JP2023127512A - Nucleic acid molecule inhibiting target gene expression - Google Patents

Abstract

To provide a novel nucleic acid molecule for inhibiting target gene expression, (1) having gene expression inhibitory activity equivalent to or greater than siRNA, (2) having no off-target effect caused by a sense strand, and (3) enabling the design of a wider range of antisense strand sequences (expansion of targetable sequence range) without being restricted by the above strand bias rules.SOLUTION: Provided is a nucleic acid molecule represented by the general formula below [where, the definition of each symbol is as described in the specification].SELECTED DRAWING: None

Description

The present invention relates to a novel nucleic acid molecule that suppresses the expression of a target gene, a composition containing the nucleic acid molecule, and a method for suppressing the expression of a target gene using the nucleic acid molecule.

RNA interference (RNAi) is known as a technique for suppressing gene expression. RNAi is a method of suppressing gene expression in order to analyze the functions of genes and proteins in a wide range of cells, and is a very powerful tool for researching molecular biology and cell biology. Suppression of gene expression by RNA interference is generally carried out, for example, by administering a short double-stranded RNA molecule consisting of a sense strand and an antisense strand to cells. The double-stranded RNA molecules are commonly referred to as small interfering RNAs (siRNAs) and are typically 21-25 nt double-stranded RNAs (dsRNAs) with dinucleotide 3' overhangs.

In RNAi, siRNA is incorporated into the RNA-induced silencing complex (RISC) and functions as a guide molecule. siRNA does not work alone, but only exerts its function when incorporated into Argonaute family proteins (AGO), which are the central proteins of RISC. siRNA in RISC functions as a guide to recognize target mRNA, and RISC constituent factors such as AGO act to suppress translation and degrade the target mRNA.

Although RNAi is a method commonly used in this technical field, strand bias poses a problem when implementing it. Strand bias is a phenomenon in which one of the two strands of the siRNA is selectively utilized due to a bias in thermodynamic stability at both ends of the siRNA. If siRNA is a symmetric molecule and has no bias in thermodynamic stability, both the sense and antisense strands should be equally incorporated into RISC. However, in reality, due to the bias described above, one strand is incorporated more than the other strand and used for the RNAi pathway.

In siRNA, the AU-rich region has loose base pairing, and the GC-rich region has strong base pairing. If the base pairing near the 5' end of siRNA is loose, it will bind to the MID domain of the AGO protein and function as a guide strand, but if the base pairing is strong, it will not be able to bind to the MID domain and will function as siRNA. I can't. In this way, the base pairing strength near the 5' end affects the frequency (probability) of binding to the MID domain, so if there is a difference in the pairing strength of the 5' ends of the sense strand and antisense strand, it will affect RISC. Differences also occur in uptake frequency, which is observed as strand bias. If the strand bias is biased toward the antisense strand, a strong gene expression suppression effect will be obtained, and if the strand bias is biased toward the sense strand, the gene expression suppression effect will be weak. Therefore, all existing siRNA design algorithms are programmed to consider strand bias and select sequences that are loosely paired on the 5' side of the antisense strand and tightly paired on the 3' side. .

By the way, it is known that when gene expression is suppressed by RNAi using siRNA or the like, a non-specific gene expression suppressing effect appears, which is called an off-target effect. Since such off-target effects cause unexpected suppression of gene expression, off-target effects are a major problem from the viewpoint of RNAi safety. In siRNA, if the strand bias is biased toward the sense strand, the off-target effect due to the sense strand will become stronger, which is undesirable.

SomaGenics connects the 3' end of the antisense strand and the 5' end of the sense strand via a loop consisting of short nucleotides (e.g., dTdT, dUdU) containing modified nucleotides at the 2' position, and We are developing synthetic short hairpin RNA (sshRNA) with reduced off-target effects due to strands (Patent Documents 1, 2, and 3).

However, (1) it has gene expression suppression activity equivalent to or higher than siRNA, (2) there is no off-target effect due to the sense strand, and (3) it is not constrained by the above strand bias rule and has a wider range of antisense There is still a need for the development of new nucleic acid molecules for suppressing target gene expression that enable the design of chain sequences (expanding the range of targetable sequences).

US Patent No. 9,816,091 US Patent No. 8,871,730 Special Publication No. 2012-505657

An object of the present invention is to provide a novel nucleic acid molecule that has the above-mentioned advantageous properties (1) to (3) and has target gene expression suppressing activity.

The present inventors have developed a single-stranded nucleic acid molecule in which an antisense strand and a sense strand are linked via a non-nucleotide linker near one end of a double-stranded nucleic acid molecule that has gene expression suppressing activity. In this RNA, L-form means that when siRNA linked through a loop structure is stretched into a single strand and arranged so that the 5' end is on the left and the 3' end is on the right, the antisense strand is in the loop. Refers to the structure located on the left side of the structure. On the other hand, in the R-type, when siRNA linked via a loop structure is stretched into a single strand and arranged so that the 5' end is on the left and the 3' end is on the right, the antisense strand is looped. Refers to the structure located on the right side of the structure. When L-type and R-type stem-loop RNAs were compared, the present inventors found that while L-type showed an excellent RNAi effect, R-type did not have such an effect.
In the process of developing a nucleic acid molecule having an L-type structure, the present inventors discovered that (i) the linkage of the antisense strand and the sense strand connects between 2' and 3' or between 2' and 5' of the sugar moiety of the nucleoside; L-shaped single-stranded nucleic acid molecule obtained by cross-linking, (ii) L-shaped single-stranded nucleic acid molecule using an alkyl chain with an amide bond inside as a linker, (iii) Direct link between nucleoside bases and (iv) 1' of the sugar moiety of the nucleoside is replaced with H, and the linkage of the antisense strand and the sense strand cross-links between the 2' and 2' of the sugar moieties of the nucleoside. The resulting L-type single-stranded nucleic acid molecule was synthesized, and its gene expression suppression activity was compared with siRNA consisting of the same antisense and sense strand sequences. As a result, the nucleic acid molecule also showed an activity equal to or higher than that of the corresponding siRNA. Furthermore, when we compared the off-target effect (expression suppression activity of a nucleic acid having a sequence complementary to the sense strand sequence) caused by the sense strand sequence between the nucleic acid molecule and siRNA, we found that siRNA has a strong sense strand suppression effect. In contrast, the gene expression suppressing activity due to the sense strand sequence was significantly reduced in the nucleic acid molecule, demonstrating that the off-target effect due to the sense strand can be significantly attenuated.
As a result of further studies based on these findings, the present inventors have completed the present invention.

That is, the present invention is as follows.
[1] General formula below:

[wherein X, Y, X ₁ , Y ₁ , X ₂ , Y ₂ are each independently an optionally modified ribonucleotide residue or an optionally modified deoxyribonucleotide residue,
T and Q are a sequence consisting of 14 to 30 consecutive optionally modified ribonucleotide residues complementary to the target nucleic acid sequence and a ribonucleotide sequence complementary thereto (one is complementary to the target nucleic acid sequence). If a sequence is complementary to one sequence, the other is a complementary sequence to it),
Z is a linker that connects the 2' or 5' position of the sugar moiety of (X) and the 2' or 3' position of the sugar moiety of (Y), or the base moiety of (X) and (Y) It is a linker that connects the base part of
m ₁ and m ₂ are each independently an integer of 0 to 5;
n ₁ and n ₂ are each independently an integer of 0 to 5]
Nucleic acid molecule shown as .
[2] The nucleic acid according to [1], wherein the linker Z is a non-nucleotide structure having an alkyl chain having an amide bond inside, or a structure that connects the base moiety of (X) and the base moiety of (Y). molecule.
[3] In the formula, the following including linker Z

The nucleic acid molecule according to [1] or [2], wherein the structure is selected from [Formula 1], [Formula 2], [Formula 3], or [Formula 4].

or

[In the formula, B and B' are each independently an atomic group having a nucleobase skeleton,
A ₁ and A ₁ ' are each independently -O-, -NR ^1a -, -S- or -CR ^1a R ^1b - (here, R ^1a and R ^1b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₂ and A ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₃ and A ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₄ and A ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms) , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
A ₅ and A ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₆ and A ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group; n is an integer from 1 to 6),
W ₁ is -(CR ¹ R ² )n-, -CO-, -(CR ¹ R ² )n-COO-(CR ¹ R ² )n-COO-(CR ¹ R ² )n, -(CR ¹ R ² ) n-O-(CR ¹ R ² CR ¹ R ² O) n-CH ₂ -, -(CR ¹ R ² ) n-ring D-(CR ¹ R ² ) n- or -(CR ¹ R ² )n-SS-(CR ¹ R ² )n- (wherein, ring D is an aryl group having 6 to 10 carbon atoms, a heteroaryl group having 2 to 10 carbon atoms, or a heteroaryl group having 4 to 10 carbon atoms. It is a cycloalkyl group or a heterocycloalkyl group having 4 to 10 carbon atoms; R ¹ and R ² are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms; n is an integer of 1 to 6; be),
E ₂ and E ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom). or an alkyl group having 1 to 10 carbon atoms),
E ₃ and E ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₄ and E ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms); , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
E ₅ and E ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₆ and E ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group: n is an integer from 1 to 6)].
[4] In the formula, the following including linker Z

The structure of [Formula 1]

The nucleic acid molecule according to any one of [1] to [3], which is [wherein the definitions of each symbol are the same as above].
[5] In the formula, the following including linker Z

The structure of [Formula 2]

or [Formula 3]

The nucleic acid molecule according to any one of [1] to [3], which is [wherein the definitions of each symbol are the same as above].
[6] In the formula, the following including linker Z

The structure of [Formula 4]

The nucleic acid molecule according to any one of [1] to [3], wherein the definition of each symbol is the same as above.

[7] In the formula, the following including linker Z

The structure of [Formula 5]

or [Formula 6]

The nucleic acid molecule according to [1] or [2] selected from [1] or [2].
[8] The nucleic acid molecule according to [1] to [7], which contains at least one modified nucleotide.
[9] The modified nucleotide may be a 2'-O-methyl modified nucleotide, a 2'-deoxy-nucleotide, a 2'-fluoro modified nucleotide, a nucleotide bound to a lipid molecule such as a cholesteryl derivative, a nucleotide bound to a peptide molecule, or a fixed nucleotide. , non-fixed nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, non-basic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides Nucleotides, 2'-hydroxyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinonucleotides, phosphoroamidates, nucleotides containing unnatural bases, tetrahydropyran-modified nucleotides, 1, From the group consisting of 5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing a phosphorothioate group, nucleotides containing a methylphosphonate group, nucleotides containing a 5'-phosphate, and nucleotides containing a 5'-phosphate mimetic. The nucleic acid molecule according to any one of [1] to [8], which is selected.
[10] A medicament comprising the nucleic acid molecule according to any one of [1] to [9].
[11] An expression inhibitor of a target gene, comprising the nucleic acid molecule according to any one of [1] to [9], wherein the target gene contains the target nucleic acid sequence. .
[12] A therapeutic agent for cancer or fibrosis, comprising the expression inhibitor according to [11].
[13] A method for suppressing expression of a target gene, comprising:
A method comprising bringing an effective amount of the nucleic acid molecule according to any one of [1] to [9] into contact with a target gene.
[14] A method for treating cancer or fibrosis, which comprises bringing an effective amount of the nucleic acid molecule according to any one of [1] to [9] into contact with a target gene.
[15] The method according to [13] or [14], which includes the step of administering the nucleic acid molecule to cells, tissues, or organs.
[16] The method according to any one of [13] to [15], wherein the nucleic acid molecule is administered in vivo or in vitro.
[17] The method according to any one of [13] to [16], wherein the nucleic acid molecule is administered to a non-human animal.

According to the nucleic acid molecule of the present invention, the effect of suppressing gene expression by an antisense strand can be obtained with an efficiency equal to or higher than that of an siRNA molecule. The nucleic acid molecules of the invention have minimized off-target effects due to the sense strand and are safer than siRNA molecules. Furthermore, the crosslinked nucleic acid molecules of the invention are not bound by strand bias rules.

FIG. 1-1 is an AEX-HPLC chart of Example 1-1 after purification. FIG. 1-2 is an AEX-HPLC chart of Example 1-2 after purification. FIG. 1-3 is an AEX-HPLC chart of Example 1-3 after purification. FIG. 1-4 is an AEX-HPLC chart of Example 1-4 after purification. FIG. 1-5 is an RP-HPLC chart of Example 1-5 after purification. FIG. 1-6 is an RP-HPLC chart of Example 1-11 after purification. FIG. 2-1 is an RP-HPLC chart of Example 2-1 after purification. FIG. 2-2 is an RP-HPLC chart of Example 2-2 after purification. FIG. 2-3 is an RP-HPLC chart of Example 2-3 after purification. FIG. 2-4 is an RP-HPLC chart of Example 2-4 after purification. FIG. 3-1 is an RP-HPLC chart of Example 3-1 after purification. FIG. 3-2 is an RP-HPLC chart of Example 3-2 after purification. FIG. 3-3 is an RP-HPLC chart of Example 3-3 after purification. FIG. 3-4 is an RP-HPLC chart of Example 3-4 after purification. FIG. 4-1 is an RP-HPLC chart of Example 4-1 after purification. FIG. 4-2 is an RP-HPLC chart of Example 4-2 after purification. FIG. 5-1 is an RP-HPLC chart of Example 5-1 after the reaction. FIG. 5-2 is an RP-HPLC chart of Example 5-2 after the reaction. FIG. 5-3 is an RP-HPLC chart of Example 5-3 after the reaction. FIG. 5-4 is an RP-HPLC chart of Example 5-4 after the reaction. FIG. 5-5 is an RP-HPLC chart of Example 5-4 after purification. FIG. 5-6 is an RP-HPLC chart of Example 5-4 after purification. FIG. 5-7 is an RP-HPLC chart of Example 5-4 after purification. FIG. 5-8 is an RP-HPLC chart of Example 5-4 after purification. FIG. 6 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-1 to 1-5 were transfected at a final concentration of 1 nM. FIG. 7 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-6 to 1-10 were transfected at a final concentration of 1 nM. FIG. 8 is a graph showing the NEK6 gene expression level when transfected with the nucleic acid molecule of Example 1-15 at a final concentration of 1 nM. FIG. 9 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-31 to 1-34 were transfected at a final concentration of 1 nM. FIG. 10 is a graph showing the GAPDH gene expression level when the nucleic acid molecules of Examples 1-35 to 1-38 were transfected at a final concentration of 1 nM. FIG. 11 is a graph showing the NEK6 gene expression level when the nucleic acid molecules of Examples 2-1, 2-2, 3-1, and 3-2 were transfected at a final concentration of 10 nM. FIG. 12 is a graph showing the GAPDH gene expression level when the nucleic acid molecules of Examples 2-3, 2-4, 3-3, and 3-4 were transfected at a final concentration of 10 nM. FIG. 13 is a graph showing the NEK6 gene expression level when the nucleic acid molecules of Examples 4-1 and 4-2 were transfected at a final concentration of 10 nM. FIG. 14 is a graph showing the NEK6 gene expression level when transfected with the nucleic acid molecule of Example 5-4 at a final concentration of 1 nM. Figure 15 shows each nucleic acid molecule (Examples 5-4, 1-11, 1-12, 1-13, 1-14) with the expression level in control (mock) cells measured by RT-PCR as 1. It is a graph showing the relative value of NEK6 gene expression level in cells transfected with. Figure 16 shows hRluc containing the target sequence of the antisense strand in cells transfected with each nucleic acid (siRNA, Example 1-11 (L type), Example 1-11 R type) as measured by a reporter assay system. It is a graph showing the expression level of a gene. Figure 17 shows the hRluc gene containing the target sequence of the sense strand in cells transfected with each nucleic acid (siRNA, Example 1-11 (L type), Example 1-11 R type) as measured by a reporter assay system. It is a graph showing the expression level of. FIG. 18 is a diagram showing the R-type structure of Example 1-11. FIG. 19 is a graph showing the expression level of the hRluc gene containing the target sequence of the sense strand in cells transfected with each nucleic acid (Example 2-1, Example 3-1), as measured by a reporter assay system.

(I) Nucleic acid molecule of the present invention The present invention relates to the following general formula:

[wherein X, Y, X ₁ , Y ₁ , X ₂ , Y ₂ are each independently an optionally modified ribonucleotide residue or an optionally modified deoxyribonucleotide residue,
T and Q are a sequence consisting of 14 to 30 consecutive optionally modified ribonucleotide residues complementary to the target nucleic acid sequence and a ribonucleotide sequence complementary thereto (one is complementary to the target nucleic acid sequence). If a sequence is complementary to one sequence, the other is a complementary sequence to it),
Z is a linker that connects the 2' or 5' position of the sugar moiety of (X) and the 2' or 3' position of the sugar moiety of (Y), or a linker that connects the base moiety of (X) and the 2' or 3' position of the sugar moiety of (Y). It is a linker that connects the base part,
m ₁ and m ₂ are each independently an integer of 0 to 5;
n ₁ and n ₂ are each independently an integer of 0 to 5]
A nucleic acid molecule represented by
I will provide a.

