD8 T cells to Tregs. These changes in the TME (tumor microenvironment) are consistent with conditions that promote tumor lysis, resulting in enhanced adaptive anti-tumor immunity. Furthermore, similar favorable changes in the proportion or ratio of immune infiltrates were observed in both treated tumors (right) and distant untreated tumors (left), underlying the observed strong abscopal effect. provided the mechanism.

Example 11
Alternative methods of engineering recombinant oncolytic viruses with increased therapeutic potential

Example 8 describes the use of the CRISPR/Cas9HFc (High Fidelity Cas9) system to generate a recombinant vaccinia virus (VACV) encoding a therapeutic gene. Alternatively, recombinant viruses can be generated using the Cre-Lox method.

A recipient VACV was constructed containing two mismatched Lox sequences, loxM3 (SEQ ID NO: 49) and loxM7 (SEQ ID NO: 51). Using the CRISPR/Cytosolic Cas9HF method, an incompatible Lox sequence was introduced into the intergenic locus between ORF_157 and ORF_158 in the CAL1 genome. Because the introduction of the Lox sequence is at an intergenic locus, the resulting recipient VACV, as well as the final product recombinant virus encoding the therapeutic gene of interest, will have all of their ORFs intact and their original therapeutic Hold possibilities.

Insertion of the desired therapeutic gene into the recipient VACV was performed by cytoplasmic recombination-mediated cassette exchange (RMCE), which involved (i) the insertion of the desired therapeutic gene and the same two matches present in the recipient VACV; (ii) the use of a vector for expression of cytosolic CRE (Cre recombinase enzyme); Selection of the desired recombinant virus was achieved by introducing a selection gene into the recipient VACV (the resulting recombinant virus is selected based on the presence of the selection gene in the recombinant virus).

Construction of recipient and donor vectors to generate recombinant VACV
The left and right homologous regions (HR) of the intergenic locus between ORF_157 and ORF_158 were selected based on the ACAM2000 vaccinia virus genome sequence (GenBank accession number: AY313847; SEQ ID NO: 70). The intergenic locus between ORF_157 and ORF_158 is a 271bp sequence (SEQ ID NO: 3), while the two HRs are a 555bp sequence (SEQ ID NO: 4) on the right side of the intergenic locus and a 642bp sequence (SEQ ID NO: 4) on the left side of the intergenic locus. Number 5). Within the intergenic locus is a 92 bp sequence (SEQ ID NO: 6) that is replaced by the therapeutic gene of interest. Using online software (dna20.com/eCommerce/cas9/input), two guide RNAs, gRNA1 (SEQ ID NO: 1) and gRNA2 (SEQ ID NO: Number 43) was selected. Guide RNAs were introduced into separate vectors (SEQ ID NO: 2 and SEQ ID NO: 48 for gRNA1 and gRNA2, respectively). Each guide RNA was constructed under the control of the U6 promoter in a lentiviral vector (Lentivector). Antibiotic resistance to puromycin was included in each lentivector backbone (vector obtained from VectorBuilder, Inc., Shenandoah, Texas).

Donor vector for first generation recipient VACV (vector 22)
To construct donor vectors for first-generation recipient VACVs, the following DNA fragments were synthesized (Genewiz, Inc., Sandier, CA):
(a) (upstream) HR (left) → loxM3 (SEQ ID NO: 49) (downstream);
(b) DNA encoding enhanced green fluorescent protein (eGFP) (SEQ ID NO: 50) flanked by upstream VACV early/late promoter (pEL) and downstream vaccinia transcription termination signal; and (c) (upstream) loxM7 (SEQ ID NO: 51) → HR (right) (downstream).

Using an in-fusion cloning kit (Takara Bio USA, Inc., Mountain View, CA), the fragments were inserted into the pUC18 vector (SEQ ID NO: 72) in the order (a) → (b) → (c) (upstream → downstream). Cloned. Multiple cloning sites were added at both ends of each HR to allow for future insertion of therapeutic genes. Immediately after the loxM3 sequence, restriction enzyme sites SpeI, XmaI, SmaI, NheI, and BmtI were added, and immediately before the loxM7 sequence, restriction enzyme sites SphI, MscI, NotI, AgeI, SwaI, and AflII were added. The sequence of the obtained vector (vector 22; loxM3→pEL→eGFP→loxM7) is shown as (SEQ ID NO: 44).

Donor vector of recipient VACV encoding TurboFP635 fluorescent protein (vector 2)
DNA encoding the TurboFP635 fluorescent protein under the control of the VACV early/late promoter (pEL) and flanked by loxM3 (upstream) and loxM7 (downstream) sequences was obtained from VectorBuilder, Inc. (Shenandoah, TX) into the pUC18 plasmid (SEQ ID NO: 72). The sequence of the obtained vector (vector 2), pUC-loxM3-pEL-TurboFP635-loxM7, is shown as (SEQ ID NO: 45).

Vector Encoding Cytoplasmic CRE Recombinase DNA encoding cytoplasmic Cre recombinase (CRE) from bacteriophage P1, which is codon-optimized and under the control of a CMV promoter, was obtained from VectorBuilder, Inc. (Shenandoah, TX) into a lentiviral vector (vector 23; SEQ ID NO: 46). To prepare recipient VACV encoding cytosolic Cre recombinase, DNA encoding eGFP under the control of the vaccinia virus early/late promoter (pEL) and bacteriophage P1 under the control of the vaccinia virus early/late promoter (pEL) The donor vector was constructed by inserting the DNA encoding the derived mammalian codon-optimized cytoplasmic Cre recombinase into the pUC18 plasmid (SEQ ID NO: 72). The loxM3 sequence was inserted upstream of the eGFP expression cassette, and the loxM7 sequence was inserted downstream of the Cre recombinase expression cassette. The resulting vector (vector 24) containing the loxM3→pEL→eGFP→pEL→CRE→loxM7 (upstream→downstream) insert in pUC18 was purchased from VectorBuilder, Inc. (vector 24; SEQ ID NO: 47).

(1) First generation recipient vaccinia virus (R1-VACV)
To obtain first generation recipient vaccinia virus, 2×10 ⁶ CV-1 cells were seeded in 6-well plates the day before transfection. 60-80% confluent CV-1 cells were transfected with 1 μg of Cas9HFc (Cytosolic High Fidelity Cas9) plasmid and 1 μg of Cas9HFc (Cytosolic High Fidelity Cas9) using 6 μl of Turbofectin 8.0 transfection reagent (Origene Technologies, Rockville, MD). transfected with guide RNA1. Cas9HF1 plasmid was obtained from Addgene (Cambridge, MA; plasmid #72247). The Cas9HF cytosolic-encoded gene (Cas9HFc) was cloned into pST1374 (Addgene Plasmid ID #13426) under the control of the CMV promoter (SEQ ID NO: 40) without nuclear localization signals or Under the control of VectorBuilder, Inc. (Shenandoah, Texas) in a plasmid construct. A high-fidelity Cas9 protein was used with several modifications to minimize off-target effects (Mali, et al. (2013) Nat Methods 10(10):957-963). Since the entire life cycle of VACV occurs in the cytoplasm, we removed the nuclear localization signal (NLS) of the high-fidelity Cas9 protein and obtained cytosolic high-fidelity Cas9 (Cas9HFc) under the control of the CMV promoter. The day after Cas9HFc and gRNA transfection, cells were infected with WTI(CAL1) virus at an MOI of 0.02 in DMEM high glucose supplemented with 2% FBS. Two hours after virus infection, cells were washed once with PBS and then transfected with 2 μg of donor vector (vector 22). Cells were incubated for 24 hours at 37 °C, 5% _CO2 and a humidified atmosphere. A mixture of infected cells and supernatant was collected and stored at −80°C for virus purification.

For virus purification, infected cells were thawed and then sonicated on ice at maximum intensity for 30 seconds on/off three times to release virus from the cells. Four monolayers of confluent CV-1 cells in 6-well plates were infected with released virus at 2 μl released virus per plate. Two days after infection, 4-5 green plaques (positive, reflecting eGFP expression) and control negative plaques (not expressing eGFP) were identified under a 2x fluorescence microscope containing 200 μl of serum-free DMEM. The cells were collected into cryovials and subjected to plaque purification 2 to 4 times until pure clones were obtained. The insertion of the loxM3→pEL→eGFP→loxM7 sequence in the recipient VACV (WT1 or CAL1) by replacing 92 base pairs in the intergenic region between ORF_157 and ORF_158 was confirmed by PCR and Sanger sequencing and its Details are shown below.

(2) Production of recombinant viruses encoding therapeutic genes
The concept of generating recombinant vaccinia viruses expressing genes of interest using the Cre/lox system was tested using a donor plasmid encoding the red fluorescent protein TurboFP635 (vector 2, above). CV-1 cells at 60-80% confluence were transfected with 1 μg of plasmid encoding Cre recombinase (vector 23). After 24 hours, cells were infected with recipient virus R1-VACV (described above) at an MOI of 0.02. Two hours after infection, cells were washed with PBS and transfected with 2 μg of vector 2. In the presence of cytoplasmic CRE recombinase protein, an RMCE occurred between the corresponding loxM3 and loxM7 sequences of R1-VACV and vector 2. The recombinant mixture was collected 24 hours after virus infection and stored at −80°C for virus purification.

For virus purification, infected cells were thawed and then sonicated on ice at maximum intensity for 30 seconds on/off three times to release virus from the cells. Four monolayers of confluent CV-1 cells in 6-well plates were infected with released virus at 2 μl released virus per plate. Two days after infection, red plaques (positive, reflecting expression of TurboFP635) were identified and selected under fluorescence microscopy at 48 hpi (green plaques indicate virus that has not been transformed and still expresses eGFP protein) . After one freeze-thaw cycle, lysates were added to monolayers of CV-1 in 6-well plates for a second round of plaque purification. Plaque purification was repeated 2-4 times until pure clones were obtained. The new recombinant VACV (R1-VACV2) can serve as another recipient virus expressing TurboFP635 fluorescent protein instead of eGFP. The efficiency of recombinant vaccinia virus production using CRME was comparable to or higher than that of the CRISPR/Cas9 method.

The insertion of the loxM3→pEL→TurboFP635→loxM7 sequence in the recipient VACV (WT1 or CAL1) by replacing 92 base pairs in the intergenic region between ORF_157 and ORF_158 was confirmed by PCR and Sanger sequencing and its Details are shown below. Using this method, recombinant vaccinia viruses expressing various therapeutic proteins were obtained by replacing vector 2 with one of the vectors selected from vectors 5 to 21 above. Tables X15 and X16 below summarize exemplary vectors for producing viruses and CAVES provided herein.

PCR and Sanger Sequencing To confirm the insertion of the transgene at the intergenic locus of the recipient virus, primer pairs were designed to amplify the intergenic region:
Reverse primer: 5'GACGAAGAAGCAAGAGATTGTGT 3' (SEQ ID NO: 41)
Forward primer: 5'ACCGTTTCCATTACCGCCA 3' (SEQ ID NO: 42).

The target sequences (complements) of the two primers are located on the HR-left and HR-right sides of vaccinia virus, respectively. Amplicons from the original virus before Cre/Lox recombination can be primers located on HR left and HR right. The PCR amplicon from the original non-recombinant virus can be 230 bp in length, and the new recombinant virus amplicon has a size equal to the size of the inserted transgene plus 140 bp from the backbone. obtain. The sequences of PCR products from all purified clones were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA).

Example 12
Attenuation of CAL-01/CAL-02 virus by deletion of anti-apoptotic genes and insertion of markers and/or therapeutic genes

The CAL-01 and CAL-02 vaccinia virus backbones can be attenuated by knocking out the viral F1L gene. VACV protein F1L is a 26 kDa protein that is expressed early after infection and is widely conserved among VACV strains. F1L is a potent inhibitor of endogenous mitochondrial apoptosis. Marker genes (eg, TurboFP635 or eGFP) and/or therapeutic genes can be introduced into the F1L locus. The CRISPR/Cas9HFc system described in Example 8 was used to generate recombinant vaccinia viruses (VACV) encoding markers and/or therapeutic genes.

The gene encoding F1L is located at ORF_050 (ACAM2000; GenBank: Accession Number: AY313847.1; SEQ ID NO: 70) of CAL-01. To eliminate F1L function, the 645bp fragment (SEQ ID NO: 52) in F1L was removed and replaced with loxM7-pEL-eGFP-loxM7-MCS (SphI, EcoRI, NotI, AgeI, SwaI, AflII) (SEQ ID NO: 53). ).

1. Guide RNA for F1L targeting (ORF_50)
Guide RNA (gRNA) sequences (SEQ ID NOs: 54 and 55) for targeting F1L in ORF_50 were selected using online software (dna20.com/eCommerce/cas9/input). Guide RNA was constructed under the control of the U6 promoter in a lentiviral vector to obtain the lentiplasmid (SEQ ID NO: 56) (vector obtained from VectorBuilder, Inc.).

2. Construction of donor vector to replace F1L with eGFP
The left (SEQ ID NO: 57) and right (SEQ ID NO: 58) homologous regions (HR) of ORF_050 were selected based on the ACAM2000 vaccinia virus genome sequence (GenBank accession number: AY313847; SEQ ID NO: 70). To construct a donor vector for VACV expressing eGFP instead of F1L, the following DNA fragments were synthesized (Genewiz, Inc., San Diego, CA):
(a) 529bp homologous left region (SEQ ID NO: 57);
(b) A selectable marker gene (eGFP), (loxM7-pEL-eGFP- loxM7-MCS, SEQ ID NO: 53); and (c) 619 bp homologous right region (SEQ ID NO: 58).

The fragments were cloned into the pUC57 (ampicillin) vector (SEQ ID NO: 73) in the order (a) → (b) → (c) (upstream → downstream).

3． Construction of donor vectors replacing F1L with eGFP and anti-VEGF
To construct donor vectors for VACV expressing eGFP and anti-VEGF antibodies in place of F1L, the following DNA fragments were synthesized (Genewiz, Inc., San Diego, CA):
(a) 529bp homologous left region (SEQ ID NO: 57);
(b) (upstream) a selectable marker gene (eGFP) that is under the control of the VACV early/late promoter (pEL), flanked by loxM7 and can be excised as required by CRE/lox recombinase, and the VACV late promoter (downstream) a single chain antibody (scAb (VEGF)) against VEGF under the control of (pL) (loxM7-pEL-eGFP-loxM7-pL-scAb (VEGF), SEQ ID NO: 69); and (c) a 619bp Homologous right region (SEQ ID NO: 58).

The fragments were cloned into the pUC57 (ampicillin) vector (SEQ ID NO: 73) in the order (a) → (b) → (c) (upstream → downstream).

Recombinant virus containing a combination of modifications at the ACAM2000 locus
The CAL-02 virus (a recombinant virus containing the therapeutic gene inserted between ORF_157 and ORF_158) was further modified to contain the recombinant inserted gene at the F1L locus and is referred to by the prefix "CAL-03". did.

Example 13
Attenuation of CAL-01/CAL-02 virus by deletion of anti-interferon gamma gene (B8R) and insertion of markers and/or therapeutic genes

The VACV strain WR gene B8R encodes a secreted protein (B8) that binds IFNγ. Protein B8 is similar to the mouse and human IFNγ receptor (IFN-R) and the myxoma virus protein M-T7, and acts as a soluble antagonist of IFNγ. Unlike cellular IFN-R, which primarily binds IFNγ from the same species, B8 can bind human, bovine, rat, and rabbit IFNγ with high affinity and mouse IFNγ with lower affinity. can do. In this example, the B8R gene is deleted and a marker gene (TurboFP635) is introduced in its place. The gene encoding B8 is located in ORF_201 (ACAM2000; GenBank: Accession Number: AY313847.1; SEQ ID NO: 70) of CAL-01. The 785 bp fragment in B8R (SEQ ID NO: 59) is deleted and replaced with loxP-pEL-TurboFP635-loxP-MCS (EcoRI, NotI, AgeI, SwaI, AflII) (SEQ ID NO: 60). The TurboFP635 expression cassette can be excised if necessary using the Cre/lox system.

1. Guide RNA for targeting B8R (ORF_201)
Guide RNA (gRNA) sequences (SEQ ID NOs: 61 and 62) for targeting B8R in ORF_201 were selected using online software (dna20.com/eCommerce/cas9/input). Guide RNA was constructed under the control of the U6 promoter in a lentiviral vector to obtain the lentiplasmid (SEQ ID NO: 63) (vector obtained from VectorBuilder, Inc.).

2. Construction of donor vector to replace B8R with TurboFP635
To construct a donor vector for VACV expressing TurboFP635 instead of B8R, the following DNA fragments were synthesized (Genewiz, Inc., San Diego, CA):
(a) 624bp homologous left region (SEQ ID NO: 64);
(b) Under the control of the VACV early/late promoter (pEL), which is adjacent to loxP and can be excised by loxP/CRE recombinase (loxP-pEL-TurboFP635-loxP-MCS, SEQ ID NO: 60) if necessary. A selectable marker (TurboFP635); and (c) a 624 bp homologous right region (SEQ ID NO: 65).

The fragments were cloned into the pUC57 (ampicillin) vector (SEQ ID NO: 73) in the order (a) → (b) → (c) (upstream → downstream).

Example 14
Engineering recombinant oncolytic viruses to inhibit angiogenesis

Vascular endothelial growth factors (VEGF) and their receptors (VEGFR), and angiopoietins (ANGPT) play a role in blood vessel development and angiogenesis. VEGF is a subfamily of growth factors with a highly conserved receptor-binding cystine-knot motif similar to that of the platelet-derived growth factor family. VEGF is a signaling protein involved in both angiogenesis and angiogenesis. Vascular endothelial growth factor A (VEGF-A), originally known as vascular permeability factor (VPF), is a signaling protein produced by cells that stimulates the formation of blood vessels.

Endothelial cells express three different VEGFRs that belong to the family of receptor tyrosine kinases (RTKs). They are named VEGFR-1 (Flt-1), VEGFR-2 (KDR/Flk-1) and VEGFR-3 (Flt-4). Although their expression is almost exclusively restricted to endothelial cells, VEGFR-1 can also be found on monocytes. All VEGFRs have seven immunoglobulin-like extracellular domains, a single transmembrane region and an intracellularly divided tyrosine kinase domain. VEGFR-2 has a lower affinity for VEGF than the Flt-1 receptor, but has higher signaling activity. Mitogenic activity in endothelial cells is primarily mediated by VEGFR-2, leading to their proliferation.

This example describes the construction of a recombinant virus encoding a single chain antibody against an anti-angiogenic or vascular normalizing gene, such as VEGF. Solid tumors are generally characterized by abnormal vasculature that is immunosuppressive and creates a hypoxic microenvironment that impairs antitumor T cell activity. Oncolytic viruses (OVs) can initiate vascular blockade within tumors, but after uptake, uptake of subsequent doses of OV and/or trafficking of immune cells into the tumor is impaired by such blockade. be able to.

Tumors counter hypoxia-induced oxygen and nutrient deprivation by secreting factors such as VEGF, thereby initiating forms of angiogenesis, but the resulting blood vessels are susceptible to therapeutic agents such as cancer treatments. suffer from structural abnormalities that impede delivery to the tumor core. “Vascular normalization” using molecules that inhibit pro-angiogenic factors such as VEGF or up-regulate anti-angiogenic factors may restore the proper balance of these signals and repair tumor vasculature. , thereby increasing the effectiveness of treatment. Accordingly, the recombinant viruses used in the CAVES/SNV compositions provided herein can be modified to recombinantly express anti-angiogenic factors, or factors that upregulate anti-angiogenic factors. can.

The insertion site for the anti-angiogenic factor was a previously described location site in the ACAM2000 vaccinia virus (between ORF157 and ORF158; see Example 8), allowing open reading of a functional virus in the resulting recombinant virus. Therapeutic genes can be inserted without changing the frame (ORF). An intermediate fragment (92 bp) with a small gap between ORF_157 and ORF_158 (271 bp; SEQ ID NO: 3) was selected to be replaced by the gene of interest. The gene of interest was introduced into this intergenic region between ORF_157 and ORF_158 using the CRISPR/Cas9HFc (High Fidelity Cas9) system, as described below. The following angiogenesis-inhibiting recombinant oncolytic viruses targeting VEGF, VEGFR and/or ANGPT were constructed.

Donor vector to generate recombinant VACV expressing angiogenesis inhibitor and selection gene (TurboFP635)

(1) Single chain antibody against TurboFP635 and VEGFR-2 To express a single chain antibody against VEGFR-2 receptor (codon optimized for vaccinia virus) together with the marker gene TurboFP635 under the control of separate promoters A donor vector was constructed. The donor vector was prepared by linearizing Vector 1 using SphI restriction enzyme, and combining DNA encoding the heavy chain of a single chain antibody against VEGFR-2 (scAb(VEGFR-2) _HC ; SEQ ID NO: 77) and DNA against VEGFR-2. It was constructed by inserting DNA encoding the light chain of a single chain antibody (scAb (VEGFR-2) _LC ; SEQ ID NO: 79) connected with a linker sequence (SEQ ID NO: 78). The scAb (VEGFR-2) recombinant sequence was combined with DNA encoding an IgK signal sequence (SEQ ID NO: 76) to promote cellular secretion of the antibody, DNA encoding a FLAG tag (SEQ ID NO: 29) to facilitate detection, and a terminator. sequence (SEQ ID NO: 80). IgK-scAb (VEGFR-2) _HC -Linker-scAb (VEGFR-2) _LC -FLAG-terminator sequences were codon-optimized for expression in vaccinia virus (e.g., idtdna.com/CodonOpt) and vaccinia early/late promoter (pEL; SEQ ID NO: 74), or alternatively the late promoter (pL; SEQ ID NO: 20). loxP → pEL → TurboFP635 → loxP → pEL → IgK → scAb (VEGFR-2) _HC → Linker → scAb (VEGFR-2) _LC → FLAG → The resulting vector containing the terminator sequence (upstream → downstream) was transferred to Genewiz, Inc. (SEQ ID NO: 81). Vector sequences were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, Calif.). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase. Alternatively, IgK-scAb (VEGFR-2) _HC -Linker-scAb (VEGFR-2) _LC -FLAG-terminator sequence under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20) and/or without the FLAG tag. It can be built with.