In this specification, a ribonucleotide sequence complementary to a target nucleic acid sequence is also referred to simply as an "antisense strand sequence" because it has an "antisense" relationship when the target nucleic acid sequence is "sense." On the other hand, the ribonucleotide sequence complementary to the antisense strand sequence is also referred to simply as the "sense strand sequence" because it has a homologous relationship with the target nucleic acid sequence.

In the above formula, when Q or (X)-(Q) is a sense strand sequence, the sense strand is (X ₁ ) _m1 -(X)-(Q)-(X ₂ ) _m2 , and (Y ₁ ) The antisense strand, _n1 -(Y)-(T)-(Y ₂ ) _n2 , is bridged by a linker, Z. If Q or (X)-(Q) is an antisense strand sequence, then the antisense strand is (X ₁ ) _m1 -(X)-(Q)-(X ₂ ) _m2 and (Y ₁ ) _n1 -( The sense strand, which is Y)-(T)-(Y ₂ ) _n2, is cross-linked by Z. The present invention provides such a nucleic acid molecule in which a sense strand and an antisense strand are crosslinked. Preferably (Q) or (X)-(Q) is the sense strand sequence and (T) or (Y)-(T) is the antisense strand sequence.

In one embodiment, the nucleic acid molecules of the invention feature a ribonucleotide residue adjacent to the sense strand sequence (Q), the 2' position or 5 of the sugar moiety of (X), where Q is a sense strand sequence. ' position and the 2' or 3' position of the sugar moiety of (Y), which is a ribonucleotide residue adjacent to the antisense strand sequence (T), are connected by a linker Z; In the case of an antisense strand sequence, the 2' or 5' position of the sugar moiety of (X), which is a ribonucleotide residue adjacent to the antisense strand sequence (Q), and the ribonucleotide residue adjacent to the sense strand sequence (T). The point is that the 2' or 3' position of the sugar moiety of (Y), which is a nucleotide residue, is connected by a linker Z.
In addition, when (X)-(Q) is a sense strand sequence, the 2' or 5' position of the sugar moiety of (X) in the sense strand sequence (X)-(Q) and the antisense strand sequence (Y )-(T) in that the 2' or 3' position of the sugar moiety of (Y) is linked by a linker Z; when (X)-(Q) is an antisense strand sequence, The 2' or 5' position of the sugar moiety of (X) in the antisense strand sequence (X)-(Q), and the 2' or 5' position of the sugar moiety of (Y) in the sense strand sequence (Y)-(T). The 3' position is connected by a linker Z.

In another embodiment, the nucleic acid molecule of the invention features a base moiety (X) that is a ribonucleotide residue adjacent to the sense strand sequence (Q), when Q is a sense strand sequence; The base portion of (Y), which is a ribonucleotide residue adjacent to the strand sequence (T), is connected by a linker Z; when Q is an antisense strand sequence, the antisense strand sequence ( The base portion of (X), which is a ribonucleotide residue adjacent to Q), and the base portion of (Y), which is a ribonucleotide residue adjacent to the sense strand sequence (T), are connected by a linker Z. That's the point.
In addition, when (X)-(Q) is a sense strand sequence, the (X) base part of the sense strand sequence (X)-(Q) and the (Y) base part of the antisense strand sequence (Y)-(T) ) are connected by a linker Z; when (X)-(Q) is an antisense strand sequence, (X) of the antisense strand sequence (X)-(Q) and the base portion of (Y) in the sense strand sequence (Y)-(T) are linked by a linker Z.
Here, the base portion refers to a site on the ribonucleotide structure that can be substituted with a base, and may or may not have a base. Preferably, both ribonucleotides to be linked have a base in the base portion.

The strand bias rule in the present invention is that in the case of siRNA, the strand bias is biased toward strands with loose base pairing (i.e., AU-rich) with the 5' end; therefore, in conventional siRNA design, the antisense strand This shows that the siRNA sequence was selected so that the 5' end of the sequence was AU-rich and the 3' end was GC-rich. However, in the nucleic acid molecule of the present invention, by crosslinking the sense strand with the antisense strand, a wide range of sequences including not only sequences that meet the above conditions but also sequences that do not meet the conditions can be selected as targets. It becomes possible. In addition, in conventional siRNA design, the sense strand sequence may be retained in RISC and exhibit off-target effects, so siRNA sequences in which genes other than the target gene include sequences complementary to the sense strand sequence are used. However, in the case of the nucleic acid molecule of the present invention, off-target effects caused by the sense strand are highly suppressed, which further widens the range of sequences that can be selected as target sequences.

The "antisense strand sequence" in the nucleic acid molecule of the present invention may be any ribonucleotide sequence as long as it is complementary to any target nucleic acid sequence. Here, the term "complementary sequence" refers not only to a sequence that is completely complementary to the target nucleic acid sequence (that is, hybridizes without mismatch), but also to a sequence that is compatible with the target sequence under physiological conditions in mammalian cells, for example. The sequence may contain a mismatch of one or several nucleotides, preferably one or two nucleotides, as long as it can hybridize with the containing nucleic acid. Examples include sequences that have an identity of 90% or more, preferably 95% or more, 97% or more, 98% or more, 99% or more to a completely complementary strand sequence of a target nucleic acid sequence in a target gene. "Nucleotide sequence identity" in the present invention is determined using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expected value = 10; allow gaps; filtering = ON; Match score = 1; mismatch score = -3). Furthermore, the complementarity of individual bases is not limited to forming Watson-Crick type base pairs with the target base, but also forming Hoogsteen type base pairs and Wobble base pairs. Also includes doing.

Alternatively, a "complementary sequence" is a nucleotide sequence that hybridizes under stringent conditions to a target nucleic acid sequence. Here, "stringent conditions" refer to, for example, the conditions described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, such as 6×SSC (sodium chloride/sodium citrate )/45°C, followed by one or more washes at 0.2×SSC/0.1% SDS/50-65°C, etc., but those skilled in the art will be able to use hybridization methods that provide equivalent stringency. The conditions for hybridization can be selected as appropriate.

The "sense strand sequence" and "antisense strand sequence" in the nucleic acid molecule of the present invention are preferably complementary sequences, but may also be sequences containing a mismatch of 1 to several nucleotides, preferably 1 or 2 nucleotides. Here, the term "complementary sequence" has the same meaning as described above regarding the complementarity of an antisense sequence to a target nucleic acid sequence.

The lengths of the antisense strand sequence and the sense strand sequence are not particularly limited as long as they can specifically hybridize with the target nucleic acid sequence and suppress the expression of the gene containing the target nucleic acid sequence. They may be the same or different. Their length can be, for example, 14-30 nucleotides, preferably 15-27 nucleotides, more preferably 16-23 nucleotides, even more preferably 19-23 nucleotides. The length of the antisense strand sequence is preferably 19-23 nucleotides, more preferably 21-23 nucleotides. The length of the sense strand sequence is preferably 17 to 23 nucleotides, more preferably 19 to 23 nucleotides.

Furthermore, the antisense strand and the sense strand have (X ₁ ) _m1 , (X ₂ ) _m2 , (Y ₁ ) _n1 , and (Y ₂ ) may have _n2 . As an example, if the sense strand sequence is (Q) and the antisense strand sequence is (T), the number (m1) of ribonucleotide residues (X ₁ ) added to the end of the sense strand sequence (Q) and (X ₂ ) number (m2) is 0 to 5, and the number (n1) of ribonucleotide residues (Y ₁ ) added to the end of the antisense strand sequence (T) and the number (n2) of (Y ₂ ) There are also 0 to 5 pieces. In a preferred embodiment, the nucleic acid molecules correspond to the compounds prepared in the examples below, where m1 = 0, m2 = 0 or 2, n ¹ = 1 and n ² = 0, respectively. It is.

The structural unit of the nucleic acid molecule of the present invention includes ribonucleotide residues. These nucleotide residues may be, for example, modified or unmodified (the modification includes the substitution of a hydrogen atom for the OH group at the 2' position, so that (Deoxyribonucleotide residues may also be included as constitutional units. In this case, they are expressed as ribonucleotide residues or deoxyribonucleotide residues.) Therefore, in the following description of modified ribonucleotide residues, they will simply be referred to as "nucleotide residues." (sometimes referred to as "base"). The nucleic acid molecules of the present invention can have improved nuclease resistance and improved stability, for example, by including modified ribonucleotide residues. Further, the nucleic acid molecule of the present invention may further contain non-nucleotide residues in addition to the above-mentioned nucleotide residues, for example.

In the nucleic acid molecule of the present invention, the constituent units of the region other than the linker (Z) are preferably nucleotide residues. Each region is composed of, for example, the following residues (1) to (3).
(1) Unmodified nucleotide residues (2) Modified nucleotide residues (3) Unmodified and modified nucleotide residues

In the nucleic acid molecule of the present invention, the linker (Z) preferably has a non-nucleotide structure, and more preferably has an alkyl chain having an amide bond inside.

In a preferred embodiment, in the nucleic acid molecule of the present invention

The structure of

or

It is.
In the above formula,
B and B' are each independently an atomic group having a nucleobase skeleton,
A ₁ and A ₁ ' are each independently -O-, -NR ^1a -, -S- or -CR ^1a R ^1b - (here, R ^1a and R ^1b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₂ and A ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₃ and A ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₄ and A ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms) , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
A ₅ and A ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₆ and A ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group; n is an integer from 1 to 6),
W ₁ is -(CR ¹ R ² )n-, -CO-, -(CR ¹ R ² )n-COO-(CR ¹ R ² )n-COO-(CR ¹ R ² )n, -(CR ¹ R ² ) n-O-(CR ¹ R ² CR ¹ R ² O) n-CH ₂ -, -(CR ¹ R ² ) n-ring D-(CR ¹ R ² ) n- or -(CR ¹ R ² )n-SS-(CR ¹ R ² )n- (wherein, ring D is an aryl group having 6 to 10 carbon atoms, a heteroaryl group having 2 to 10 carbon atoms, or a heteroaryl group having 4 to 10 carbon atoms. It is a cycloalkyl group or a heterocycloalkyl group having 4 to 10 carbon atoms; R ¹ and R ² are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms; n is an integer of 1 to 6; be),
E ₂ and E ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₃ and E ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₄ and E ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms); , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
E ₅ and E ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₆ and E ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group: n is an integer from 1 to 6).

In the above formula, "alkyl group having 1 to 10 carbon atoms", "aryl group having 6 to 10 carbon atoms", "heteroaryl group having 2 to 10 carbon atoms", "cycloalkyl group having 4 to 10 carbon atoms", and The "heterocycloalkyl group having 4 to 10 carbon atoms" may be substituted at a substitutable position, and examples of the substituent include those described in Substituent Group A below.

The terms and symbols used in the present invention are defined below.

Examples of "alkyl groups having 1 to 10 carbon atoms" include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl etc., preferably C _1-6 alkyl groups (e.g., methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 1-ethylpropyl, hexyl, isohexyl). , 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2-ethylbutyl). Examples of the "aryl group having 6 to 10 carbon atoms" include phenyl group, tolyl group, xylyl group, and naphthyl group.

"Protecting groups for amino groups" specifically include amide groups such as acetyl, trichloroacetyl, trifluoroacetyl, benzoyl, and N-phthalimide, and carbamate groups such as 9-fluoronylmethoxycarbonyl and t-butoxycarbonyl. can be mentioned.

"Hydroxyl group-protecting group" means a general hydroxyl-protecting group known to those skilled in the art that is introduced to prevent the reaction of hydroxyl groups; for example, Protective Groups in Organic Synthesis, published by John Wiley and Sons ( 1980), specifically, acyl protecting groups such as acetyl and benzoyl, alkyl protecting groups such as trityl, 4-methoxytrityl, 4,4'-dimethoxytrityl, and benzyl, and trimethylsilyl. , tert-butyldimethylsilyl, tert-butyldiphenylsilyl and the like.

"Electron-withdrawing group" refers to a group that attracts electrons more easily from the bonded atom side than a hydrogen atom, and specifically includes cyano, nitro, alkylsulfonyl (e.g., methylsulfonyl, ethylsulfonyl), halogen ( Examples include fluorine atom, chlorine atom, bromine atom, or iodine atom), arylsulfonyl (eg, phenylsulfonyl, naphthylsulfonyl), trihalomethyl (eg, trichloromethyl, trifluoromethyl), and the like.

Examples of "halogen" include fluorine atom, chlorine atom, bromine atom, and iodine atom.

"Alkyl group" means a straight or branched alkyl group having 1 to 30 carbon atoms, preferably 1 to 12 carbon atoms, more preferably 1 to 6 carbon atoms, particularly preferably 1 to 4 carbon atoms, and specifically, methyl , ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl , nonadecyl, icosyl and the like. Preferred examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl and the like.

"Alkenyl group" means a linear or branched alkenyl group having 2 to 30 carbon atoms, preferably 2 to 12 carbon atoms, more preferably 2 to 8 carbon atoms, and the alkyl group has one or more double bonds. Examples include those that have. Specific examples include vinyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1,3-butadienyl, 3-methyl-2-butenyl, and the like.

"Alkynyl group" means a linear or branched alkynyl group having 2 to 30 carbon atoms, preferably 2 to 12 carbon atoms, more preferably 2 to 8 carbon atoms, and the alkyl group has one or more triple bonds. Examples include things. Specific examples include ethynyl, propynyl, propargyl, butynyl, pentynyl, hexynyl, and the like. The alkynyl group may further have one or more double bonds.

"Alkoxy group" means a straight or branched alkoxy group having 1 to 30 carbon atoms, preferably 1 to 12 carbon atoms, more preferably 1 to 6 carbon atoms, particularly preferably 1 to 4 carbon atoms, and specifically, methoxy , ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentyloxy, tert-pentyloxy, neopentyloxy, 2-pentyloxy, 3-pentyl Oxy, n-hexyloxy, 2-hexyloxy, and the like.

"Aryl group" means an aryl group having 6 to 24 carbon atoms, preferably 6 to 10 carbon atoms, and includes monocyclic aromatic hydrocarbon groups such as phenyl, 1-naphthyl, 2-naphthyl, 1-anthryl, 2- Examples include polycyclic aromatic hydrocarbon groups such as anthryl, 9-anthryl, 1-phenanthryl, 2-phenanthryl, 3-phenanthryl, 4-phenanthryl, and 9-phenanthryl. Examples of the "aryl group having 6 to 10 carbon atoms" include those having 6 to 10 carbon atoms among the above-mentioned aryl groups, and specific examples thereof include phenyl, naphthyl, and the like.

"Heterocycloalkyl group" means a hecycloalkyl group having 6 to 24 carbon atoms, preferably 6 to 10 carbon atoms. Examples of the heterocycloalkyl group include those in which one or more carbon atoms forming the cyclic structure of the cycloalkyl group described below are substituted with a nitrogen atom, an oxygen atom, a sulfur atom, or the like. Specific examples include [1,3]dioxolanyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and tetrahydrofuryl. . Examples of the "heterocycloalkyl group having 4 to 10 carbon atoms" include those having 4 to 10 carbon atoms among the above heterocycloalkyl groups, and specifically, pyrrolidinyl, piperidyl, piperazyl, morpholyl, oxetanyl, and tetrahydrofuryl. , tetrahydropyranyl, thioxetanyl, tetrahydrothienyl, and tetrahydrothiopyranyl groups.

The term "aralkyl group" refers to an aralkyl group having 7 to 30 carbon atoms, preferably 7 to 11 carbon atoms, and specific examples include benzyl, 2-phenethyl, and naphthalenylmethyl.

"Cycloalkyl group" means a cycloalkyl group having 3 to 24 carbon atoms, preferably 3 to 15 carbon atoms, and specifically includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and bridged ring. Examples thereof include formula hydrocarbon groups, spiro hydrocarbon groups, etc., and preferred examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and bridged cyclic hydrocarbon groups. Examples of the "bridged cyclic hydrocarbon group" include bicyclo[2.1.0]pentyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.2]octyl, and bicyclo[3.2.1] Examples include octyl, tricyclo[2.2.1.0]heptyl, bicyclo[3.3.1]nonyl, 1-adamantyl, 2-adamantyl, and the like. Examples of the "spiro hydrocarbon group" include spiro[3.4]octyl and the like. Examples of the "cycloalkyl group having 4 to 10 carbon atoms" include those having 4 to 10 carbon atoms among the above cycloalkyl groups, specifically cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, etc. Can be mentioned.

"Cycloalkenyl group" means a cycloalkenyl group having 3 to 24 carbon atoms, preferably 3 to 7 carbon atoms, containing at least 1, preferably 1 or 2 double bonds, and specifically, cyclopropenyl , cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl and the like. The cycloalkenyl group also includes bridged cyclic hydrocarbon groups and spirohydrocarbon groups having an unsaturated bond in the ring. Examples of "bridged cyclic hydrocarbon group having an unsaturated bond in the ring" include bicyclo[2.2.2]octenyl, bicyclo[3.2.1]octenyl, tricyclo[2.2.1.0] Examples include heptenyl. Examples of the "spiro hydrocarbon group having an unsaturated bond in the ring" include spiro[3.4]octenyl and the like.

"Cycloalkylalkyl group" means an alkyl group (described above) substituted with the cycloalkyl group, preferably a cycloalkylalkyl group having 4 to 30 carbon atoms, more preferably 4 to 11 carbon atoms. Specific examples include cyclopropylmethyl, 2-cyclobutylethyl, cyclopentylmethyl, 3-cyclopentylpropyl, cyclohexylmethyl, 2-cyclohexylethyl, and cycloheptylmethyl.

"Alkoxyalkyl group" means an alkyl group (described above) substituted with the alkoxy group, preferably a straight or branched alkoxyalkyl group having 2 to 30 carbon atoms, more preferably 2 to 12 carbon atoms. . Specific examples include methoxymethyl, methoxyethyl, ethoxymethyl, ethoxyethyl and t-butoxymethyl.

"Alkylene group" means a straight or branched alkylene group having 1 to 30 carbon atoms, preferably 1 to 12 carbon atoms, more preferably 1 to 6 carbon atoms, particularly preferably 1 to 4 carbon atoms, and specifically, methylene , ethylene, and propylene.

A "heteroaryl group" includes, for example, a monocyclic aromatic heterocyclic group and a fused aromatic heterocyclic group. The heteroaryl is, for example, furyl (e.g. 2-furyl, 3-furyl), thienyl (e.g. 2-thienyl, 3-thienyl), pyrrolyl (e.g. 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl), imidazolyl (e.g. 1-imidazolyl, 2-imidazolyl, 4-imidazolyl), pyrazolyl (e.g. 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), triazolyl (e.g. 1,2,4-triazol-1-yl), 1,2,4-triazol-3-yl, 1,2,4-triazol-4-yl), tetrazolyl (e.g. 1-tetrazolyl, 2-tetrazolyl, 5-tetrazolyl), oxazolyl (e.g. 2-oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyl (e.g. 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl), thiazolyl (e.g. 2-thiazolyl, 4-thiazolyl, 5-thiazolyl), thiadiazolyl, isothiazolyl (e.g. 3) -isothiazolyl, 4-isothiazolyl, 5-isothiazolyl), pyridyl (e.g. 2-pyridyl, 3-pyridyl, 4-pyridyl), pyridazinyl (e.g. 3-pyridazinyl, 4-pyridazinyl), pyrimidinyl (e.g. 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl), furazanyl (e.g. 3-furazanyl), pyrazinyl (e.g. 2-pyrazinyl), oxadiazolyl (e.g. 1,3,4-oxadiazol-2-yl), benzofuryl (e.g. 2-benzo[b]furyl, 3-benzo[b]furyl, 4-benzo[b]furyl, 5-benzo[b]furyl, 6-benzo[b]furyl, 7-benzo[b]furyl), benzo Thienyl (e.g. 2-benzo[b]thienyl, 3-benzo[b]thienyl, 4-benzo[b]thienyl, 5-benzo[b]thienyl, 6-benzo[b]thienyl, 7-benzo[b] thienyl), benzimidazolyl (e.g. 1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazolyl), dibenzofuryl, benzoxazolyl, benzothiazolyl, quinoxalinyl (e.g. 2-quinoxalinyl, 5-quinoxalinyl, 6-quinoxalinyl), cinnolinyl (e.g. 3-cinnolinyl, 4-cinnolinyl, 5-cinnolinyl, 6-cinnolinyl, 7-cinnolinyl, 8-cinnolinyl), quinazolinyl (e.g. 2-quinazolinyl, 4-quinazolinyl, 5-quinazolinyl, 6-quinazolinyl, 7-quinazolinyl, 8-quinazolinyl), quinolyl (e.g. 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl), phthalazinyl (e.g. 1-phthalazinyl, 5-phthalazinyl, 6-phthalazinyl), isoquinolyl (e.g. 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), prill, pteridinyl ( Examples: 2-pteridinyl, 4-pteridinyl, 6-pteridinyl, 7-pteridinyl), carbazolyl, phenanthridinyl, acridinyl (examples: 1-acridinyl, 2-acridinyl, 3-acridinyl, 4-acridinyl, 9-acridinyl) , indolyl (e.g. 1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), isoindolyl, phenazinyl (e.g. 1-phenazinyl, 2-phenazinyl) or pheno Examples include thiazinyl (eg, 1-phenothiazinyl, 2-phenothiazinyl, 3-phenothiazinyl, 4-phenothiazinyl), and the like.
Examples of the "heteroaryl group having 2 to 10 carbon atoms" include those having 2 to 10 carbon atoms among the above heteroaryl groups, specifically furyl, thienyl, pyrrolyl, oxazolyl, and triazolyl groups. , pyridyl group, quinolinyl group, etc.

In the present invention, examples of the "substituent" include those described in Substituent Group A below.
Substituent group A
(1) Halogen (fluorine atom, chlorine atom, bromine atom or iodine atom);
(2) alkyl group (described above);
(3) alkoxy group (described above);
(4) alkenyl group (described above);
(5) alkynyl group (described above);
(6) haloalkyl group (e.g., chloromethyl, fluoromethyl, dichloromethyl, difluoromethyl, dichlorofluoromethyl, trifluoromethyl, pentafluoroethyl, etc.);
(7) Aryl group (described above);
(8) heteroaryl group (described above);
(9) Aralkyl group (described above)
(10) cycloalkyl group (described above);
(11) cycloalkenyl group (described above);
(12) cycloalkylalkyl group (described above);
(13) cycloalkenylalkyl group (e.g., cyclopentenylethyl, cyclohexenylethyl, cyclohexenylbutyl, etc.);
(14) hydroxyalkyl group (e.g., hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxybutyl, etc.);
(15) alkoxyalkyl group (described above);
(16) aminoalkyl group (e.g., aminomethyl, aminoethyl, aminopropyl, etc.);
(17) Heterocyclyl group (e.g., 1-pyrrolinyl, 2-pyrrolinyl, 3-pyrrolinyl, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, pyrrolidinonyl, 1-imidazolinyl, 2-imidazolinyl, 4-imidazolinyl, 1-imidazolidinyl, 2-imidazolidinyl, 4-imidazolidinyl, imidazolidinonyl, 1-pyrazolinyl, 3-pyrazolinyl, 4-pyrazolinyl, 1-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidinonyl, piperidino, 2-piperidinyl, 3-piperidinyl, 4- piperidinyl, 1-piperazinyl, 2-piperazinyl, piperazinonyl, 2-morpholinyl, 3-morpholinyl, morpholino, tetrahydropyranyl, tetrahydrofuranyl, etc.);
(18) heterocyclylalkenyl group (e.g., 2-piperidinylethenyl, etc.);
(19) heterocyclylalkyl group (e.g., piperidinylmethyl, piperazinylmethyl, etc.);
(20) heteroarylalkyl group (e.g., pyridylmethyl, quinolin-3-ylmethyl, etc.);
(21) Silyl group;
(22) Silyloxyalkyl group (e.g., silyloxymethyl, silyloxyethyl, etc.)
(23) mono-di- or trialkylsilyl groups (eg, methylsilyl, ethylsilyl, etc.); and (24) mono-, di- or trialkylsilyloxyalkyl groups (eg, trimethylsilyloxymethyl, etc.).

"Atom group having a nucleobase skeleton" means a functional group having a nucleobase skeleton in all or part of its structure. Here, the "nucleobase skeleton" may be a natural nucleobase skeleton or an artificial nucleobase skeleton, but is preferably a natural nucleobase skeleton.
The natural nucleobases include adenine, cytosine, guanine, uracil, thymine, or other nitrogen-containing aromatic rings (e.g., 5-alkylpyrimidine, 5-halogenopyrimidine, deazapurine, deazapyrimidine, azapurine, azapyrimidine). It is more preferable. It may be synonymous with "base" in the nucleotide residue described below.

The nucleic acid molecule of the present invention may be labeled with a labeling substance, for example. The labeling substance is not particularly limited, and examples thereof include fluorescent substances, dyes, isotopes, and the like. Examples of the labeling substance include fluorophores such as pyrene, TAMRA, fluorescein, Cy3 dye, and Cy5 dye, and examples of the dye include Alexa dyes such as Alexa488. Examples of isotopes include stable isotopes and radioactive isotopes. Stable isotopes, for example, have less risk of exposure and do not require dedicated facilities, making them easier to handle and reducing costs. Furthermore, stable isotopes do not change the physical properties of the labeled compound, and have excellent properties as tracers. Examples of stable isotopes include ^2H , ^13C , ^15N , ^17O , ^18O , ^33S , ^34S and ^36S .

Nucleotide residues include sugars, bases and phosphates as constituents. Ribonucleotide residues have ribose residues as sugars and adenine (A), guanine (G), cytosine (C) and uracil (U) (which can also be replaced by thymine (T)) as bases. However, deoxyribonucleotide residues have deoxyribose residues as sugars and can also be replaced by adenine (dA), guanine (dG), cytosine (dC) and thymine (dT) (uracil (dU)) as bases. ).

A modified nucleotide residue may have any component of the nucleotide residue modified. In the present invention, "modification" may be, for example, substitution, addition, and/or elimination of the aforementioned constituent elements, substitution, addition, and/or elimination of atoms and/or functional groups in the aforementioned constituent elements. The modified nucleotide residue may be, for example, a naturally occurring modified nucleotide residue or an artificially modified nucleotide residue. For naturally occurring modified nucleotide residues, see, for example, Limbach et al. (1994, Summary: the modified nucleosides of RNA, Nucleic Acids Res. 22:2183-2196).

Examples of modification of nucleotide residues include modification of ribose-phosphate skeleton (hereinafter referred to as ribophosphate skeleton).

In the riboric acid skeleton, for example, a ribose residue can be modified. The ribose residue can, for example, modify the 2'-position carbon, and specifically, for example, modify the hydroxyl group bonded to the 2'-position carbon with a hydrogen atom, a halogen atom such as fluorine, or an -O-alkyl group (e.g., -O-Me group), -O-acyl group (e.g. -O-COMe group) and amino group, preferably selected from the group consisting of hydrogen atom, methoxy group and fluorine atom can be substituted with an atom or group. By replacing the hydroxyl group at the 2'-position carbon with hydrogen, the ribose residue can be replaced with deoxyribose. The ribose residue can be substituted, for example, with a stereoisomer, for example, with an arabinose residue.

The ribophosphate backbone may be replaced, for example, by a non-ribophosphate backbone with a non-ribose residue and/or a non-phosphate. Examples of the non-ribophosphoric acid skeleton include uncharged riboric acid skeletons. Examples of substitutes for nucleotides substituted with non-ribophosphate backbones include morpholino, cyclobutyl, pyrrolidinyl, and the like. Other examples of the above-mentioned substitutes include, for example, artificial nucleic acid monomer residues. Specific examples include PNA (peptide nucleic acid), LNA (Locked Nucleic Acid), and ENA (2'-O,4'-C-Ethylenebridged Nucleic Acid), with PNA being preferred.

In the ribophosphate skeleton, the phosphate group can also be modified. In the ribophosphate backbone, the phosphate group closest to the sugar residue is called the alpha phosphate group. The alpha phosphate group is negatively charged, and its charge is evenly distributed over the two oxygen atoms that are not attached to the sugar residue. Among the four oxygen atoms in the α-phosphate group, the two oxygen atoms that are not bonded to sugar residues in the phosphodiester bond between nucleotide residues are hereinafter also referred to as "non-linking oxygen". . On the other hand, two oxygen atoms bonded to a sugar residue in a phosphodiester bond between nucleotide residues are hereinafter referred to as "linking oxygen." The α-phosphate group is preferably modified, for example, to become uncharged or to have an asymmetric charge distribution in non-bonded oxygen.

A phosphate group may, for example, replace a non-bonding oxygen. Non-bonded oxygen is, for example, any of S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen) and OR (R is an alkyl or aryl group). It is preferably substituted with S. For example, both non-bonding oxygens are preferably substituted, more preferably both are substituted with S. Such modified phosphate groups include, for example, phosphorothioates, phosphorodithioates, phosphoroselenates, boranophosphates, boranophosphate esters, phosphonate hydrogens, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. Among these, phosphorodithioate in which the two non-bonding oxygens are both replaced with S is preferred.

A phosphate group may, for example, replace a bound oxygen. The bound oxygen can be substituted, for example, with any of the atoms S (sulfur), C (carbon) and N (nitrogen), and such modified phosphate groups include, for example, bridged phosphoroamidates substituted with N. , S-substituted bridged phosphorothioate, and C-substituted bridged methylene phosphonate. Substitution of bound oxygen is preferably carried out, for example, in at least one of the 5' terminal nucleotide residue and the 3' terminal nucleotide residue of the nucleic acid molecule of the present invention, and in the case of the 5' side, substitution with C is preferred; In the latter case, substitution by N is preferred.

The phosphate group may be substituted, for example, by a phosphorus-free linker. Examples of linkers include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenecarbonylamino, methylenemethylimino, methylenehydra. Examples include methylenedimethylhydrazo, methyleneoxymethylimino, and methylenecarbonylamino, and methylenecarbonylamino and methylenemethylimino are preferred.

The nucleic acid molecule of the present invention may be modified, for example, at least one of the nucleotide residues at the 3' end and the 5' end. The modification is as described above, and is preferably performed on the terminal phosphate group. The entire phosphate group may be modified, or one or more atoms in the phosphate group may be modified. In the former case, for example, the entire phosphate group may be replaced or deleted.

Examples of modification of terminal nucleotide residues include addition of other molecules. Other molecules include, for example, functional molecules such as labeling substances and protective groups. Examples of the protecting group include S (sulfur), Si (silicon), B (boron), and ester-containing groups. The functional molecules such as the labeling substances can be used, for example, to detect the nucleic acid molecules of the present invention.

Other molecules may be attached to the phosphate groups of nucleotide residues, or via spacers to phosphate groups or sugar residues. The terminal atom of the spacer can be added to or replaced with, for example, the bound oxygen of a phosphate group, or O, N, S or C of a sugar residue. The binding site of the sugar residue is preferably, for example, C at the 3' position or C at the 5' position, or an atom bonded to these. A spacer can also be added to or substituted, for example, at the terminal atom of a nucleotide substitute, such as the PNA.

Spacers are not particularly limited, and include, for example, -(CH ₂ ) _n -, -(CH ₂ ) _n N-, -(CH ₂ ) _n O-, -(CH ₂ ) _n S-, O(CH ₂ CH ₂ Examples include O) _n CH ₂ CH ₂ OH, abasic sugars, amides, carboxy, amines, oxyamines, oximines, thioethers, disulfides, thioureas, sulfonamides, morpholinos, and biotin reagents and fluorescein reagents. In the above formula, n is a positive integer, preferably 1 to 6, more preferably n=3 or 6.

In addition to these, molecules added to the terminal include, for example, dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic group hydrocarbons (e.g. phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic carriers (e.g. cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)col acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphoric acid, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] ₂ , polyaminos, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption enhancers (e.g. aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g. imidazole, bisimidazole, histamine, imidazole) cluster, acridine-imidazole complex, Eu ³⁺ complex of tetraazamacrocycle), etc.

The 5' end of the nucleic acid molecule of the present invention may be modified, for example, with a phosphate group or a phosphate group analog. Phosphate groups are, for example, 5' monophosphate ((HO) ₂ (O)PO-5'), 5' diphosphate ((HO) ₂ (O)POP(HO)(O)-O-5 '), 5' triphosphate ((HO) ₂ (O)PO-(HO)(O)POP(HO)(O)-O-5'), 5'-guanosine cap (7-methylated or non-methylated), Methylation, 7m-GO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'), 5'-adenosine cap (Appp), optional modification or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'), 5' monothiophosphate (phosphorothioate: (HO ) ₂ (S)PO-5'), 5'-dithiophosphoric acid (phosphorodithioate: (HO)(HS)(S)PO-5'), 5'-phosphorothiolic acid ((HO) ₂ (O ) PS-5'), sulfur-substituted mono-, di- and triphosphates (e.g. 5'-α-thiotriphosphate, 5'-γ-thiotriphosphate, etc.), 5'-phosphoric acid ruamidate ((HO) ₂ (O)P-NH-5', (HO)(NH ₂ )(O)PO-5'), 5'-alkylphosphonic acid (e.g. RP(OH)(O) -O-5', (OH) ₂ (O)P-5'-CH ₂ , R is alkyl (e.g. methyl, ethyl, isopropyl, propyl, etc.)), 5'-alkyl ether phosphonic acid (e.g. RP( OH)(O)-O-5', R is an alkyl ether (eg, methoxymethyl, ethoxymethyl, etc.).

Among the nucleotide residues, the bases are not particularly limited. The base may be a natural base or a non-natural base. For example, common bases, modified analogs thereof, etc. can be used.