(2) A recombinant fusion protein containing parts of the extracellular domains of human VEGFR1 and VEGFR2 fused to the Fc part of TurboFP635 and human IgG1. known) and VEGFR-2 (also known as KDR or Flk-1). Each of the VEGFRs is composed of seven immunoglobulin (Ig) domains within their extracellular region, with Ig domains 2 and 3 contributing the majority of the binding energy for VEGF. This construct binds to vascular endothelial growth factor A (VEGF-A), vascular endothelial growth factor B (VEGF-B), and placental growth factor (PGF), a growth factor found in the placenta that is homologous to vascular endothelial growth factor. to target. VEGFR-1 acts as a cell surface receptor for VEGF-A, VEFG-B and PGF, and VEGFR-2 acts as a cell surface receptor for VEGF-A and vascular endothelial growth factors C and D (VEGF-C and VEGF-D, respectively). Acts as a cell surface receptor.

A vaccinia virus codon-optimized fusion protein containing part of the VEGFR-1 and VEGFR-2 extracellular domains fused to the Fc portion of human IgG1 (the "Fusion Protein") together with the marker gene TurboFP635 under the control of a separate promoter. A donor vector for expression was constructed. The donor vector was linearized using the SphI restriction enzyme to contain DNA encoding the IgK signal sequence (SEQ ID NO: 76), which promotes cellular secretion of the antibody, and a FLAG tag (SEQ ID NO: 29), which facilitates detection. and a DNA encoding a fusion protein (SEQ ID NO: 82) linked to a terminator sequence (SEQ ID NO: 80). The IgK-fusion protein-FLAG-terminator sequence was codon-optimized for expression in vaccinia virus (eg, idtdna.com/CodonOpt) and placed under the control of the vaccinia early/late promoter (pEL; SEQ ID NO: 74). The resulting vector containing loxP→pEL→TurboFP635→loxP→pEL→IgK→fusion protein→FLAG→terminator sequence (upstream→downstream) was purchased from Genewiz, Inc. It was synthesized by (SEQ ID NO: 83) The sequence of the vector was confirmed by Sanger sequencing (Retrogen, Inc., San Diego, CA). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase. Alternatively, the IgK-scAb (VEGF-A fusion protein)-FLAG-terminator sequence can be constructed under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20) and/or without the FLAG tag.

(3) TurboFP635 single chain antibody against ANGPT2
ANGPT2 encodes an antagonist of angiopoietin 1 (ANGPT1) and endothelial TEK tyrosine kinase (TIE-2, TEK). ANGPT2 can disrupt the vascular remodeling ability of ANGPT1 and induce endothelial cell apoptosis.

A donor vector was constructed to express a single chain antibody against ANGPT2 (codon optimized for vaccinia virus) together with the marker gene TurboFP635 under the control of separate promoters. The donor vector was created by linearizing Vector 1 using SphI restriction enzyme, and combining the DNA encoding the heavy chain of a single chain antibody against ANGPT2 (scAb(ANGPT2) _HC ; SEQ ID NO: 84) and the light chain of a single chain antibody against ANGPT2. It was constructed by inserting DNA encoding the chain (scAb (ANGPT2) _LC ; SEQ ID NO: 85) connected with a linker sequence (SEQ ID NO: 78). The scAb (ANGPT2) recombinant sequence was combined with a DNA encoding an IgK signal sequence (SEQ ID NO: 76) to promote cellular secretion of the antibody, a DNA encoding a FLAG tag (SEQ ID NO: 29) to facilitate detection, and a terminator sequence ( SEQ ID NO: 80). IgK-scAb (ANGPT2) _HC -Linker-scAb (ANGPT2) _LC -FLAG-terminator sequences were codon-optimized for expression in vaccinia virus (e.g., idtdna.com/CodonOpt) and vaccinia early/late promoter (pEL; was placed under the control of SEQ ID NO: 74). loxP → pEL → TurboFP635 → loxP → pEL → IgK → scAb (ANGPT2) _HC → Linker → scAb (ANGPT2) _LC → FLAG → The resulting vector containing the terminator sequence (upstream → downstream) was purchased from Genewiz, Inc. (SEQ ID NO: 86). Vector sequences were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, Calif.). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase. Alternatively, the IgK-scAb(ANGPT2) _HC -Linker-scAb(ANGPT2) _LC -FLAG-terminator sequence is constructed under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20) and/or without the FLAG tag. Can be done.

(4) Single chain antibody against TurboFP635 and VEGF-A Donor for expressing single chain antibody against VEGF-A (codon optimized for vaccinia virus) together with the marker gene TurboFP635 under the control of separate promoters The vector was constructed. The donor vector was prepared by linearizing Vector 1 using SphI restriction enzyme, and combining DNA encoding the heavy chain of a single chain antibody against VEGF-A (scAb(VEGF-A) _HC ; SEQ ID NO: 87) and DNA against VEGF-A. It was constructed by inserting DNA encoding the light chain of a single chain antibody (scAb (VEGF-A) _LC ; SEQ ID NO: 88) connected with a linker sequence (SEQ ID NO: 78). The scAb (VEGF-A) recombinant sequence was combined with DNA encoding an IgK signal sequence (SEQ ID NO: 76) to promote cellular secretion of the antibody, DNA encoding a FLAG tag (SEQ ID NO: 29) to facilitate detection, and a terminator. sequence (SEQ ID NO: 80). IgK-scAb (VEGF-A) _HC -Linker-scAb (VEGF-A) _LC -FLAG-Terminator sequences are codon-optimized for expression in vaccinia virus (e.g., idtdna.com/CodonOpt) and vaccinia early/late It was placed under the control of a promoter (pEL; SEQ ID NO: 74). loxP → pEL → TurboFP635 → loxP → pEL → IgK → scAb (VEGF-A) _HC → Linker → scAb (VEGF-A) _LC → FLAG → The resulting vector containing the terminator sequence (upstream → downstream) was purchased from Genewiz, Inc. (SEQ ID NO: 89). Vector sequences were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, Calif.). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase. Alternatively, IgK-scAb (VEGF-A) _HC -Linker-scAb (VEGF-A) _LC -FLAG-terminator sequence under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20) and/or without the FLAG tag. It can be built with.

Donor vector encoding two single chain antibodies and a selection gene (TurboFP635)

(1) Single-chain antibody against VEGF-A and single-chain antibody against ANGPT2 in the opposite direction Two inhibitors of angiogenesis: single-chain antibody against VEGF-A and single-chain antibody against ANGPT-2 (vaccinia virus donor vector for expressing pEL (SEQ ID NO: 74) or pL (SEQ ID NO: 20) promoters together with the marker gene TurboFP635, each independently controlled by the pEL (SEQ ID NO: 74) or pL (SEQ ID NO: 20) promoter. We constructed a donor vector controlled by Exemplary donor vectors include (a) a vector for VEGF-A linked to DNA encoding an IgK signal sequence, a FLAG tag, and a terminator sequence and under the control of the vaccinia virus early/late promoter (pEL; SEQ ID NO: 74); a full-chain antibody (scAb (VEGF-A)); and (b) in the opposite orientation to (a), linked to DNA encoding the IgK signal sequence, FLAG tag and terminator sequence, and the vaccinia virus early/late promoter ( Panel; SEQ ID NO: 74) encodes a single chain antibody against ANGPT2 (scAb (ANGPT2)).

The donor vector was constructed by linearizing Vector 1 using SphI restriction enzyme and inserting: (1) ligated with a linker sequence (SEQ ID NO: 78), which further facilitates cellular secretion of the antibody; A single strand for VEGF-A linked to a DNA encoding an IgK signal sequence (SEQ ID NO: 76), a DNA encoding a FLAG tag to facilitate detection (SEQ ID NO: 29), and a terminator sequence (SEQ ID NO: 80). DNA encoding the heavy chain of an antibody (scAb(VEGF-A) _HC ; SEQ ID NO: 87) and DNA encoding the light chain of a single chain antibody against VEGF-A (scAb(VEGF-A) _LC ; SEQ ID NO: 88) (2) DNA that is linked by a linker sequence (SEQ ID NO: 78) and further encodes an IgK signal sequence that promotes cellular secretion of antibodies (SEQ ID NO: 76), and DNA that encodes a FLAG tag that facilitates detection (SEQ ID NO: 76). No. 29), and a DNA encoding the heavy chain of a single chain antibody against ANGPT2 (scAb(ANGPT2 _)HC ; SEQ ID No. 84) linked to a terminator sequence (SEQ ID No. 80) and a DNA encoding the heavy chain of a single chain antibody against ANGPT2 (scAb(ANGPT2)HC; SEQ ID No. 84) DNA encoding light chain (scAb (ANGPT2) _LC ; SEQ ID NO: 85). IgK-scAb (VEGF-A) _HC -Linker-scAb (VEGF-A) _LC -FLAG-Terminator sequences are codon-optimized for expression in vaccinia virus (e.g., idtdna.com/CodonOpt) and vaccinia early/late It was placed under the control of a promoter (pEL; SEQ ID NO: 74). IgK-scAb (ANGPT2) _HC -Linker-scAb (ANGPT2) _LC -FLAG-terminator sequences were codon-optimized for expression in vaccinia virus (e.g., idtdna.com/CodonOpt) and vaccinia early/late promoter (pEL; was placed under the control of SEQ ID NO: 74). IgK-scAb (VEGF-A) _HC -linker-scAb (VEGF-A) _LC -FLAG-terminator sequence and IgK-scAb (ANGPT2) _HC -linker-scAb (ANGPT2) _LC -FLAG-terminator sequence in opposite orientation Inserted. Obtained loxP → pEL → TurboFP635 → loxP → pEL → IgK → scAb (VEGF-A) _HC → linker → scAb (VEGF-A) _LC → FLAG → terminator ← terminator ← FLAG ← scAb (ANGPT2) _LC ← linker ← scAb (ANGPT2) A vector containing _{the HC} ←IgK←pEL sequence (upstream → downstream) was purchased from Genewiz, Inc. (SEQ ID NO: 90). Vector sequences were confirmed by Sanger sequencing (Retrogen, Inc., San Diego, Calif.). The TurboFP635 cassette can be used as a selection gene and can be excised as necessary using loxP/CRE recombinase. Alternatively, both IgK-scAb(VEGF-A) _HC -linker-scAb(VEGF-A) _LC -FLAG-terminator sequence and IgK-scAb(ANGPT2) _HC -linker-scAb(ANGPT2) _LC -FLAG-terminator sequence. , under the control of the vaccinia virus late promoter (pL; SEQ ID NO: 20), and/or without the FLAG tag.

Example 15
CAVES enhances the therapeutic efficacy of checkpoint inhibitors

This example demonstrates that the CAVES compositions provided herein can increase the therapeutic efficacy of other therapeutic agents, such as checkpoint inhibitors, when administered as a combination therapy.

Mouse colon cancer model (CT26)
Colon tumors were generated by subcutaneous injection of 2×10 ⁶ CT26 cells into the right flank of 4-6 week old athymic nude mice. Eight days after tumor cell injection, mice were treated as follows:
(1) Intratumoral injection of 1×10 ⁶ SNV-1c (day 0);
(2) treated by systemic administration of anti-PD1 (200ug/animal, i.p., clone RMP1-14, Bio X Cell);
(3) intratumoral injection of 1 × 10 ⁶ SNV-1c (day 0) and systemic administration of anti-PD1 on day 2; or (4) control mice treated intratumorally with PBS (n = 8 per treatment group). ).

For a single intratumoral injection, the data demonstrated that control animals exhibited a mean tumor volume of approximately 2000 ^mm 17 days after intratumoral injection into CT26 tumors. In comparison, treatment with anti-PD1 resulted in a mean tumor volume of approximately 1450 ^mm3 at day 17. Treatment with SNV-1c resulted in a slightly greater slowing of tumor progression, with a mean tumor volume of approximately 1200 ^mm3 at day 17. Mice treated with both anti-PD1 and SNV-1c showed synergistic benefit, with a mean tumor volume of approximately 900 ^mm3 at day 17.

In another experiment, 2×10 ⁶ CT26 colon cancer mouse cells were injected subcutaneously into the right flank of immunocompetent BALB/c mice. 10 days after tumor inoculation, treat mice with 1 × ¹⁰ CAVES in combination with anti-mouse PD1 (200 ug per animal, clone RMP1-14, Bio X cells) or a single dose of CAVES for 3 times every 2 days. did. CAVES were generated by infecting stem cells with CAL1 virus at an MOI of 0.1 and harvested 28 hours after infection. Anti-PD1 was administered intraperitoneally 2 days after CAVES injection. The data in the table below shows that anti-PD1 therapeutic efficacy was enhanced when combined with CAVES treatment.

Prostate Cancer Model Prostate tumors were generated by subcutaneous injection of 2×10 ⁶ RM1 prostate cancer cells into the right flank of 4-6 week old athymic nude mice. Twenty days after tumor cell injection, mice were treated as follows:
(1) Intratumoral injection of 1×10 ⁶ SNV-1c (day 0);
(2) treated by systemic administration of anti-PD1 (200ug/animal, i.p., clone RMP1-14, Bio X Cell);
(3) intratumoral injection of 1 × 10 ⁶ SNV-1c (day 0) and systemic administration of anti-PD1 on day 2;
(4) Intratumoral injection of 1×10 ⁶ SNV-3c: 1×10 ⁵ pfu CAL3 virus (see Example 12) incubated with adipose-derived stem cells (MOI=0.2, 28 hours)
(5) intratumorally injected with 1 × 10 ⁶ SNV-3c (day 0) and systemically administered anti-PD1 on day 2; or (6) control mice intratumorally injected with PBS (n = 8 per treatment group). ).

For a single intratumoral injection, the data demonstrated that control animals showed an average approximately 45-50 fold increase in tumor volume 10 days after intratumoral injection into CT26 tumors. The mean fold increase in tumor volume in animals treated with anti-PD1 alone was similar to that of controls. Treatment with SNV-1c resulted in a significant delay in tumor progression, with an average fold increase in tumor volume of approximately 16-fold. In comparison, mice treated with both anti-PD1 and SNV-1c showed an average fold increase in tumor volume of approximately 24-25-fold.

SNV-3c compositions containing viruses expressing anti-angiogenic factors were found to be more effective in enhancing the therapeutic efficacy of anti-PD1. Treatment with SNV-3c resulted in a significant delay in tumor progression, with an average fold increase in tumor volume of approximately 12-fold at day 10. Mice treated with both anti-PD1 and SNV-3c showed greater slowing of tumor progression, with an average fold increase in tumor volume of approximately 7-fold at day 10.

Accordingly, the compositions provided herein can be used in combination therapy with other anti-cancer treatments and agents, such as checkpoint inhibitors, to enhance efficacy.

Since modifications will be apparent to those skilled in the art, it is intended that the invention be limited only by the scope of the claims appended hereto.

Also provided herein are methods of treatment comprising administering the systems provided herein to a subject in need of such treatment. This system can be used alone or with, for example, but not limited to, checkpoint inhibitors, CAR-T cells, co-stimulatory molecules, therapeutic antibodies, bi-antibodies and antibody-drug conjugates. Can be administered in combination with other immuno-oncology therapies including.
Additionally, provided herein is the following:
[Section 1]
A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the oncolytic virus is not an adenovirus,
the carrier cell is a cell in which the virus can replicate;
the carrier cells are not tumor cells or immune cells, and
A cell-assisted viral expression system, wherein said carrier cell expresses at least one immunomodulatory or recombinant therapeutic protein encoded by said virus and expressed by association of said virus with said carrier cell.
[Section 2]
A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the oncolytic virus is not a measles virus,
the carrier cell is a stem cell in which the virus can replicate, and
A cell-assisted viral expression system, wherein said carrier cell expresses at least one immunomodulatory or recombinant therapeutic protein encoded by a virus and expressed by association of the virus with the carrier cell.
[Section 3]
A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the carrier cell is a cell in which the virus can replicate;
the carrier cell expresses at least one immunomodulatory protein or recombinant therapeutic protein encoded by a virus and expressed by association of the virus and the carrier cell;
said carrier cells have been treated and/or modified to enhance the immunosuppressive and/or immunoprivileged properties of said cells for administration to a human subject, and optionally said cells are , a cell-assisted viral expression system that has been treated or modified to enhance amplification of the virus in the cell.
[Section 4]
A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the oncolytic virus is not an adenovirus,
the carrier cell is a stem cell,
the carrier cell expresses at least one immunomodulatory or recombinant therapeutic protein encoded by a virus and expressed by association of the virus with the carrier cell, and
A cell-assisted virus expression system, wherein the oncolytic virus is incubated for 6 hours or more after the carrier cells are infected with the oncolytic virus.
[Section 5]
5. The cell-assisted viral expression system (CAVES) according to item 4 above, wherein the virus is vaccinia virus.
[Section 6]
Cell-assisted virus expression system (CAVES) according to item 4 or item 5 above, wherein the carrier cells containing the virus are produced by infecting the cells at a multiplicity of infection (MOI) of 0.001 to 10. .
[Section 7]
The cell-assisted viral expression system (CAVES) according to any of items 1 to 6 above, which is cryopreserved.
[Section 8]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 6 above, which has been refrigerated for at least 24 hours.
[Section 9]
7. The cell-assisted viral expression system (CAVES) according to any one of items 1 to 6 above, wherein the temperature of the composition is -20°C to -80°C or about -20°C to about -80°C.
[Section 10]
stored at a temperature of 5° C. to −200° C. for at least 24 hours, said carrier cells contain less than about 100 or 50 or 10 virus particles, and said cells are sonicated; The cell-assisted viral expression system (CAVES) according to any of the above items 1 to 7, which can be evaluated by measuring plaque-forming units.
[Section 11]
A cell-assisted viral expression system (CAVES) according to any of paragraphs 7, 9 and 10 above, wherein the cell-assisted viral expression system (CAVES) is stored for at least 24 hours at about -80°C to -200°C or a temperature therebetween.
[Section 12]
The cell-assisted virus expression system (CAVES) according to any one of items 1 to 11 above, wherein the virus is a TK+ vaccinia virus.
[Section 13]
The cell-assisted virus expression system (CAVES) according to any of items 1 to 11 above, wherein the virus is attenuated.
[Section 14]
A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the carrier cell is a cell in which the virus can replicate;
said carrier cell expresses at least one immunomodulatory protein or recombinant therapeutic protein encoded by said virus and expressed by association of said virus with said carrier cell, and
A cell-assisted viral expression system, wherein said CAVES are cryopreserved or in a composition containing a cryoprotectant.
[Section 15]
15. The cell-assisted viral expression system (CAVES) according to item 14 above, wherein the virus is not an adenovirus.
[Section 16]
The cell-assisted viral expression system (CAVES) according to item 14 or item 5 above, wherein the temperature of the composition is just or about -200°C to -20°C.
[Section 17]
The cell-assisted viral expression system (CAVES) according to item 7 or item 14 above, wherein the CAVES is in a composition comprising one or both of DMSO and glycerol for cryopreservation.
[Section 18]
Any of paragraphs 1 to 14 above, wherein said carrier cell carrying an oncolytic virus is produced by infecting said cell with said virus at a multiplicity of infection (MOI) of no more than 10 virus particles/cell. Cell-assisted viral expression system (CAVES) as described in .
[Section 19]
19. The cell-assisted viral expression system (CAVES) according to item 18 above, wherein the MOI is 0.001 to 10.
[Section 20]
20. Cell-assisted viral expression system (CAVES) according to item 19 above, wherein the MOI is at least 0.1 or at least 0.3 or at least 0.5.
[Section 21]
A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 19 above, wherein the carrier cell comprises from about 900 or about 1000 copies to about 10,0000 or about 11,000 copies of the oncolytic virus genome. ).
[Section 22]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 19 above, comprising less than 100 viral genomes/cell.
[Section 23]
The above clause, wherein the carrier cell contains from about 900 or about 1000 copies to about 10,0000 or about 11,000 copies of the oncolytic virus genome, wherein the carrier cell contains about 900 or about 1000 copies to about 10,0000 or about 11,000 copies of the oncolytic virus genome. The cell-assisted viral expression system (CAVES) according to any one of 1 to 22.
[Section 24]
Paragraphs 1-23 above, wherein said carrier cells contain less than about 100 or 50 or 10 virus particles, and the number of virus particles can be assessed by sonicating said cells and measuring plaque forming units. A cell-assisted viral expression system (CAVES) according to any of the above.
[Section 25]
Items 1 to 24 above, wherein the carrier cells contain from 1 to less than 200 virus particles/cell, and the number of virus particles can be assessed by sonicating the cells and measuring plaque forming units. A cell-assisted viral expression system (CAVES) according to any of the above.
[Section 26]
25. The cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 24 above, wherein the carrier cells contain from 1 to less than 200 virus particles/cell.
[Section 27]
the cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of the cell for administration to a human subject;
and/or said cell has been treated or modified to enhance amplification of said virus within said cell;
The cell-assisted viral expression system (CAVES) according to any one of items 1, 2, and 7 to 26 above.
[Section 28]
said cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject; and
the cell has been treated or modified to enhance amplification of the virus within the cell;
The cell-assisted viral expression system (CAVES) according to any of items 1 to 27 above.
[Section 29]
The above clause, wherein said carrier cells are permissive for oncolytic virus amplification and are not recognized by said subject's immune system for a sufficient time to accumulate within the tumor and/or deliver virus to the subject's tumor. The cell-assisted viral expression system (CAVES) according to any one of 1 to 28.
[Section 30]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 3 to 29 above, wherein the carrier cells are selected from treated or modified stem cells, immune cells and tumor cells.
[Section 31]
30. The cell-assisted viral expression system (CAVES) according to any of items 1 to 29 above, wherein the carrier cells are embryonic epithelial cells or fibroblasts.
[Section 32]
30. The cell-assisted viral expression system (CAVES) according to any one of items 3 to 29 above, wherein the carrier cell is an immune cell.
[Section 33]
The immune cells include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. The cell-assisted viral expression system (CAVES) according to paragraph 32 above, selected from among targeted CAR-T cells.
[Section 34]
The cell-assisted viral expression system (CAVES) according to any of items 3 to 29 above, wherein the carrier cells are modified or treated cells from a hematological malignancy cell line.
[Section 35]
The cell line may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. The cell-assisted viral expression system (CAVES) according to item 34 above, which is a cell line.
[Section 36]
33. The cell-assisted viral expression system (CAVES) according to any one of items 1 to 32 above, wherein the carrier cells are stem cells.
[Section 37]
The stem cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small juvenile stem cells, dermal fibroblast stem cells 37. Cell-assisted viral expression system (CAVES) according to paragraph 36 above, selected from among , tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells.
[Section 38]
37. The cell-assisted viral expression system (CAVES) according to paragraph 36, wherein the stem cells are selected from mesenchymal cells.
[Section 39]
The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors Cell-assisted viral expression system (CAVES) according to paragraph 38, isolated from/derived from cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells.
[Section 40]
37. The cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 36 above, wherein the cells are selected from endothelial progenitor cells, neural stem cells, adult bone marrow cells and mesenchymal stem cells.
[Section 41]
The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth 37. The cell-assisted viral expression system (CAVES) according to any of items 1 to 36 above, which is a mesenchymal stem cell isolated from or derived from papilla-derived stem cells and muscle satellite cells.
[Section 42]
42. The cell-assisted viral expression system (CAVES) according to paragraph 41, wherein the mesenchymal stem cells are isolated from adipose stromal cells.
[Section 43]
37. The cell-assisted viral expression system (CAVES) according to any of items 1 to 36 above, wherein the carrier cells include adipose stromal cells.
[Section 44]
37. The cell-assisted viral expression system (CAVES) according to any of items 1 to 36 above, wherein the cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof.
[Section 45]
45. The cell-assisted viral expression system (CAVES) according to any one of items 1 to 44 above, wherein the carrier cell is derived from a stromal vascular cell group (SVF) of adipose stromal cells.
[Section 46]
Items 1 to 45 above, wherein the cells are stem cells derived from the epiadventitial adipose stromal cells (CD34+SA-ASC) obtained by culturing the epiadventitial adipose stromal cells to produce AD-MSCs. A cell-assisted viral expression system (CAVES) according to any of the above.
[Section 47]
39. The cell-assisted viral expression system (CAVES) according to item 38 above, wherein the mesenchymal cells are derived from adipose stromal cells.
[Section 48]
The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). The cell-assisted viral expression system (CAVES) according to any one of items 1 to 47 above, which is an adipose stromal cell selected from.
[Section 49]
49. The cell-assisted virus according to any one of items 1 to 48 above, wherein the carrier cells are adipose cultured adipose mesenchymal stem cells (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC). Expression system (CAVES).
[Section 50]
The carrier cells and the oncolytic virus are incubated for a sufficient period of time for the immunomodulatory or therapeutic protein encoded by the virus to be expressed and/or for a period of time prior to administration to a subject or storage of the virus. 50. A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 49 above, wherein the cell-assisted viral expression system (CAVES) is co-cultured in vitro for a period of time sufficient to undergo at least one replication cycle.
[Section 51]
Cell-assisted virus expression according to paragraph 50, wherein the carrier cell and the virus are co-cultured for a period sufficient for the oncolytic virus immunomodulatory protein to be expressed and for the virus to undergo at least one replication cycle. System (CAVES).
[Section 52]
52. A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 51 above, wherein said cells are autologous to said subject to be treated.
[Section 53]
52. A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 51 above, wherein said cells are allogeneic to said subject to be treated.
[Section 54]
The virus may include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, poliovirus. Any of the above items 1 to 53 selected from viruses, parvoviruses, retroviruses, alphaviruses, flaviviruses, rhabdoviruses, papillomaviruses, influenza viruses, mumps viruses, gibbon leukemia viruses, Maraba viruses and Sindbis viruses. Cell-assisted viral expression system (CAVES) described in Crab.
[Section 55]
55. The cell-assisted viral expression system (CAVES) according to any one of items 1 and 3 to 54 above, wherein the virus is measles virus.
[Section 56]
55. The cell-assisted viral expression system (CAVES) according to item 54, wherein the virus is a retrovirus.
[Section 57]
55. The cell-assisted viral expression system (CAVES) according to item 54, wherein the virus is a poxvirus, which is vaccinia virus.
[Section 58]
58. The cell-assisted viral expression system (CAVES) according to item 57 above, wherein the vaccinia virus is TK+.
[Section 59]
55. The cell-assisted viral expression system (CAVES) according to item 54, wherein the virus is attenuated.
[Section 60]
The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Tashkent, Wyeth, IHD- 55. Cell-assisted viral expression system (CAVES) according to paragraph 54 above, which is a poxvirus selected from among the strains of J, IHD-W, Brighton, Dairen I and Connaught.
[Section 61]
61. The cell-assisted viral expression system (CAVES) according to item 60, wherein the virus is ACAM1000 or ACAM2000.
[Section 62]
expression of an immunomodulatory protein and/or therapeutic protein encoded by said virus, wherein after said virus infects said carrier cell, at least one immunomodulatory protein or therapeutic protein encoded by said virus is expressed; or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14; 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, The above was achieved by incubating for more than 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 or 59 hours. The cell-assisted viral expression system (CAVES) according to any of items 1 to 57.
[Section 63]
63. A cell according to paragraph 62, wherein the expression of an immunomodulatory and/or therapeutic protein encoded by said virus is achieved by incubating said carrier cell with said virus for 6 hours or more than 6 hours after infection. Assisted viral expression systems (CAVES).
[Section 64]
64. The cell-assisted viral expression system (CAVES) according to item 63 above, wherein the virus is vaccinia virus.
[Section 65]
63. The cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 62 above, wherein the carrier cells carrying the virus are incubated post-infection for a time sufficient for expression of the protein and replication of the virus.
[Section 66]
The cell-assisted virus expression system (CAVES) according to item 62 or item 60 above, wherein after incubation, the carrier cells containing the virus are stored at -5°C to -200°C for at least 24 hours.
[Section 67]
67. The cell-assisted viral expression system (CAVES) according to any one of items 1 to 66 above, wherein the CAVES or the composition containing the CAVES is stored at -5°C to -200°C for at least 24 hours.
[Section 68]
67. The cell-assisted viral expression system (CAVES) according to any of items 1 to 66 above, wherein the CAVES or the composition containing the CAVES is stored at -80°C to -200°C for at least 24 hours.
[Section 69]
69. The cell-assisted viral expression system (CAVES) according to any of items 1 to 68 above, wherein the virus expresses an immunomodulatory protein that is displayed on the surface of the carrier cell.
[Section 70]
62. Cell-assisted viral expression system (CAVES) according to paragraph 61, wherein the immunomodulatory viral protein is selected from VCP (C3L), B5R, HA (A56R), B18R/B19R and B8R.
[Section 71]
The carrier cells are stem cells that are mesenchymal cells derived from adipose stromal cells,
the virus is vaccinia virus, and
the carrier cell containing the virus is under conditions in which at least one immunomodulatory or therapeutic protein encoded by the virus is expressed, or the carrier cell is capable of propagation, or the virus is capable of replicating; produced by incubating the cells with the virus for 6 hours or more under conditions that allow
The cell-assisted viral expression system (CAVES) according to any of items 1 to 69 above.
[Section 72]
Said incubation was carried out for any time between 6 hours and the next day, up to 24 hours, up to 26 hours, up to 3 hours, up to 3 days, up to 4 days, up to 5 days, or from 6 hours to 1 week. Cell-assisted viral expression system (CAVES) according to paragraph 71.
[Section 73]
72. A cell-assisted viral expression system (CAVES) according to any of paragraphs 62-71 above, wherein said conditions include incubation in a cell culture medium at a temperature of about 25°C to 40°C.
[Section 74]
74. The cell-assisted viral expression system (CAVES) according to any one of items 1 to 73 above, wherein the virus is a vaccinia virus selected from those described in any of items 280 to 310 above.
[Section 75]
The virus is a vaccinia virus selected from vaccinia viruses,
a) the nucleic acid sequence set forth in SEQ ID NO: 71 or a sequence having at least 95% sequence identity thereto;
b) at least one therapeutic gene or detectable marker gene inserted in the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding vaccinia virus;
c) a partially or completely deleted F1L locus of the corresponding unmodified vaccinia virus, where the F1L gene is not expressed;
d) a partially or completely deleted B8R locus of the corresponding unmodified vaccinia virus, where the B8R gene is not expressed;
e) One or more of the following modifications:
(i) at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus;
(ii) a partially or completely deleted F1L locus of the corresponding unmodified vaccinia virus, where the F1L gene is not expressed; and/or
(ii) a partially or completely deleted B8R locus in the corresponding unmodified vaccinia virus, where the B8R gene is not expressed;
The cell-assisted viral expression system (CAVES) according to any of items 1 to 73 above, comprising:
[Section 76]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 75a) to 75e) above, wherein the corresponding unmodified vaccinia virus comprises the nucleic acid sequence shown in SEQ ID NO: 70 or SEQ ID NO: 71.
[Section 77]
Paragraph 75b) above, wherein said modification comprises at least one therapeutic gene inserted into said intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus. , e) and the cell-assisted viral expression system (CAVES) according to any of paragraph 76 above.
[Section 78]
The therapeutic gene(s) may include immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies and angiogenesis. Cell-assisted viral expression system (CAVES) according to paragraph 77 above, selected from among inhibitors.
[Section 79]
79. The cell-assisted viral expression system (CAVES) according to item 78, wherein the therapeutic gene is a costimulatory factor that is OX40L or CD40L.
[Section 80]
Paragraph 75b) above, wherein said modification comprises at least one marker gene inserted in said intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus. and e), and the cell-assisted viral expression system (CAVES) according to any of paragraphs 76 to 78 above.
[Section 81]
Clause 80 above, wherein said marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Cell-assisted viral expression system (CAVES) as described in .
[Section 82]
the B8R gene is not expressed because the modification is a partially or completely deleted B8R locus in the corresponding unmodified virus;
the modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted B8R locus;
The cell-assisted viral expression system (CAVES) according to any of paragraphs 75d) to 75f) above.
[Section 83]
The modification is a partially or completely deleted F1L locus of the corresponding unmodified virus, so that the F1L gene is not expressed;
said modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted F1L locus;
The cell-assisted viral expression system (CAVES) according to any of paragraphs 75c), e), and f) above.
[Section 84]
A cell-assisted viral expression system (CAVES) according to paragraph 82 or paragraph 83 above, which encodes at least one therapeutic gene.
[Section 85]
The therapeutic gene(s) may include immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies and angiogenesis. Cell-assisted viral expression system (CAVES) according to paragraph 84 above, selected from among inhibitors.
[Section 86]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 82 to 85 above, comprising at least one marker gene.
[Section 87]
Clause 86 above, wherein said marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Cell-assisted viral expression system (CAVES) as described in .
[Section 88]
The cell-assisted viral expression system (CAVES) according to any of paragraphs 75b) and f) above and paragraphs 76 to 87 above, wherein at least one therapeutic gene is an anti-cancer antibody.
[Section 89]
89. The cell-assisted viral expression system (CAVES) according to item 88 above, wherein the anti-cancer antibody is an anti-VEGF antibody or an anti-CTLA-4 antibody.
[Section 90]
The cell-assisted viral expression system (CAVES) according to Item 88 or Item 89 above, wherein the anti-cancer antibody is a single chain antibody.
[Section 91]
91. The cell-assisted viral expression system (CAVES) according to any of items 88 to 90 above, further comprising a nucleic acid encoding an IgK signal peptide for promoting secretion of the antibody.
[Section 92]
92. The cell-assisted viral expression system (CAVES) according to any of paragraphs 88 to 91 above, further comprising a nucleic acid encoding a FLAG tag to facilitate detection of the antibody.
[Section 93]
Paragraphs 75b) and e above, wherein said virus comprises a gene encoding a therapeutic product and/or a detectable marker gene selected from sodium-iodine symporter (NIS), OX40L and 4-IBBL. ) and the cell-assisted viral expression system (CAVES) according to any of items 76 to 87 above.
[Section 94]
The cell-assisted viral expression system (CAVES) according to any of items 74 and 76 to 93 above, wherein the unmodified vaccinia virus is ACAM2000 or ACAM1000.
[Section 95]
95. The cell-assisted viral expression system (CAVES) according to paragraph 94, wherein the unmodified vaccinia virus is ACAM2000.
[Section 96]
76. The cell-assisted viral expression system (CAVES) according to any of items 3 to 75 above, wherein the cells are derived from a tumor of the subject to whom the composition is administered.
[Section 97]
97. A cell-assisted viral expression system (CAVES) according to paragraph 96 above, encoding a therapeutic product.
[Section 98]
98. A cell-assisted viral expression system (CAVES) according to paragraph 97, wherein the therapeutic product is one or more of a cytokine, a chemokine, a co-stimulator, a prodrug activator, and a therapeutic antibody.
[Section 99]
The therapeutic product may be GM-CSF, IL2, IL10, IL12, IL-15, IL-17, IL-18, IL-21, TNF, MIP1a, FLt3L, IFN-b, IFN-g, CCl5, CCl2 , CCl19, CXCl11, OX40L, 41BBL, CD40L, B7.1/CD80, GITRL, LIGHT, CD70, BITE, and VEGFA, VEGFB, PGF, VEGFR2, PDGFR, Ang-1, Ang-2, ANGPT1, ANGPT2, HGF, 99. The cell-assisted viral expression system (CAVES) of paragraph 98 above, which is one or more of a single chain antibody against lacZ, a cytosine deaminase enzyme, and a human sodium-iodine symporter.
[Section 100]
99. A cell-assisted viral expression system (CAVES) according to paragraph 98, wherein said therapeutic product is an immune checkpoint inhibitor.
[Section 101]
Cell-assisted viral expression according to item 100 above, wherein the immune checkpoint inhibitor is an antibody against PD-1, PD-L1, CTLA4, TIM-3, BTLA, VISTA, PD-L1, or LAG-3. System (CAVES).
[Section 102]
97. A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 96 above, wherein said oncolytic virus encodes a therapeutic product that inhibits or reduces angiogenesis.
[Section 103]
The encoded therapeutic product is optionally linked directly or indirectly to the Fc portion of human IgG1, anti-angiopoietin-2 (ANGPT) single chain antibody, and combinations thereof. 98. Cell-assisted viral expression system (CAVES) according to paragraph 97 above, selected from VEGFR single chain antibodies, VEGFR or its extracellular domain.
[Section 104]
A pharmaceutical composition comprising a cell-assisted viral expression system (CAVES) according to any of the above items 1 to 103 in a pharmaceutically acceptable medium.
[Section 105]
105. The pharmaceutical composition according to item 104 above, which is cryopreserved.
[Section 106]
A pharmaceutical composition according to paragraph 104 above or paragraph 105 above, which is formulated for direct administration without dilution.
[Section 107]
107. A pharmaceutical composition according to any of paragraphs 104 to 106 above, which is formulated as a single dose.
[Section 108]
108. The pharmaceutical composition according to any of paragraphs 104 to 107 above, wherein said pharmaceutically acceptable vehicle is suitable for parenteral administration.
[Section 109]
109. The pharmaceutical composition according to any of paragraphs 104 to 108 above, which is formulated for intratumoral, intraperitoneal, intravenous, subcutaneous, oral, mucosal, or rectal administration.
[Section 110]
109. The pharmaceutical composition according to any of paragraphs 104 to 109 above, which is formulated for systemic administration.
[Section 111]
104. The cell-assisted viral expression system (CAVES) according to any of items 1 to 103 above, wherein the virus expresses an immunomodulatory protein that is displayed on the carrier cell surface.
[Section 112]
112. The cell-assisted viral expression system (CAVES) according to paragraph 111 above, wherein the virus is vaccinia virus.
[Section 113]
Cell-assisted viral expression system (CAVES) according to paragraph 111 or paragraph 112 above, wherein the immunomodulatory viral protein is selected from VCP (C3L), B5R, HA (A56R), B18R/B19R and B8R. ).
[Section 114]
The oncolytic virus is an oncolytic vaccinia virus, herpes virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), Coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus. , picornavirus, poliovirus, parvovirus, lentivirus, alphavirus, flavivirus, rhabdovirus, papillomavirus, influenza virus, mumps virus, gibbon leukemia virus, maraba virus and sindbis virus, as described above. The cell-assisted viral expression system (CAVES) according to any of items 1 to 110.
[Section 115]
115. A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 114 above, wherein said virus encodes a therapeutic product.
[Section 116]
116. A cell-assisted viral expression system (CAVES) according to paragraph 115 above, wherein said therapeutic product is a polypeptide or a nucleic acid.
[Section 117]
117. A cell-assisted viral expression system (CAVES) according to paragraph 116, above, wherein said therapeutic product is a polypeptide.
[Section 118]
117. The cell-assisted viral expression system (CAVES) of paragraph 116 above, wherein the therapeutic product is a nucleic acid that is double-stranded RNA.
[Section 119]
117. The cell-assisted viral expression system (CAVES) according to paragraph 116 above, wherein the cells are T cells.
[Section 120]