Examples of the base include purine bases such as adenine and guanine, and pyrimidine bases such as cytosine, uracil and thymine. In addition to these bases, examples of the base include xanthine, hypoxanthine, and nucleosides such as nebularine, isoguanosine, and tubercidine. Bases include, for example, alkyl derivatives such as 2-aminoadenine, 6-methylated purine; alkyl derivatives such as 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; 6- Azouracil, 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; 8-halination, amination, thiol 5-trifluoromethylated and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidine; N-2, N- 6, and O-6 substituted purines (including 2-aminopropyladenine); 5-propynyluracil and 5-propynylcytosine; dihydrouracil; 3-deaza-5-azacytosine; 2-aminopurine; 5-alkyluracil; 7 -Alkylguanine; 5-alkylcytosine; 7-deazaadenine; N6,N6-dimethyladenine; 2,6-diaminopurine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazole; 2 -Pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacetic acid; 5-methoxycarbonylmethyluracil; 5-methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil; 5-Methylaminomethyl-2-thiouracil; 3-(3-amino-3-carboxypropyl)uracil; 3-methylcytosine; 5-methylcytosine; N4-acetylcytosine; 2-thiocytosine; N6-methyladenine; N6- It can be isopentyladenine; 2-methylthio-N6-isopentenyladenine; N-methylguanine; O-alkylated base, etc. Purines and pyrimidines also include, for example, U.S. Pat. (Englisch et al.), Angewandte Chemie, International Edition, 1991, vol. 30, p. 613.

In addition to these, modified nucleotide residues may include, for example, residues lacking a base, ie, an abasic riboric acid backbone. Modified nucleotide residues may also be used, for example, in U.S. Provisional Application No. 60/465,665 (filed on April 25, 2003) and International Application No. PCT/US04/07070 (filed on March 8, 2004). ) can be used, and the present invention can make use of these documents.

In a preferred embodiment, the nucleic acid molecule of the invention comprises at least one modified nucleotide as described above. Preferably, the nucleic acid molecule of the invention comprises at least one modified nucleotide as described above in the sense strand. Preferably, the modified nucleotide is a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, a deoxy-nucleotide, a 3' terminal deoxy-thymidine (dT) nucleotide, a 2'-fluoro modified nucleotide, a 2' -deoxy-modified nucleotides, terminal nucleotides attached to cholesteryl derivatives or dodecanoic acid bisdecylamide groups, fixed nucleotides, non-fixed nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, non-basic nucleotides, 2' -Amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl-modified nucleotide, 2'-O-alkyl-modified nucleotide Nucleotides, morpholinonucleotides, phosphoroamidates, nucleotides containing unnatural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups nucleotides, 5'-phosphate-containing nucleotides, and 5'-phosphate mimetic-containing nucleotides.

The method for synthesizing the nucleic acid molecule of the present invention is not particularly limited, and conventionally known methods can be employed. Examples of the synthesis method include a chemical synthesis method and a synthesis method using genetic engineering techniques. The chemical synthesis method is not particularly limited, and examples include the phosphoramidite method and the H-phosphonate method. For the chemical synthesis method, for example, a commercially available automatic nucleic acid synthesizer can be used. The chemical synthesis method generally uses amidites. The amidite is not particularly limited, and commercially available RNA amidites include, for example, DMT-2'-O-TBDMS amidite (Proligo), ACE amidite, TOM amidite, CEE amidite, CEM amidite, TEM amidite, and the like. Examples of the genetic engineering method include an in vitro transcription synthesis method, a method using a vector, and a method using a PCR cassette. The vector is not particularly limited, and includes non-viral vectors such as plasmids, viral vectors, and the like.

It is a preferred embodiment of the present invention to use an amidite compound having the following structure in place of such commercially available amidites.

[In the formula, B is an atomic group having a nucleobase skeleton,
Z ₁ is -CH ₂ - or -CO-,
Z ₂ is -O- or -NH-,
R is a hydroxyl protecting group,
R _a and R _b are the same or different and represent a hydrogen atom or a substituent; R _c represents a hydrogen atom, an electron-withdrawing group, or a substituent that may be substituted with an electron-withdrawing group;
D ₁ represents a protecting group for an amino group. ]
Amidite compounds in which Z ₁ is -CH ₂ - and Z ₂ is -O- are also referred to as trifluoroacetylaminoethoxymethyl (AEM) amidites.

The structure of a preferred AEM amidite is as follows.

Here, B is an atomic group having a nucleobase skeleton, and DMTr means 4,4'-dimethoxytrityl.

The structure of a preferred AEC amidite is as follows.

Here, B is an atomic group having a nucleobase skeleton, and DMTr means 4,4'-dimethoxytrityl.

The amidite compound of the present invention can be produced according to conventional methods.

(II) Uses of the nucleic acid molecule of the present invention The nucleic acid molecule of the present invention has a target gene expression suppressing activity equivalent to or higher than that of siRNA, and the off-target effect caused by the sense strand is significantly attenuated, so it can be used as is. Alternatively, it can be formulated as an expression inhibitor of a gene containing a target nucleic acid sequence together with a pharmacologically acceptable additive. The gene expression suppressor can be used, for example, as a research reagent to suppress the expression of a target gene in an in vitro system (e.g., isolated cells, tissues or organs), or can be used to suppress the expression of a target gene The expression of the gene can also be suppressed by administering it in vivo to a subject in which the gene is present. When administering the gene expression regulating agent of the present invention in vivo, the administration target includes, for example, non-human animals such as humans and non-human mammals other than humans.

For example, by administering the gene expression suppressor of the present invention to a patient who has suffered from or is likely to suffer from a disease caused by the target gene in the future, the expression of the target gene is suppressed and the disease is treated. be able to. As used herein, "treatment" is used to include, for example, prevention of the disease, delay of onset, improvement of the disease, improvement of prognosis, etc.

In the present invention, the disease to be treated is not particularly limited, and includes, for example, a disease associated with high expression of a certain gene. Depending on the type of the disease, a gene involved in the disease is set as the target gene, and further, depending on the target gene, an expression suppressing sequence (i.e., an antisense strand sequence) and a sense strand sequence complementary thereto. can be designed as appropriate.

As a specific example, the target gene may include the TGF-β1 gene. The nucleic acid molecule of the present invention having an antisense strand sequence for the TGF-β1 gene can be used, for example, to treat fibrotic diseases, specifically idiopathic pulmonary fibrosis. Similarly, when targeting NIMA-related kinase 6 (NEK6), which plays an important role in tumorigenesis, the nucleic acid molecules of the invention can be used, for example, in the treatment of cancer or fibrosis (WO/2019/ 022257).

Examples of pharmacologically acceptable additives include excipients such as sucrose and starch, binders such as cellulose and methyl cellulose, disintegrants such as starch and carboxymethyl cellulose, lubricants such as magnesium stearate and Aerosil, Aromatic agents such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolid, and dispersing agents such as surfactants. , water, diluents such as physiological saline, base wax, etc., but are not limited thereto.

In order to promote the introduction of the nucleic acid molecule of the present invention into target cells, the gene expression suppressor of the present invention can further contain a reagent for nucleic acid introduction. The nucleic acid introduction reagents include atelocollagen; liposome; nanoparticle; lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, or poly(ethyleneimine) (PEI). Cationic lipids such as, for example, can be used.

In a preferred embodiment, the gene expression suppressor of the present invention may be a pharmaceutical composition in which the nucleic acid molecule of the present invention is encapsulated in a liposome. Liposomes are microscopic closed vesicles that have an internal phase surrounded by one or more lipid bilayers, typically capable of retaining water-soluble substances in the inner layer and lipid-soluble substances within the lipid bilayer. As used herein, "encapsulation" refers to the nucleic acid molecule of the present invention that may be retained within the inner layer of a liposome or within a lipid bilayer. The liposome used in the present invention may be a monolayer or a multilayer, and the particle size can be appropriately selected within the range of, for example, 10 to 1000 nm, preferably 50 to 300 nm. Considering the deliverability to the target tissue, the particle size may be, for example, 200 nm or less, preferably 100 nm or less.

Methods for encapsulating water-soluble compounds such as nucleic acids in liposomes include the lipid film method (vortex method), reversed-phase evaporation method, surfactant removal method, freeze-thaw method, and remote loading method. The method is not limited, and any known method can be selected as appropriate.

The gene expression inhibitor of the present invention can be administered orally or parenterally to mammals (e.g., humans, cats, ferrets, mink, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cows, monkeys). However, it is preferable to administer the drug parenterally.

Suitable formulations for parenteral administration (e.g., subcutaneous, intramuscular, local, intraperitoneal, etc.) include aqueous and nonaqueous isotonic sterile injectable solutions containing antioxidants. , a buffer, a bacteriostatic agent, a tonicity agent, etc. may be included. Also included are aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, and the like. The formulation can be packaged in containers such as ampoules or vials for unit doses or multiple doses. Alternatively, the active ingredient and pharmacologically acceptable additives can be lyophilized and stored in a state where it is sufficient to dissolve or suspend them in a suitable sterile vehicle immediately before use.
Other formulations suitable for parenteral administration include sprays and the like.

The content of the nucleic acid molecule of the present invention in the gene expression suppressor is, for example, about 0.1 to 100% by weight of the entire preparation.

The dosage of the gene expression suppressor of the present invention varies depending on the purpose of administration, the method of administration, the type and severity of the target disease, and the circumstances of the subject (sex, age, body weight, etc.). When administering the nucleic acid molecule of the present invention, the single dose of the nucleic acid molecule of the present invention is usually 2 nmol/kg or more and 50 nmol/kg or less, and when locally administered, it is preferably 1 pmol/kg or more and 10 nmol/kg or less. It is desirable to administer such a dose 1 to 10 times, more preferably 5 to 10 times.

EXAMPLES Hereinafter, the present invention will be explained in more detail with reference to Examples, but the present invention is not limited to these Examples.

Production example 1 Synthesis of AEM reagent

(1) Synthesis of Compound 2 Ethyl trifluoroacetate (13.1 mL, 1.1 eq.) was added to a solution of Compound 1 (6.1 g, 100 mmol) in methanol (40 mL) under an argon atmosphere, and the mixture was stirred at room temperature overnight. did. The reaction mixture was concentrated under reduced pressure to obtain the target compound 2 as a white solid.
ESI-Mass:156.03[MH] ^-

(2) Synthesis of Compound 3 To a solution of Compound 2 (100 mmol) in dimethyl sulfoxide (100 mL) were added acetic anhydride (71.8 mL, 7.6 eq.) and acetic acid (51.5 mL, 9.0 eq.) under an argon atmosphere. The mixture was added and stirred at room temperature for 1 day. A suspension of sodium hydrogen carbonate and water was slowly added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with water and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 100:0 to 50:50) to obtain target compound 3 (AEM reagent) as a colorless oil. 8.4 g of material was obtained.
ESI-Mass:240.03[M+Na] ⁺

Production Example 2 Synthesis of uridine AEM amidite (U5)

(1) Synthesis of 3',5'-O-(telysopropyldisiloxane-1,3-diyl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]uridine (U2) Compound U1 (3.3 g, 6.8 mmol) was azeotropically distilled with a mixed solvent of toluene and tetrahydrofuran and dried under vacuum for 1 hour. Under an argon atmosphere, dehydrated tetrahydrofuran (30 mL), molecular sieves 4A (3.3 g), and N-iodosuccinimide (2.3 g, 1.5 eq.) were added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.9 mL, 1.5 eq.) was added dropwise. After stirring for 5 minutes, an AEM reagent (Compound 3; 2.2 g, 1.5 eq.) dissolved in tetrahydrofuran (7 mL) was added, and the mixture was stirred at -45°C for 1 hour. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at -45°C, and the mixture was stirred at room temperature for 30 minutes until the brown color disappeared. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed once with a saturated aqueous sodium thiosulfate solution, once with a saturated aqueous sodium bicarbonate solution, and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 90:10 to 50:50) to obtain the target compound U2 as a high purity fraction, a white foam. 3.1 g of a pale yellow oily substance was obtained as a low purity fraction, and 1.7 g of a pale yellow oily substance was obtained.
ESI-Mass:678.24[M+Na] ⁺

(2) Synthesis of 2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]uridine (U3) A solution of compound U2 (3.1 g, 4.7 mmol) in dehydrated methanol (30 mL) was added under an argon atmosphere. Ammonium fluoride (0.7 g, 4.0 eq.) was added and stirred at 50° C. for 4 hours. Methanol and silica gel were added to the reaction mixture, and the solution was concentrated under reduced pressure. The obtained residue was packed in a column and purified by silica gel column chromatography (chloroform: 20% methanol/80% chloroform = 100:0 to 35:65) to obtain the target compound U3 as a white foamy substance. I got 5g.
ESI-Mass:412.09[MH] ^-

(3) Synthesis of 5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]uridine (U4) Compound U3 (1.9 g, 4. DMTr-Cl (1.9 g, 1.2 eq.) was added to a solution of 7 mmol) in dehydrated pyridine (20 mL) at 0° C. under an argon atmosphere, and the mixture was stirred at room temperature overnight. DMTr-Cl (0.3 g, 0.2 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 4 hours. Methanol (10 mL) was added to the reaction mixture and stirred for 10 minutes. After concentrating the solution under reduced pressure, a saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 70:30 to 0:100, containing 0.05% pyridine) to obtain the target compound U4. 2.8 g was obtained as a pale yellow foam.
ESI-Mass:738.22 [M+Na] ⁺

(4) 5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]uridine 3'-O-(2-cyanoethyl N,N-diisopropyl Synthesis of phosphoramidite (U5) Diisopropylammonium tetrazolide (0.8 g, 1.2 eq. ), 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (1.5 mL, 1.2 eq.) was added, and the mixture was stirred at 40°C for 2 hours. Water, a saturated aqueous sodium chloride solution, and a saturated aqueous sodium bicarbonate solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 70:30 to 0:100, containing 0.1% triethylamine) to obtain the target compound U5. Obtained 3.2 g as a white foam.
³¹ P-NMR (202 MHz, CDCl ₃ ): 151.99, 149.74 (<integral ratio> 1.0:1.2)
¹ H-NMR (500 MHz, CDCl ₃ ) δ: 1.00-1.20(m, 12H), 2.43-2.47(m, 1H), 2.60-2.65(m, 1H), 3.44-4.10(m, 10H), 3.79 -3.81(-OMe, 6H), 4.15-4.25(m, 1H), 4.35-4.37(m, 1H), 4.54-4.68(m, 1H), 4.79-5.24(m, 3H), 5.86-5.91(m , 1H), 6.81-6.87(m, 4H), 7.23-7.43(m, 9H), 7.81-7.92(m, 1H), 8.12-8.20(m, 1H), 8.83-9.15(m, 1H)
ESI-Mass:938.32 [M+Na] ⁺

Production Example 3 Synthesis of adenosine AEM amidite (A5)

(1) N ⁶ -acetyl-3',5'-O-(terisopropyldisiloxane-1,3-diyl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]adenosine ( Synthesis of A2) Compound A1 (3.7 g, 6.8 mmol) was azeotropically distilled with a mixed solvent of toluene and tetrahydrofuran, and dried under vacuum for 1 hour. Under an argon atmosphere, dehydrated tetrahydrofuran (30 mL), molecular sieves 4A (3.7 g), and N-iodosuccinimide (2.0 g, 1.3 eq.) were added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.8 mL, 1.3 eq.) was added dropwise. After stirring for 5 minutes, an AEM reagent (Compound 3; 2.0 g, 1.3 eq.) dissolved in tetrahydrofuran (7 mL) was added, and the mixture was stirred at -45°C for 3 hours and at 0°C for 1 hour. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at 0°C, and the mixture was stirred at room temperature for 30 minutes until the brown color disappeared. Water and a saturated aqueous sodium chloride solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed once with a saturated aqueous sodium thiosulfate solution, once with a saturated aqueous sodium bicarbonate solution, and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 50:50 to 0:100) to obtain target compound A2 as a high purity fraction and a white foam. 3.1 g of a white foamy substance and 1.8 g of a low purity fraction, a white foamy substance, were obtained.
ESI-Mass:721.30[M+H] ⁺

(2) Synthesis of N ⁶ -acetyl-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]adenosine (A3) A solution of compound A2 (3.1 g, 4.3 mmol) in dehydrated tetrahydrofuran (30 mL) TEA/3HF (0.8 mL, 1.2 eq.) was added to the mixture under an argon atmosphere, and the mixture was stirred at room temperature for 5 hours. Methanol and silica gel were added to the reaction mixture, and the solution was concentrated under reduced pressure. The obtained residue was packed in a column and purified by silica gel column chromatography (chloroform: 20% methanol/80% chloroform = 100:0 to 35:65) to obtain the target compound A3 as a white foamy substance. I got 6g.
ESI-Mass:501.13[M+Na] ⁺