117. The cell-assisted viral expression system (CAVES) of paragraph 116 above, wherein the therapeutic product is an anti-cancer drug.
[Section 121]
121. A cell-assisted viral expression system (CAVES) according to any of paragraphs 115 to 120 above, wherein the therapeutic product is an antibody or an antigen-binding fragment thereof.
[Section 122]
122. The cell-assisted viral expression system (CAVES) according to paragraph 121, wherein the therapeutic product is an anti-CTLA4, anti-PD-1 or anti-PD-L1 antibody or an antigen-binding fragment thereof.
[Section 123]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 115 to 121 above, wherein the therapeutic product is an immune checkpoint inhibitor or a product that modulates an immune pathway.
[Section 124]
A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 123 above, in a cryopreservation composition.
[Section 125]
125. The cell-assisted viral expression system (CAVES) of paragraph 124, above, wherein the cryopreservation composition comprises one or more glycerol, DMSO or other cryopreservation agent.
[Section 126]
A pharmaceutical composition comprising the cell-assisted viral expression system (CAVES) or a plurality thereof according to any one of items 1 to 103 and 111 to 125 above.
[Section 127]
127. The pharmaceutical composition according to paragraph 126 above, which is formulated for parenteral administration.
[Section 128]
127. A pharmaceutical composition according to paragraph 126 above, which is formulated for local or systemic administration.
[Section 129]
The pharmaceutical composition according to any of the above items 126 to 128, which is formulated for oral, intravenous, intratumoral, rectal, subcutaneous or mucosal administration.
[Section 130]
A method of treating cancer, including solid tumors or hematological malignancies, in a subject, comprising administering a cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 125 above, or paragraphs 126 to 126 above. 129. A method comprising administering a pharmaceutical composition according to any of 129.
[Section 131]
A method of treating cancer, including a solid tumor or hematological malignancy, in a subject, the method comprising:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less;
b) cells proliferate and/or replicate for a sufficient period of time for said virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce cell-assisted viral expression systems (CAVES); incubating or co-cultivating said cells with said oncolytic virus under conditions capable of
c) administering to said subject said cell-assisted viral expression system (CAVES) to treat said solid tumor or hematological malignancy.
[Section 132]
132. The method of paragraph 131 above, wherein the MOI is 0.001 to 10, or 0.1 to 10, or 0.1, or less than 0.3, or less than 0.1, or less than 0.5.
[Section 133]
Said carrier cells and virus are present for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. 133. The method according to any of paragraphs 130 to 132 above, wherein the method is incubated or co-cultured for more than 2 hours.
[Section 134]
134. The method of any of paragraphs 130-133 above, wherein the cells and virus are incubated or co-cultured for at least 6 hours.
[Section 135]
135. The method of any of paragraphs 130-134 above, wherein the cells and virus are incubated or co-cultured for at least or up to 1, 2, 3, 4, 5, 6, or 7 days.
[Section 136]
136. The method according to any of the above items 130 to 135, wherein after incubating or co-culturing the cells and virus, the obtained cell-assisted viral expression system (CAVES) is stored.
[Section 137]
137. The method according to paragraph 136 above, wherein the storage is carried out at a temperature of -5°C to -200°C, or in a refrigerator, or in liquid nitrogen or CO2.
[Section 138]
138. The method according to paragraph 136 or 137 above, wherein the cell-assisted viral expression system (CAVES) is cryopreserved.
[Section 139]
139. The method of any of paragraphs 136-138 above, wherein said cell-assisted viral expression system (CAVES) is stored for at least 24 hours.
[Section 140]
The cell-assisted viral expression system (CAVES) may be used for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or for up to 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12 years or longer.
[Section 141]
141. A method according to any of paragraphs 131 to 140 above, wherein the cell-assisted viral expression system (CAVES) is stored after incubation or co-cultivation (step b) and before administration (step c).
[Section 142]
142. The method of any of paragraphs 130-141 above, wherein said cell-assisted viral expression system (CAVES) is refrigerated or frozen or stored at a temperature of about or just -5°C to -200°C.
[Section 143]
143. The method of paragraph 142, wherein the cell-assisted viral expression system (CAVES) is stored at a temperature of about -80°C to -200°C or in liquid nitrogen or CO2.
[Section 144]
144. The method according to any of paragraphs 130 to 143 above, wherein the carrier cells are not immune cells and/or tumor cells.
[Section 145]
144. The method according to any of the above items 130 to 143, wherein the carrier cell is an immune cell, a tumor cell, a tumor cell line, or a stem cell.
[Section 146]
146. The method according to any of the above items 130 to 145, wherein the carrier cell is a stem cell.
[Section 147]
said carrier cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject; and/or
147. The method according to any of paragraphs 130 to 146 above, wherein the carrier cell is treated and/or modified to enhance the amplification of the virus in the cell.
[Section 148]
148. The method of any of paragraphs 130-147 above, wherein the carrier cells are selected from treated or modified carrier cells selected among stem cells, immune cells and tumor cells.
[Section 149]
148. The method according to any of the above items 130 to 147, wherein the carrier cells are embryonic epithelial cells or fibroblasts.
[Section 150]
148. The method according to any of the above items 130 to 147, wherein the carrier cell is an immune cell.
[Section 151]
The carrier cells may include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. 148. The method according to any of paragraphs 130 to 147 above, wherein the CAR-T cells are selected from among the targeted CAR-T cells.
[Section 152]
said carrier cell is an engineered or treated cell from a hematological malignancy cell line, said cell is adapted to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject, and/or or the method according to any of the above items 130 to 147, wherein the method is treated or modified, or both treated and modified, to enhance amplification of the virus in the cell.
[Section 153]
The carrier cells may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. The method according to any of the above items 130 to 152, which is a cell line.
[Section 154]
153. The method according to any of the above items 130 to 152, wherein the carrier cell is a stem cell.
[Section 155]
The stem cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small juvenile stem cells, dermal fibroblast stem cells , tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells.
[Section 156]
156, above, wherein the stem cells are selected from mesenchymal cells.
[Section 157]
The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors 157. The method of paragraph 156, isolated from/derived from cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells.
[Section 158]
158. The method according to any of paragraphs 130 to 157 above, wherein the carrier cells are selected from endothelial progenitor cells, neural stem cells and adult bone marrow cells, mesenchymal stem cells.
[Section 159]
The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth 159. The method according to any of the above items 130 to 158, wherein the mesenchymal stem cells are isolated from or derived from papilla-derived stem cells and muscle satellite cells.
[Section 160]
159, above, wherein the mesenchymal stem cells are isolated from adipose stromal cells.
[Section 161]
161. The method according to any of paragraphs 130 to 160 above, wherein the carrier cells include adipose stromal cells.
[Section 162]
162. The method of any of paragraphs 130-161 above, wherein the cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof.
[Section 163]
163. The method according to any of paragraphs 130 to 162, wherein the carrier cells are derived from the stromal vascular population (SVF) of adipose stromal cells.
[Section 164]
Items 130 to 163 above, wherein the cells are stem cells derived from the epiadventitial adipose stromal cells (CD34+SA-ASC) obtained by culturing the epiadventitial adipose stromal cells to produce AD-MSCs. Any method described.
[Section 165]
165. The method according to paragraph 164, wherein the mesenchymal cells are derived from adipose stromal cells.
[Section 166]
The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). 165. The method according to any of the above items 130 to 164, wherein the adipose stromal cells are selected from.
[Section 167]
167. The method according to any one of items 130 to 166, wherein the carrier cells are adipose cultured adipose mesenchymal stem cells (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC).
[Section 168]
168. The method of any of paragraphs 130-167 above, wherein said cells are allogeneic to the subject to be treated.
[Section 169]
168. The method of any of paragraphs 130-167 above, wherein the cells are autologous to the subject to be treated.
[Section 170]
The virus may include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, poliovirus. Any of the above paragraphs 130 to 169 selected from viruses, parvoviruses, retroviruses, alphaviruses, marabaviruses, flaviviruses, rhabdoviruses, papillomaviruses, influenza viruses, mumps viruses, gibbon leukemia viruses and Sindbis viruses. Method described in Crab.
[Section 171]
170, above, wherein the virus is measles virus.
[Section 172]
171. The method of paragraph 170 above, wherein the virus is a retrovirus that is a lentivirus.
[Section 173]
171. The method according to paragraph 170, wherein the virus is a poxvirus, which is a vaccinia virus.
[Section 174]
The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Tashkent, Wyeth, IHD- 170, wherein the poxvirus is selected from among the strains of J, IHD-W, Brighton, Dairen I and Connaught.
[Section 175]
175. The method of paragraph 174 above, wherein the virus is ACAM1000 or ACAM2000.
[Section 176]
the virus is vaccinia virus,
the carrier cells are stem cells derived from adipose stromal cells;
The method according to any of the above items 130 to 175.
[Section 177]
177. The method of any of paragraphs 130-176 above, wherein said CAVES expresses an immunomodulatory protein encoded by said virus.
[Section 178]
178. The method of any of paragraphs 130-177 above, wherein the cancer comprises a solid tumor.
[Section 179]
178. The method according to any of the above items 130 to 177, wherein the cancer is a hematological malignancy.
[Section 180]
The subject includes a solid tumor or hematological malignancy selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, leukemia, lymphoma and kidney cancer. 179. The method according to any one of the above items 130 to 179, comprising:
[Section 181]
The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. 180, above, wherein the method is selected.
[Section 182]
182. The method of any of paragraphs 130-181 above, wherein the oncolytic virus encodes a heterologous gene product.
[Section 183]
183, above, wherein the heterologous gene product is an anti-cancer therapeutic.
[Section 184]
184, above, wherein said product is an antibody or antigen binding portion thereof.
[Section 185]
185. The method according to any of the above items 130 to 184, wherein the subject is a human.
[Section 186]
185. The method according to any of the above items 130 to 184, wherein the subject is a non-human animal.
[Section 187]
185. The method according to any of paragraphs 130 to 184 above, wherein the subject is a farm or zoo animal.
[Section 188]
185. The method according to any of paragraphs 130 to 184 above, wherein the subject is a dog or a cat.
[Section 189]
188. The method of paragraph 187, wherein the subject is a cow, horse, goat, mule, zebra, giraffe, gorilla, bonobo, donkey, pig, llama, chimpanzee, or alpaca.
[Section 190]
186. The method according to any of paragraphs 130 to 185 above, wherein the subject is a pediatric human.
[Section 191]
191, wherein said cell-assisted viral expression system (CAVES) is administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular, or intraocular injection. Method.
[Section 192]
191. The method of any of paragraphs 130 to 190 above, wherein the cell-assisted viral expression system (CAVES) is administered by intramuscular or subcutaneous administration.
[Section 193]
193. The method of any of paragraphs 130-192 above, comprising administering another anti-cancer treatment or therapy.
[Section 194]
194. The method of paragraph 193 above, wherein said other cancer treatment or therapy is immunotherapy.
[Section 195]
195. The method of paragraph 194, wherein the immunotherapy comprises administering a checkpoint inhibitor or a treatment that inhibits a checkpoint or immunosuppressive pathway.
[Section 196]
administering a treatment that activates a T cell response in said subject, said treatment comprising administering a blocking antibody to a negative costimulatory molecule, or comprising an agonist antibody to an activating costimulatory molecule. The method according to any of paragraphs 130 to 195.
[Section 197]
197. The method of paragraph 196, wherein said treatment comprises administering a blocking antibody against a negative co-stimulatory molecule.
[Section 198]
The above clause, wherein said blocking antibody is directed against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3. 196 or the method described in paragraph 197 above.
[Section 199]
199. The method of any of paragraphs 196-198 above, wherein said treatment comprises administration of an inhibitor of the PD-1 pathway.
[Section 200]
199. The method of paragraph 199 above, wherein the inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligand.
[Section 201]
199, above, wherein the inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1.
[Section 202]
199. The method of any of paragraphs 196-198 above, wherein the treatment comprises administering an anti-CTLA-4 antibody, an anti-PD-L1 antibody, or an anti-PD-1 antibody.
[Section 203]
199. The method of any of paragraphs 196-198 above, wherein said treatment comprises administering a blocking antibody against a negative costimulatory molecule selected among PD-L1 and CTLA-4.
[Section 204]
204. The method of any of paragraphs 130-203 above, comprising a treatment comprising administering an agonist antibody to a costimulatory molecule.
[Section 205]
205. The method of paragraph 204 above, wherein the co-stimulatory molecule is selected from CD28, OX40, CD40, GITR, CD137, CD27 and HVEM.
[Section 206]
A cell-assisted viral expression system (CAVES) according to any of paragraphs 1 to 125 above or any of paragraphs 126 to 129 above for use in treating cancer, including solid tumors or hematological malignancies. Pharmaceutical compositions as described.
[Section 207]
A cell-assisted viral expression system (CAVES) according to any of paragraphs 1-125 above or a cell-assisted viral expression system (CAVES) according to paragraphs 126-129 above for use in treating cancer, including solid tumors or hematological malignancies, in a subject. Use of any of the pharmaceutical compositions.
[Section 208]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 206 or paragraph 207 above, wherein the cell-assisted viral expression system comprises:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less; and
b) conditions under which cells can proliferate and/or replicate for a sufficient period of time for said oncolytic virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce said CAVES; and incubating or co-cultivating said cells with said oncolytic virus.
[Section 209]
Cell-assisted viral expression systems (CAVES) or cells for use according to paragraph 208 above, wherein said MOI is 0.001-10, 0.1-10, 0.1-1, 0.1 to less than 1, 0.1-0.5 or 0.1. Use of assisted viral expression systems (CAVES).
[Section 210]
Said carrier cells and virus are present for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 209 above, produced by incubating or co-cultivating for a time of .
[Section 211]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 210 above, wherein said cells and virus are incubated or co-cultured for at least 6 hours. .
[Section 212]
Cell-assisted viral expression for use according to any of paragraphs 206-211 above, wherein said cells and virus are incubated or co-cultured for at least or up to 1, 2, 3, 4, 5, 6, or 7 days. (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 213]
A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system for use according to any of paragraphs 206-212 above, wherein said cell-assisted viral expression system (CAVES) is stored for use. Use of (CAVES).
[Section 214]
Cell-assisted viral expression systems (CAVES) or cells for the use according to paragraph 213 above, wherein said storage is carried out at a temperature between -5°C and -200°C, or in a refrigerator, or in liquid nitrogen or CO2. Use of assisted viral expression systems (CAVES).
[Section 215]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 213 or 214 above, wherein said cell-assisted viral expression system (CAVES) is cryopreserved.
[Section 216]
A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of paragraphs 213-215 above, wherein said cell-assisted viral expression system (CAVES) is stored for at least 24 hours. CAVES).
[Section 217]
The cell-assisted viral expression system (CAVES) may be used for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or for up to 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12 or more years. Use of type virus expression systems (CAVES).
[Section 218]
Cell-assisted virus expression system (CAVES) for use according to any of paragraphs 213 to 217 above, wherein the resulting cell-assisted virus expression system (CAVES) is preserved after incubation of the carrier cell and the oncolytic virus. Use of expression systems (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 219]
A cell-assisted viral expression system (CAVES) for use according to any of paragraphs 206-218 above, wherein said cells are stored or refrigerated or frozen at a temperature of about or just -5°C to -200°C; or Use of cell-assisted viral expression systems (CAVES).
[Section 220]
Cell-assisted viral expression systems (CAVES) for use according to paragraph 219 above, wherein said cells are stored at a temperature of about -80°C to -200°C or in liquid nitrogen or CO2. or the use of cell-assisted viral expression systems (CAVES).
[Section 221]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 220 above, wherein said carrier cells are not immune cells and/or tumor cells. .
[Section 222]
Cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 220 above, wherein the carrier cells are immune cells, or tumor cells, or tumor cell lines, or stem cells. Use of viral expression systems (CAVES).
[Section 223]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 222 above, wherein said carrier cells are stem cells.
[Section 224]
said carrier cells are treated or modified, or both treated and modified, so as to enhance the immunosuppressive or immunoprivileged properties of said cells for administration to a human subject; and/or
the carrier cell has been treated and/or modified to enhance the amplification of the virus within the cell;
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 223 above.
[Section 225]
Cell-assisted viral expression system for use according to any of paragraphs 206 to 224 above, wherein said carrier cells are selected from treated or modified cells selected among stem cells, immune cells and tumor cells. (CAVES) or the use of cell-assisted viral expression systems (CAVES).
[Section 226]
Cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 224 above, wherein the carrier cells are embryonic epithelial cells or fibroblasts. Use of.
[Section 227]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 224 above, wherein said carrier cells are immune cells.
[Section 228]
The carrier cells may include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 224 above, selected from targeting CAR-T cells. .
[Section 229]
Said carrier cell is treated or modified to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject and/or to enhance the amplification of said virus in said cell. Cell-assisted viral expression system for use according to any of paragraphs 206 to 224 above, wherein the modified or treated cells are derived from a hematological malignancy cell line, which have been treated or both treated and modified. (CAVES) or the use of cell-assisted viral expression systems (CAVES).
[Section 230]
The carrier cells may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. The use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 229 above, which is a cell line.
[Section 231]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 229 above, wherein said carrier cells are stem cells.
[Section 232]
The carrier cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Sexual stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small immature stem cells, dermal fibroblasts A cell-assisted viral expression system for use according to any of paragraphs 206-231 above, wherein the stem cells are selected from among stem cells, tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells ( CAVES) or cell-assisted viral expression systems (CAVES).
[Section 233]
233. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 232 above, wherein said stem cells are selected from mesenchymal cells.
[Section 234]
The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for use as described in paragraph 233 above, isolated from/derived from cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells. Use of viral expression systems (CAVES).
[Section 235]
A cell-assisted viral expression system (CAVES) for use according to any of paragraphs 206 to 234 above, wherein said carrier cells are selected from endothelial progenitor cells, neural stem cells, adult bone marrow cells and mesenchymal stem cells. ) or the use of cell-assisted viral expression systems (CAVES).
[Section 236]
The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth Cell-assisted viral expression for use according to any of paragraphs 206-235 above, wherein the mesenchymal stem cells are isolated from or derived from papilla-derived stem cells, muscle satellite cells, and other such cells. (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 237]
237. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 236, above, wherein said mesenchymal stem cells are isolated from adipose stromal cells.
[Section 238]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-237 above, wherein the carrier cells comprise adipose stromal cells.
[Section 239]
Cell-assisted viral expression system for use according to any of paragraphs 206 to 238 above, wherein said cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof. (CAVES) or the use of cell-assisted viral expression systems (CAVES).
[Section 240]
Cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 239 above, wherein the carrier cells are derived from the stromal vascular population (SVF) of adipose stromal cells. Use of viral expression systems (CAVES).
[Section 241]
Items 206 to 240 above, wherein the cells are stem cells derived from the epiadventitial adipose stromal cells (CD34+SA-ASC) by culturing the epiadventitial adipose stromal cells to produce AD-MSCs. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for any of the uses described.
[Section 242]
242. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 241 above, wherein said mesenchymal stem cells are derived from adipose stromal cells.
[Section 243]
The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 240 above, wherein the adipose stromal cells are selected from:
[Section 244]
For the use according to any of the above items 206 to 243, wherein the carrier cells are adipose cultured adipose mesenchymal stem cells (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC). Use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 245]
A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of paragraphs 206-244 above, wherein said cells are allogeneic to the subject to be treated. Use of.
[Section 246]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 244 above, wherein said cells are autologous to the subject to be treated. .
[Section 247]
Viruses include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackievirus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, and poliovirus. , parvovirus, retrovirus, alphavirus, flavivirus, rhabdovirus, papillomavirus, influenza virus, mumps virus, gibbon leukemia virus, and Sindbis virus, according to any of paragraphs 206 to 246 above. The use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for the use of.
[Section 248]
248. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 247 above, wherein said virus is measles virus.
[Section 249]
248. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 247 above, wherein said virus is a retrovirus, which is a lentivirus.
[Section 250]
248. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 247 above, wherein said virus is a poxvirus, which is a vaccinia virus.
[Section 251]
The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth, IHD- Cell-Assisted Viral Expression System (CAVES) or Cell-Assisted Viral Expression for use as described in paragraph 247 above, which is a poxvirus selected from among the strains of J, IHD-W, Brighton, Dairen I and Connaught. Use of systems (CAVES).
[Section 252]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 251 above, wherein said virus is ACAM1000 or ACAM2000.
[Section 253]
253. The cell-assisted viral expression system (CAVES) according to paragraph 252, wherein the viral genome comprises the nucleotide sequence shown in SEQ ID NO: 70 or 71.
[Section 254]
the virus is vaccinia virus, and
the carrier cells are stem cells derived from adipose stromal cells;
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-252 above.
[Section 255]
255. The cell-assisted viral expression system of paragraph 254 above, wherein the carrier cell and virus are incubated for at least 6 hours, and the incubation is carried out under conditions such that the virus infects the cell and expresses the encoded protein. CAVES).
[Section 256]
256. The cell-assisted viral expression system (CAVES) of paragraph 255 above, wherein the incubation is for 10, 12, 14, 16 or 20 hours or less.
[Section 257]
A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of paragraphs 206 to 254 above, wherein said CAVES expresses an immunomodulatory protein encoded by said virus. Use of.
[Section 258]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-257 above, wherein said cancer comprises a solid tumor.
[Section 259]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 258 above, wherein said cancer is a hematological malignancy.
[Section 260]
The target to be treated is a solid tumor or hematological malignancy selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, leukemia, lymphoma and kidney cancer. Cell-assisted viral expression system (CAVES) or use of a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 259 above, having a cancer comprising:
[Section 261]
The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. The use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 259 above, selected.
[Section 262]
262. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-261 above, wherein said oncolytic virus encodes a heterologous gene product.
[Section 263]
263. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 262, above, wherein said heterologous gene product is an anti-cancer therapeutic.
[Section 264]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 262 above or paragraph 187 above, wherein said product is an antibody or an antigen-binding portion thereof.
[Section 265]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 193 to 264 above, wherein said subject to be treated is a human.
[Section 266]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206 to 264 above, wherein the subject to be treated is a non-human animal.
[Section 267]
A cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for use according to any of paragraphs 206 to 264 above, wherein the subject to be treated is a farm or zoo animal. use.
[Section 268]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-264 above, wherein the subject to be treated is a dog or a cat.
[Section 269]
Cell-assisted virus for use according to paragraph 187 above, wherein the subject to be treated is a cow, horse, goat, mule, zebra, giraffe, gorilla, bonobo, donkey, pig, llama, chimpanzee, or alpaca. Use of expression systems (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 270]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-265 above, wherein the subject to be treated is a pediatric human.
[Section 271]
Cell support for use according to any of paragraphs 206 to 270 above, wherein the CAVES are for administration by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular, or intraocular injection. Use of type virus expression systems (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 272]
Cell-assisted viral expression system (CAVES) or cell-assisted virus for use according to any of paragraphs 206 to 270 above, wherein said cell-assisted viral expression system (CAVES) is for intramuscular or subcutaneous administration. Use of expression system (CAVES).
[Section 273]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 206-272 above, in combination with another different anti-cancer treatment or therapy.
[Section 274]
209. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 209 above, wherein said other cancer treatment or therapy is immunotherapy.
[Section 275]
Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems for use according to paragraph 274 above, wherein said immunotherapy comprises checkpoint inhibitors or treatments that inhibit checkpoints or immunosuppressive pathways. Use of (CAVES).
[Section 276]
Any of paragraphs 206-275 above, comprising a treatment that activates a T cell response in said subject, said treatment comprising a blocking antibody to a negative costimulatory molecule or an agonist antibody to an activating costimulatory molecule. The use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for the uses described in .
[Section 277]
277. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 276, above, wherein said treatment comprises blocking antibodies against negative co-stimulatory molecules.
[Section 278]
276 above, or wherein said blocking antibody is directed against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3; or Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use described in paragraph 213 above.
[Section 279]
279. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 276-278 above, wherein said treatment comprises an inhibitor of the PD-1 pathway.
[Section 280]
Cell-assisted viral expression systems (CAVES) or cell-assisted for use according to paragraph 279 above, wherein said inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligands. Use of type virus expression systems (CAVES).
[Section 281]
a cell-assisted viral expression system (CAVES) for use according to paragraph 279 above, wherein said inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1; or Use of cell-assisted viral expression systems (CAVES).
[Section 282]
a cell-assisted viral expression system (CAVES) or Use of cell-assisted viral expression systems (CAVES).
[Section 283]
Cell-assisted viral expression for use according to any of paragraphs 276-278 above, wherein said treatment comprises blocking antibodies against negative costimulatory molecules selected among PD-L1 and CTLA-4. (CAVES) or cell-assisted viral expression systems (CAVES).
[Section 284]
Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression for use according to any of paragraphs 206-283 above, including treatments comprising costimulatory molecules, agonist antibodies to CAR-T and/or TILs. Use of systems (CAVES).
[Section 285]
Cell-assisted viral expression systems (CAVES) or cell-assisted viruses for use according to paragraph 284 above, wherein said co-stimulatory molecules are selected from CD28, OX40, GITR, CD40, CD137, CD27 and HVEM. Use of expression system (CAVES).
[Section 286]
A vaccinia virus comprising a genome having the nucleotide sequence shown in SEQ ID NO: 71.
[Section 287]
A modified ACAM2000 virus comprising at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus.
[Section 288]
A modified ACAM2000 virus that contains a partially or completely deleted or interrupted F1L locus of the corresponding unmodified ACAM2000 virus, in which the F1L gene is not expressed.
[Section 289]
A modified ACAM2000 virus that contains a partially or completely deleted or interrupted B8R locus of the corresponding unmodified ACAM2000 virus, in which the B8R gene is not expressed.
[Section 290]
Modified ACAM2000 viruses containing one or more of the following modifications:
(a) at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus;
(b) a partially or completely deleted F1L locus of the corresponding unmodified ACAM2000 virus, where the F1L gene is not expressed; and/or
(c) A partially or completely deleted B8R locus in the corresponding unmodified ACAM2000 virus, where the B8R gene is not expressed.
[Section 291]
A modified ACAM2000 virus that contains one or more of the following modifications in the corresponding unmodified ACAM2000 virus:
at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 174 (ORF_174) and open reading frame 175 (ORF_175); and/or
At least one truncated open reading frame (ORF) at one or more of the following loci: ORF72, ORF73, ORF156, ORF157, ORF158, ORF159, ORF160, ORF174 and ORF175.
[Section 292]
The above clause, wherein said modification comprises at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 174 (ORF_174) and open reading frame 175 (ORF_175) of the corresponding unmodified ACAM2000 virus. Modified ACAM2000 virus described in 291.
[Section 293]
The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. selected from;
the marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt);
The modified ACAM2000 virus according to item 292 above.
[Section 294]
Contains at least one truncated open reading frame (ORF) at one or more of the following loci: ORF72, ORF73, ORF156, ORF157, ORF158, ORF159, ORF160, ORF174 and ORF175, and one or more of the following loci: ORF72 , ORF73, ORF156, ORF157, ORF158, ORF159, ORF160, ORF174 and ORF175, further comprising at least one therapeutic and/or marker gene inserted into the truncated region.
[Section 295]
The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. selected from;
the marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt);
The modified ACAM2000 virus described in paragraph 294 above.
[Section 296]
The modified ACAM2000 virus according to any of paragraphs 287 to 295 above, wherein the corresponding unmodified ACAM2000 comprises the nucleic acid sequence shown in SEQ ID NO: 70 or SEQ ID NO: 71.
[Section 297]
Paragraphs 287, 290 above, wherein said modification comprises at least one therapeutic gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus. , or the modified ACAM2000 virus described in 296.
[Section 298]
The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. The modified ACAM2000 virus according to paragraph 297 above, selected from:
[Section 299]
Paragraphs 287, 290 above, wherein said modification comprises at least one marker gene inserted in the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus. , 291, 296 or 297.
[Section 300]
Clause 299 above, wherein said marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Modified ACAM2000 virus described in.
[Section 301]
Since the modification is a partially or completely deleted B8R locus of the corresponding unmodified ACAM2000 virus, the B8R gene is not expressed;
the modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted B8R locus;
The modified ACAM2000 virus according to any of paragraphs 289, 290, or 296 above.
[Section 302]
Since the modification is a partially or completely deleted F1L locus of the corresponding unmodified ACAM2000 virus, the F1L gene is not expressed;
said modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted F1L locus;
The modified ACAM2000 virus according to any of paragraphs 288, 290, or 296 above.
[Section 303]
The modified ACAM2000 virus of paragraph 301 or 302 above, comprising at least one therapeutic gene.
[Section 304]
The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. The modified ACAM2000 virus according to paragraph 303 above, selected from:
[Section 305]
The modified ACAM2000 virus according to any of paragraphs 301 to 304 above, comprising at least one marker gene.
[Section 306]
Clause 305 above, wherein said marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Modified ACAM2000 virus described in.
[Section 307]
The modified ACAM2000 virus according to any of paragraphs 287 and 290-306 above, wherein at least one therapeutic gene is an anti-cancer antibody.
[Section 308]
The modified ACAM2000 virus according to item 307 above, wherein the anti-cancer antibody is an anti-VEGF antibody or an anti-CTLA-4 antibody.
[Section 309]
The modified ACAM2000 virus according to Item 307 or Item 308 above, wherein the anti-cancer antibody is a single chain antibody.
[Section 310]
The modified ACAM2000 virus according to any of paragraphs 307 to 309 above, further comprising a nucleic acid encoding an IgK signal peptide for promoting secretion of the antibody.
[Section 311]
The modified ACAM2000 virus according to any of paragraphs 307 to 309 above, further comprising a nucleic acid encoding a FLAG tag to facilitate detection of the antibody.
[Section 312]
Any of paragraphs 287 and 290-311 above, wherein the at least one detectable marker gene and/or the gene encoding the therapeutic product is a sodium-iodine symporter (NIS), OX40L, or 4-IBBL. Modified ACAM2000 virus described in.
[Section 313]
ACAM2000 virus according to paragraph 1 above, further comprising at least one inactivated gene selected from thymidine kinase (TK), hemagglutinin (HA), interferon alpha/beta blocker receptor or immunomodulator. or the modified ACAM2000 virus according to any of paragraphs 387 to 312 above.
[Section 314]
The ACAM2000 virus according to paragraph 1 above or the modified ACAM2000 virus according to any of paragraphs 287 to 313 above, which has been further modified to enhance EEV (extracellular enveloped virus) production.
[Section 315]
The ACAM2000 virus or modified ACAM2000 virus according to paragraph 314 above, wherein the further modification for enhancing EEV production is a mutation in the gene encoding the A34R protein.
[Section 316]
316. The ACAM2000 virus or modified ACAM2000 virus of paragraph 315 above, wherein said mutation encodes an A34R protein comprising mutation K151E.
[Section 317]
A method of treating a solid tumor or hematological malignancy in a subject, the method comprising administering to said subject a composition comprising an oncolytic virus and adipose stromal cells, wherein said adipose stromal cells A method, wherein adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-) are selected.
[Section 318]
A method of treating a solid tumor or hematologic malignancy in a subject, the composition comprising an oncolytic virus and cultured adipose mesenchymal stem cells (AD-MSCs) derived from epiadventitial adipose stromal cells (CD34+SA-ASCs). A method comprising administering an agent to said subject.
[Section 319]
319. The method of paragraph 317 or paragraph 318 above, wherein the cells and oncolytic virus are co-cultured in vitro prior to administration to the subject.
[Section 320]
The method of paragraph 319, above, wherein the cells are co-cultured for a sufficient time that the oncolytic virus immunomodulatory protein is expressed or that the virus undergoes at least one replication cycle. .
[Section 321]
The adipose mesenchymal stem cells (AD-MSCs) are derived from epiadventitial adipose stromal cells (CD34+SA-ASC) by culturing epiadventitial adipose stromal cells to produce the AD-MSCs, The method described in paragraph 318 above.
[Section 322]
said cells and viruses for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. The method of paragraph 319 or paragraph 320 above, wherein the method is co-cultured over a period of time.
[Section 323]
The above clause, wherein said oncolytic virus is selected from poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, measles virus, reovirus, cytomegalovirus (CMV) and lentivirus. The method described in any one of 317-322.
[Section 324]
324. The method of paragraph 323 above, wherein the oncolytic virus is vaccinia virus.
[Section 325]
The vaccinia virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth. , IHD-J, IHD-W, Brighton, Dairen I and Connaught.
[Section 326]
326. The method according to any of paragraphs 317 to 325 above, wherein the tumor is a solid tumor.
[Section 327]
Any of the above items 317 to 326, wherein the subject has a cancer selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, and kidney cancer. Method described in Crab.
[Section 328]
The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. The method of paragraph 326 above, wherein the method is selected.
[Section 329]
329. The method of any of paragraphs 317-328 above, wherein the oncolytic virus encodes a heterologous gene product.
[Section 330]
329, above, wherein the heterologous gene product is an anti-cancer therapeutic.
[Section 331]
330, above, wherein said product is an antibody.
[Section 332]
332. The method according to any of paragraphs 317 to 331 above, wherein the subject is a human.
[Section 333]
333. The method of paragraph 332 above, wherein the subject is a pediatric patient.
[Section 334]
334. The method of any of paragraphs 317-333 above, wherein said cells are autologous to said subject.
[Section 335]
334. The method of any of paragraphs 317-333 above, wherein said cells are allogeneic to said subject.
[Section 336]
336. The method of any of paragraphs 317-335 above, wherein the virus is administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular or intraocular injection.
[Section 337]
337. The method of any of paragraphs 317-336 above, wherein the cells are administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular, or intraocular injection.
[Section 338]
338. The method of any of paragraphs 317-337 above, comprising administering another anti-cancer treatment or therapy.
[Section 339]
339. The method of paragraph 338, above, wherein said other cancer treatment or therapy is immunotherapy.
[Section 340]
340. The method of paragraph 339, above, wherein said immunotherapy comprises administering a checkpoint inhibitor or a treatment that inhibits a checkpoint or immunosuppressive pathway.
[Section 341]
administering a treatment that activates a T cell response in said subject, said treatment comprising administering a blocking antibody to a negative costimulatory molecule, or comprising an agonist antibody to an activating costimulatory molecule. The method according to any of paragraphs 317 to 338.
[Section 342]
342. The method of paragraph 341, above, wherein said treatment comprises administering a blocking antibody against a negative co-stimulatory molecule.
[Section 343]
The above clause, wherein said blocking antibody is directed against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3. 341 or the method described in paragraph 342 above.
[Section 344]
344. The method of any of paragraphs 341-343 above, wherein said treatment comprises administration of an inhibitor of the PD-1 pathway.
[Section 345]
345. The method of paragraph 344, above, wherein the inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligand.
[Section 346]
345. The method of paragraph 344 above, wherein the inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1.
[Section 347]
344. The method of any of paragraphs 341-343 above, wherein the treatment comprises administering an anti-CTLA-4 antibody, an anti-PD-L1 antibody, or an anti-PD-1 antibody.
[Section 348]
344. The method of any of paragraphs 341-343 above, wherein said treatment comprises administering a blocking antibody against a negative costimulatory molecule selected among PD-L1 and CTLA-4.
[Section 349]
349. The method of any of paragraphs 317-348 above, comprising a treatment comprising administering an agonist antibody to a costimulatory molecule.
[Section 350]
349. The method of paragraph 349 above, wherein the co-stimulatory molecule is selected from CD28, OX40, GITR, CD137, CD27 and HVEM.
[Section 351]
A composition or combination comprising:
(a) an oncolytic virus;
(b) epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) or pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-); including;
A composition or combination where the composition is a mixture of cells and a virus and the combination is two separate compositions, one composition comprising the virus and the other composition comprising the cells.
[Section 352]
The above clause, wherein said oncolytic virus is selected from poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, measles virus, reovirus, cytomegalovirus (CMV) and lentivirus. A composition or combination according to 351.
[Section 353]
353. The composition or combination according to paragraph 352 above, wherein the oncolytic virus is vaccinia virus.
[Section 354]
The vaccinia virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth. , IHD-J, IHD-W, Brighton, Dairen I and Connaught.
[Section 355]
A composition or combination according to any of paragraphs 351-354 above for use in treating solid tumors or hematological malignancies.
[Section 356]
The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, mast cell tumor, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliosis, nephroblastoma, B-cell lymphoma, lymphocytic leukemia , retinoblastoma, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma and gastric glands. 356. A composition or combination according to paragraph 355 above, selected from among cancers.
[Section 357]
A combination therapy for use in the treatment of a solid tumor or hematological malignancy in a subject, the combination therapy comprising:
(a) Stem cells,
the stem cells contain an oncolytic virus;
The stem cells are derived from epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). Stem cells, which are selected adipose stromal cells,
(b) a treatment that activates a T cell response in said subject, comprising a blocking antibody to a negative costimulatory molecule, or a treatment comprising an agonist antibody to an activating costimulatory molecule.
[Section 358]
358, above, wherein in (b), the treatment comprises a blocking antibody against a negative co-stimulatory molecule.
[Section 359]
The use according to paragraph 358 above, wherein the blocking antibody is against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA and LAG-3. combination for.
[Section 360]
In (b), the combination according to any of paragraphs 357-359 above, wherein said treatment comprises an inhibitor of the PD-1 pathway.
[Section 361]
360. A combination for use according to paragraph 360 above, wherein said inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligands.
[Section 362]
Combination for use according to paragraph 360 above, wherein said inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1.
[Section 363]
In (b), the combination for use according to any of paragraphs 357 to 359 above, wherein the treatment comprises an anti-CTLA-4 antibody, an anti-PD-L1 antibody or an anti-PD-1 antibody.
[Section 364]
In (b), the combination of paragraph 357 or paragraph 358 above, wherein the treatment comprises blocking antibodies against negative costimulatory molecules selected among PD-L1 and CTLA-4.
[Section 365]
In (b), the combination therapy for use according to any of paragraphs 357-364 above, wherein said treatment comprises an agonist antibody to a costimulatory molecule.
[Section 366]
366. The combination according to paragraph 365 above, wherein said costimulatory molecule is selected from CD28, OX40, GITR, CD137, CD27 and HVEM.
[Section 367]
A combination therapy according to any of paragraphs 357-366 above, wherein (a) is for use after (b).
[Section 368]
A combination therapy according to any of paragraphs 357-366 above, wherein (a) is for use before (b).
[Section 369]
Any of paragraphs 357-368 above, further comprising a treatment that induces apoptosis of cells within the tumor, wherein the treatment is selected from radiotherapy, chemotherapy, immunotherapy, phototherapy, or a combination thereof. Combination therapy for use as described in paragraph 1.
[Section 370]
370. The combination therapy of paragraph 369 above, wherein said treatment that induces apoptosis comprises radiation therapy.
[Section 371]
Combination therapy for use according to any of paragraphs 357-370 above, further comprising a treatment to modify the tumor microenvironment, said treatment comprising a cytokine blocker.
[Section 372]
The lytic virus is poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, mumps virus, influenza virus, measles virus, reovirus, human immunodeficiency virus (HIV), hantavirus, myxoma. Combination therapy for use according to any of paragraphs 357-371 above, selected among viruses, cytomegalovirus (CMV) and lentiviruses.
[Section 373]
Combination therapy for use according to any of paragraphs 357-371 above, wherein said oncolytic virus is vaccinia virus.
[Section 374]
The stem cells were treated with the TLR agonist intravenous immunoglobulin (IVIG); monocyte-conditioned medium; supernatants from neutrophil extracellular trap-exposed peripheral blood mononuclear cells; peptidoglycan isolated from Gram-positive bacteria; isolated lipoarabinomannan; zymosan isolated from yeast cell wall; polyadenylate-polyuridic acid; poly(IC); lipopolysaccharide; monophosphoryl lipid A; flagellin; galdiquimod; imiquimod; R848; oligonucleoside containing a CpG motif and 23S ribosomal RNA; or
For the use according to any of paragraphs 357 to 373 above, wherein said stem cells are co-cultured with monocytes, T cells, T cells exposed to T cell stimulation or natural killer cells pretreated with IVIG. combination therapy.
[Section 375]
The use may include bladder tumors, breast tumors, prostate tumors, carcinomas, basal cell carcinomas, biliary tract cancers, bladder cancers, bone cancers, brain cancers, central nervous system (CNS) cancers, glioma tumors, Cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer, intraepithelial neoplasia , kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, retina Blastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer, lymphosarcoma , osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma, pulmonary sarcoma, nerve Sarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, infectious sexually transmitted disease tumors, Testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, Gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, squamous cell carcinoma of the lung, leukemia, hemangioectiocytoma, ocular neoplasm, foreskin fibrosarcoma, ulcerative squamous cell carcinoma. Cancer, foreskin cancer, connective tissue neoplasm, mast cell tumor, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B cell lymphoma, lymphocytic leukemia, retinoblastoma , to treat liver neoplasms, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumors, gastric MALT lymphoma, and gastric adenocarcinoma. Combination therapy for use according to any of paragraphs 357-374 above, wherein the combination therapy is
[Section 376]
The above clause, wherein said use is for treating glioblastoma, breast cancer, lung cancer, prostate cancer, colon cancer, ovarian cancer, neuroblastoma, central nervous system tumors, pancreatic adenocarcinoma, or melanoma. Combination therapy for use as described in any of 357-375.
[Section 377]
The combination for use according to any of paragraphs 357 to 376 above, wherein the stem cells are autologous.
[Section 378]
Combination for use according to any of paragraphs 357 to 376 above, wherein said stem cells are allogeneic.
[Section 379]
Cell-assisted viral expression system (CAVES) according to any of paragraphs 1-103 and 111-125 above, wherein the carrier cells are treated or modified for conditional immortalization.
[Section 380]
379 above, wherein said carrier cell is modified to express one or more of c-myc, v-myc, E6/E7, hTERT, wild type or modified SV40 large tumor antigen, loxP and/or tetR. Cell-assisted viral expression system (CAVES) as described in .
[Section 381]
A pharmaceutical composition comprising a cell-assisted viral expression system (CAVES) according to paragraph 379 or paragraph 380 above in a pharmaceutically acceptable medium.
[Section 382]
382. The pharmaceutical composition according to paragraph 381 above, which is cryopreserved.
[Section 383]
A pharmaceutical composition according to paragraph 381 above or paragraph 382 above, which is formulated for direct administration without dilution.
[Section 384]
A pharmaceutical composition according to any of paragraphs 381-383 above, which is formulated as a single dose.
[Section 385]
385. The pharmaceutical composition according to any of paragraphs 381-384 above, wherein said pharmaceutically acceptable vehicle is suitable for parenteral administration.
[Section 386]
A cell-assisted viral expression system (CAVES) according to paragraph 379 above or paragraph 380 above for use in treating cancer, including solid tumors or hematological malignancies.
[Section 387]
A cell-assisted viral expression system (CAVES) according to paragraph 379 above or paragraph 380 above or any of paragraphs 381 to 385 above for use in treating cancer, including solid tumors or hematological malignancies, in a subject. Use of the pharmaceutical composition according to claim 1.
[Section 388]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to paragraph 386 or paragraph 387 above, wherein said cell-assisted viral expression system comprises:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less; and
b) conditions under which cells can proliferate and/or replicate for a sufficient period of time for said oncolytic virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce said CAVES; and incubating or co-cultivating said cells with said virus.
[Section 389]
Cell assisted viral expression systems (CAVES) or cells for the use according to paragraph 388 above, wherein said MOI is 0.001 to 10, 0.1 to 10, 0.1 to 1, 0.1 to less than 1, 0.1 to 0.5 or 0.1. Use of assisted viral expression systems (CAVES).
[Section 390]
Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of paragraphs 386-389 above, wherein said cells and virus are incubated or co-cultured for at least 6 hours. .
[Section 391]
the carrier cell is treated or modified for conditional immortalization;
proliferation of said modified carrier cell population is activated at a first time point(s) prior to preparation of CAVES and/or prior to administration of CAVES to a subject;
Any of paragraphs 130-205 above, wherein proliferation of said carrier cell population is inactivated at a second time point after the first time point(s) and prior to administration of said CAVES to said subject. Method described.
[Section 392]
A method for producing a cell-assisted viral expression system (CAVES), comprising:
Carrier cells and oncolytic viruses for infection of cells by viruses are incubated at an MOI of 0.001 to 10 for at least 6 hours and up to less than 48 hours under conditions in which the virus expresses the encoded protein, thereby incubating the carrier cells for up to 48 hours. expressing at least one immunomodulatory protein or recombinant therapeutic protein encoded by the virus by association of said virus with said carrier cell to produce a cell-assisted viral expression system (CAVES);
collecting the cell-assisted virus expression system cells; and
A method comprising storing them in a cryopreservation medium at low temperatures to produce conserved cell-assisted viral expression systems (CAVES).
[Section 393]
393, above, wherein the MOI is 0.001 to 10, 0.1 to 10, 0.1 to 1, 0.1 to less than 1, 0.1 to 0.5, or 0.1.
[Section 394]
The incubation time is at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. The method according to paragraph 392 or paragraph 393 above.
[Section 395]
395. The method of paragraph 394 above, wherein the incubation time is at least 6 hours.
[Section 396]
396. The method of any of paragraphs 392-395 above, wherein the carrier cell is treated or modified for conditional immortalization.
[Section 397]
396 above, wherein said carrier cell is modified to express one or more of c-myc, v-myc, E6/E7, hTERT, wild type or modified SV40 large tumor antigen, loxP and/or tetR. The method described in.
[Section 398]
The virus is one of immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. 398. The method of any of paragraphs 392-397 above, wherein the method is processed or modified to encode or include the following:

Claims (398)

A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the oncolytic virus is not an adenovirus,
the carrier cell is a cell in which the virus can replicate;
the carrier cell is not a tumor cell or an immune cell; and the carrier cell contains at least one immunomodulatory or recombinant therapeutic protein encoded by the virus and expressed by association of the virus with the carrier cell. A cell-assisted viral expression system that expresses A cell-assisted viral expression system (CAVES) comprising carrier cells,
the carrier cell contains an oncolytic virus,
the oncolytic virus is not a measles virus,
the carrier cell is a stem cell on which the virus can replicate; and the carrier cell contains at least one immunomodulatory protein encoded by the virus and expressed by association of the virus with the carrier cell or a recombinant therapeutic protein. A cell-assisted viral expression system that expresses proteins. A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the carrier cell is a cell in which the virus can replicate;
the carrier cell expresses at least one immunomodulatory protein or recombinant therapeutic protein encoded by a virus and expressed by association of the virus and the carrier cell;
said carrier cells have been treated and/or modified to enhance the immunosuppressive and/or immunoprivileged properties of said cells for administration to a human subject, and optionally said cells are , a cell-assisted viral expression system that has been treated or modified to enhance amplification of the virus in the cell. A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the oncolytic virus is not an adenovirus,
the carrier cell is a stem cell,
the carrier cell expresses at least one immunomodulatory or recombinant therapeutic protein encoded by a virus and expressed by association of the virus with the carrier cell, and the carrier cell is infected with the oncolytic virus. Afterwards, the oncolytic virus was incubated for more than 6 hours in a cell-assisted viral expression system. 5. The cell-assisted viral expression system (CAVES) of claim 4, wherein the virus is vaccinia virus. Cell-assisted viral expression system (CAVES) according to claim 4 or claim 5, wherein the carrier cells containing virus are produced by infecting the cells at a multiplicity of infection (MOI) of 0.001 to 10. . The cell-assisted viral expression system (CAVES) according to any one of claims 1 to 6, which is cryopreserved. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 6, which has been refrigerated for at least 24 hours. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 6, wherein the temperature of the composition is from -20°C to -80°C or about -20°C to about -80°C. stored at a temperature of 5° C. to −200° C. for at least 24 hours, said carrier cells contain less than about 100 or 50 or 10 virus particles, and said cells are sonicated; Cell-assisted viral expression system (CAVES) according to any of claims 1 to 7, which can be evaluated by measuring plaque-forming units. 11. A cell-assisted viral expression system (CAVES) according to any of claims 7, 9 and 10, wherein the cell-assisted viral expression system (CAVES) is stored for at least 24 hours at a temperature of about -80°C to -200°C or therebetween. The cell-assisted viral expression system (CAVES) according to any of claims 1 to 11, wherein the virus is a TK ⁺ vaccinia virus. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 11, wherein the virus is attenuated. A cell-assisted viral expression system (CAVES) comprising carrier cells, comprising:
the carrier cell contains an oncolytic virus,
the carrier cell is a cell in which the virus can replicate;
the carrier cell expresses at least one immunomodulatory protein or recombinant therapeutic protein encoded by the virus and expressed by association of the virus and the carrier cell, and the CAVES are cryopreserved; , or a cell-assisted viral expression system in a composition containing a cryoprotectant. 15. The cell-assisted viral expression system (CAVES) of claim 14, wherein the virus is not an adenovirus. Cell-assisted viral expression system (CAVES) according to claim 14 or claim 5, wherein the temperature of the composition is at or about -200°C to -20°C. 15. A cell-assisted viral expression system (CAVES) according to claim 7 or claim 14, wherein the CAVES is in a composition comprising one or both of DMSO and glycerol for cryopreservation. Any of claims 1 to 14, wherein said carrier cell carrying an oncolytic virus is produced by infecting said cell with said virus at a multiplicity of infection (MOI) of no more than a maximum of 10 virus particles/cell. Cell-assisted viral expression system (CAVES) as described in . Cell-assisted viral expression system (CAVES) according to claim 18, wherein the MOI is 0.001-10. Cell-assisted viral expression system (CAVES) according to claim 19, wherein the MOI is at least 0.1 or at least 0.3 or at least 0.5. A cell-assisted viral expression system (CAVES) according to any of claims 1 to 19, wherein the carrier cell contains from about 900 or about 1000 copies to about 10,0000 or about 11,000 copies of the oncolytic virus genome. ). Cell-assisted viral expression system (CAVES) according to any of claims 1 to 19, comprising less than 100 viral genomes/cell. stored at a temperature of 5°C to -200°C for at least 24 hours, wherein said carrier cell contains from about 900 or about 1000 copies to about 10,0000 or about 11,000 copies of said oncolytic virus genome. The cell-assisted viral expression system (CAVES) according to any one of 1 to 22. Claims 1-23, wherein the carrier cells contain less than about 100 or 50 or 10 virus particles, and the number of virus particles can be assessed by sonicating the cells and measuring plaque forming units. A cell-assisted viral expression system (CAVES) according to any of the above. 25. The method of claims 1-24, wherein the carrier cells contain from 1 to less than 200 virus particles/cell, and the number of virus particles can be assessed by sonicating the cells and measuring plaque forming units. A cell-assisted viral expression system (CAVES) according to any of the above. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 24, wherein the carrier cells contain from 1 to less than 200 virus particles/cell. the cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of the cell for administration to a human subject;
and/or said cell has been treated or modified to enhance amplification of said virus within said cell;
Cell-assisted viral expression system (CAVES) according to any one of claims 1, 2, and 7-26. said cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject; and said cell is treated or modified to enhance amplification of the virus within the cell;
Cell-assisted viral expression system (CAVES) according to any one of claims 1 to 27. 12. The carrier cell is permissive for oncolytic virus amplification and is not recognized by the subject's immune system for a sufficient time to accumulate within the tumor and/or deliver the virus to the subject's tumor. The cell-assisted viral expression system (CAVES) according to any one of 1 to 28. Cell-assisted viral expression system (CAVES) according to any of claims 3 to 29, wherein the carrier cells are selected from treated or modified stem cells, immune cells and tumor cells. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 29, wherein the carrier cells are embryonic epithelial cells or fibroblasts. Cell-assisted viral expression system (CAVES) according to any of claims 3 to 29, wherein the carrier cells are immune cells. The immune cells include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. 33. Cell assisted viral expression system (CAVES) according to claim 32, selected from targeting CAR-T cells. Cell-assisted viral expression system (CAVES) according to any of claims 3 to 29, wherein the carrier cells are modified or treated cells from a hematological malignancy cell line. The cell line may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. 35. A cell-assisted viral expression system (CAVES) according to claim 34, which is a cell line. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 32, wherein the carrier cells are stem cells. The stem cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small juvenile stem cells, dermal fibroblast stem cells 37. A cell-assisted viral expression system (CAVES) according to claim 36, selected from among , tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells. 37. A cell-assisted viral expression system (CAVES) according to claim 36, wherein said stem cells are selected from mesenchymal cells. The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors 39. Cell-assisted viral expression system (CAVES) according to claim 38, isolated from/derived from cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 36, wherein said cells are selected among endothelial progenitor cells, neural stem cells, adult bone marrow cells and mesenchymal stem cells. The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth Cell-assisted viral expression system (CAVES) according to any of claims 1 to 36, which is a mesenchymal stem cell isolated from or derived from papilla-derived stem cells and muscle satellite cells. 42. The cell-assisted viral expression system (CAVES) of claim 41, wherein the mesenchymal stem cells are isolated from adipose stromal cells. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 36, wherein the carrier cells comprise adipose stromal cells. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 36, wherein the cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 44, wherein the carrier cells are derived from the stromal vascular population (SVF) of adipose stromal cells. 46. The method of claims 1 to 45, wherein the cells are stem cells derived from the epiadventitial adipose stromal cells (CD34+SA-ASC) by culturing the epiadventitial adipose stromal cells to produce AD-MSCs. A cell-assisted viral expression system (CAVES) according to any of the above. 39. The cell-assisted viral expression system (CAVES) of claim 38, wherein the mesenchymal cells are derived from adipose stromal cells. The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). Cell-assisted viral expression system (CAVES) according to any of claims 1 to 47, wherein the cell-assisted viral expression system (CAVES) is an adipose stromal cell selected from. The cell-assisted virus according to any one of claims 1 to 48, wherein the carrier cell is an adipose cultured adipose mesenchymal stem cell (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC). Expression system (CAVES). The carrier cells and the oncolytic virus are incubated for a sufficient period of time for the immunomodulatory or therapeutic protein encoded by the virus to be expressed and/or for a period of time prior to administration to a subject or storage of the virus. Cell assisted viral expression system (CAVES) according to any of claims 1 to 49, co-cultured in vitro for a period sufficient to undergo at least one replication cycle. 51. Cell-assisted viral expression according to claim 50, wherein the carrier cell and virus are co-cultured for a period sufficient for the oncolytic virus immunomodulatory protein to be expressed and for the virus to undergo at least one replication cycle. System (CAVES). Cell-assisted viral expression system (CAVES) according to any of the preceding claims, wherein said cells are autologous to said subject to be treated. Cell-assisted viral expression system (CAVES) according to any of the preceding claims, wherein said cells are allogeneic to said subject to be treated. The virus may include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, poliovirus. Any of claims 1 to 53 selected from viruses, parvoviruses, retroviruses, alphaviruses, flaviviruses, rhabdoviruses, papillomaviruses, influenza viruses, mumps viruses, gibbon leukemia viruses, Maraba viruses and Sindbis viruses. Cell-assisted viral expression system (CAVES) described in Crab. Cell-assisted viral expression system (CAVES) according to any of claims 1 and 3-54, wherein the virus is measles virus. 55. The cell-assisted viral expression system (CAVES) of claim 54, wherein the virus is a retrovirus. 55. The cell-assisted viral expression system (CAVES) of claim 54, wherein the virus is a poxvirus, which is vaccinia virus. 58. The cell-assisted viral expression system (CAVES) of claim 57, wherein said vaccinia virus is TK ⁺ . 55. The cell-assisted viral expression system (CAVES) of claim 54, wherein said virus is attenuated. The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Tashkent, Wyeth, IHD- 55. Cell-assisted viral expression system (CAVES) according to claim 54, which is a poxvirus selected among the strains of J, IHD-W, Brighton, Dairen I and Connaught. 61. The cell-assisted viral expression system (CAVES) of claim 60, wherein the virus is ACAM1000 or ACAM2000. expression of an immunomodulatory protein and/or therapeutic protein encoded by said virus, wherein after said virus infects said carrier cell, at least one immunomodulatory protein or therapeutic protein encoded by said virus is expressed; or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14; 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, Claims achieved by incubating for more than 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 or 59 hours. The cell-assisted viral expression system (CAVES) according to any of items 1 to 57. 63. A cell according to claim 62, wherein expression of an immunomodulatory and/or therapeutic protein encoded by said virus is achieved by incubating said carrier cell with said virus for 6 hours or more than 6 hours after infection. Assisted viral expression systems (CAVES). 64. The cell-assisted viral expression system (CAVES) of claim 63, wherein said virus is vaccinia virus. 63. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 62, wherein the carrier cells carrying the virus are incubated post-infection for a time sufficient for expression of the protein and replication of the virus. 61. The cell-assisted viral expression system (CAVES) of claim 62 or claim 60, wherein after incubation, the carrier cells containing the virus were stored at -5°C to -200°C for at least 24 hours. 67. A cell-assisted viral expression system (CAVES) according to any of claims 1 to 66, wherein the CAVES or a composition containing the CAVES is stored at -5°C to -200°C for at least 24 hours. 67. A cell-assisted viral expression system (CAVES) according to any of claims 1 to 66, wherein the CAVES or a composition containing the CAVES is stored at -80°C to -200°C for at least 24 hours. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 68, wherein the virus expresses an immunomodulatory protein that is displayed on the carrier cell surface. 62. Cell-assisted viral expression system (CAVES) according to claim 61, wherein said immunomodulatory viral protein is selected among VCP (C3L), B5R, HA (A56R), B18R/B19R and B8R. The carrier cells are stem cells that are mesenchymal cells derived from adipose stromal cells,
the virus is vaccinia virus, and the carrier cell containing the virus is grown under conditions in which at least one immunomodulatory or therapeutic protein encoded by the virus is expressed, or the carrier cell is grown. or produced by incubating the cells with the virus for 6 hours or more under conditions that allow the virus to replicate.
Cell-assisted viral expression system (CAVES) according to any one of claims 1 to 69. Claims that the incubation was carried out for 6 hours to the next day, up to 24 hours, up to 26 hours, up to 3 hours, up to 3 days, up to 4 days, up to 5 days, or any time between 6 hours and 1 week. Cell-assisted viral expression system (CAVES) according to paragraph 71. A cell-assisted viral expression system (CAVES) according to any of claims 62-71, wherein said conditions include incubation in a cell culture medium at a temperature of about 25°C to 40°C. A cell-assisted viral expression system (CAVES) according to any of claims 1 to 73, wherein the virus is a vaccinia virus selected from those according to any of claims 280 to 310. The virus is a vaccinia virus selected from vaccinia viruses,
a) the nucleic acid sequence shown in SEQ ID NO: 71 or a sequence having at least 95% sequence identity thereto;
b) at least one therapeutic gene or detectable marker gene inserted in the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding vaccinia virus;
c) a partially or completely deleted F1L locus of the corresponding unmodified vaccinia virus, where the F1L gene is not expressed;
d) a partially or completely deleted B8R locus of the corresponding unmodified vaccinia virus, where the B8R gene is not expressed;
e) One or more of the following modifications:
(i) at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus;
(ii) a partially or completely deleted F1L locus of the corresponding unmodified vaccinia virus, where the F1L gene is not expressed; and/or (ii) a partially or completely deleted F1L locus of the corresponding unmodified vaccinia virus. 74. The cell-assisted viral expression system (CAVES) according to any one of claims 1 to 73, comprising a B8R gene locus deleted in the B8R gene locus, in which the B8R gene is not expressed. Cell-assisted viral expression system (CAVES) according to any of claims 75a) to e), wherein the corresponding unmodified vaccinia virus comprises the nucleic acid sequence shown in SEQ ID NO: 70 or SEQ ID NO: 71. Claim 75b) wherein said modification comprises at least one therapeutic gene inserted into said intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus. , e) and a cell-assisted viral expression system (CAVES) according to claim 76. The therapeutic gene(s) may include immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies and angiogenesis. 78. Cell-assisted viral expression system (CAVES) according to claim 77, selected from among inhibitors. 79. The cell-assisted viral expression system (CAVES) of claim 78, wherein the therapeutic gene is a costimulatory factor that is OX40L or CD40L. 75b) wherein said modification comprises at least one marker gene inserted in said intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified vaccinia virus. and e) and a cell-assisted viral expression system (CAVES) according to any of claims 76 to 78. 80. Said marker gene(s) are selected from green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Cell-assisted viral expression system (CAVES) as described in . the B8R gene is not expressed because the modification is a partially or completely deleted B8R locus in the corresponding unmodified virus;
said modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted B8R locus;
Cell-assisted viral expression system (CAVES) according to any one of claims 75d) to f). The modification is a partially or completely deleted F1L locus of the corresponding unmodified virus, so that the F1L gene is not expressed;
said modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted F1L locus;
A cell-assisted viral expression system (CAVES) according to any of claims 75c), e), and f). 84. A cell-assisted viral expression system (CAVES) according to claim 82 or claim 83, encoding at least one therapeutic gene. The therapeutic gene(s) may include immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies and angiogenesis. 85. A cell-assisted viral expression system (CAVES) according to claim 84, selected from among inhibitors. Cell-assisted viral expression system (CAVES) according to any of claims 82 to 85, comprising at least one marker gene. 86. The marker gene(s) are selected from green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Cell-assisted viral expression system (CAVES) as described in . Cell-assisted viral expression system (CAVES) according to claims 75b) and f) and any of claims 76-87, wherein at least one therapeutic gene is an anti-cancer antibody. 89. The cell-assisted viral expression system (CAVES) of claim 88, wherein the anti-cancer antibody is an anti-VEGF antibody or an anti-CTLA-4 antibody. 90. The cell-assisted viral expression system (CAVES) of claim 88 or claim 89, wherein the anti-cancer antibody is a single chain antibody. Cell-assisted viral expression system (CAVES) according to any of claims 88 to 90, further comprising a nucleic acid encoding an IgK signal peptide for promoting secretion of said antibody. 92. A cell-assisted viral expression system (CAVES) according to any of claims 88 to 91, further comprising a nucleic acid encoding a FLAG tag to facilitate detection of said antibody. Claims 75b) and e, wherein the virus comprises a gene encoding a therapeutic product and/or a detectable marker gene selected among sodium-iodine symporter (NIS), OX40L and 4-IBBL. ) and the cell-assisted viral expression system (CAVES) according to any one of claims 76 to 87. A cell-assisted viral expression system (CAVES) according to any of claims 74 and 76-93, wherein the unmodified vaccinia virus is ACAM2000 or ACAM1000. 95. The cell-assisted viral expression system (CAVES) of claim 94, wherein the unmodified vaccinia virus is ACAM2000. A cell-assisted viral expression system (CAVES) according to any of claims 3 to 75, wherein the cells are derived from a tumor of the subject to whom the composition is administered. 97. A cell-assisted viral expression system (CAVES) according to claim 96, encoding a therapeutic product. 98. The cell-assisted viral expression system (CAVES) of claim 97, wherein the therapeutic product is one or more of a cytokine, a chemokine, a co-stimulator, a prodrug activator, and a therapeutic antibody. The therapeutic product may be GM-CSF, IL2, IL10, IL12, IL-15, IL-17, IL-18, IL-21, TNF, MIP1a, FLt3L, IFN-b, IFN-g, CCl5, CCl2 , CCl19, CXCl11, OX40L, 41BBL, CD40L, B7.1/CD80, GITRL, LIGHT, CD70, BITE, and VEGFA, VEGFB, PGF, VEGFR2, PDGFR, Ang-1, Ang-2, ANGPT1, ANGPT2, HGF, 99. The cell-assisted viral expression system (CAVES) of claim 98, wherein the cell-assisted viral expression system (CAVES) is one or more of a single chain antibody against lacZ, a cytosine deaminase enzyme, and a human sodium-iodine symporter. 99. The cell-assisted viral expression system (CAVES) of claim 98, wherein the therapeutic product is an immune checkpoint inhibitor. 101. Cell-assisted viral expression according to claim 100, wherein the immune checkpoint inhibitor is an antibody against PD-1, PD-L1, CTLA4, TIM-3, BTLA, VISTA, PD-L1, or LAG-3. System (CAVES). Cell-assisted viral expression system (CAVES) according to any of claims 1 to 96, wherein the oncolytic virus encodes a therapeutic product that inhibits or reduces angiogenesis. The encoded therapeutic product is optionally linked directly or indirectly to the Fc portion of human IgG1, anti-angiopoietin-2 (ANGPT) single chain antibody, and combinations thereof. 98. Cell assisted viral expression system (CAVES) according to claim 97, selected among VEGFR single chain antibodies, VEGFR or extracellular domains thereof. A pharmaceutical composition comprising a cell-assisted viral expression system (CAVES) according to any of claims 1 to 103 in a pharmaceutically acceptable medium. 105. The pharmaceutical composition of claim 104, which is cryopreserved. 106. The pharmaceutical composition of claim 104 or claim 105, formulated for direct administration without dilution. 107. A pharmaceutical composition according to any of claims 104 to 106, formulated as a single dose. 108. A pharmaceutical composition according to any of claims 104 to 107, wherein said pharmaceutically acceptable vehicle is suitable for parenteral administration. 109. A pharmaceutical composition according to any of claims 104 to 108, formulated for intratumoral, intraperitoneal, intravenous, subcutaneous, oral, mucosal, or rectal administration. 109. A pharmaceutical composition according to any of claims 104 to 109, formulated for systemic administration. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 103, wherein the virus expresses an immunomodulatory protein that is displayed on the carrier cell surface. 112. The cell-assisted viral expression system (CAVES) of claim 111, wherein said virus is vaccinia virus. 113. The cell-assisted viral expression system (CAVES) of claim 111 or claim 112, wherein the immunomodulatory viral protein is selected from VCP (C3L), B5R, HA (A56R), B18R/B19R and B8R. ). The oncolytic virus is an oncolytic vaccinia virus, herpes virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), Coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus. , picornavirus, poliovirus, parvovirus, lentivirus, alphavirus, flavivirus, rhabdovirus, papillomavirus, influenza virus, mumps virus, gibbon leukemia virus, maraba virus and sindbis virus, claim The cell-assisted viral expression system (CAVES) according to any of items 1 to 110. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 114, wherein said virus encodes a therapeutic product. 116. The cell-assisted viral expression system (CAVES) of claim 115, wherein the therapeutic product is a polypeptide or a nucleic acid. 117. The cell-assisted viral expression system (CAVES) of claim 116, wherein the therapeutic product is a polypeptide. 117. The cell-assisted viral expression system (CAVES) of claim 116, wherein the therapeutic product is a nucleic acid that is double-stranded RNA. 117. The cell-assisted viral expression system (CAVES) of claim 116, wherein said cells are T cells. 117. The cell-assisted viral expression system (CAVES) of claim 116, wherein the therapeutic product is an anti-cancer drug. A cell-assisted viral expression system (CAVES) according to any of claims 115 to 120, wherein the therapeutic product is an antibody or an antigen-binding fragment thereof. 122. The cell-assisted viral expression system (CAVES) of claim 121, wherein the therapeutic product is an anti-CTLA4, anti-PD-1 or anti-PD-L1 antibody or antigen-binding fragment thereof. Cell-assisted viral expression system (CAVES) according to any of claims 115-121, wherein the therapeutic product is an immune checkpoint inhibitor or a product that modulates an immune pathway. Cell-assisted viral expression system (CAVES) according to any of claims 1 to 123, in a cryopreservation composition. 125. The cell-assisted viral expression system (CAVES) of claim 124, wherein the cryopreservation composition comprises one or more glycerol, DMSO or other cryopreservation agent. A pharmaceutical composition comprising a cell-assisted viral expression system (CAVES) or a plurality thereof according to any of claims 1-103 and 111-125. 127. The pharmaceutical composition of claim 126, formulated for parenteral administration. 127. The pharmaceutical composition of claim 126, formulated for local or systemic administration. 129. A pharmaceutical composition according to any of claims 126 to 128, formulated for oral, intravenous, intratumoral, rectal, subcutaneous or mucosal administration. A method of treating cancer, including solid tumors or hematological malignancies, in a subject, comprising administering a cell-assisted viral expression system (CAVES) according to any of claims 1-125, or claims 126-126. 129. A method comprising administering a pharmaceutical composition according to any of 129. A method of treating cancer, including a solid tumor or hematological malignancy, in a subject, the method comprising:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less;
b) cells proliferate and/or replicate for a sufficient period of time for said virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce cell-assisted viral expression systems (CAVES); incubating or co-cultivating said cells with said oncolytic virus under conditions capable of