(3) Synthesis of N ⁶ -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]adenosine (A4) Compound A3 (2 DMTr-Cl (2.2 g, 1.5 eq.) was added to a solution of dehydrated pyridine (20 mL) under an argon atmosphere at 0° C., and the mixture was stirred at room temperature for 4 hours. DMTr-Cl (1.5 g, 1.0 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. Methanol (10 mL) was added to the reaction mixture and stirred for 10 minutes. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (dichloromethane: 10% methanol/90% dichloromethane = 100:0 to 0:100, containing 0.05% pyridine) to obtain the desired product. 2.9 g of compound A4 was obtained as a pale yellow foam.
ESI-Mass:803.27 [M+Na] ⁺

(4) N ⁶ -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]adenosine 3'-O-(2-cyanoethyl Synthesis of N,N-diisopropyl phosphoramidite (A5) To a solution of compound A4 (2.9 g, 3.7 mmol) in dehydrated acetonitrile (40 mL) was added diisopropylammonium tetrazolide (0.8 g) at room temperature under an argon atmosphere. , 1.2 eq.) and 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (1.4 mL, 1.2 eq.) were added, and the mixture was stirred at 40°C for 1 hour. After concentrating the reaction mixture under reduced pressure, water and a saturated aqueous sodium bicarbonate solution were added, followed by extraction with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 50:50 to 0:100, containing 0.1% triethylamine) to obtain target compound A5. Obtained 3.2 g as a white foam.
³¹ P-NMR (202 MHz, CDCl ₃ ): 151.75,150.87, 14.83 (<integral ratio> 1.1:1.0:0.4)
¹ H-NMR (500MHz, CDCl ₃ ) δ: 1.04-1.30(m, 12H), 2.37-2.41(m, 1H), 2.58-2.64(m, 4H), 3.35-3.93(m, 11H), 3.76- 3.79(-OMe, 6H), 4.32-4.41(m, 1H), 4.63-4.71(m, 1H), 4.73-4.78(m, 1H), 4.80-4.96(m, 2H), 6.21-6.25(m, 1H), 6.77-6.85(m, 4H), 7.20-7.47(m, 10H), 8.25(s, 0.5H), 8.27(s, 0.5H), 8.61(brs, 1H), 8.71(brs, 1H)
ESI-Mass:1003.38 [M+Na] ⁺

Production example 4 Synthesis of guanosine AEM amidite (G5)

(1) N ² -isobutyryl-3',5'-O-(terisopropyldisiloxane-1,3-diyl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]guanosine ( Synthesis of G2) Compound G1 (4.0 g, 6.8 mmol) was azeotropically distilled with a mixed solvent of toluene and tetrahydrofuran, and dried under vacuum for 1 hour. Under an argon atmosphere, dehydrated tetrahydrofuran (30 mL), molecular sieves 4A (4.0 g), and N-iodosuccinimide (2.3 g, 1.5 eq.) were added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.9 mL, 1.5 eq.) was added dropwise. After stirring for 5 minutes, an AEM reagent (Compound 3; 2.2 g, 1.5 eq.) dissolved in tetrahydrofuran (5 mL) was added, and the mixture was stirred at -45°C for 1 hour. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at -45°C, and the mixture was stirred at room temperature for 30 minutes until the brown color disappeared. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed once with a saturated aqueous sodium thiosulfate solution, once with a saturated aqueous sodium bicarbonate solution, and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 5.2 g of a crude product of target compound G2 as a white foamy substance.
ESI-Mass:787.32[M+Na] ⁺

(2) Synthesis of N ² -isobutyryl-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]guanosine (G3) In a solution of compound G2 (5.1 g, 6.8 mmol) in dehydrated tetrahydrofuran (60 mL) , TEA/3HF (1.3 mL, 1.2 eq.) was added under an argon atmosphere, and the mixture was stirred at room temperature for 6 hours. Methanol and silica gel were added to the reaction mixture, and the solution was concentrated under reduced pressure. The obtained residue was packed in a column and purified by silica gel column chromatography (chloroform: 20% methanol/80% chloroform = 100:0 to 35:65) to obtain the target compound G3 as a white foamy substance. I got 4g.
ESI-Mass:545.16[M+Na] ⁺

(3) Synthesis of N ² -isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]guanosine (G4) Compound G3 (3 DMTr-Cl (3.3 g, 1.5 eq.) was added to a solution of 0.4 g, 6.5 mmol) in dehydrated pyridine (35 mL) at 0° C. under an argon atmosphere, and the mixture was stirred at room temperature for 3 hours. DMTr-Cl (3.3 g, 1.5 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 4 hours. DMTr-Cl (3.3 g, 1.5 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. Methanol (20 mL) was added to the reaction mixture and stirred for 10 minutes. After concentrating the solution under reduced pressure, the resulting residue was roughly purified by silica gel column chromatography (dichloromethane: 10% methanol/90% dichloromethane = 100:0 to 0:100, containing 0.05% pyridine). The obtained crude product was purified by silica gel column chromatography (dichloromethane: 10% methanol/90% dichloromethane = 50:50, containing 0.05% pyridine) to obtain target compound G4 as a pale yellow foamy substance. I got 1g.
ESI-Mass:825.31 [M+H] ⁺

(4) N ² -isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]guanosine 3'-O-(2-cyanoethyl Synthesis of N,N-diisopropyl phosphoramidite (G5) To a solution of compound G4 (3.0 g, 3.7 mmol) in dehydrated acetonitrile (40 mL) was added diisopropylammonium tetrazolide (0.8 g) at room temperature under an argon atmosphere. , 1.3 eq.) and 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (1.5 mL, 1.3 eq.) were added, and the mixture was stirred at 40°C for 4 hours. 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (0.8 mL, 0.7 eq.) was added to the reaction mixture, and the mixture was stirred at 40°C for 1 hour. Water and a saturated aqueous sodium bicarbonate solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 50:50 to 0:100, containing 0.1% triethylamine) to obtain crude product 2. .0g was obtained. Ethyl acetate and n-hexane were added to 1.6 g of the crude product and sonicated, and the solid was filtered and dried under reduced pressure to obtain 0.7 g of the target compound G5 as a white solid.
³¹ P-NMR (202 MHz, CDCl ₃ ): 150.99,150.37 (<integral ratio> 1.0:0.5)
¹ H-NMR (500 MHz, CDCl ₃ ) δ: 0.78-1.20(m, 18H), 1.79-1.85(m, 0.33H), 2.05-2.11(m, 0.67H), 2.31(t, J= 6.0 Hz , 0.67H), 2.68-2.72(m, 1.33H), 3.17-3.22(m, 1H), 3.33-4.00(m, 9H), 3.75-3.80(-OMe, 6H), 4.22-4.34(m, 1H) ), 4.50-4.60(m, 1H), 4.71-4.84(m, 2H), 4.95-5.09(m, 0.67H), 5.11-5.16(m, 0.33H), 5.90(d, J= 7.0 Hz, 0.33 H), 6.00(d, J= 7.0 Hz, 0.67H), 6.78-6.83(m, 4H), 7.07-7.13(m, 1H), 7.20-7.55(m, 9H), 7.81(s, 0.33H) , 7.83(s, 0.67H), 8.08(brs, 0.33H), 8.50(brs, 0.67H), 12.05(brs, 1H)
ESI-Mass:1047.38 [M+Na] ⁺

Production Example 5 Synthesis of cytidine AEM amidite (C5)

(1) N ⁴ -acetyl-3',5'-O-(terisopropyldisiloxane-1,3-diyl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]cytidine ( Synthesis of C2) Compound C1 (3.6 g, 6.8 mmol) was vacuum dried for 1 hour. Under an argon atmosphere, dehydrated tetrahydrofuran (30 mL), molecular sieves 4A (3.6 g), and N-iodosuccinimide (2.3 g, 1.5 eq.) were added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.9 mL, 1.5 eq.) was added dropwise. After stirring for 5 minutes, an AEM reagent (Compound 3; 2.2 g, 1.5 eq.) dissolved in tetrahydrofuran (5 mL) was added, and the mixture was stirred at -45°C for 1 hour. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at -45°C, and the mixture was stirred at room temperature for 30 minutes until the brown color disappeared. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed once with a saturated aqueous sodium thiosulfate solution, once with a saturated aqueous sodium bicarbonate solution, and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 5.5 g of a crude product of target compound C2 as a white foamy substance.
ESI-Mass:719.27[M+Na] ⁺

(2) Synthesis of N ⁴ -acetyl-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]cytidine (C3) In a solution of compound C2 (5.5 g, 7.9 mmol) in dehydrated tetrahydrofuran (70 mL) , TEA/3HF (1.3 mL, 1.0 eq.) was added under an argon atmosphere, and the mixture was stirred at room temperature for 1 day. After adding ethyl acetate to the reaction mixture and sonicating it, insoluble matter was filtered to obtain solid <1>. After concentrating the filtrate under reduced pressure, the resulting residue was purified by silica gel column chromatography (chloroform: 20% methanol/80% chloroform = 100:0 to 35:65) to obtain purified product <2>. Ta. Solid <1> and purified product <2> were mixed to obtain 3.1 g of target compound C3 as a white solid.
ESI-Mass:477.12[M+Na] ⁺

(3) Synthesis of N ⁴ -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]cytidine (C4) Compound C3(3 DMTr-Cl (3.5 g, 1.5 eq.) was added to a solution of dehydrated pyridine (35 mL) under an argon atmosphere at 0° C., and the mixture was stirred at room temperature overnight. DMTr-Cl (1.7 g, 0.8 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. Methanol (20 mL) was added to the reaction mixture and stirred for 1 hour. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (dichloromethane: 10% methanol/90% dichloromethane = 100:0 to 50:50, containing 0.05% pyridine) to obtain the desired product. 4.8 g of compound C4 was obtained as a pale yellow foam.
ESI-Mass:779.25 [M+Na] ⁺

(4) N ⁴ -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]cytidine 3'-O-(2-cyanoethyl Synthesis of N,N-diisopropyl phosphoramidite (C5) To a solution of compound C4 (4.8 g, 6.3 mmol) in dehydrated acetonitrile (50 mL) was added diisopropylammonium tetrazolide (1.6 g) at room temperature under an argon atmosphere. , 1.5 eq.) and 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (3.0 mL, 1.5 eq.) were added, and the mixture was stirred at 40°C for 2 hours. Water, a saturated aqueous sodium bicarbonate solution, and a saturated aqueous sodium chloride solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 50:50 to 0:100, containing 0.1% triethylamine) to obtain target compound C5. Obtained 5.1 g as a white foam.
³¹ P-NMR (202 MHz, CDCl ₃ ): 152.32,149.93, 14.75 (<integral ratio>0.5:1.0:0.5)
¹ H-NMR (500 MHz, CDCl ₃ ) δ: 0.97-1.30(m, 12H), 2.18-2.22(m, 3H), 2.37-2.60(m, 2H), 3.45-3.85(m, 10H), 3.80 -3.83(-OMe, 6H), 4.20-4.30(m, 1H), 4.35-4.38(m, 1H), 4.50-4.59(m, 1H), 4.81(d, J= 7.0Hz, 0.33H), 4.90 (d, J= 7.0Hz, 0.67H), 5.04(d, J= 7.0 Hz, 0.67H), 5.19(d, J= 7.0 Hz, 0.33H), 5.90-5.95(m, 1H), 6.82-7.02 (m, 5H), 7.25-7.47(m, 9H), 8.39(brs, 0.67H), 8.56(brs, 0.33H), 8.60(d, J= 7.5 Hz, 0.33H),
8.63-8.68(m, 1H), 8.77(brs, 0.67H)
ESI-Mass:979.37 [M+Na] ⁺

Production Example 6 Synthesis of AEC reagent

(1) Synthesis of Compound 5 Ethyl trifluoroacetate (23.1 g, 1.05 eq.) was added to a solution of Compound 4 (25 g, 0.155 mol) in tetrahydrofuran (100 mL) under an argon atmosphere, and the mixture was stirred at room temperature overnight. did. The reaction mixture was concentrated under reduced pressure, and n-hexane was added to the residue to obtain the target compound 5 as a white solid (25.4 g, yield 64%).
¹ H-NMR (500MHz, CDCl ₃ ) δ(ppm):1.44(9H,s), 3.36(2H,dd,J=4.5,10.5Hz), 3.46(2H,dd,J=5.5,19.5Hz), 4.96(1H,s), 7.80(1H,s).

(2) Synthesis of compound 6 To a solution of compound 5 (25.4 g, 98.8 mmol) in methylene chloride (25 mL) was added 4 mol/L hydrochloric acid-dioxane solution aqueous acetic acid (150 mL, 6 eq.) under ice cooling for 30 minutes. The mixture was added dropwise and further stirred at room temperature overnight. A suspension of sodium hydrogen carbonate and water was slowly added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the residue was crystallized by adding ethyl acetate to obtain the target compound 6 (AEC reagent) as a white solid (19.0 g, quant.).
^1H -NMR (500MHz, DMSO- _d6 ) δ(ppm):3.43-3.61(4H,m), 8.79(3H,brs), 9.68(1H,brs).

Production Example 7 Synthesis of uridine AEC amidite

(1) 3',5'-O-(tetraisopropyldisiloxane-1,3-diyl)-2'-[N-[2-[(trifluoroacetyl)amino]ethyl]carbamate]uridine (U6) Synthesis To compound U1 (5.0 g, 10.3 mmol) were added dehydrated dichloromethane (50 mL) and N,N'-carbonyldiimidazole (3.3 g, 20.5 mmol), and the mixture was stirred at room temperature for 1 hour. N,N'-carbonyldiimidazole (0.16 g, 1.0 mmol) was added, and the mixture was further stirred for 3 hours (reaction mixture 1).
AEC reagent (Compound 6; 3.0 g, 15.5 mmol) was dissolved in dehydrated dichloromethane (50 mL) and cooled to 0°C. After adding triethylamine (1.6 g, 15.5 mmol) and stirring at 0°C for 40 minutes, reaction mixture 1 was added, and the mixture was stirred at 0°C for 80 minutes and at room temperature for 17 hours. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed once with a saturated aqueous sodium hydrogen carbonate solution and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 6.4 g of a white foam containing the target compound U6.
ESI-Mass:691.2386[M+Na] ⁺

(2) Synthesis of 2'-[N-[2-[(trifluoroacetyl)amino]ethyl]carbamate]uridine (U7) In a solution of compound U6 (3.0 g, 4.5 mmol) in dehydrated tetrahydrofuran (30 mL), Triethylamine trihydrofluoride (0.88 mL, 5.4 mmol) was added and stirred at room temperature for 17 hours. After concentrating the reaction mixture under reduced pressure, the resulting residue was purified by silica gel column chromatography (chloroform:methanol = 95:5 to 80:20) to obtain 0.5 g of target compound U7 as a white solid.
ESI-Mass:449.0869[M+Na] ⁺ ,425.0948[MH] ^-

(3) Synthesis of 5'-O-(4,4'-dimethoxytrityl)-2'-[N-[2-[(trifluoroacetyl)amino]ethyl]carbamate]uridine (U8) Compound U7 (1. 4,4'-dimethoxytrityl chloride (1.14 g, 3.4 mmol) was added to a solution of 2 g, 2.8 mmol) in dehydrated pyridine (12 mL) at 0°C under an argon atmosphere, and the mixture was stirred at room temperature for 2 hours. . Methanol (7 mL) was added to the reaction mixture and stirred for 1 hour. After concentrating the solution under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over sodium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (dichloromethane:methanol = 100:0 to 90:10, containing 0.05% pyridine) to obtain the target compound U8 as a pale yellow foam. 1.76 g of a solid substance was obtained.
ESI-Mass:751.2245[M+Na] ⁺

(4) 5'-O-(4,4'-dimethoxytrityl)-2'-[N-[2-[(trifluoroacetyl)amino]ethyl]carbamate]uridine3'-O-(2-cyanoethyl N , N-diisopropylphosphoramidite) (U9) Compound U8 (1.76 g, 2.4 mmol) was azeotropically distilled with dehydrated acetonitrile and dried in vacuo. Diisopropylammonium tetrazolide (0.5 g, 3.0 mmol) was added and the mixture was further dried under vacuum for 1 hour. Dehydrated acetonitrile (15 mL) was added, and the mixture was stirred at 40° C. for 5 minutes under an argon atmosphere. 2-Cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (0.9 g, 3.0 mmol) was added and stirred at 40°C for 2 hours. After concentrating the solution under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 40:60 to 10:90, containing 0.1% triethylamine) to obtain the target compound U9. Obtained 1.45 g as a white foam.
ESI-Mass:1030.4556[M+TEA+H] ^+
31P -NMR (202MHz, CDCl ₃ ):151.08,150.80
¹ H-NMR (500MHz, CDCl ₃ ):1.06-1.25(m,12H), 2.44(t,1H), 2.59-2.76(m,1H), 3.35-3.94(m,10H), 3.78-3.80(- OMe,6H), 4.23-4.35(m,1H), 4.67-4.71(m,1H), 5.23-5.42(m,2H), 5.73-5.94(m,1H), 6.20-6.24(m,1H), 6.80-6.86(m,4H), 7.21-7.40(m,9H), 7.72-7.76(m,1H), 7.80-7.89(m,1H), 9.09-9.24(m,1H)

Production example 8

(1) Synthesis of Compound 8 Ethyl trifluoroacetate (6.5 mL, 1.1 eq.) was added to a solution of Compound 7 (5.1 g, 49.7 mmol) in methanol (50 mL) under an argon atmosphere, and the mixture was stirred at room temperature. Stir overnight. The reaction mixture was concentrated under reduced pressure to obtain 10.0 g of target compound 8 as a colorless oil.
ESI-Mass:222.08[M+Na] ⁺

(2) Synthesis of Compound 9 Acetic acid (12.9 mL, 9.0 eq.), acetic anhydride (19. 0 mL, 8.0 eq.) was added thereto, and the mixture was stirred at 40° C. for 6 hours and at room temperature overnight. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. A suspension of sodium hydrogen carbonate and water was slowly added to the organic layer, and the mixture was stirred at room temperature for 30 minutes, then water was added and extracted with ethyl acetate. The organic layer was washed with water and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 100:0 to 80:20) to obtain 2.4 g of target compound 9 as a colorless oil. Obtained.
ESI-Mass:282.08[M+Na] ⁺

Production example 9

(1) 3',5'-O-(telysopropyldisiloxane-1,3-diyl)-2'-O-[3-(trifluoroacetyl)amino-2,2-dimethylpropoxymethyl]uridine Synthesis of (U10) Compound U1 (3.3 g, 6.8 mmol) was mixed with dehydrated tetrahydrofuran (30 mL), molecular sieves 4A (3.3 g), and N-iodosuccinimide (1.9 g, 1.2 eq.) under an argon atmosphere. was added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.73 mL, 1.2 eq.) was added dropwise. After stirring for 5 minutes, compound 9 (2.1 g, 1.2 eq.) dissolved in tetrahydrofuran (8 mL) was added, and the mixture was stirred at -45°C for 1 hour. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at -45°C, and the mixture was stirred at room temperature for 5 minutes until the brown color disappeared. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 100:0 to 50:50) to obtain the target compound U10 as a white foamy substance. .6g was obtained.
ESI-Mass:720.30[M+Na] ⁺

(2) Synthesis of 2'-O-[3-(trifluoroacetyl)amino-2,2-dimethylpropoxymethyl]uridine (U11) A solution of compound U10 (4.5 g, 6.4 mmol) in dehydrated tetrahydrofuran (40 mL) TEA/3HF (1.3 mL, 1.2 eq.) was added to the mixture under an argon atmosphere, and the mixture was stirred at room temperature for 6 hours. Methanol and silica gel were added to the reaction mixture, and the solution was concentrated under reduced pressure. The obtained residue was packed in a column and purified by silica gel column chromatography (chloroform: 20% methanol/80% chloroform = 100:0 to 35:65) to obtain the target compound U11 as a white foamy substance. I got 8g.
ESI-Mass:478.14[M+Na] ⁺

(3) Synthesis of 5'-O-(4,4'-dimethoxytrityl)-2'-O-[3-(trifluoroacetyl)amino-2,2-dimethylpropoxymethyl]uridine (U12) Compound U11 ( DMTr-Cl (3.1 g, 1.5 eq.) was added to a solution of 2.8 g, 6.0 mmol) in dehydrated pyridine (25 mL) at 0° C. under an argon atmosphere, and the mixture was stirred at room temperature for 5 hours. DMTr-Cl (1.5 g, 0.75 eq.) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. Methanol (30 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for 15 minutes. After concentrating the solution under reduced pressure, methanol (20 mL) was added. After concentrating the solution under reduced pressure, saturated aqueous sodium hydrogen carbonate solution and water were added, followed by extraction with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 80:20 to 30:70, containing 0.1% triethylamine) to obtain the target compound U12. Obtained 3.9 g as a white foam.
ESI-Mass:780.27[M+Na] ⁺

(4) 5'-O-(4,4'-dimethoxytrityl)-2'-O-[3-(trifluoroacetyl)amino-2,2-dimethylpropoxymethyl]uridine 3'-O-(2- Synthesis of cyanoethyl N,N-diisopropyl phosphoramidite) (U13) Diisopropylammonium tetrazolide (1. 1 g, 1.3 eq.) and 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (2.1 mL, 1.3 eq.) were added, and the mixture was stirred at 40°C for 3 hours. Diisopropylammonium tetrazolide (0.57 g, 0.65 eq.) and 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (1.0 mL, 0.65 eq.) were added to the reaction mixture at room temperature. ) and stirred at 40°C for 1 hour. After concentrating half of the solvent under reduced pressure, water and a saturated aqueous sodium bicarbonate solution were added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 100:30 to 30:70, containing 0.1% triethylamine) to obtain the target compound U13. Obtained 3.6 g as a white foam.
ESI-Mass:980.37[M+Na] ⁺

Production example 10 Synthesis of abasic AEM amidite (B5)

(1) 3',5'-O-(tetraisopropyldisiloxane-1,3-diyl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]-abasic-D-ribose (B2 ) Synthetic Compound B1 (2.0 g, 5.3 mmol) was azeotropically distilled with a mixed solvent of toluene and tetrahydrofuran and dried under vacuum for 1 hour. Under an argon atmosphere, dehydrated tetrahydrofuran (20 mL), molecular sieves 4A (2 g), and N-iodosuccinimide (1.8 g, 1.5 eq.) were added and stirred, and the mixture was cooled to -45°C. After stirring for 5 minutes, trifluoromethanesulfonic acid (0.7 mL, 1.5 eq.) was added dropwise. After stirring for 10 minutes, an AEM reagent (Compound 3; 1.7 g, 1.5 eq.) dissolved in tetrahydrofuran (5 mL) was added, and the mixture was stirred at -45°C for 3 hours. A mixed solution of a saturated aqueous sodium thiosulfate solution and a saturated aqueous sodium bicarbonate solution was added to the reaction mixture at -45°C, and the mixture was stirred at room temperature for 10 minutes until the brown color disappeared. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed once with a saturated aqueous sodium thiosulfate solution, once with a saturated aqueous sodium bicarbonate solution, and once with a saturated aqueous sodium chloride solution, and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 81:19 to 60:40) to obtain 1.0 g of target compound B2.
ESI-Mass:568.2407[M+Na] ⁺

(2) Synthesis of 2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]-abasic-D-ribose (B3) Add compound B2 (1.0 g, 1.8 mmol) to a methanol (15 mL) solution. , ammonium fluoride (228 mg, 6.2 mmol) was added, and the mixture was stirred at 50°C for 2.5 hours. After the reaction mixture was concentrated under reduced pressure, the resulting residue was purified by silica gel column chromatography (dichloromethane:methanol = 98:2 to 90:10) to obtain 0.4 g of target compound B3.
ESI-Mass: 326.0812 [M+Na] ⁺ , 302.0853 [MH] ^-

(3) Synthesis of 5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]-abasic-D-ribose (B4) Compound B3 ( 0.4 g, 1.2 mmol) was azeotroped with pyridine, and the resulting residue was dissolved in dehydrated pyridine (12 mL). 4,4'-dimethoxytrityl chloride (0.5 g, 1.4 mmol) was added at 0° C. under an argon atmosphere, and the mixture was stirred at room temperature for 2 hours. Furthermore, 4,4'-dimethoxytrityl chloride (0.4 g, 1.2 mmol) was added, and the mixture was stirred at room temperature for 4 hours. Methanol (10 mL) was added to the reaction mixture and stirred for 20 minutes. The solution was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (hexane:ethyl acetate = 60:40 to 35:65, containing 0.1% triethylamine) to obtain 62 mg of target compound B4.
ESI-Mass:628.2088[M+Na] ⁺

(4) 5'-O-(4,4'-dimethoxytrityl)-2'-O-[2-(trifluoroacetyl)aminoethoxymethyl]-abasic-3'-O-(2-cyanoethyl N, Synthesis of N-diisopropyl phosphoramidite (B5) Compound B4 (270 mg, 0.4 mmol) was azeotropically distilled with dehydrated acetonitrile and dried in vacuo. Diisopropylammonium tetrazolide (95 mg, 0.5 mmol) was added and further vacuum-dried. Dehydrated acetonitrile (7 mL) was added, and the mixture was stirred at 40° C. for 5 minutes under an argon atmosphere. 2-cyanoethyl N,N,N',N'-tetraisopropyl phosphorodiamidite (169 mg, 0.5 mmol) dissolved in dehydrated acetonitrile (2 mL) was added, and the mixture was stirred at 40°C for 1.5 hours. After concentrating the solution under reduced pressure, saturated aqueous sodium hydrogen carbonate solution was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 83:17 to 50:50, containing 0.1% triethylamine) to obtain target compound B5. Obtained 175 mg as a white foam.
ESI-Mass:806.3466[M+H] ⁺ ,828.3243[M+Na] ^+
31 P-NMR (202 MHz, CDCl ₃ ): 150.31, 150.04

Production Example 11 Synthesis of Each Nucleic Acid Molecule The nucleic acid molecules shown in the following examples were synthesized using a nucleic acid synthesizer (trade name: ABI 3900 DNA Synthesizer, Applied Biosystems) based on the phosphoramidite method. The structures of nucleic acid molecules are shown in Tables 1-1 to 1-6, Tables 2-1 to 2-2, Tables 3-1 to 3-2, Tables 4-1 to 4-4, Tables 5-1 to It is shown in Table 5-2. As the RNA amidite, EMM amidite (WO/2013/027843) or TBDMS amidite (Proligo) was used, and 2'-OMe Phosphoramidite (ChemGenes) was indicated in italics in the sequence. 5'-Amino-Modifier Phthalamidite (ChemGenes) or 3'-Amino-Modifier Phthalamido lcaa CPG (ChemGenes) is used for X in the sequence, and Spacer Phosphora is used for W in the sequence. Using midite (ChemGenes), add CNV- to Z in the sequence. AEM amidite (Compound U5; Production Example 2, Compound A5; Production Example 3, Compound G5; Production Example 4, Compound C5; Production Example 5, Compound B5; Production Example 10), AEC amidite (Compound U9; Production Example 7), or Compound U13 (Production Example 9) was used. The amidite was deprotected according to a conventional method. The synthesized nucleic acid molecules were purified by HPLC.

Example 1-1
The nucleic acid molecule synthesized in Production Example 11 was purified to obtain Example 1-1 with a purity of 98.8%. The AEX-HPLC chart after purification is shown in Figure 1-1. Mass spectrometry: 12283.7 (calculated value 12283.3)

Example 1-2
The nucleic acid molecule synthesized in Production Example 11 was purified to obtain Example 1-2 with a purity of 98.1%. The AEX-HPLC chart after purification is shown in Figure 1-2. Mass spectrometry: 12421.3 (calculated value 12421.4)

Example 1-3
The nucleic acid molecule synthesized in Production Example 11 was purified to obtain Example 1-3 with a purity of 98.8%. The AEX-HPLC chart after purification is shown in Figure 1-3. Mass spectrometry: 12559.6 (calculated value 12559.4)

Example 1-4
The nucleic acid molecule synthesized in Production Example 11 was purified to obtain Example 1-4 with a purity of 98.3%. The AEX-HPLC chart after purification is shown in Figure 1-4. Mass spectrometry: 12697.6 (calculated value 12697.5)

Example 1-5
The nucleic acid molecule synthesized in Production Example 11 was purified to obtain Example 1-5 with a purity of 97.7%. The AEX-HPLC chart after purification is shown in Figure 1-5. Mass spectrometry: 12835.2 (calculated value 12835.5)

Examples 1-6 to 1-10
Examples 1-6 to 1-10 were obtained in the same manner as Examples 1-1 to 1-5.

Example 1-11
Mix 250 μL of 100 μmol/L NI-0269, 14.5 μL of 10 mg/mL BS3/DMF solution, 5.5 μL of distilled water for injection, and 30 μL of 1 mol/L phosphate buffer (pH 8.5), and heat to 30°C. The mixture was stirred for 1.5 hours. 14.5 μL of a 20 mg/mL BS3 aqueous solution was added, and the mixture was further stirred for 3 and a half hours. After precipitating the reaction solution with ethanol, the precipitate was purified (purification device: AKTA purifier; column: Develosil C8-UG-5, 5 μm, 10 x 50 mm; flow rate: 2.5 mL/min; detection: UV 254 nm; Buffer A: 50 mmol/ _{Buffer B: 50 mmol/L TEAA (pH 7.4), 50% CH 3 CN} ), and the peak of the target product was fractionated. The separated fractions were precipitated with ethanol, and the resulting precipitate was dissolved in distilled water for injection. Example 1-11 with a purity of 74.5% was obtained. Mass spectrometry: 13750.02 (calculated value: 13750.16). The RP-HPLC chart after purification is shown in Figure 1-6.
BS3: Bis (sulfosuccinimidyl) superate, disodium salt (Dojindo Chemical Research Institute)

Examples 1-12 to 1-39
Examples 1-12 to 1-39 were obtained in the same manner as Example 1-11.
The structural formulas of these nucleic acid molecules 1-1 to 1-39 are shown in Tables 1-1 to 1-4.

[In the table, Z represents the part surrounded by a frame in the following [Formula 1] structure. ]

Examples 1-40 to 1-45
Examples 1-40 to 1-45 can be obtained in the same manner as Examples 1-1 to 1-10.

Examples 1-46 to 1-50
Examples 1-46 to 1-50 can be obtained in the same manner as Examples 1-11 to 1-39.

Example 1-51
A 42 mmol/L solution of N-succinimidyl bromoacetate in dimethylformamide (50 eq.) is added to the sense strand in 200 mM phosphate buffer (pH 8.5), and the mixture is stirred at 25° C. for 2 hours. Reagents are removed from the reaction mixture by ethanol precipitation to obtain a precipitate. The precipitate is dissolved in 200 mM phosphate buffer (pH 8.5), antisense strand (1.0 eq.) is added, and the mixture is stirred at 25°C overnight. The reaction mixture was purified by HPLC (column: XBridge Oligonucleotide, BEH C18, 2.5 μm, 10 mm x 50 mm; flow rate: 4.7 mL/min; detection: UV 260 nm; column oven: 60°C; Buffer A: 50 mmol/L TEAA ( pH 7.3), 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.3), 50% CH ₃ CN), and Example 1-51 can be obtained.
In this example, N-succinimidyl bromoacetate is used as the linker compound.

Production example 12
Synthesis of linker compound 10

To a solution of 3,6-Dioxaoctanedioic acid (178 mg, 1.0 mmol) in acetonitrile (3 mL) were added pyridine (162 μL) and N,N'-disuccinimidyl carbonate (512 mg, 2.0 mmol), and the solution was stirred at room temperature. Stir for hours. After concentrating the solution under reduced pressure, 1 mol/L hydrochloric acid was added and extracted with dichloromethane. The organic layer was dried with sodium sulfate. The solution was concentrated under reduced pressure to obtain 179 mg of a crude product containing Compound 10.
ESI-Mass: 395.0699 [M+Na] ⁺

Example 1-52
In 200 mM phosphate buffer (pH 8.5), 5 nmol each of the sense strand and antisense strand were mixed to a final concentration of 100 μM, 50 mmol/L Compound 10/DMSO solution (50 eq.) was added, and the mixture was incubated at 21°C. Let stand for 15 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 1-52 can be obtained.

Example 1-53
In 200 mM phosphate buffer (pH 8.5), 20 nmol each of the sense strand and antisense strand were mixed to a final concentration of 200 μM, and a 50 mmol/L DMF solution (30 eq.) of DST Crosslinker (Funakoshi) was added. Stir at 30°C for 3 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 1-53 can be obtained.
DST: Disuccinimidyl tartrate (Funakoshi)

Production example 13
Synthesis of linker compound 11

N,N-dimethylformamide (20 μL) was added to a solution of isophthalic acid (84 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 45 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 80 minutes. The reaction mixture was concentrated under reduced pressure. To a solution of the obtained residue in dichloromethane (2 mL) were added N-hydroxysuccinimide (140 mg, 1.2 mmol) and pyridine (0.5 mL), and the mixture was stirred at room temperature for 45 minutes. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain a crude product containing Compound 11.

Example 1-54
Mix 20 nmol each of the sense strand and antisense strand to a final concentration of 200 μM in 200 mM phosphate buffer (pH 8.5), add 50 mmol/L compound 11/DMSO solution (30 eq.), and mix at 30°C. Stir for 40 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 1-54 can be obtained.

Production example 14
Synthesis of linker compound 15

(1) Synthesis of Compound 13 In a dichloromethane (50 mL) solution of Compound 12 (5.3 g, 21.6 mmol) and monomethyl suberate (4.9 g, 1.2 eq.), 1-ethyl-3- (3-dimethylaminopropyl)carbodiimide hydrochloride (5.0 g, 1.2 eq.) was added and stirred at room temperature overnight. Water and a saturated aqueous sodium bicarbonate solution were added to the reaction mixture, extracted with dichloromethane, and the organic layer was dried over magnesium sulfate. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (n-hexane:ethyl acetate = 30:70 to 0:100) to obtain 9.4 g of target compound 13 as a colorless oil. Obtained.
ESI-Mass: 438.24 [M+Na] ⁺

(2) Synthesis of compound 14 Trifluoroacetic acid (17.3 mL, 10 eq.) was added to a solution of compound 13 (9.4 g, 22.6 mmol) in dichloromethane (80 mL) under an argon atmosphere, and the mixture was stirred at room temperature for 3 hours. did. The reaction mixture was concentrated under reduced pressure to obtain 8.3 g of target compound 14 as a pale yellow oil.
ESI-Mass: 304.09 [M+H] ⁺

(3) Synthesis of Compound 15 In a dichloromethane (80 mL) solution of Compound 14 (3.0 g, 9.9 mmol) and pentafluorophenol (4.6 g, 2.5 eq.), 1-ethyl-3- (3-dimethylaminopropyl)carbodiimide hydrochloride (4.7 g, 2.5 eq.) and 4-dimethylaminopyridine (121 mg, 0.1 eq.) were added, and the mixture was stirred at room temperature overnight. After concentrating the solution under reduced pressure, the resulting residue was purified by silica gel column chromatography (dichloromethane:ethyl acetate = 100:0 to 85:15) to obtain the crude product of target compound 15 as a pale yellow oil. 5.6g was obtained.
ESI-Mass: 658.08 [M+Na] ⁺

Example 1-55
Mix 20 nmol each of the sense strand and antisense strand to a final concentration of 200 μM in 200 mM phosphate buffer (pH 8.5), add 30 mmol/L Compound 15/DMF solution (30 eq.), and mix at 30°C. Stir for 2 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN) to obtain Example 1-55.

Example 1-56
20 nmol each of the sense strand and antisense strand (30 μL aqueous solution in total), 20 μL of 30 mmol/L DSP/DMF solution, 20 μL of 1% triethylamine aqueous solution, and 30 μL of 2-propanol are mixed and stirred at 30° C. for 45 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 1-56 can be obtained.
DSP: Dithiobis (succinimidyl propionate) (Dojindo Chemical Research Institute)
The structural formulas of these nucleic acid molecules 1-40 to 1-56 are shown in Tables 1-5 to 1-6.

[In the table, Z represents the part surrounded by a frame in the following [Formula 1] structure. ]

Example 2-1
In 200 mM phosphate buffer (pH 8.5), 5 nmol each of the sense strand and antisense strand were mixed to a final concentration of 100 μM, 150 nmol of an aqueous BS3 solution was added, and the mixture was stirred at 25° C. for 3 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and the peak of the target product was fractionated. The separated fractions were precipitated with ethanol, and the resulting precipitate was dissolved in distilled water for injection. Example 2-1 with a purity of 95.1% was obtained.
Mass spectrometry: 13651.1 (calculated value: 13650.3)
The RP-HPLC chart after purification is shown in Figure 2-1.

Example 2-2
It was synthesized in the same manner as in Example 2-1 to obtain Example 2-2 with a purity of 88.5%.
Mass spectrometry: 13651.1 (calculated value 13650.3)
The RP-HPLC chart after purification is shown in Figure 2-2.

Example 2-3
It was synthesized in the same manner as in Example 2-1 to obtain Example 2-3 with a purity of 99.9%.
Mass spectrometry: 14440.8 (calculated value 14440.8)
The RP-HPLC chart after purification is shown in Figure 2-3.

Example 2-4
It was synthesized in the same manner as in Example 2-1 to obtain Example 2-4 with a purity of 100.0%.
Mass spectrometry: 14440.9 (calculated value 14440.8)
The RP-HPLC chart after purification is shown in Figure 2-4.
The structural formulas of these nucleic acid molecules 2-1 to 2-4 are shown in Table 2-1.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 2]. ]

Examples 2-5 to 2-6
Examples 2-5 to 2-6 can be obtained in the same manner as Examples 2-1 to 2-4.

Example 2-7
Compound U9 (Production Example 7) is used as the 2'-position crosslinking amidite for U of the antisense strand. Example 2-7 can be obtained by synthesis in the same manner as in Example 2-1.

Example 2-8
Compound U13 (Production Example 9) is used as the 2'-position crosslinking amidite for U in the antisense strand. Example 2-8 can be obtained by synthesis in the same manner as in Example 2-1.

Production example 15
Synthesis of linker compound 16

N,N-dimethylformamide (20 μL) was added to a solution of dodecanedioic acid (115 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (140 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over sodium sulfate. The solution was concentrated under reduced pressure to obtain 232 mg of a crude product containing Compound 16.

Example 2-9
Mix 100 nmol of each of the sense strand and antisense strand, and add distilled water for injection to make a total volume of 480 μL. Add 300 μL of isopropanol, followed by 200 μL of 20 mM Compound 16/DMF solution and 20 μL of triethylamine, and stir at 25° C. for 15 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-9 can be obtained.

Example 2-10
Mix 20 nmol each of the sense strand and antisense strand in 200 mM phosphate buffer (pH 8.5), add a 50 mmol/L aqueous solution (30 eq.) of Sulfo-EGS Crosslinker (Funakoshi), and leave at 30°C for 3 hours. Stir. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-10 can be obtained.
Sulfo-EGS: Ethylene glycolbis (sulfosuccinimidylsuccinate) (Funakoshi)

Production example 16
Synthesis of linker compound 17

To a solution of COOH-PEG5-COOH (134 mg, 0.5 mmol) in acetonitrile (2 mL) were added pyridine (82 μL) and N,N'-disuccinimidyl carbonate (258 mg, 1.0 mmol), and the mixture was stirred at room temperature for 2 hours. Half stirred. After concentrating the solution under reduced pressure, 1 mol/L hydrochloric acid was added and extracted with dichloromethane. The organic layer was dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 129 mg of a crude product containing Compound 17.
ESI-Mass:483.1192[M+Na] ⁺

Example 2-11
40 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 17/DMSO solution (20 eq.) is added, and the mixture is stirred at 30° C. for 45 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-11 can be obtained.

Production example 17
Synthesis of linker compound 18

N,N-dimethylformamide (20 μL) was added to a solution of terephthalic acid (84 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 45 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 80 minutes. The reaction mixture was concentrated under reduced pressure. To a solution of the obtained residue in dichloromethane (2 mL) were added N-hydroxysuccinimide (140 mg, 1.2 mmol) and pyridine (0.5 mL), and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain a white crude product containing Compound 18.

Example 2-12
30 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 18/DMSO solution (30 eq.) is added, and the mixture is stirred at 30° C. for 40 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-12 can be obtained.

Production example 18
Synthesis of linker compound 19

N,N-dimethylformamide (20 μL) was added to a solution of 2,5-furandicarboxylic acid (79 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (145 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 1 hour. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 210 mg of a crude product containing Compound 19.

Example 2-13
30 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 19/DMSO solution (30 eq.) is added, and the mixture is stirred at 30° C. for 2 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-13 can be obtained.

Example 2-14
Example 2-14 can be obtained by synthesis using linker compound 15 in the same manner as in Example 1-63.

Example 2-15
20 nmol each of the sense strand and antisense strand (30 μL aqueous solution in total), 20 μL of 30 mmol/L DSH/DMF solution, 20 μL of 1% triethylamine aqueous solution, and 30 μL of 2-propanol are mixed and stirred at 30° C. for 45 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 2-15 can be obtained.
DSH: Dithiobis (succinimidyl hexanoate) (Dojindo Chemical Research Institute)
The structural formulas of these nucleic acid molecules 2-5 to 2-15 are shown in Table 2-2.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 2]. ]

Example 3-1
In 200 mM phosphate buffer (pH 8.5), 5 nmol each of the sense strand and antisense strand were mixed to a final concentration of 100 μM, 150 nmol of an aqueous BS3 solution was added, and the mixture was stirred at 25° C. for 3 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and the peak of the target product was fractionated. The separated fractions were precipitated with ethanol, and the resulting precipitate was dissolved in distilled water for injection. Example 3-1 with a purity of 96.9% was obtained.
Mass spectrometry: 13651.0 (calculated value 13650.3)
The RP-HPLC chart after purification is shown in Figure 3-1.

Example 3-2
It was synthesized in the same manner as in Example 3-1 to obtain Example 3-2 with a purity of 91.8%.
Mass spectrometry: 13651.2 (calculated value 13650.3)
The RP-HPLC chart after purification is shown in Figure 3-2.

Example 3-3
It was synthesized in the same manner as in Example 3-1 to obtain Example 3-3 with a purity of 96.0%.
Mass spectrometry: 14440.9 (calculated value 14440.8)
The RP-HPLC chart after purification is shown in Figure 3-3.

Example 3-4
It was synthesized in the same manner as in Example 3-1 to obtain Example 3-4 with a purity of 98.9%.
Mass spectrometry: 14441.0 (calculated value 14440.8)
The RP-HPLC chart after purification is shown in Figure 3-4.
The structural formulas of these nucleic acid molecules 3-1 to 3-4 are shown in Table 3-1.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 3]. ]

Examples 3-5 to 3-6
Examples 3-5 to 3-6 can be obtained in the same manner as Examples 3-1 to 3-4.

Example 3-7
Compound U9 (Production Example 7) is used as the 2'-position crosslinking amidite for U in the sense strand. Example 3-7 can be obtained by synthesis in the same manner as in Example 3-1.

Example 3-8
Compound U13 (Production Example 9) is used as the 2'-position crosslinking amidite for U in the sense strand. Example 3-8 can be obtained by synthesis in the same manner as in Example 3-1.

Production example 19
Synthesis of linker compound 20

N,N-dimethylformamide (20 μL) was added to a solution of nonadecanedioic acid (164 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (140 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over sodium sulfate. The solution was concentrated under reduced pressure to obtain 301 mg of a crude product containing Compound 20.

Example 3-9
Mix 100 nmol of each of the sense strand and antisense strand, and add distilled water for injection to make a total volume of 480 μL. Add 300 μL of isopropanol, followed by 200 μL of 20 mM Compound 20/DMF solution and 20 μL of triethylamine, and stir at 25° C. for 15 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-9 can be obtained.

Production example 20
Synthesis of linker compound 21

To a solution of COOH-PEG6-COOH (152 mg, 0.5 mmol) in acetonitrile (2 mL) were added pyridine (81 μL) and N,N'-disuccinimidyl carbonate (251 mg, 1.0 mmol), and the mixture was stirred at room temperature for 2 hours. Half stirred. After concentrating the solution under reduced pressure, 1 mol/L hydrochloric acid was added and extracted with dichloromethane. The organic layer was dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 205 mg of a crude product containing Compound 21.
ESI-Mass:527.1419[M+Na] ⁺

Example 3-10
40 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 21/DMSO solution (20 eq.) is added, and the mixture is stirred at 30° C. for 45 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-10 can be obtained.

Production example 21
Synthesis of linker compound 22

N,N-dimethylformamide (20 μL) was added to a solution of trans-3-hexenedioic acid (72 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 50 minutes. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (140 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 2 hours. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 186 mg of a crude product containing Compound 22.

Example 3-11
30 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 22/DMSO solution (30 eq.) is added, and the mixture is stirred at 30° C. for 30 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-11 can be obtained.

Production example 22
Synthesis of linker compound 23

N,N-dimethylformamide (20 μL) was added to a solution of 1,3-adamantanedicarboxylic acid (117 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 20 minutes. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (146 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 45 minutes. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain a crude product containing Compound 23.

Example 3-12
40 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 23/DMSO solution (50 eq.) is added, and the mixture is stirred at 30° C. for 2 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-12 can be obtained.

Production example 23
Synthesis of linker compound 24

N,N-dimethylformamide (20 μL) was added to a solution of 3,5-pyridinedicarboxylic acid (83 mg, 0.5 mmol) in dichloromethane (2 mL), and the mixture was cooled to 0°C. Oxalyl chloride (103 μL, 1.2 mmol) was added and stirred at room temperature for 30 minutes. Further, oxalyl chloride (103 μL, 1.2 mmol) was added, and the mixture was stirred at room temperature for 45 minutes. The reaction mixture was concentrated under reduced pressure. N-hydroxysuccinimide (141 mg, 1.2 mmol) and pyridine (0.5 mL) were added to a solution of the obtained residue in dichloromethane (2 mL), and the mixture was stirred at room temperature for 75 minutes. Water was added to the reaction mixture and extracted with dichloromethane. The organic layer was washed with a saturated aqueous sodium chloride solution and then dried over magnesium sulfate. The solution was concentrated under reduced pressure to obtain 266 mg of a crude product containing Compound 24.

Example 3-13
30 nmol each of the sense strand and antisense strand are mixed in 200 mM phosphate buffer (pH 8.5), a 50 mmol/L Compound 24/DMSO solution (30 eq.) is added, and the mixture is stirred at 30° C. for 2 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-13 can be obtained.

Example 3-14
Example 3-14 can be obtained by synthesis using linker compound 15 in the same manner as in Example 1-63.

Example 3-15
20 nmol each of the sense strand and antisense strand (30 μL aqueous solution in total), 20 μL of 30 mmol/L DSO/DMF solution, 20 μL of 1% triethylamine aqueous solution, and 30 μL of 2-propanol are mixed and stirred at 30° C. for 45 minutes. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and Example 3-15 can be obtained.
DSO: Dithiobis (succinimidyl octanoate) (Dojindo Chemical Research Institute)
The structural formulas of these nucleic acid molecules 3-5 to 3-15 are shown in Table 3-2.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 3]. ]

Example 4-1
In 200 mM phosphate buffer (pH 8.5), 20 nmol each of the sense strand and antisense strand were mixed to a final concentration of 200 μM, 600 nmol of an aqueous BS3 solution was added, and the mixture was stirred at 25° C. for 2 hours. Purify the reaction solution (column: XBridge Oligonucleotide BEH C18, 2.5 μm, 10 x 50 mm; flow rate: 4.7 mL/min; column temperature: 60°C; detection: UV 260 nm; Buffer A: 50 mmol/L TEAA (pH 7.4) , 5% CH ₃ CN; Buffer B: 50 mmol/L TEAA (pH 7.4), 90% CH ₃ CN), and the peak of the target product was fractionated. The separated fractions were precipitated with ethanol, and the resulting precipitate was dissolved in distilled water for injection. Example 4-1 with 100% purity was obtained.
Mass spectrometry: 13285.9 (calculated value: 13285.1)
The RP-HPLC chart after purification is shown in Figure 4-1.

Example 4-2
It was synthesized in the same manner as in Example 4-1 to obtain Example 4-2 with a purity of 99.5%.
Mass spectrometry: 13937.5 (calculated value 13936.5)
The RP-HPLC chart after purification is shown in Figure 4-2.
The structural formulas of these nucleic acid molecules 4-1 and 4-2 are shown in Table 4-1.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 4]. ]

Examples 4-3 to 4-32 The nucleic acids of Examples 4-3 to 4-32 can be obtained in the same manner as PCT/JP2021/31252.
The structural formulas of these nucleic acid molecules 4-3 to 4-32 are shown in Tables 4-2 to 4-4.

[In the table, Z represents the part surrounded by a frame of the structure of [Formula 4]. ]

Example 5-1
20 μM sense strand and antisense strand, 50 mM phosphate buffer (pH 7.0), and 100 mM sodium chloride solution were mixed, allowed to stand at 90° C. for 5 minutes, and then allowed to cool to room temperature. The resulting solution was cooled to 0° C. and irradiated with a UV wavelength of 365 nm for 30 seconds. The RP-HPLC chart after the reaction is shown in Figure 5-1. Example 5-1 with a purity of 97.7% was obtained.
Mass spectrometry: 14002.1 (calculated value: 14001.5)

Example 5-2
It was synthesized in the same manner as in Example 5-1 to obtain Example 5-2 with a purity of 95.2%. The RP-HPLC chart after the reaction is shown in Figure 5-2.
Mass spectrometry: 13327.7 (calculated value 13327.1)

Example 5-3
It was synthesized in the same manner as in Example 5-1 to obtain Example 5-3 with a purity of 78.4%+20.1%. The RP-HPLC chart after the reaction is shown in Figure 5-3.
Mass spectrometry: 13986.1 (calculated value 13985.5)

Example 5-4
Example 5-4 was obtained by synthesizing in the same manner as in Example 5-1. The RP-HPLC chart after the reaction is shown in Figure 5-4.
Mass spectrometry: 13327.7 (calculated value 13327.1)
Furthermore, the four observed peaks were isolated (Figures 5-5, 5-6, 5-7, and 5-8).

Examples 5-5 to 5-8
Examples 5-5 to 5-8 were obtained in the same manner as Examples 5-1 to 5-4.
The structural formulas of these nucleic acid molecules 5-1 to 5-8 are shown in Table 5-1.

[In the table, the cross-link structure is

CL-5 represents the structure of [Formula 5] below,

CL-6 represents the structure of [Formula 6] below. ]

Examples 5-9, 5-10
Examples 5-9 and 5-10 can be obtained in the same manner as Examples 5-1 to 5-8.
The structural formulas of these nucleic acid molecules 5-9 and 5-8 are shown in Table 5-2.

[In the table, the cross-link structure is

CL-7 represents the following structure,

CL-8 represents the following structure. ]

Example 6: Evaluation of the ability of nucleic acid molecules to suppress gene expression The ability of the nucleic acid molecules produced in each example to suppress gene expression was evaluated. H1299 cells were used for gene expression evaluation. RPMI (Invitrogen) containing 10% FBS was used as a medium and cultured at 37°C _under 5% CO2.

First, cells were cultured in a medium, and 400 μL of the cell suspension was dispensed into a 24-well plate at a density of 5×10 ⁴ cells/well. Furthermore, cells in the wells were transfected with nucleic acid molecules using the transfection reagent Lipofectamine RNAiMAX (Invitrogen) according to the attached protocol. Specifically, the composition per well was set as follows and transfection was performed. In the following composition, (B) is Opti-MEM (Invitrogen) and (C) is a nucleic acid molecule solution, and 100 μL of both were added in total.

After culturing for 24 hours after transfection, RNA was collected using RNeasy Mini Kit (QIAGEN) according to the attached protocol. Next, using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara), according to the attached protocol, the expression level of the NEK6 gene and the GAPDH gene, which is an internal standard, the expression level of the TGFB1 gene, and the GAPDH gene, which is an internal standard, The expression level of the GAPDH gene and the expression level of the internal standard HPRT1 gene were measured. The expression level of the target gene was corrected by the expression level of the internal standard gene.

PCR was performed using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) as a reagent and LightCycler 480 Instrument II (Roche) as an instrument. The following primer sets were used to amplify each gene.
Primer set for NEK6 gene
5'-ggagttccaacacctctgc-3'
5'-gagccactgtcttcctgtcc-3'
Primer set for GAPDH gene
5'-atggggaaggtgaaggtcg-3'
5'-gggtcattgatggcaacaatatc-3'
Primer set for TGFB1 gene
5'-gctaatggtggaaccccaca-3'
5'-cggagctctgatgtgttgaa-3
Primer set for HPRT1 gene
5'-gaaaaggaccccacgaagtgt-3'
5'-agtcaagggcatatcctacaaca-3'

In addition, as a control, cells treated in the same manner except that (C) the nucleic acid molecule solution was not added and 1.0 μL of the transfection reagent solution and (B) were added for a total of 100 μL were also treated. The expression level was measured (mock).

Regarding the expression level of each gene after correction, the expression level in control (mock) cells was set as 1, and the relative value of the expression level in cells into which each nucleic acid molecule was introduced was determined (Figures 6 to 15).
FIG. 6 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-1 to 1-5 were transfected at a final concentration of 1 nM.
FIG. 7 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-6 to 1-10 were transfected at a final concentration of 1 nM.
FIG. 8 is a graph showing the NEK6 gene expression level when transfected with the nucleic acid molecule of Example 1-15 at a final concentration of 1 nM.
FIG. 9 is a graph showing the expression level of the TGFB1 gene when the nucleic acid molecules of Examples 1-31 to 1-34 were transfected at a final concentration of 1 nM.
FIG. 10 is a graph showing the GAPDH gene expression level when the nucleic acid molecules of Examples 1-35 to 1-38 were transfected at a final concentration of 1 nM.
FIG. 11 is a graph showing the NEK6 gene expression level when the nucleic acid molecules of Examples 2-1, 2-2, 3-1, and 3-2 were transfected at a final concentration of 10 nM.
FIG. 12 is a graph showing the GAPDH gene expression level when the nucleic acid molecules of Examples 2-3, 2-4, 3-3, and 3-4 were transfected at a final concentration of 10 nM.
FIG. 13 is a graph showing the NEK6 gene expression level when the nucleic acid molecules of Examples 4-1 and 4-2 were transfected at a final concentration of 10 nM.
FIG. 14 is a graph showing the NEK6 gene expression level when transfected with the nucleic acid molecule of Example 5-4 at a final concentration of 1 nM.
FIG. 15 is a graph showing the NEK6 gene expression level when the nucleic acid molecules of Examples 5-4, 1-11, 1-12, 1-13, and 1-14 were transfected at predetermined final concentrations.
As can be seen from FIGS. 6 to 15, the nucleic acid molecules of the present invention were found to suppress the expression of target genes.

Example 7: Evaluation of off-target effects caused by the sense strand using a reporter assay system A reporter plasmid was prepared as described below, and the off-target effects caused by the sense strand were confirmed.

(1) Preparation of reporter plasmid A reporter plasmid used in the following reporter assay was prepared. The production was outsourced to GENEWIZ.

Based on the sequence information of the loaded expression suppressing sequence (antisense strand) and its complementary sequence (sense strand), the following two types of artificial DNA (hereinafter referred to as synthetic fragments) were chemically synthesized. A restriction enzyme recognition sequence ( Xho I; CTCGAG) was added to the 5' end of the synthetic fragment, and a restriction enzyme recognition sequence ( Not I; GCGGCCGC) was added to the 3' end. An artificial DNA with a sequence complementary to this sequence is similarly synthesized (however, contrary to the sequence, Xho I is added to the 5' end and Not I is added to the 3' end), and a double strand is formed with this sequence. , restriction enzyme recognition site Two types of reporter plasmids, Guide10 and Pass10, were constructed by incorporating the above synthetic fragment. Guide10 is a reporter plasmid that measures the activity of the antisense strand, while Pass10 is a reporter plasmid that measures the activity of the sense strand. In addition, in the cultured cells, the fusion mRNA of the hRluc gene and the synthetic fragment (target mRNA) and hluc+ (correction mRNA) are expressed from the reporter plasmid.

Guide10.
5'- GAGATAAGATGAATCTCTTCTCC AAGCAGAGTACACACAGCATATAAACACTGATTTCAAATGGTGCTAGAACAACCAGCTAAGACACTGCCACTCGCATTATTACTCACGGTACGAGTTCCACACGTGGACTCGGATCTGCTCCTTGAATGCTGGCGGTTCATTGGGCAAGTTTCTTAGCCGTTCTTTGCCTTACTTGAGTCGTCTTCTGTGGTTCAGCGAGCCACGGCAGC-3'
Pass10.
5'- GGAGAAGAGATTCATCTTATCTC TATATGCTGTGTGTACTCTGCTTTCTAGCACCATTTGAAATCAGTGTTAGTGGCAGTGTCTTAGCTGGTTGTCGCGTACCAAAAGTAATAATGCGCAAATCCGAGTCCACGTGTGGAAATAAACCGCCAGCATTCAAGGAGAGAACGGCTAAGAAACTTGCCCAAGAAAACGACTCAAGTAAGGCAAGCTACCGTGGCTCGCTGAACCAC-3'

The underlined portion in the above sequence indicates the target sequence of the antisense strand and sense strand of the nucleic acid molecule described below.

(2) Measurement of hRluc gene expression suppression effect in reporter assay system The reporter plasmid and nucleic acid molecule were transfected into cultured cells, and the hRluc gene expression suppression effect was confirmed.

(a) Materials and Methods Each nucleic acid molecule solution was prepared using distilled water for injection (Otsuka Pharmaceutical). A reporter plasmid solution was prepared using TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).

HCT116 cells (DS Pharma Biomedical) were used. A DMEM (GIBCO) medium containing 10% FBS was used as the medium, and the cells were cultured at 37° C. and 5% CO ₂ .

First, cells were seeded at 2×10 ⁶ cells in a 10 cm dish. After further culturing the cells for 24 hours, 3 μg of the reporter plasmid was transfected using the transfection reagent Lipofectamine 2000 (Invitrogen) according to the attached protocol of the transfection reagent. Specifically, the composition per well was set as follows and transfection was performed. In the following composition, (B) is Opti-MEM (Invitrogen) and (C) is a 100 ng/μL reporter plasmid solution, and a total of 1.955 mL of both was added.

After 24 hours, the cells were collected, the number of cells was counted, and a cell suspension was prepared using a medium to give a concentration of 2×10 ⁵ cells/mL. Using the transfection reagent Lipofectamine RNAiMAX (Invitrogen), cells were transfected with nucleic acid molecules (siRNA, Examples 1-11 (L type)) in a 96-well plate (B&W IsoPlate-96 TC, PerkinElmer) according to the attached protocol of the transfection reagent. , R type of Example 1-11; Figure 17)). Specifically, transfection was performed with the composition per well set as follows. In the following composition, (B) is Opti-MEM (Invitrogen) and (C) is a nucleic acid molecule solution, and 14.8 μL of both were added in total. The final concentrations of nucleic acid molecules were 0.01, 0.1, and 1 nmol/L. As a control (reference) in transfection, a 14.8 μL well containing only (B) without (C) was set.

After further culturing for 24 hours, the luminescence of hRluc and hluc+ was measured using the Dual-Glo Luciferase Assay System (Promega) according to the attached protocol. The hRluc/hluc+ ratio of each well was determined from each measured value. Furthermore, the hRluc/hluc+ ratio of the control (reference) was set to 1, and the relative expression level of hRluc in each well was calculated.

(b) Results A graph showing the expression level of the hRluc gene fused with the target RNA sequence of the antisense strand sequence in cells transfected with each nucleic acid molecule is shown in FIG. As shown in FIG. 15, the L-type nucleic acid molecule prepared in Example 1-11 suppressed the expression of the hRluc gene at a level equivalent to that of siRNA. This result is consistent with the RT-PCR result. On the other hand, the R type of Example 1-11 did not suppress the expression of the hRluc gene.

Further, FIG. 16 shows a graph showing the expression level of the hRluc gene fused to the target RNA sequence of the sense strand sequence in cells transfected with the nucleic acid molecule. siRNA strongly suppressed the expression of the hRluc gene, but Example 1-1 did not suppress the expression of the hRluc gene. On the other hand, the R type of Example 1-11 strongly suppressed the expression of the hRluc gene, similar to siRNA.

In a similar manner, off-target effects of the sense strand were investigated for the nucleic acid molecules of Examples 2-1 and 3-1. The final concentration of nucleic acid molecules was 1 nmol/L.
The results are shown in FIG. Examples 2-1 and 3-1 did not suppress hRluc gene expression.

From the above results, the L-type nucleic acid molecule of the present invention (1) has gene expression suppression activity equivalent to or higher than that of siRNA, and (2) the off-target effect caused by the sense strand is sufficiently attenuated. , can be used more safely than conventional siRNA. Furthermore, at least the off-target effects caused by the sense strand can be ignored, so (3) it is possible to design a wider range of antisense strand sequences than with conventional siRNA.

Since the L-type nucleic acid molecule of the present invention has the above-mentioned excellent properties (1) to (3), it is extremely useful as a novel gene expression suppressor in place of conventional siRNA.

Claims (17)

The general formula below:

[wherein X, Y, X ₁ , Y ₁ , X ₂ , Y ₂ are each independently an optionally modified ribonucleotide residue or an optionally modified deoxyribonucleotide residue,
T and Q are a sequence consisting of 14 to 30 consecutive optionally modified ribonucleotide residues complementary to the target nucleic acid sequence and a ribonucleotide sequence complementary thereto (one is complementary to the target nucleic acid sequence). If a sequence is complementary to one sequence, the other is a complementary sequence to it),
Z is a linker that connects the 2' or 5' position of the sugar moiety of (X) and the 2' or 3' position of the sugar moiety of (Y), or the base moiety of (X) and (Y) It is a linker that connects the base part of
m ₁ and m ₂ are each independently an integer of 0 to 5;
n ₁ and n ₂ are each independently an integer of 0 to 5]
Nucleic acid molecule shown as . The nucleic acid molecule according to claim 1, wherein the linker Z is a non-nucleotide structure having an alkyl chain having an amide bond therein, or a structure that connects the base moiety of (X) and the base moiety of (Y). In the formula, the following including linker Z

The nucleic acid molecule according to claim 1 or 2, wherein the structure of is selected from [Formula 1], [Formula 2], [Formula 3], or [Formula 4].




or

[In the formula, B and B' are each independently an atomic group having a nucleobase skeleton,
A ₁ and A ₁ ' are each independently -O-, -NR ^1a -, -S- or -CR ^1a R ^1b - (here, R ^1a and R ^1b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₂ and A ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₃ and A ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₄ and A ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms) , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
A ₅ and A ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
A ₆ and A ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group; n is an integer from 1 to 6),
W ₁ is -(CR ¹ R ² )n-, -CO-, -(CR ¹ R ² )n-COO-(CR ¹ R ² )n-COO-(CR ¹ R ² )n, -(CR ¹ R ² ) n-O-(CR ¹ R ² CR ¹ R ² O) n-CH ₂ -, -(CR ¹ R ² ) n-ring D-(CR ¹ R ² ) n- or -(CR ¹ R ² )n-SS-(CR ¹ R ² )n- (wherein, ring D is an aryl group having 6 to 10 carbon atoms, a heteroaryl group having 2 to 10 carbon atoms, or a heteroaryl group having 4 to 10 carbon atoms. It is a cycloalkyl group or a heterocycloalkyl group having 4 to 10 carbon atoms; R ¹ and R ² are each independently a hydrogen atom or an alkyl group having 1 to 10 carbon atoms; n is an integer of 1 to 6; be),
E ₂ and E ₂ ' are each independently -CR ^2a R ^2b -, -CO-, an alkynyl group, an alkenyl group, or a single bond (here, R ^2a and R ^2b are each independently a hydrogen atom). or an alkyl group having 1 to 10 carbon atoms),
E ₃ and E ₃ ' are each independently -O-, -NR ^3a -, -S-, -CR ^3a R ^3b - or a single bond (here, R ^3a and R ^3b are each independently is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₄ and E ₄ ' are each independently -(CR ^4a R ^4b )n-, -(CR ^4a R ^4b )n-ring D- (here, ring D is an aryl group having 6 to 10 carbon atoms); , a heteroaryl group having 2 to 10 carbon atoms, a cycloalkyl group having 4 to 10 carbon atoms, or a heterocycloalkyl group having 4 to 10 carbon atoms; R ^4a and R ^4b are each independently a hydrogen atom or a carbon number is an alkyl group of 1 to 10; n is an integer of 1 to 6) or a single bond,
E ₅ and E ₅ ' are each independently -NR ^5a - or a single bond (wherein R ^5a is a hydrogen atom or an alkyl group having 1 to 10 carbon atoms),
E ₆ and E ₆ ' are each independently -(CR ^6a R ^6b )n- or a single bond (here, R ^6a and R ^6b are each independently a hydrogen atom or a carbon number of 1 to 10). is an alkyl group: n is an integer from 1 to 6)]. In the formula, the following including linker Z

The structure of [Formula 1]

The nucleic acid molecule according to any one of claims 1 to 3, which is [wherein the definitions of each symbol are the same as above]. In the formula, the following including linker Z

The structure of [Formula 2]

or [Formula 3]

The nucleic acid molecule according to any one of claims 1 to 3, wherein the definition of each symbol is the same as above. In the formula, the following including linker Z

The structure of [Formula 4]

The nucleic acid molecule according to any one of claims 1 to 3, which is [wherein the definitions of each symbol are the same as above]. In the formula, the following including linker Z

The structure of [Formula 5]

or [Formula 6]

The nucleic acid molecule according to claim 1 or 2, which is selected from the following. Nucleic acid molecule according to any one of claims 1 to 7, comprising at least one modified nucleotide. The modified nucleotide may be a 2'-O-methyl modified nucleotide, a 2'-deoxy-nucleotide, a 2'-fluoro modified nucleotide, a nucleotide bound to a lipid molecule such as a cholesteryl derivative, a nucleotide bound to a peptide molecule, a fixed nucleotide, or a non-fixed nucleotide. nucleotide, conformationally restricted nucleotide, constrained ethyl nucleotide, non-basic nucleotide, 2'-amino-modified nucleotide, 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2 '-hydroxyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinonucleotides, phosphoroamidates, nucleotides containing unnatural bases, tetrahydropyran-modified nucleotides, 1,5-an selected from the group consisting of hydroxytol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a phosphorothioate group, nucleotides containing a methylphosphonate group, nucleotides containing a 5'-phosphate, and nucleotides containing a 5'-phosphate mimetic. , the nucleic acid molecule according to any one of claims 1 to 8. A medicament comprising the nucleic acid molecule according to any one of claims 1 to 9. An expression inhibitor for a target gene, comprising the nucleic acid molecule according to any one of claims 1 to 9, wherein the target gene contains the target nucleic acid sequence. A therapeutic agent for cancer or fibrosis, comprising the expression inhibitor according to claim 11. A method for suppressing the expression of a target gene, the method comprising contacting the target gene with an effective amount of the nucleic acid molecule according to any one of claims 1 to 9. A method for treating cancer or fibrosis, comprising contacting a target gene with an effective amount of the nucleic acid molecule according to any one of claims 1 to 9. 15. The method of claim 13 or 14, comprising administering the nucleic acid molecule to a cell, tissue or organ. 16. The method according to any one of claims 13 to 15, wherein the nucleic acid molecule is administered in vivo or in vitro. 17. The method according to any one of claims 13 to 16, wherein the nucleic acid molecule is administered to a non-human animal.