c) administering to said subject said cell-assisted viral expression system (CAVES) to treat said solid tumor or hematological malignancy. 132. The method of claim 131, wherein the MOI is 0.001 to 10, or 0.1 to 10, or 0.1, or less than 0.3, or less than 0.1, or less than 0.5. Said carrier cells and virus are present for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. 133. The method of any of claims 130 to 132, wherein the method is incubated or co-cultured for more than 30 days. 134. The method of any of claims 130-133, wherein the cells and virus are incubated or co-cultured for at least 6 hours. 135. The method of any of claims 130-134, wherein the cells and virus are incubated or co-cultured for at least or up to 1, 2, 3, 4, 5, 6, or 7 days. 136. The method according to any of claims 130 to 135, wherein after incubating or co-culturing the cells and virus, the resulting cell-assisted viral expression system (CAVES) is stored. 137. The method of claim 136, wherein the storage is carried out at a temperature of -5°C to -200°C, or in a refrigerator, or in liquid nitrogen or _CO2 . 138. The method of claim 136 or 137, wherein the cell-assisted viral expression system (CAVES) is cryopreserved. 139. The method of any of claims 136-138, wherein the cell-assisted viral expression system (CAVES) is stored for at least 24 hours. The cell-assisted viral expression system (CAVES) may be used for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or for up to 1, 2, 3, 4, 5 139. The method of any of claims 136-139, wherein the method is stored for , 6, 7, 8, 9, 10, 11, 12 years or more. 141. A method according to any of claims 131 to 140, wherein the cell-assisted viral expression system (CAVES) is stored after incubation or co-cultivation (step b) and before administration (step c). 142. The method of any of claims 130-141, wherein the cell-assisted viral expression system (CAVES) is refrigerated or frozen or stored at a temperature of about or just -5°C to -200°C. 143. The method of claim 142, wherein the cell-assisted viral expression system (CAVES) is stored at a temperature of about -80°C to -200°C or in liquid nitrogen or _CO2 . 144. The method according to any of claims 130 to 143, wherein the carrier cells are not immune cells and/or are not tumor cells. 144. The method according to any of claims 130 to 143, wherein the carrier cell is an immune cell, or a tumor cell, or a tumor cell line, or a stem cell. 146. The method according to any of claims 130 to 145, wherein the carrier cells are stem cells. said carrier cell has been treated or modified, or both treated and modified, to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject; 147. The method of any of claims 130 to 146, wherein carrier cells have been treated and/or modified to enhance amplification of the virus in said cells. 148. The method of any of claims 130 to 147, wherein the carrier cells are selected from treated or modified carrier cells selected among stem cells, immune cells and tumor cells. 148. The method of any of claims 130-147, wherein the carrier cells are embryonic epithelial cells or fibroblasts. 148. The method according to any of claims 130 to 147, wherein the carrier cell is an immune cell. The carrier cells may include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. 148. The method of any of claims 130-147, wherein the method is selected among targeting CAR-T cells. said carrier cell is an engineered or treated cell from a hematological malignancy cell line, said cell is adapted to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject, and/or 148. The method of any of claims 130 to 147, wherein the method has been treated or modified, or both treated and modified, to enhance amplification of the virus in the cell. The carrier cells may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. 153. The method according to any of claims 130 to 152, which is a cell line. 153. The method according to any of claims 130 to 152, wherein the carrier cells are stem cells. The stem cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small juvenile stem cells, dermal fibroblast stem cells 155. The method according to claims 130-154, wherein the stem cells are selected from among , tissue/tumor-associated fibroblasts, epithelial stem cells, and embryonic epithelial stem cells. 156. The method of claim 155, wherein the stem cells are selected from mesenchymal cells. The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors 157. The method of claim 156, isolated from/derived from dental papilla-derived stem cells, muscle satellite cells, and other such cells. 158. The method of any of claims 130-157, wherein the carrier cells are selected among endothelial progenitor cells, neural stem cells and adult bone marrow cells, mesenchymal stem cells. The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth 159. The method according to any of claims 130 to 158, wherein the mesenchymal stem cells are isolated from or derived from papilla-derived stem cells and muscle satellite cells. 160. The method of claim 159, wherein the mesenchymal stem cells are isolated from adipose stromal cells. 161. The method of any of claims 130-160, wherein the carrier cells comprise adipose stromal cells. 162. The method of any of claims 130-161, wherein the cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof. 163. The method of any of claims 130 to 162, wherein the carrier cells are derived from the stromal vascular population (SVF) of adipose stromal cells. 164. The method of claims 130 to 163, wherein the cells are stem cells derived from the epiadventitial adipose stromal cells (CD34+SA-ASC) by culturing the epiadventitial adipose stromal cells to produce AD-MSCs. Any method described. 165. The method of claim 164, wherein the mesenchymal cells are derived from adipose stromal cells. The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). 165. The method according to any of claims 130 to 164, wherein the adipose stromal cells are selected from. 167. The method according to any of claims 130 to 166, wherein the carrier cells are adipose cultured adipose mesenchymal stem cells (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC). 168. The method of any of claims 130-167, wherein the cells are allogeneic to the subject to be treated. 168. The method of any of claims 130-167, wherein the cells are autologous to the subject being treated. The virus may include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackie virus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, poliovirus. Any of claims 130 to 169 selected from viruses, parvoviruses, retroviruses, alphaviruses, marabaviruses, flaviviruses, rhabdoviruses, papillomaviruses, influenza viruses, mumps viruses, gibbon leukemia viruses and Sindbis viruses. Method described in Crab. 171. The method of claim 170, wherein the virus is measles virus. 171. The method of claim 170, wherein the virus is a retrovirus that is a lentivirus. 171. The method of claim 170, wherein the virus is a poxvirus that is vaccinia virus. The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Tashkent, Wyeth, IHD- 171. The method of claim 170, wherein the poxvirus is selected from strains of J, IHD-W, Brighton, Dairen I and Connaught. 175. The method of claim 174, wherein the virus is ACAM1000 or ACAM2000. the virus is vaccinia virus,
the carrier cells are stem cells derived from adipose stromal cells;
176. The method according to any of claims 130-175. 177. The method of any of claims 130-176, wherein said CAVES expresses an immunomodulatory protein encoded by said virus. 178. The method of any of claims 130-177, wherein the cancer comprises a solid tumor. 178. The method of any of claims 130-177, wherein the cancer is a hematological malignancy. The subject includes a solid tumor or hematological malignancy selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, leukemia, lymphoma and kidney cancer. 180. The method according to any one of claims 130 to 179, comprising: The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. 181. The method of claim 180, wherein the method is selected. 182. The method of any of claims 130-181, wherein the oncolytic virus encodes a heterologous gene product. 183. The method of claim 182, wherein the heterologous gene product is an anti-cancer therapeutic. 184. The method of claim 183, wherein the product is an antibody or antigen binding portion thereof. 185. The method of any of claims 130-184, wherein the subject is a human. 185. The method of any of claims 130-184, wherein the subject is a non-human animal. 185. The method of any of claims 130-184, wherein the subject is a farm or zoo animal. 185. The method of any of claims 130-184, wherein the subject is a dog or a cat. 188. The method of claim 187, wherein the subject is a cow, horse, goat, mule, zebra, giraffe, gorilla, bonobo, donkey, pig, llama, chimpanzee, or alpaca. 186. The method of any of claims 130-185, wherein the subject is a pediatric human. 191. According to any of claims 130 to 190, the cell-assisted viral expression system (CAVES) is administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular, or intraocular injection. Method. 191. The method of any of claims 130-190, wherein said cell-assisted viral expression system (CAVES) is administered by intramuscular or subcutaneous administration. 193. The method of any of claims 130-192, comprising administering another anti-cancer treatment or therapy. 194. The method of claim 193, wherein said other cancer treatment or therapy is immunotherapy. 195. The method of claim 194, wherein the immunotherapy comprises administering a checkpoint inhibitor or a treatment that inhibits a checkpoint or immunosuppressive pathway. administering a treatment that activates a T cell response in said subject, said treatment comprising administering a blocking antibody to a negative costimulatory molecule or comprising an agonist antibody to an activating costimulatory molecule. The method according to any of paragraphs 130 to 195. 197. The method of claim 196, wherein said treatment comprises administering a blocking antibody to a negative costimulatory molecule. 12. The blocking antibody is directed against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3. 196 or the method of claim 197. 199. The method of any of claims 196-198, wherein said treatment comprises administration of an inhibitor of the PD-1 pathway. 200. The method of claim 199, wherein the inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligand. 200. The method of claim 199, wherein the inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1. 199. The method of any of claims 196-198, wherein the treatment comprises administering an anti-CTLA-4 antibody, an anti-PD-L1 antibody, or an anti-PD-1 antibody. 199. The method of any of claims 196-198, wherein said treatment comprises administering a blocking antibody against a negative costimulatory molecule selected among PD-L1 and CTLA-4. 204. The method of any of claims 130-203, comprising a treatment comprising administering an agonist antibody to a costimulatory molecule. 205. The method of claim 204, wherein the co-stimulatory molecule is selected from CD28, OX40, CD40, GITR, CD137, CD27 and HVEM. A cell-assisted viral expression system (CAVES) according to any of claims 1 to 125 or any of claims 126 to 129 for use in treating cancer, including solid tumors or hematological malignancies. Pharmaceutical compositions as described. A cell-assisted viral expression system (CAVES) according to any of claims 1-125 or according to claims 126-129 for use in treating cancer, including solid tumors or hematological malignancies, in a subject. Use of any of the pharmaceutical compositions. 208. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to claim 206 or claim 207, wherein said cell-assisted viral expression system comprises:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less; and
b) conditions under which cells can proliferate and/or replicate for a sufficient period of time for said oncolytic virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce said CAVES; and incubating or co-cultivating said cells with said oncolytic virus. Cell-assisted viral expression systems (CAVES) or cells for use according to claim 208, wherein the MOI is 0.001-10, 0.1-10, 0.1-1, 0.1 to less than 1, 0.1-0.5 or 0.1. Use of assisted viral expression systems (CAVES). Said carrier cells and virus are present for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 209, produced by incubating or co-cultivating for a time of . 211. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 210, wherein said cells and virus are incubated or co-cultured for at least 6 hours. . Cell-assisted viral expression for use according to any of claims 206-211, wherein the cells and virus are incubated or co-cultured for at least or up to 1, 2, 3, 4, 5, 6, or 7 days. (CAVES) or cell-assisted viral expression systems (CAVES). A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system for use according to any of claims 206 to 212, wherein said cell-assisted viral expression system (CAVES) is stored for use. Use of (CAVES). Cell-assisted viral expression systems (CAVES) for use according to claim 213, or wherein said storage is carried out at a temperature between −5° C. and −200° C., or in a refrigerator, or in liquid nitrogen or CO ₂ . Use of cell-assisted viral expression systems (CAVES). 215. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 213 or 214, wherein said cell-assisted viral expression system (CAVES) is cryopreserved. A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 213-215, wherein said cell-assisted viral expression system (CAVES) is stored for at least 24 hours. CAVES). The cell-assisted viral expression system (CAVES) may be used for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or for up to 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12 or more years. Use of type virus expression systems (CAVES). Cell-assisted virus for use according to any of claims 213 to 217, wherein the resulting cell-assisted virus expression system (CAVES) is preserved after incubation of the carrier cell and the oncolytic virus. Use of expression systems (CAVES) or cell-assisted viral expression systems (CAVES). A cell-assisted viral expression system (CAVES) for use according to any of claims 206-218, or wherein the cells are stored or refrigerated or frozen at a temperature of about or just -5°C to -200°C. Use of cell-assisted viral expression systems (CAVES). A cell-assisted viral expression system (CAVES) for use according to claim 219, wherein the cells are stored at a temperature of about -80°C to -200°C or in liquid nitrogen or _CO2 . ) or the use of cell-assisted viral expression systems (CAVES). Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 220, wherein said carrier cells are not immune cells and/or tumor cells. . Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for use according to any of claims 206 to 220, wherein the carrier cells are immune cells, or tumor cells, or tumor cell lines, or stem cells. Use of viral expression systems (CAVES). 223. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-222, wherein said carrier cells are stem cells. said carrier cell is treated or modified, or both treated and modified, so as to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject; and/or said carrier cell has been treated and/or modified to enhance amplification of said virus within said cell,
224. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-223. Cell-assisted viral expression system for use according to any of claims 206 to 224, wherein said carrier cells are selected from treated or modified cells selected among stem cells, immune cells and tumor cells. (CAVES) or the use of cell-assisted viral expression systems (CAVES). Cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for use according to any of claims 206 to 224, wherein the carrier cells are embryonic epithelial cells or fibroblasts. Use of. 225. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 224, wherein said carrier cells are immune cells. The carrier cells may include granulocytes, mast cells, monocytes, dendritic cells, natural killer cells, lymphocytes, T cell receptor (TCR) transgenic cells that target tumor-specific antigens, and tumor-specific antigen targeting cells. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 224, selected among targeting CAR-T cells. . Said carrier cell is treated or modified to enhance the immunosuppressive or immunoprivileged properties of said cell for administration to a human subject and/or to enhance the amplification of said virus in said cell. 225. A cell-assisted viral expression system for use according to any of claims 206 to 224, wherein the modified or treated cells are derived from a hematological malignancy cell line, or have been both treated and modified. (CAVES) or the use of cell-assisted viral expression systems (CAVES). The carrier cells may be associated with human leukemia, T-cell leukemia, myelomonocytic leukemia, lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), acute lymphoblastic leukemia (ALL), erythroleukemia, myelomonoblastic leukemia, malignant non-Hodgkin NK lymphoma, myeloma/plasmacytoma, multiple myeloma and macrophage cell lines. 230. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-229, which is a cell line. 230. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206 to 229, wherein said carrier cells are stem cells. The carrier cells may be adult stem cells, embryonic stem cells, fetal stem cells, neural stem cells, mesenchymal stem cells, totipotent stem cells, pluripotent stem cells, induced pluripotent stem cells, multipotent stem cells, oligopotent stem cells, or unipotent stem cells. Sexual stem cells, adipose stromal stem cells, endothelial stem cells (e.g. endothelial progenitor cells, placental endothelial progenitor cells, angiogenic endothelial cells, pericytes), adult peripheral blood stem cells, myoblasts, small immature stem cells, dermal fibroblasts A cell-assisted viral expression system for use according to any of claims 206-231, wherein the cell-assisted viral expression system ( CAVES) or cell-assisted viral expression systems (CAVES). 233. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 232, wherein said stem cells are selected from mesenchymal cells. The mesenchymal cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, and endometrial regeneration. cells, placental bipotent endothelial/mesenchymal progenitor cells, amniotic or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic girdle stem cells, chorionic villus mesenchymal stromal cells, subcutaneous White adipose mesenchymal stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle precursors Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for use according to claim 233 isolated from/derived from cells, dental papilla-derived stem cells, muscle satellite cells, and other such cells. Use of viral expression systems (CAVES). Cell-assisted viral expression system (CAVES) for use according to any of claims 206-234, wherein said carrier cells are selected among endothelial progenitor cells, neural stem cells, adult bone marrow cells and mesenchymal stem cells. ) or the use of cell-assisted viral expression systems (CAVES). The cells include adult bone marrow, adipose tissue, blood, dental pulp, neonatal umbilical cord, umbilical cord blood, placental mesenchymal cells, placenta-derived adherent stromal cells, placenta-derived decidual stromal cells, endometrial regeneration cells, and placenta. Bipotent endothelial/mesenchymal progenitor cells, amniotic membrane or amniotic fluid mesenchymal stem cells, amniotic fluid-derived progenitor cells, Wharton's jelly mesenchymal stem cells, pelvic zone stem cells, chorionic villus mesenchymal stromal cells, subcutaneous white adipose interstitial cells Leaf stem cells, pericytes, perisinusoidal reticular cells, hair follicle-derived stem cells, hematopoietic stem cells, periosteum-derived mesenchymal stem cells, lateral plate mesenchymal stem cells, deciduous deciduous tooth stem cells, periodontal ligament stem cells, dental follicle progenitor cells, teeth Cell-assisted viral expression for use according to any of claims 206-235, which is a mesenchymal stem cell isolated from or derived from papilla-derived stem cells, muscle satellite cells, and other such cells. (CAVES) or cell-assisted viral expression systems (CAVES). 237. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 236, wherein the mesenchymal stem cells are isolated from adipose stromal cells. 238. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-237, wherein said carrier cells comprise adipose stromal cells. Cell-assisted viral expression system for use according to any of claims 206-238, wherein the cells are MSCs isolated from umbilical cord blood, peripheral blood, muscle, cartilage or amniotic fluid, or a mixture thereof. (CAVES) or the use of cell-assisted viral expression systems (CAVES). Cell-assisted viral expression system (CAVES) or cell-assisted viral expression system (CAVES) for use according to any of claims 206-239, wherein the carrier cells are derived from the stromal vascular population (SVF) of adipose stromal cells. Use of viral expression systems (CAVES). 241. The cell of claim 206 to 240, wherein the cell is a stem cell derived from the epithelial adipose stromal cell (CD34+SA-ASC) by culturing the epithelial adipose stromal cell to produce AD-MSC. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for any of the uses described. 242. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 241, wherein the mesenchymal stem cells are derived from adipose stromal cells. The carrier cells are epithelial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). Cell-assisted viral expression system (CAVES) or use of a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-240, wherein the adipose stromal cells are selected from: For use according to any of claims 206 to 243, wherein the carrier cells are adipose cultured adipose mesenchymal stem cells (AD-MSC) derived from epiadventitial adipose stromal cells (CD34+SA-ASC). Use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES). A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-244, wherein said cells are allogeneic to the subject to be treated. Use of. 245. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use of any of claims 206-244, wherein said cells are autologous to the subject to be treated. . Viruses include poxvirus, herpes simplex virus, adeno-associated virus, reovirus, vesicular stomatitis virus (VSV), coxsackievirus, Semliki Forest virus, Seneca Valley virus, Newcastle disease virus, Sendai virus, dengue virus, picornavirus, and poliovirus. , parvovirus, retrovirus, alphavirus, flavivirus, rhabdovirus, papillomavirus, influenza virus, mumps virus, gibbon leukemia virus, and Sindbis virus, according to any of claims 206-246. The use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for the use of. 248. A cell-assisted viral expression system (CAVES) or use of a cell-assisted viral expression system (CAVES) for use according to claim 247, wherein said virus is measles virus. 248. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 247, wherein the virus is a retrovirus that is a lentivirus. 248. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 247, wherein said virus is a poxvirus, which is vaccinia virus. The virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth, IHD- Cell-Assisted Viral Expression System (CAVES) or Cell-Assisted Viral Expression for use according to claim 247, wherein the poxvirus is selected from the strains of J, IHD-W, Brighton, Dairen I and Connaught. Use of systems (CAVES). 252. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 251, wherein the virus is ACAM1000 or ACAM2000. 253. The cell-assisted viral expression system (CAVES) of claim 252, wherein the viral genome comprises the sequence of nucleotides set forth in SEQ ID NO: 70 or 71. The virus is vaccinia virus, and the carrier cell is a stem cell derived from adipose stromal cell.
253. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to any of claims 206-252. 255. The cell-assisted viral expression system of claim 254, wherein the carrier cell and virus are incubated for at least 6 hours, and the incubation is performed under conditions such that the virus infects the cell and expresses the encoded protein. CAVES). 256. The cell-assisted viral expression system (CAVES) of claim 255, wherein the incubation is for 10, 12, 14, 16 or 20 hours or less. 255. A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-254, wherein said CAVES expresses an immunomodulatory protein encoded by said virus. Use of. 258. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-257, wherein said cancer comprises a solid tumor. 259. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-258, wherein said cancer is a hematological malignancy. The target to be treated is a solid tumor or hematological malignancy selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, leukemia, lymphoma and kidney cancer. 260. The use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-259, with a cancer comprising: The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. 260. A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to claim 259, which is selected. 262. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-261, wherein said oncolytic virus encodes a heterologous gene product. 263. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 262, wherein the heterologous gene product is an anti-cancer therapeutic. 188. A cell-assisted viral expression system (CAVES) or use of a cell-assisted viral expression system (CAVES) for the use of claim 262 or claim 187, wherein said product is an antibody or an antigen-binding portion thereof. 265. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 193 to 264, wherein the subject to be treated is a human. 265. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-264, wherein the subject to be treated is a non-human animal. A cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206 to 264, wherein the subject to be treated is a farm or zoo animal. use. 265. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-264, wherein the subject to be treated is a dog or a cat. 188. Cell-assisted virus for use according to claim 187, wherein the subject to be treated is a cow, horse, goat, mule, zebra, giraffe, gorilla, bonobo, donkey, pig, llama, chimpanzee, or alpaca. Use of expression systems (CAVES) or cell-assisted viral expression systems (CAVES). 266. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-265, wherein the subject to be treated is a pediatric human. Cell support for use according to any of claims 206-270, wherein the CAVES are for administration by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular, or intraocular injection. Use of type virus expression systems (CAVES) or cell-assisted viral expression systems (CAVES). Cell-assisted viral expression system (CAVES) or cell-assisted virus for use according to any of claims 206-270, wherein said cell-assisted viral expression system (CAVES) is for intramuscular or subcutaneous administration. Use of expression system (CAVES). 273. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 206-272 in combination with another different anti-cancer treatment or therapy. 209. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 209, wherein said other cancer treatment or therapy is immunotherapy. 275. A cell-assisted viral expression system (CAVES) or cell-assisted viral expression system for use according to claim 274, wherein said immunotherapy comprises a checkpoint inhibitor or a treatment that inhibits a checkpoint or immunosuppressive pathway. Use of (CAVES). Any of claims 206-275 comprising a treatment that activates a T cell response in said subject, said treatment comprising a blocking antibody to a negative costimulatory molecule or an agonist antibody to an activating costimulatory molecule. The use of cell-assisted viral expression systems (CAVES) or cell-assisted viral expression systems (CAVES) for the uses described in . 277. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to claim 276, wherein said treatment comprises blocking antibodies against negative costimulatory molecules. 276 or 276, wherein the blocking antibody is against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3. 214. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use according to claim 213. 279. Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for use according to any of claims 276-278, wherein said treatment comprises an inhibitor of the PD-1 pathway. Cell-assisted viral expression system (CAVES) or cell-assisted for use according to claim 279, wherein the inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligands. Use of type virus expression systems (CAVES). A cell-assisted viral expression system (CAVES) for use according to claim 279, or wherein the inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1. Use of cell-assisted viral expression systems (CAVES). Cell-assisted viral expression system (CAVES) for use according to any of claims 276-278, wherein said treatment comprises an anti-CTLA-4 antibody, an anti-PD-L1 antibody, or an anti-PD-1 antibody; or Use of cell-assisted viral expression systems (CAVES). Cell-assisted viral expression for use according to any of claims 276-278, wherein said treatment comprises blocking antibodies against negative costimulatory molecules selected among PD-L1 and CTLA-4. (CAVES) or cell-assisted viral expression systems (CAVES). Cell-assisted viral expression systems (CAVES) or cell-assisted viral expression for use according to any of claims 206-283, comprising treatments comprising costimulatory molecules, agonistic antibodies against CAR-T and/or TILs. Use of systems (CAVES). 285. A cell-assisted viral expression system (CAVES) or cell-assisted virus for use according to claim 284, wherein said costimulatory molecule is selected from CD28, OX40, GITR, CD40, CD137, CD27 and HVEM. Use of expression system (CAVES). A vaccinia virus comprising a genome having the nucleotide sequence shown in SEQ ID NO: 71. A modified ACAM2000 virus comprising at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus. A modified ACAM2000 virus that contains a partially or completely deleted or interrupted F1L locus of the corresponding unmodified ACAM2000 virus, in which the F1L gene is not expressed. A modified ACAM2000 virus that contains a partially or completely deleted or interrupted B8R locus of the corresponding unmodified ACAM2000 virus, in which the B8R gene is not expressed. Modified ACAM2000 viruses containing one or more of the following modifications:
(a) at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus;
(b) a partially or completely deleted F1L locus of the corresponding unmodified ACAM2000 virus, wherein the F1L gene is not expressed; and/or (c) a partially or completely deleted F1L locus of the corresponding unmodified ACAM2000 virus; A completely deleted B8R locus, where the B8R gene is not expressed. A modified ACAM2000 virus that contains one or more of the following modifications in the corresponding unmodified ACAM2000 virus:
at least one therapeutic or marker gene inserted in the intergenic region between open reading frame 174 (ORF_174) and open reading frame 175 (ORF_175); and/or the following loci: ORF72, ORF73, ORF156, ORF157 , at least one truncated open reading frame (ORF) in one or more of ORF158, ORF159, ORF160, ORF174 and ORF175. 12. The modification comprises at least one therapeutic or marker gene inserted into the intergenic region between open reading frame 174 (ORF_174) and open reading frame 175 (ORF_175) of the corresponding unmodified ACAM2000 virus. Modified ACAM2000 virus described in 291. The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. selected from;
the marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt);
293. The modified ACAM2000 virus of claim 292. Contains at least one truncated open reading frame (ORF) at one or more of the following loci: ORF72, ORF73, ORF156, ORF157, ORF158, ORF159, ORF160, ORF174 and ORF175, and one or more of the following loci: ORF72 292. The modified ACAM2000 virus of claim 291, further comprising at least one therapeutic and/or marker gene inserted into the truncated region of , ORF73, ORF156, ORF157, ORF158, ORF159, ORF160, ORF174 and ORF175. The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. selected from;
the marker gene(s) are selected from green fluorescent protein (GFP), sensitive green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt);
295. The modified ACAM2000 virus of claim 294. 296. The modified ACAM2000 virus of any of claims 287-295, wherein the corresponding unmodified ACAM2000 comprises the nucleic acid sequence set forth in SEQ ID NO: 70 or SEQ ID NO: 71. 287, 290, wherein said modification comprises at least one therapeutic gene inserted into the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus. , or the modified ACAM2000 virus described in 296. The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. 298. The modified ACAM2000 virus of claim 297, selected from: 287, 290, wherein said modification comprises at least one marker gene inserted in the intergenic region between open reading frame 157 (ORF_157) and open reading frame 158 (ORF_158) of the corresponding unmodified ACAM2000 virus. , 291, 296 or 297. 299. The marker gene(s) are selected from green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635 and phosphoribosyltransferase (gpt). Modified ACAM2000 virus described in. Since the modification is a partially or completely deleted B8R locus of the corresponding unmodified ACAM2000 virus, the B8R gene is not expressed;
the modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted B8R locus;
297. The modified ACAM2000 virus of any of claims 289, 290, or 296. Since the modification is a partially or completely deleted F1L locus of the corresponding unmodified ACAM2000 virus, the F1L gene is not expressed;
said modified virus comprises at least one therapeutic and/or marker gene inserted in the region of the partially or completely deleted F1L locus;
297. The modified ACAM2000 virus of any of claims 288, 290, or 296. 303. The modified ACAM2000 virus of claim 301 or 302, comprising at least one therapeutic gene. The therapeutic gene(s) may be among immune checkpoint inhibitors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. 304. The modified ACAM2000 virus of claim 303, selected from: 305. A modified ACAM2000 virus according to any of claims 301-304, comprising at least one marker gene. 305. The marker gene(s) are selected from green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), blue fluorescent protein (BFP), TurboFP635, and phosphoribosyltransferase (gpt). Modified ACAM2000 virus described in. 307. The modified ACAM2000 virus of any of claims 287 and 290-306, wherein at least one therapeutic gene is an anti-cancer antibody. 308. The modified ACAM2000 virus of claim 307, wherein the anti-cancer antibody is an anti-VEGF antibody or an anti-CTLA-4 antibody. 309. The modified ACAM2000 virus of claim 307 or claim 308, wherein the anti-cancer antibody is a single chain antibody. 310. The modified ACAM2000 virus of any of claims 307-309, further comprising a nucleic acid encoding an IgK signal peptide for promoting secretion of the antibody. 310. The modified ACAM2000 virus of any of claims 307-309, further comprising a nucleic acid encoding a FLAG tag to facilitate detection of said antibody. Any of claims 287 and 290-311, wherein the at least one detectable marker gene and/or the gene encoding the therapeutic product is sodium-iodine symporter (NIS), OX40L, or 4-IBBL. Modified ACAM2000 virus described in. ACAM2000 virus according to claim 1, further comprising at least one inactivated gene selected among thymidine kinase (TK), hemagglutinin (HA), interferon alpha/beta blocker receptor or immunomodulator. or the modified ACAM2000 virus according to any of claims 387-312. The ACAM2000 virus of claim 1 or the modified ACAM2000 virus of any of claims 287-313, which is further modified to enhance EEV (extracellular enveloped virus) production. 315. The ACAM2000 virus or modified ACAM2000 virus of claim 314, wherein the further modification for enhanced EEV production is a mutation in the gene encoding the A34R protein. 316. The ACAM2000 virus or modified ACAM2000 virus of claim 315, wherein said mutation encodes an A34R protein that includes mutation K151E. A method of treating a solid tumor or hematological malignancy in a subject, the method comprising administering to said subject a composition comprising an oncolytic virus and adipose stromal cells, wherein said adipose stromal cells A method, wherein adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-) are selected. A method of treating a solid tumor or hematologic malignancy in a subject, the composition comprising an oncolytic virus and cultured adipose mesenchymal stem cells (AD-MSCs) derived from epiadventitial adipose stromal cells (CD34+SA-ASCs). A method comprising administering an agent to said subject. 319. The method of claim 317 or claim 318, wherein the cells and oncolytic virus are co-cultured in vitro prior to administration to the subject. 320. The method of claim 319, wherein the cells are co-cultured for a period of time sufficient for the oncolytic virus immunomodulatory protein to be expressed or for the virus to undergo at least one replication cycle. . The adipose mesenchymal stem cells (AD-MSCs) are derived from epiadventitial adipose stromal cells (CD34+SA-ASC) by culturing epiadventitial adipose stromal cells to produce the AD-MSCs, 319. The method of claim 318. said cells and viruses for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. 321. The method of claim 319 or claim 320, wherein the method is co-cultured over a period of time. 12. The oncolytic virus is selected from poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, measles virus, reovirus, cytomegalovirus (CMV) and lentivirus. The method described in any one of 317-322. 324. The method of claim 323, wherein the oncolytic virus is vaccinia virus. The vaccinia virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth. 325. The method of claim 324, wherein the poxvirus is selected from strains of , IHD-J, IHD-W, Brighton, Dairen I, and Connaught. 326. The method of any of claims 317-325, wherein the tumor is a solid tumor. Any of claims 317-326, wherein the subject has a cancer selected from lung cancer, pancreatic cancer, breast cancer, colon cancer, head and neck cancer, liver cancer, melanoma, and kidney cancer. Method described in Crab. The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B-cell lymphoma, lymphocytic leukemia, retinoblastoma cancer, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma, and gastric adenocarcinoma. 327. The method of claim 326, wherein the method is selected. 329. The method of any of claims 317-328, wherein the oncolytic virus encodes a heterologous gene product. 330. The method of claim 329, wherein the heterologous gene product is an anti-cancer therapeutic. 331. The method of claim 330, wherein the product is an antibody. 332. The method of any of claims 317-331, wherein the subject is a human. 333. The method of claim 332, wherein the subject is a pediatric patient. 334. The method of any of claims 317-333, wherein said cells are autologous to said subject. 334. The method of any of claims 317-333, wherein the cell is allogeneic to the subject. 336. The method of any of claims 317-335, wherein the virus is administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular or intraocular injection. 337. The method of any of claims 317-336, wherein the cells are administered by intratumoral, intravenous, intraperitoneal, intrathecal, intraventricular, intraarticular or intraocular injection. 338. The method of any of claims 317-337, comprising administering another anti-cancer treatment or therapy. 339. The method of claim 338, wherein said other cancer treatment or therapy is immunotherapy. 340. The method of claim 339, wherein the immunotherapy comprises administering a checkpoint inhibitor or a treatment that inhibits a checkpoint or immunosuppressive pathway. administering a treatment that activates a T cell response in said subject, said treatment comprising administering a blocking antibody to a negative costimulatory molecule or comprising an agonist antibody to an activating costimulatory molecule. The method according to any of paragraphs 317 to 338. 342. The method of claim 341, wherein said treatment comprises administering a blocking antibody to a negative costimulatory molecule. 12. The blocking antibody is directed against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA, PD-L1, and LAG-3. 341 or the method of claim 342. 344. The method of any of claims 341-343, wherein said treatment comprises administration of an inhibitor of the PD-1 pathway. 345. The method of claim 344, wherein the inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligand. 345. The method of claim 344, wherein the inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1. 344. The method of any of claims 341-343, wherein the treatment comprises administering an anti-CTLA-4 antibody, an anti-PD-L1 antibody, or an anti-PD-1 antibody. 344. The method of any of claims 341-343, wherein said treatment comprises administering a blocking antibody against a negative costimulatory molecule selected among PD-L1 and CTLA-4. 349. The method of any of claims 317-348, comprising a treatment comprising administering an agonist antibody to a costimulatory molecule. 350. The method of claim 349, wherein the co-stimulatory molecule is selected from CD28, OX40, GITR, CD137, CD27 and HVEM. A composition or combination comprising:
(a) an oncolytic virus;
(b) epithelial adventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) or pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-); including;
A composition or combination wherein the composition is a mixture of cells and a virus and the combination is two separate compositions, one composition comprising the virus and the other composition comprising the cells. 12. The oncolytic virus is selected from poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, measles virus, reovirus, cytomegalovirus (CMV) and lentivirus. A composition or combination according to 351. 353. The composition or combination of claim 352, wherein the oncolytic virus is vaccinia virus. The vaccinia virus is Dryvax, ACAM1000, ACAM2000, Lister, EM63, LIVP, Tian Tan, Copenhagen, Western Reserve, Modified Vaccinia Ankara (MVA), New York City Board of Health, Dairen, Ikeda, LC16M8, Copenhagen, Tashkent, Wyeth. 354. The composition or combination of claim 353, wherein the composition or combination is a poxvirus selected from strains of , IHD-J, IHD-W, Brighton, Dairen I, and Connaught. 355. A composition or combination according to any of claims 351-354 for use in treating solid tumors or hematological malignancies. The solid tumor or hematological malignancy is a bladder tumor, breast tumor, prostate tumor, carcinoma, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain cancer, central nervous system (CNS) cancer, Glioma tumors, cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer , intraepithelial neoplasm, kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, Pancreatic cancer, retinoblastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer. Cancer, lymphosarcoma, osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma , pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing sarcoma, Wilms tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, Transmissible sexually transmitted disease tumors, testicular tumors, seminomas, Sertoli cell tumors, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell Tumors, thymoma, gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, lung squamous cell carcinoma, leukemia, hemangiopericytoma, ocular neoplasm, foreskin fibrosarcoma , ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue neoplasm, mast cell tumor, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliosis, nephroblastoma, B-cell lymphoma, lymphocytic leukemia , retinoblastoma, liver neoplasm, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumor, gastric MALT lymphoma and gastric glands. 356. The composition or combination of claim 355, selected from among cancers. A combination therapy for use in the treatment of a solid tumor or hematological malignancy in a subject, the combination therapy comprising:
(a) Stem cells,
the stem cell contains an oncolytic virus;
The stem cells are derived from epiadventitial adipose stromal cells (SA-ASC; CD235a-/CD45-/CD34+/CD146-/CD31-) and pericytes (CD235a-/CD45-/CD34-/CD146+/CD31-). Stem cells, which are selected adipose stromal cells;
(b) a treatment that activates a T cell response in said subject, comprising a blocking antibody to a negative costimulatory molecule, or a treatment comprising an agonist antibody to an activating costimulatory molecule. 358. The combination of claim 357, in (b), the treatment comprises a blocking antibody against a negative co-stimulatory molecule. 359. The use of claim 358, wherein the blocking antibody is against a negative costimulatory molecule selected from CTLA-1, CTLA-4, PD-1, TIM-3, BTLA, VISTA and LAG-3. combination for. 360. The combination of any of claims 357-359, wherein in (b) said treatment comprises an inhibitor of the PD-1 pathway. 361. A combination for use according to claim 360, wherein said inhibitor of the PD-1 pathway is selected among antibodies against PD-1 and soluble PD-1 ligand. 361. A combination for use according to claim 360, wherein said inhibitor of the PD-1 pathway is an antibody selected from AMP-244, MEDI-4736, MPDL328 OA and MIH1. Combination for use according to any of claims 357 to 359, wherein in (b) said treatment comprises an anti-CTLA-4 antibody, an anti-PD-L1 antibody or an anti-PD-1 antibody. 359. The combination of claim 357 or claim 358, wherein in (b) said treatment comprises blocking antibodies to negative co-stimulatory molecules selected among PD-L1 and CTLA-4. 365. A combination therapy for use according to any of claims 357-364, wherein in (b) said treatment comprises an agonist antibody to a co-stimulatory molecule. 366. The combination of claim 365, wherein the co-stimulatory molecule is selected from CD28, OX40, GITR, CD137, CD27 and HVEM. 367. The combination therapy of any of claims 357-366, wherein (a) is for use after (b). 367. The combination therapy of any of claims 357-366, wherein (a) is for use before (b). Any of claims 357-368, further comprising a treatment that induces apoptosis of cells within the tumor, wherein the treatment is selected from radiotherapy, chemotherapy, immunotherapy, phototherapy, or a combination thereof. Combination therapy for use as described in paragraph 1. 370. The combination therapy of claim 369, wherein the treatment that induces apoptosis comprises radiation therapy. 371. A combination therapy for use according to any of claims 357-370, further comprising a treatment to alter the tumor microenvironment, said treatment comprising a cytokine blocker. The lytic virus is poxvirus, adenovirus, herpes simplex virus, Newcastle disease virus, vesicular stomatitis virus, mumps virus, influenza virus, measles virus, reovirus, human immunodeficiency virus (HIV), hantavirus, myxoma. 372. A combination therapy for use according to any of claims 357-371 selected among viruses, cytomegalovirus (CMV) and lentiviruses. 372. Combination therapy for use according to any of claims 357-371, wherein said oncolytic virus is vaccinia virus. The stem cells were treated with the TLR agonist intravenous immunoglobulin (IVIG); monocyte conditioned medium; supernatants from peripheral blood mononuclear cells exposed to neutrophil extracellular traps; peptidoglycan isolated from Gram-positive bacteria; isolated lipoarabinomannan; zymosan isolated from yeast cell wall; polyadenylic-polyuridic acid; poly(IC); lipopolysaccharide; monophosphoryl lipid A; flagellin; galdiquimod; imiquimod; R848; oligonucleoside containing a CpG motif and 23S ribosomal RNA; or said stem cells are co-administered with IVIG-pretreated monocytes, T cells, T cells or natural killer cells exposed to T cell stimulation. 374. A combination therapy for use according to any of claims 357-373, wherein the combination therapy is in culture. The use may include bladder tumors, breast tumors, prostate tumors, carcinomas, basal cell carcinomas, biliary tract cancers, bladder cancers, bone cancers, brain cancers, central nervous system (CNS) cancers, glioma tumors, Cervical cancer, choroidal cancer, colon and rectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer, intraepithelial neoplasia , kidney cancer, laryngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, melanoma, myeloma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, retina Blastoma, rhabdomyosarcoma, rectal cancer, kidney cancer, respiratory system cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, urinary system cancer, lymphosarcoma , osteosarcoma, breast tumor, mast cell tumor, brain tumor, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchial adenocarcinoma, small cell lung cancer, non-small cell lung cancer, fibroma, myxochondroma, pulmonary sarcoma, nerve Sarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilms' tumor, Burkitt's lymphoma, microglioma, osteoclastoma, oral neoplasm, fibrosarcoma, genital squamous cell carcinoma, infectious sexually transmitted disease tumors, Testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma, granulocytic sarcoma, corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, Gastric tumor, adrenal cancer, oral papillomatosis, hemangioendothelioma, cystadenoma, follicular lymphoma, intestinal lymphosarcoma, squamous cell carcinoma of the lung, leukemia, hemangioectiocytoma, ocular neoplasm, foreskin fibrosarcoma, ulcerative squamous cell carcinoma. Cancer, foreskin cancer, connective tissue neoplasm, mast cell tumor, hepatocellular carcinoma, pulmonary adenomatosis, pulmonary sarcoma, Rous sarcoma, reticuloendotheliopathy, nephroblastoma, B cell lymphoma, lymphocytic leukemia, retinoblastoma , to treat liver neoplasms, lymphosarcoma, plasmacytoid leukemia, swim bladder sarcoma (fish), caseous lymphadenitis, lung cancer, insulinoma, neuroma, islet cell tumors, gastric MALT lymphoma, and gastric adenocarcinoma. 375. A combination therapy for use according to any of claims 357-374. Claims wherein the use is for treating glioblastoma, breast cancer, lung cancer, prostate cancer, colon cancer, ovarian cancer, neuroblastoma, central nervous system tumors, pancreatic adenocarcinoma, or melanoma. Combination therapy for use as described in any of 357-375. 377. A combination for use according to any of claims 357-376, wherein said stem cells are autologous. 377. A combination for use according to any of claims 357-376, wherein said stem cells are allogeneic. Cell-assisted viral expression system (CAVES) according to any of claims 1-103 and 111-125, wherein the carrier cells have been treated or modified for conditional immortalization. Claim 379 wherein said carrier cell is modified to express one or more of c-myc, v-myc, E6/E7, hTERT, wild type or modified SV40 large tumor antigen, loxP and/or tetR. Cell-assisted viral expression system (CAVES) as described in . 381. A pharmaceutical composition comprising a cell-assisted viral expression system (CAVES) according to claim 379 or claim 380 in a pharmaceutically acceptable vehicle. 382. The pharmaceutical composition of claim 381, which is cryopreserved. 383. The pharmaceutical composition of claim 381 or claim 382, formulated for direct administration without dilution. 384. A pharmaceutical composition according to any of claims 381-383, formulated as a single dose. 385. The pharmaceutical composition of any of claims 381-384, wherein said pharmaceutically acceptable vehicle is suitable for parenteral administration. 381. A cell-assisted viral expression system (CAVES) according to claim 379 or claim 380 for use in treating cancer, including solid tumors or hematological malignancies. The cell-assisted viral expression system (CAVES) of claim 379 or claim 380 or any of claims 381-385 for use in treating cancer, including solid tumors or hematological malignancies, in a subject. Use of the pharmaceutical composition according to claim 1. 388. The use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use of claim 386 or claim 387, wherein said cell-assisted viral expression system comprises:
a) infecting cells with an oncolytic virus at a multiplicity of infection (MOI) of 10 or less; and
b) conditions under which cells can proliferate and/or replicate for a sufficient period of time for said oncolytic virus to express therapeutic or immunomodulatory proteins encoded in the genome of said virus to produce said CAVES; and incubating or co-cultivating said cells with said virus. 389. Cell assisted viral expression system (CAVES) or cells for use according to claim 388, wherein said MOI is 0.001 to 10, 0.1 to 10, 0.1 to 1, 0.1 to less than 1, 0.1 to 0.5 or 0.1. Use of assisted viral expression systems (CAVES). Use of a cell-assisted viral expression system (CAVES) or a cell-assisted viral expression system (CAVES) for the use of any of claims 386-389, wherein said cells and virus are incubated or co-cultured for at least 6 hours. . the carrier cell is treated or modified for conditional immortalization;
proliferation of said modified carrier cell population is activated at a first time point(s) prior to preparation of CAVES and/or prior to administration of CAVES to a subject;
206. Any of claims 130-205, wherein proliferation of the carrier cell population is inactivated at a second time point after the first time point(s) and prior to administration of the CAVES to the subject. Method described. A method for producing a cell-assisted viral expression system (CAVES), comprising:
Carrier cells and oncolytic viruses for infection of cells by viruses are incubated at an MOI of 0.001 to 10 for at least 6 hours and up to less than 48 hours under conditions in which the virus expresses the encoded protein, thereby incubating the carrier cells for at least 48 hours. expressing at least one immunomodulatory or recombinant therapeutic protein encoded by the virus by association of said virus with said carrier cell to produce a cell-assisted viral expression system (CAVES);
A method comprising: harvesting the cell-assisted viral expression system cells; and storing them in a cryopreservation medium at low temperature to produce a conserved cell-assisted viral expression system (CAVES). 393. The method of claim 392, wherein the MOI is 0.001 to 10, 0.1 to 10, 0.1 to 1, 0.1 to less than 1, 0.1 to 0.5, or 0.1. The incubation time is at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 35, 36, 40 hours or more. 394. The method of claim 392 or claim 393, wherein: 395. The method of claim 394, wherein the incubation time is at least 6 hours. 396. The method of any of claims 392-395, wherein the carrier cell has been treated or modified for conditional immortalization. Claim 396, wherein the carrier cell is modified to express one or more of c-myc, v-myc, E6/E7, hTERT, wild type or modified SV40 large tumor antigen, loxP and/or tetR. The method described in. The virus is one of immune checkpoint inhibitors, costimulatory factors, cytokines, growth factors, photosensitizers, radionuclides, toxins, antimetabolites, signal transduction modulators, anti-cancer antibodies, and angiogenesis inhibitors. 398. The method of any of claims 392-397, wherein the method is processed or modified to code for or include the following: