JP2023088734A - Antitumor agent comprising rna, method for activating immune cell, method for inhibiting metastasis of tumor cell, immunostimulator, agent for enhancing antitumor effect of antitumor agent, and pharmaceutical composition - Google Patents

Abstract

To provide an antitumor agent that comprises, as an active ingredient, RNA to activate an immune cell.SOLUTION: An antitumor agent comprises, as an active ingredient, RNA having a base sequence of the following (i), (ii), or (iii) and comprising at least one chemical modification: (i) a base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8, (ii) a base sequence having at least 90% identity to the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8, (iii) a base sequence at least having successive 20-200 bases in the base sequence of (i) or (ii).SELECTED DRAWING: Figure 15

Description

Applied for application of Article 30, Paragraph 2 of the Patent Law Date of publication June 16, 2021 Address of publication https://www. nature. com/articles/s41467-021-23969-1

TECHNICAL FIELD The present invention relates to an antitumor agent containing RNA, a method for activating immune cells, a method for suppressing metastasis of tumor cells, an immunostimulator, an agent for enhancing the antitumor effect of an antitumor agent, and a pharmaceutical composition.

It is well known that intercellular communication driven by signaling molecules such as hormones, cytokines, autacoids and neurotransmitters is critical to tissue function. In recent years, extracellular vesicles (EV) containing extracellular RNA (exRNA) such as microvesicles and exosomes, and nonvesicular ribonucleoprotein complexes (RNP) have been extensively used as important transducers for intercellular communication. (Non-Patent Document 1). Among them, it has been reported that tumor-derived EVs non-specifically integrate into secondary cells to support tumor progression (Non-Patent Document 2). However, it has not been established whether an exRNA-mediated specific response to target cells exists, and if so, what biological response is elicited.

Tumor metastasis is one of the important problems involving intracellular signaling. Many worthwhile studies have shown that metastasis involves complex systemic events between host and tumor cells. Specifically, tissues and immune cells in the host form a tumor-friendly pre-metastatic soil, followed by the physical appearance of tumor cells in distant tissues. (Non-Patent Document 2). Although the primary therapeutic target is the primary tumor, due to the widespread dissemination of circulating and resting tumor cells, other strategies, including prophylactic chemotherapy and immunotherapy, are also important for reducing the risk of metastasis. So far, no antimetastatic therapy has been established that interferes with the empowerment of tumor cells by host tissue cells (Non-Patent Document 3).

JCI Insight 3, doi:10.1172/jci.insight.98942 (2018) Nat Rev Cancer 17, 302-317, doi:10.1038/nrc.2017.6 (2017) Trends Cancer 3, 391-406, doi:10.1016/j.trecan.2017.04.008 (2017)

We recently discovered latent anti-metastatic immune cells in the pre-metastatic soil (EMBO Mol Med 10, doi:10.15252/emmm.201708643 (2018)). Specifically, we found that B220 ⁺ CD11c ⁺ NK1.1 ⁺ natural killer (NK) cells migrated from liver to lung in cancer-bearing mice. Such cells accumulate in fibrinogen ⁺ hyperpermeable sites, demonstrating dual anti-metastatic activity. That is, such cells remove concentrated fibrinogen and possess tumor-destructive potential through interferon gamma (IFNγ) production (Nat Commun 4, 1853, doi:10.1038/ncomms2856 (2013)). The molecular mechanisms underlying the migration of B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells from liver to lung and their anti-metastatic potential remain to be elucidated. A comparison of gene expression analysis between liver B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells and lung B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells showed that ZC3H12D, which belongs to the RNA-binding zinc finger family, had the highest magnification in lung cells. It was shown to show a change in Additionally, ZC3H12D has been reported as a putative tumor suppressor in lymphoma and lung cancer patients (Cancer Res 67, 93-99, doi:10.1158/0008-5472. CAN-06-2723 (2007); Br J Haematol 139, 161 -163, doi:10.1111/j.1365-2141.2007.06752.x (2007)). We therefore hypothesized that the ZC3H12D protein interacts specifically with extracellular RNA in antimetastatic function.

The problems to be solved by the present invention are an antitumor agent containing RNA capable of activating immune cells, a method for activating immune cells, a method for suppressing metastasis of tumor cells, an immunostimulator, and an antitumor agent of an antitumor agent. An object of the present invention is to provide an effect enhancer and a pharmaceutical composition.

The present invention includes embodiments described below.

Section 1. An antitumor agent comprising, as an active ingredient, an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A nucleotide sequence having at least 20 to 200 consecutive nucleotide sequences among the above (i) or (ii) nucleotide sequences Item 2. The at least one chemical modification is such that 80% or more of the total number of uridine nucleosides in the RNA is pseudouridine, 1-methylpseudouridine, 1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methyl Cytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- Dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza- Item 2. The antitumor agent according to Item 1, which comprises a uridine analogue selected from the group consisting of uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine.
Item 3. The RNA is a variant of RNA having the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, and the coding sequence from 88th to 897th of the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 has bases substituted to have 1 to 5 additional stop codons compared to the native coding sequence.
Section 4. Item 3. The antitumor agent according to Item 1 or 2, wherein the RNA has a length of 20 to 200 bases.
Item 5. Item 2. The antitumor agent according to item 2, which has the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) A base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences Item 6. A method for activating immune cells in vitro or in a non-human animal, comprising administering to cells an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification: .
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive bases among the base sequences of (i) or (ii) Item 7. Suppression of metastasis of tumor cells in vitro or in a non-human animal comprising administering to cells an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification: Method.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A nucleotide sequence having at least 20 to 200 consecutive nucleotide sequences among the above (i) or (ii) nucleotide sequences Item 8. The at least one chemical modification is such that 80% or more of the total number of nucleosides in the RNA are uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 5-methyl Cytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- Dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza- Item 8. The method of item 6 or 7, wherein the method comprises a uridine analogue selected from the group consisting of uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine.
Item 9. The RNA is a variant of RNA having the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, and the coding sequence from 88th to 897th of the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.
Item 10. Item 9. The method according to any one of Items 6 to 8, wherein the RNA has a length of 20 to 200 bases.
Item 11. Item 8. The method according to Item 8, which has the following base sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) A nucleotide sequence having at least 20 to 150 consecutive nucleotide sequences among the above (i) or (ii) nucleotide sequences Item 12. An immunostimulant comprising, as an active ingredient, an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences Item 13. Enhancement of the immunostimulatory effect of an immunostimulatory agent or the antitumor effect of an antitumor agent, comprising an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification agent.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences Item 14. A pharmaceutical composition containing RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A nucleotide sequence having at least 20 to 200 consecutive nucleotide sequences among the above (i) or (ii) nucleotide sequences Item 15. Item 15. The pharmaceutical composition according to item 14, which is a pharmaceutical composition for the prevention and/or treatment of tumors.

The antitumor agent of the embodiment of the present invention can activate immune cells to effectively suppress tumors. According to the method for activating immune cells of another embodiment of the present invention, immune cells can be effectively activated. According to the method for suppressing metastasis of tumor cells according to another embodiment of the present invention, metastasis of tumor cells can be effectively suppressed. The immunostimulant of another embodiment of the present invention can effectively activate immune cells. The antitumor effect enhancer of an antitumor agent according to another embodiment of the present invention can effectively enhance the antitumor effect of an antitumor agent. The pharmaceutical composition of another embodiment of the invention is useful for the prevention and/or treatment of tumors.

(A) ZC3H12D ⁺ CD45 ⁺ leukocytes increased in the lungs of tumor-bearing mice generated by E07701 cell transplantation during primary tumor growth. Immunization against lung tissue harvested from mice bearing primary tumor sizes of 0 mm (n=3), 4 mm (n=3), 7 mm (n=3), and 9 mm (n=3). A tissue staining test was performed. Mean ± s.e.m. (B) Assay system for examining mRNA levels in CD45 ⁺ leukocytes when co-cultured with lung tissue in the top well and CD45 ⁺ leukocytes in the bottom well (left panel). Zc3h12d expression was stimulated by tumor-bearing lungs. Lungs were obtained from tumor-bearing mice (n=7) (left panel, 2 Tu-Lu) and lungs were obtained from tumor-free mice (n=7) (left panel, 1 No-Lu). Lu). mRNA levels by stimulation with each lung (right panel), mean±s.e.m., Welch's t-test. (C) Metastatic nodule number in each mouse type. Mean±s.e.m., Welch's t-test. (D) Overall tumor size in each mouse type. Mean±s.e.m., Welch's t-test. Detection of cell surface ZC3H12D and extracellular tumor-associated IL1β-mRNA. (A) FACS analysis of surface and intracellular ZC3H12D protein in peripheral blood mononuclear cells (PBMC) from tumor-free or tumor-bearing mice. Anti-ZC3H12D antibody (bold line ab100862 antibody) and control isotype antibody (dotted line) were used. (B) Kinetics of ZC3H12D expression in splenocytes after stimulation with tumor cell culture supernatant (TCM). Bars represent 5 μm. (C) Flow cytometric analysis of ZC3H12D on RAW 264.7 cell surface 3 hours after TCM stimulation. Addition of RNase A to TCM did not cause entry of ZC3H12D into cells (right lane). NoCM is control culture supernatant (CM) without tumor cells (n=3 per group). (D) Reduction of surface ZC3H12D after application of purified RNA from TCM by FACS analysis (n=3, No (no RNA), n=7 RNA-TCM). The graph in FIG. 2 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. (A) Fluorescence confocal microscopy of ZC ⁺ RAW after application of FITC-labeled IL1β-mRNA and β-actin mRNA with or without Cap-Poly (A) (CP). Show a 3D image. Data are representative of 5 independent experiments. (B) Human-mouse-chimeric IL1β-mRNA followed by reverse transcription using 3′-mouse gene-specific primers and 5′-human probe in RT-qPCR analysis for detection of external IL1β-mRNA. system (upper panel). Detection of chimeric IL1β-mRNA entry into ZC ⁺ RAW. Nuclear and cytoplasmic RNA were normalized to Hotair and β-actin, respectively (n=7-8 per group). (C) 3D images showing the time course of IL1β-mRNA-FITC uptake in the nucleus of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated Zc4h12d+/- and Zc4h12d−/− mice (left panel). Quantitative analysis of RNA-FITC in the nucleus of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells (right panel). (A) IL1β-mRNA domain-dependent ZC after addition of FITC-labeled full-length (full), CDS (full-length minus 3′UTR) or 100 ng/mL 3′UTR IL1β-mRNA (3′UTR) ⁺ Quantitative analysis of nuclear uptake of RAW. (B) Competition assay for IL1β-mRNA uptake in the nucleus of ZC ⁺ RAW. Uptake of full-length IL1β was inhibited by pretreatment with 3′UTR IL1β. Mean values (N=11-14 3D images per group). The graph in FIG. 4 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. ZC3H12D recognizes a specific sequence of IL1β-mRNA. (A) Narrowing scheme for determining the ZC3H12D binding site in the murine IL1β-mRNA (NM_008361) 3'UTR. Each number indicates a nucleotide position. (B) Electrophoretic mobility shift assay (EMSA). Mouse IL1β probes (EMSA probes 1-9) were assayed with or without ZC3H12D. Probes 1-9 are 50 nucleotides in length and labeled with biotin at the 3' end. Arrows indicate band shifts due to binding of ZC3H12D to probe 5. (C) EMSA competition assay. The interaction between ZC3H12D and probe 5 was tested. ZC3H12D protein and biotin-labeled probe 5 (50 nm) were mixed with a 100-fold excess of unlabeled probes 1-9 (5 μM). (D) EMSA competition assay. The interaction between ZC36 protein and probe 5 was tested. ZC36 protein and biotin-labeled probe 5 (50 nm) were mixed with 100-fold excess of unlabeled probes 5-1 to 5-7 (5 μM). These competitors are 20 nucleotides in length and part of probe 5. The graph shows the relative intensity of the upper band (=upper band/(upper band+lower band)). The position of the upper band is marked with an arrow. (E) Sequences of labeled probes 5-1 to 5-7 (SEQ ID NOS: 8-13, respectively; the sequence on the drawing is SEQ ID NO: 6). IL1β-mRNA triggers biology in ZC3H12D ⁺ NK nuclei. (A) Irregular nuclei in wild-type mouse B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells 6 h after IL1β-mRNA-Cap(+)PolyA(+)-FITC uptake. Zc3h12d-/- mice do not develop irregular nuclei. CP: 5'Cap and 3'Poly(A) tail. The vertical axis is the copy number. (B) Example of immunostaining of phosphorous H2AX in the nucleus of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells 3 h after IL1β-mRNA-CP uptake (left image), wild-type and Zc3h12d-/- mice. Quantitative analysis of phospho-H2AX in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells derived from (right graph). Bar: 5 μm. (C) Time course of secondary necrosis in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type and Zc3h12d−/− mice. Green (wild-type, -RNA), blue (wild-type, +RNA), orange (Zc3h12d-/-, -RNA) and magenta (Zc3h12d-/-, +RNA) are shown. (D) Detection system for internalized ex-IL1β-mRNA bound to Pol II in ZC ⁺ RAW cells. Real-time PCR analysis of IL1β-chimera-mRNA associated with Pol II in the nucleus. (E) Quantification by qPCR of IL1rn in nuclear RNA of ZC ⁺ RAW after application of IL1β-chimera-mRNA (n=5-6 per group). The vertical axis indicates relative mRNA levels. (F) Quantification by qPCR of Dusp1 in nuclear RNA of ZC ⁺ RAW after application of IL1β-chimera-mRNA (n=12 per group). The vertical axis indicates relative mRNA levels. In the image of FIG. 6, the bar represents 5 μm. The graph in FIG. 6 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. (A) Human ZC3H12D contributes to hIL1β-mRNA uptake. (A) Scheme of the two splicing isoforms of hZC3H12D. The long and short forms encode proteins of 58 kDa and 36 kDa, respectively. All have a common amino-terminal sequence containing zinc finger regions (green). The long form also has a proline-rich region (orange). (B) IHC analysis of ZC3H12D in 786-O cells overexpressing the long form (hZC58) and short form (hZC36). (C) Representative confocal microscopy images of hIL1β-mRNA-FITC uptake in hZC58 or hZC36 cell nuclei (upper image). Quantification signals of hIL1β-mRNA-FITC in hZC58 or hZC36 cell nuclei (lower panel) (3D images per group: n=38 for hZC58; n=50 for hZC36). (D) Uptake of hIL1β-mRNA-FITC into CD56 ⁺ CD3 ⁻ NK cell nuclei 3 hours after application of 50 ng/mL RNA and 200 U/mL IL-2 protein. Confocal microscopy imaging shows DAPI-stained nuclei in one image (top image) and a 3D stack combining 15 images from top to bottom (middle image). 3D stacked images show a comparison of nuclear uptake between IL1β-mRNA and hβactin mRNA (bottom panel). (E) IHC analysis of IFNγ induction 48 hours after RNA application with 200 U/mL IL-2 to CD56 ⁺ CD3 ⁻ NK cells. Positive controls were incubated with IL2 medium plus 20 ng/mL IL12 protein (IFNγ signals from n=15-19 ZC3H12D ⁺ cells per group). The vertical axis indicates the intensity ratio of IFNγ to the number of DAPI-positive cells. ZC3H12D ^{+ NK} cells with ^IL1β - ^mRNA in the nucleus function in antimetastasis. Nomad. The vertical axis indicates the number (arbitrary unit) of migrated B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells in wild-type mice and Zc3h12d−/− mice. Mean values (n=3 per group) are shown with standard errors, and the results of one-way ANOVA are shown. (B) Migration assay on RNA derived from TCM-deficient ZC3H12D-bound RNA. RNA samples were obtained from LTCM passed over a column without protein (#1) and a ZC3H12D protein column (#2). "no" represents zero RNA. Shows the number of migrated B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells in wild-type and Zc3h12d−/− mice (n=3 per group) (C) TCM-stimulated Zc3h12d+/- mice after incubation with IL1β-mRNA. and IFNγ induction in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from Zc3h12d−/− mice. Representative examples of IHC images (upper panel) and quantitative ratio of IFNγ-positive cells to the number of DAPI-positive cells (lower panel) (n=6 culture dishes per group). (D) In vitro tumor destruction assay after co-incubation of tumor cells with B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells stimulated with 50 ng/mL IL1β-mRNA. Representative images of rhodamine-labeled E0771 cells that became Zombie+ dead cells during the assay (upper panel). Dead E0771 and LLC cells were increased after co-culture with IL1β-mRNA-stimulated B220 ⁺ CD11c + NK1.1 ⁺ cells from TCM-stimulated Zc3h12d−/− mice, and increased after co-culture with B220 + CD11c ⁺ NK1.1 + cells from Zc3h12d−/− mice. It did not increase in the same cells (bottom panel). B220 ⁺ CD11c ⁺ NK1.1 ⁺ are indicated as ^Tri NK (n=7-12 culture dishes per group, lower left panel; n=20 culture dishes per group (lower right panel)). In the images, in FIG. 8 the bar represents 5 μm. The graph in FIG. 8 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. (A) Upregulation of IFNγ in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells of wild-type or Zc3h12d−/− mice TCM-stimulated with four fragments of the 3′UTR (3 dishes per group). The vertical axis indicates the intensity ratio of IFNγ-positive cells to the number of DAPI-positive cells. (B) Migration assay of IL1β-mRNA and β-actin mRNA using wild-type mouse B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells (10 ng/ml) (n=3 per group). The graph in FIG. 9 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. (A) In vivo antimetastatic assay. B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells in TCM-stimulated mouse spleens were stimulated with IL1β-mRNA (IL1β-mRNA-primed) and applied to another TCM-stimulated mouse. Rhodamine-labeled tumor cells were injected to assess metastasis. (B) Shows the number of metastatic LLC cells in lungs with or without B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells stimulated with pretreated IL1β-mRNA from Zc3h12d+/- and Zc3h12d−/− mice (per group). n=6 mice, 4 sections per mouse). The graph in FIG. 10 shows the mean±standard deviation and the results of Student's t-test or one-way ANOVA. Activation of cell migration activity by IL1βRNA in cultured mouse macrophage cells (RAW264.7 cells). (A) From top to bottom, unlabeled IL1β-mRNA with Cap-Poly(A), FITC-labeled β-actin mRNA with Cap-Poly(A), FITC-labeled IL1β-mRNA without Cap-Poly(A), and Fluorescence confocal microscopy of ZC ⁺ RAW cells after application of FITC-labeled IL1β-mRNA with Cap-Poly(A). Show a 3D image. Data are representative of 5 independent experiments. (B) Quantitative analysis of various RNA-FITC with Cap-Poly(A) in the nuclei of ZC ⁺ RAW cells. non-labeled IL1β: non-labeled IL1β, βactin RNA: β-actin RNA, IL1β-stop RNA: IL1β RNA with a stop codon (C) B220 from TCM-stimulated wild-type (left) and Zc4h12d-/- (right) mice. 3D images showing the time course of uptake of various RNA-FITCs in the nuclei of ⁺ CD11c ⁺ NK1.1 ⁺ cells. (D) Quantitative analysis of different RNA-FITCs in the nuclei of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type (left) and Zc4h12d−/− (right) mice. non-labeled IL1β: non-labeled IL1β, βactin RNA: β-actin RNA, IL1β-stop RNA: IL1β RNA containing a stop codon. Time course of secondary necrosis in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type and Zc3h12d−/− mice. WT-actb: Wild-type with β-actin RNA, WT-IL1b: Wild-type with IL1β RNA, WT-IL1b-stop Wild-type with stop codon-introduced IL1β RNA, Homo-actb: Zc3h12d-/- mouse β-actin RNA application in cells, Homo IL1b: IL1β RNA application in Zc3h12d-/- mouse-derived cells, Homo IL1b-stop: Zc3h12d-/- mouse-derived cells IL1β RNA application with a stop codon introduced. (A) IFNγ induction in B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from Zc3h12d+/- (left) and Zc3h12d-/- mice (right) stimulated with TCM after incubation with IL1β-mRNA. Quantitative ratio of IFNγ-positive cells to DAPI-positive cells (n=6 culture dishes per group). (B) In vitro after co-incubation of tumor cells with B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from Zc3h12d+/- mice (left) and Zc3h12d−/− mice (right) stimulated with 50 ng/mL of various mRNAs. Tumor destructive assay. Graphs show mean ± standard deviation and the results of Student's t-test or one-way ANOVA. (A) 786- overexpressed ZC3H12D when β-actin mRNA (β-actin) modified with 1-methyltheuridine and a partial sequence (130mer) of human IL1β mRNA modified with 1-methyltheuridine were allowed to act. O cell migration assay (n=3 per group). The vertical axis indicates the number of migrated cells (arbitrary unit). (B) Overexpression of ZC3H12D when a partial sequence of native human IL1β (130mer IL1β) and a partial sequence in which all uridines in the partial sequence are replaced with 1-methylpseudouridine (130mer IL1β Me-pU) are acted on. Migration assay of 786-O cells that were exposed (n=3 per group). The vertical axis indicates the number of migrated cells (arbitrary unit). Concentration of RNA used: 10 ng/mL. (A) β-actin mRNA modified with 1-methyltheuridine (β-actin, Me-pU), mouse full-length IL1β-mRNA modified with 1-methyltheuridine (IL1β, Me-pU), 1-methyltheuridine and overexpressed ZC3H12D when reacted with mouse full-length IL1β-mRNA (IL1β-stop, Me-pU) modified with a stop codon and natural mouse full-length IL1β-mRNA (IL1β, Me-pU). 786-O cell migration assay (n=3 per group). The vertical axis indicates the number of migrated cells (arbitrary unit). (B) No addition of RNA (no), partial sequence of native beta-actin mRNA (SEQ ID NO: 52) (130mer β-actin), partial sequence of native human IL1β (SEQ ID NO: 4) (IL1β), A partial sequence of β-actin mRNA in which all uridines are replaced with 1-methylpseudouridine (β-actin, Me-pU) and IL1β in which all uridines in the sequence are replaced with 1-methylpseudouridine (IL1β, Migration assay of 786-O cells overexpressing ZC3H12D when exposed to Me-pU (n=3 per group). The vertical axis indicates the number of migrated cells (arbitrary unit). Concentration of RNA used: 100 ng/mL.

BEST MODE FOR CARRYING OUT THE INVENTION Embodiments of the present invention will be described below.
1. Summary of RNAs of the Disclosure
In the present disclosure, RNAs having the following base sequences (i), (ii), or (iii) and containing at least one chemical modification are used (these RNAs are referred to as "RNAs of the present disclosure ”.)
(i) RNA having the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) RNA having a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

RNA consisting of the base sequence represented by SEQ ID NO: 2 is the 3' untranslated region (3' UTR).

The RNA consisting of the nucleotide sequence represented by SEQ ID NO: 8 is the 3′ untranslated region (3′ UTR).

Surprisingly, the present inventors found that (1) non-vesicular exILβ-mRNA, which is a sequence near the untranslated region on the side of the RNA 3′-terminal region of IL-1β, is associated with the cell surface RNA-binding property of NK cells. (2) mouse NK cells incorporating exILβ-mRNA induce cell migration and interferon-γ (IFNγ) production, leading to tumor destruction; (3) treatment of human NK cells with synthetic IL1β-mRNA maintained sustained production of IFNγ; (5) increase in the number of cells activated by administration of fragments of exIL1β-mRNA to mouse macrophage cultured cells; and (6) pseudo-uridyl nucleoside of exILβ-mRNA. Even if exILβ-mRNA is chemically modified, which is commonly used as a method for mRNA medicine, such as by using uridyl nucleotides or by inserting a stop codon in the mRNA sequence, the cell activation effect of exIL1β-mRNA can be observed. I found out that I can play. exILβ-mRNA may have a role as an intrinsic intercellular neurotransmitter with anti-tumor or anti-metastatic functions.

As used herein, "chemical modification" of RNA may be any chemical modification applied to RNA, and not only replacement with a base sequence different from the natural base sequence, but also Even if the type of the base is the same as that of the base, chemical modification of the base is also included.

In some embodiments, at least one chemical modification is to make a uridine in the RNA a uridine analogue.

Nucleobases and nucleosides containing uridine analogs include, for example, uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl -1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine , 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxy uridine, and uridine analogs selected from the group consisting of 2'-O-methyluridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more of the total number of uridines in said RNA are uridine analogues.

Nucleobases and nucleosides containing uridine analogs include, for example, uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl -1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine , 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxy Uridine and uridine analogs selected from the group consisting of 2'-O-methyluridine.

In some embodiments, at least one chemical modification is that 90% or more of the total number of uridines in said RNA are uridine analogues.

Nucleobases and nucleosides containing uridine analogs include, for example, uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl -1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine , 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxy Uridine and uridine analogs selected from the group consisting of 2'-O-methyluridine.

In some embodiments, at least one chemical modification is that 100% of the total number of uridine nucleosides in said RNA are uridine analogues.

Nucleobases and nucleosides containing uridine analogs include, for example, uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl -1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine , 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxy Uridine and uridine analogs selected from the group consisting of 2'-O-methyluridine.

In some embodiments, at least one chemical modification is to make a cytidine in RNA a cytidine analogue.

Nucleobases and nucleosides including cytidine analogs include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, 4-acetyl-cytidine, 5-formylcytidine, 4-methylcytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl- Cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, Zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl-cytidine, 5,2′-O-dimethyl-cytidine, 4-acetyl-2′ -O-methyl-cytidine, 4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine (f5Cm), 4,4,2'-O-trimethyl-cytidine, 1-thio -cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine.

In some embodiments, at least one chemical modification is that 80% or more of the total number of cytidine nucleosides in said RNA are cytidine analogues.

In some embodiments, at least one chemical modification is that 90% or more of the total number of cytidine nucleosides in said RNA are cytidine analogues.

In some embodiments, at least one chemical modification is that 100% of the total number of cytidine nucleosides in said RNA are cytidine analogues.

In some embodiments, at least one chemical modification is to make an adenine in the RNA an adenine analogue.

Nucleobases and nucleosides containing adenine analogs include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halo-purine (eg, 2-amino-6-chloro-purine), 6-halo -purine (e.g. 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2- amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, 2 -methyl-adenine, 6-methyladenosine, 2-methylthio-6-methyl-adenosine, 6-isopentenyladenosine, 2-methylthio-6-isopentenyl-adenosine, 6-(cis-hydroxyisopentenyl)adenosine, 2- Methylthio-6-(cis-hydroxyisopentenyl)adenosine, 6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 6-methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-6-threonylcarbamoyl-adenosine , 6,6-dimethyl-adenosine, 6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-6-hydroxynorvalylcarbamoyl-adenosine, 6-acetyl-adenosine, 7-methyladenine, 2-methylthio-adenine, 2- Methoxy-adenine, α-thio-adenosine, 2′-O-methyl-adenosine, 6,2′-O-dimethyl-adenosine, 6,6,2′-O-trimethyl-adenosine, 1,2′-O- dimethyl-adenosine, 2'-O-ribosyladenosine (phosphate)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'- F-adenosine, 2'-OH-ara-adenosine, and 6-(19-amino-pentaoxanonadecyl)-adenosine.

In some embodiments, at least one chemical modification is that 80% or more of the total number of adenine nucleosides in said RNA are adenine analogues.

In some embodiments, at least one chemical modification is that 90% or more of the total number of adenine nucleosides in said RNA are adenine analogues.

In some embodiments, at least one chemical modification is that 100% of the total number of adenine nucleosides in said RNA are adenine analogues.

In some embodiments, at least one chemical modification is to make a guanine in the RNA a guanine analogue.

Nucleobases and nucleosides containing guanine analogues include inosine, 1-methyl-inosine, wyocin, methylwyocin, 4-demethyl-wyocin, isowyocin, wybutsin, peroxywybutsin, hydroxywybutsin, unmodified hydroxywybutsin. Butocine, 7-deaza-guanosine, queosine, epoxyqueosine, galactosyl-queosine, mannosyl-quaosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, alkaeosine, 7-deaza -8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methylguanosine, 6-thio-7-methyl- Guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methylguanosine, 2-methyl-guanosine, 2,2-dimethyl-guanosine, 2,7-dimethyl-guanosine, 2,2,7-dimethyl-guanosine , 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, 2-methyl-6-thio-guanosine, 2,N2-dimethyl-6-thio-guanosine, α -thio-guanosine, 2'-O-methyl-guanosine, 2-methyl-2'-O-methyl-guanosine, 2,2-dimethyl-2'-O-methyl-guanosine, 1-methyl-2'-O -methyl-guanosine, 2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine (phosphate) , 1-thio-guanosine, O6-methyl-guanosine, 2′-F-ara-guanosine, and 2′-F-guanosine.

In some embodiments, at least one chemical modification is that 80% or more of the total number of guanine nucleosides in said RNA are guanine analogues.

In some embodiments, at least one chemical modification is that 90% or more of the total number of guanine nucleosides in said RNA are adenine analogues.

In some embodiments, at least one chemical modification is that 100% or more of the total number of guanine nucleosides in said RNA are adenine analogues.

When nucleotides are designated with the abbreviations A, G, C, T, or U, each letter refers to a representative base and/or derivative or analogue thereof, e.g., A for adenine, or e.g. , including adenine analogues such as 7-deazaadenine.

RNAs of the present disclosure include RNAi inducers, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, RNAs, aptamers, vectors, and the like. In preferred embodiments, the RNA of the present disclosure is mRNA.

In some embodiments, at least one chemical modification is base substitution such that the RNA of the present disclosure has 1-5 additional stop codons relative to the native coding sequence.

In some preferred embodiments, the RNA of the present disclosure is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, wherein the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence from positions 88 to 897 of has base substitutions to have 1-5 additional stop codons compared to the native coding sequence. RNA is preferably mRNA.

When such RNA is administered to cells overexpressing the ZC3H12D protein, it activates the migratory capacity of the cells, induces the antimetastatic activity of the cells, and increases the tumor-destructive activity when the cells are natural killer (NK) cells. etc.

RNA consisting of the nucleotide sequence represented by SEQ ID NO: 1 corresponds to the full-length nucleotide sequence of IL1β-mRNA, which is the mRNA of human interleukin 1β (IL1β, NM — 000576).

RNA consisting of the nucleotide sequence represented by SEQ ID NO: 6 corresponds to the full-length nucleotide sequence of IL1β-mRNA, which is the mRNA of mouse interleukin 1β (IL1β, NM — 008361).

The RNA of the present disclosure may contain one type of at least one chemical modification described above, or may contain two or more types.

The lower limit of the base sequence of (i), (ii) or (iii) above is preferably 20 bases or more, more preferably 25 bases or more, more preferably 30 bases or more, more preferably 40 bases or more. The upper limit of the base sequence of (i), (ii), or (iii) above is preferably 150 bases or less, more preferably 100 bases or less, and more preferably 50 bases or less.

The 5'-end and 3'-end of the base sequences (i), (ii), or (iii) above may be unmodified or modified.

When the nucleotide sequence portion of (i), (ii), or (iii) is used as the first region, the RNA of the present disclosure has a 5' untranslated region on the 5' end side of the first region (UTR). The 5'UTR may be the native 5'UTR of the polypeptide of interest encoded by the first region, or it may be a different 5'UTR from the encoded polypeptide of interest. In one embodiment, the 5'UTR may include at least one translation initiation sequence such as a Kozak sequence, an internal ribosome entry site (IRES), and/or fragments thereof. The sequences and design of these 5'UTRs in RNA medicine are well known.

RNAs of the present disclosure may further include a 5' cap and poly A tail.

A 5' cap is usually a modified nucleotide building block and generally refers to a structure added to the 5' end of a mature mRNA. The 5' cap may be formed by modified nucleotides, especially derivatives of guanine nucleotides. Preferably, the 5' cap is attached to the 5' end via a 5'-5'-triphosphate linkage. The 5' cap may be methylated, eg m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid with the 5' cap.

A poly-A tail, also called a poly-A tail, refers to a continuous adenine polynucleotide. Although the base length of poly A is not particularly limited, it is preferably 20 or more, more preferably 50 or more. Although the upper limit of the base length is not particularly limited, it is, for example, 200 or less.

In some embodiments, the RNA of the present disclosure is mRNA and comprises a 5'UTR, the base sequence of (i), (ii), or (iii) above and at least one chemical modification, and a polyA tail.

In the RNA of the present disclosure, a labeling molecule such as a fluorescent substance or a chromogenic substance may be attached to at least one of the bases of the base sequences (i), (ii), or (iii) above.

Various embodiments of the RNA of the present disclosure above are applicable singly or in combination to each aspect of the RNA of the present disclosure below.

2. Aspects of the RNA of the present disclosure According to the first aspect, an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification is included as an active ingredient: Anti-tumor agents are provided.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

Cells include cancer cells, tumor cells, or immune cells.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. An RNA that has at least a sequence, contains at least one chemical modification, and is capable of increasing the anti-tumor activity of a cell.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA that has at least a sequence, contains at least one chemical modification, and is capable of activating immune cells.

At least one chemical modification is as described above.

Activation of immune cells can be evaluated by IFNγ production in immune cells, improvement in migration ability of immune cells or tumor cells expressing ZC3H12D protein, and the like.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

Such chemical modifications of bases with uridine analogues, cytidine analogues, adenine analogues, guanine analogues are well known and can be carried out by those of ordinary skill in the art.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a nucleotide sequence having at least 20 to 150 contiguous nucleotide sequences among the nucleotide sequences (i) or (ii) above The mRNA consisting of the nucleotide sequence represented by SEQ ID NO: 5 represents human IL1β-mRNA. , one of the fragments when divided into four fragments containing 150 nucleotides. The mRNA consisting of the nucleotide sequence represented by SEQ ID NO: 21 is one of four fragments obtained by dividing mouse IL1β-mRNA into four fragments each containing 150 nucleotides, and is represented by human sequence IL1β-mRNA number 6. It is a fragment of the portion corresponding to the mRNA consisting of the base sequence of

According to a second aspect, an in vitro or non-human comprising administering to a cell an RNA having the following base sequence (i), (ii), or (iii) and including at least one chemical modification: A method of activating immune cells in an animal is provided.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) a base sequence having at least 20 to 200 contiguous bases selected from the base sequences (i) or (ii) above Cells include cancer cells, tumor cells, and immune cells.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

Activation of immune cells can be evaluated by IFNγ production in immune cells, improvement in migration ability of immune cells or tumor cells expressing ZC3H12D protein, and the like.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA that has at least a sequence, contains at least one chemical modification, and is capable of activating immune cells.

At least one chemical modification is as described above.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long. The length of the base sequence (i), (ii), or (iii) can be, for example, 20 to 150 bases, 20 to 100 bases, or 20 to 50 bases.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences

According to a third aspect, an in vitro or non-human comprising administering to a cell an RNA having the following nucleotide sequence (i), (ii), or (iii) and including at least one chemical modification: A method of inhibiting metastasis of tumor cells in an animal is provided.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

Cells include cancer cells, tumor cells, or immune cells.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

Suppression of metastasis of tumor cells can be evaluated by counting the number of metastatic tumor cells or the like.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. An RNA that has at least a sequence, contains at least one chemical modification, and is capable of increasing the anti-tumor activity of a cell.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA having at least a sequence, containing at least one chemical modification, and capable of inhibiting metastasis of tumor cells.

At least one chemical modification is as described above.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long. The length of the base sequence (i), (ii), or (iii) can be, for example, 20 to 150 bases, 20 to 100 bases, or 20 to 50 bases.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences

According to a fourth aspect, there is provided an immunostimulant comprising, as an active ingredient, an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification: .
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA that has at least a sequence, contains at least one chemical modification, and is capable of activating immune cells.

At least one chemical modification is as described above.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

Activation of immune cells can be evaluated by IFNγ production in immune cells, improvement in migration ability of immune cells or tumor cells expressing ZC3H12D protein, and the like.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long. The length of the base sequence (i), (ii), or (iii) can be, for example, 20 to 150 bases, 20 to 100 bases, or 20 to 50 bases.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences

According to a fifth aspect, the immunostimulatory effect of an immunostimulatory agent comprising an RNA having the following (i), (ii), or (iii) base sequence and containing at least one chemical modification An agent for enhancing the antitumor effect of a tumor agent is provided.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA that has at least a sequence, contains at least one chemical modification, and is capable of activating immune cells.

At least one chemical modification is as described above.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. An RNA that has at least a sequence, contains at least one chemical modification, and is capable of increasing the anti-tumor activity of a cell.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA having at least a sequence, containing at least one chemical modification, and capable of inhibiting metastasis of tumor cells.

Cells include cancer cells, tumor cells, or immune cells.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

Activation of immune cells can be evaluated by IFNγ production in immune cells, improvement in migration ability of immune cells or tumor cells expressing ZC3H12D protein, and the like.

Suppression of metastasis of tumor cells can be evaluated by counting the number of metastatic tumor cells or the like.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long. The length of the base sequence (i), (ii), or (iii) can be, for example, 20 to 150 bases, 20 to 100 bases, or 20 to 50 bases.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences

Antitumor agents include kinase inhibitors, apoptosis inducers, nuclear receptor regulators, immunomodulators, nuclear export signal inhibitors, proteasome regulators, DNA-damaging agents, antimetabolites, platinum-based antitumor agents ( platinum complexes), microtubule inhibitors, alkylating agents, and one or more antitumor agents selected from anthracycline antitumor agents, and salts of these compounds are also included. These antitumor agents are well known and commercially available.

The antitumor agent and the base sequence (i), (ii), or (iii) are not particularly limited in administration method as long as they exhibit the enhancing effect of the present invention, and can be administered simultaneously. or can be administered sequentially or at intervals. The order of administration of these compositions is also not particularly limited, and the anti-tumor agent may be administered before, simultaneously with, or after the RNA.

According to a sixth aspect, there is provided a pharmaceutical composition containing RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences

In some embodiments, the pharmaceutical composition is for the prevention and/or treatment of tumors.

Tumors include head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, liver cancer, gallbladder cancer, bile duct cancer, biliary tract cancer, pancreatic cancer, lung cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, renal cancer. cancer, bladder cancer, prostate cancer, testicular tumor, osteosarcoma, multiple myeloma, skin cancer, brain tumor, mesothelioma, and the like.

In some embodiments, the pharmaceutical composition is a pharmaceutical composition for immunostimulation.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (i) above and containing at least one chemical modification has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 and has at least one chemical modification and is capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of activating immune cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of increasing the anti-tumor activity of cells.

In a specific embodiment, the RNA having the nucleotide sequence of (ii) above and including at least one chemical modification has 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8 It is an RNA having a base sequence, containing at least one chemical modification, and capable of suppressing metastasis of tumor cells.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA that has at least a sequence, contains at least one chemical modification, and is capable of activating immune cells.

At least one chemical modification is as described above.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. An RNA that has at least a sequence, contains at least one chemical modification, and is capable of increasing the anti-tumor activity of a cell.

In a specific embodiment, the RNA having the nucleotide sequence of (iii) above and containing at least one chemical modification comprises 20 to 200 contiguous bases of the nucleotide sequence of (i) or (ii) above. RNA having at least a sequence, containing at least one chemical modification, and capable of inhibiting metastasis of tumor cells.

Cells include cancer cells, tumor cells, or immune cells.

Immune cells include natural killer cells (NK cells), macrophages, eosinophils, neutrophils, basophils, dendritic cells, lymphocytes and the like. Preferably, the immune cells are natural killer cells (NK cells), macrophages, or both.

Activation of immune cells can be evaluated by IFNγ production in immune cells, improvement in migration ability of immune cells or tumor cells expressing ZC3H12D protein, and the like.

Suppression of metastasis of tumor cells can be evaluated by counting the number of metastatic tumor cells or the like.

In some embodiments, at least one chemical modification is a uridine analogue.

In some embodiments, at least one chemical modification is a cytidine analogue.

In some embodiments, at least one chemical modification is an adenine analogue.

In some embodiments, at least one chemical modification is a guanine analogue.

In some embodiments, the at least one chemical modification is 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methyl - pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1- Deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy -pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, and 2′-O-methyl-pseudouridine Includes uridine analogues selected from the group consisting of uridine. In a preferred embodiment, the uridine analogue is 1-methyl-pseudouridine.

In some embodiments, at least one chemical modification is that 80% or more, 90% or more, or 100% of the total number of uridines in said RNA are uridine analogues.

In some embodiments, the RNA is such that all uridines in the nucleotide sequence represented by SEQ ID NO: 1 are 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- Taurinomethyl-4-thio-pseudouridine, 1-methyl-pseudouridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1 -methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2 -Methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl) It has a nucleotide sequence that is chemically modified with pseudouridine or a uridine analogue that is 2′-O-methyl-pseudouridine.

In some embodiments, the RNA is a variant form of RNA having the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, from the 88th position of the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 The coding sequence through position 897 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:3.

In some embodiments, the length of the base sequence of (i), (ii), or (iii) is 20-200 bases long. The length of the base sequence (i), (ii), or (iii) can be, for example, 20 to 150 bases, 20 to 100 bases, or 20 to 50 bases.

In some embodiments, the RNA has the base sequence represented by SEQ ID NO:4.

In some embodiments, the nucleotide sequence (i), (ii), or (iii) is the following nucleotide sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences

In the first to sixth aspects of the present invention, when using the RNA of the present invention as an active ingredient of a drug, a pharmaceutical carrier may be blended as necessary, and various dosage forms may be adopted depending on the purpose of prevention or treatment. is. The form of the anti-tumor agent containing the above RNA may be, for example, an injection, a suppository, an oral preparation, an ointment, an eye drop, etc., preferably an injection (intravenous injection, etc.). Each of these dosage forms can be produced by a conventional formulation method known to those skilled in the art.

As pharmaceutical carriers, various organic or inorganic carrier substances commonly used as pharmaceutical materials are used, and excipients, binders, disintegrants, lubricants, coating agents, etc. in solid formulations, solvents and solubilizers in liquid formulations. , a suspending agent, a tonicity agent, a pH adjusting agent, a pH buffering agent, an analgesic agent, and the like. Formulation additives such as preservatives, antioxidants, coloring agents, corrigents, corrigents, stabilizers and the like can also be used as necessary.

A subject for administration of the potentiator of the embodiments of the present invention is a mammal, preferably a human.

In addition, the daily dosage of the above RNA varies depending on the patient's symptoms, body weight, age, sex, etc., and cannot be determined indiscriminately. It is preferably 100 ng to 100 μg, more preferably 1 μg to 10 μg.

The amount of RNA to be incorporated into each dosage unit form described above is appropriately set according to the properties of the RNA used, the patient's condition, the dosage form, and the like.

The disclosures of all patent applications and publications cited herein are hereby incorporated by reference in their entirety.

EXAMPLES The present invention will be described in more detail with reference to Examples below, but the present invention is not limited to these.

1. Method (1) Reagents The following primary antibodies and factors were used in this study: mouse anti-ZC3H12D antibody (anti-ZC3H12D antibody ab1000862; Abcam), human anti-ZC3H12D antibody (ab1000862; Abcam), mouse cell sorting and FACS analysis: It was used. For mouse CD11c: PE anti-mouse CD11c (BioLegend); isotype control, PE Armenian Hamster IgG (eBioscience); Alexa Fluor 647 anti-mouse CD11c (BioLegend); and isotype control, Alexa Fluor 647 Armenian Hamster IgG (BioLegend). For mouse NK1.1: Brilliant Violet 421 anti-mouse NK-1.1 (BioLegend); isotype control, Brilliant Violet 421 mouse IgG2a, κ (BioLegend); APC anti-mouse NK-1.1 antibody (BioLegend); and isotype control, APC mouse IgG2a , κ (BD Pharmingen). For B220: PE/Cy7 anti-mouse/human CD45R/B220 antibody (BioLegend); isotype control, PE/Cy7 Rat IgG2a, κ (BioLegend); APC anti-mouse/human CD45R/B220 antibody (BioLegend); and isotype control, APC Rat IgG2a, kappa (BD Pharmingen). For CD45: PE/Cy7 anti-mouse CD45 antibody (BioLegend) and isotype control, PE/Cy7 rat IgG2b (BioLegend). Cell sorting against human CD56: PE anti-human CD56 (NCAM) antibody (BioLegend) and isotype control, mouse IgG1, κ (BioLegend). Cell sorting against human CD3: Alexa Fluor 488 anti-human CD3 antibody (BioLegend) and isotype control, mouse IgG1, κ (BioLegend). Mouse (D-17, sc-9344; Santa Cruz Biotechnology) and human (B27; BioLegend) anti-IFNγ antibodies were used for cell staining. Human IL2 (BioLegend) and human IL12 (PeproTech) were used for cell culture.

(2) Animals
C57BL6 mice were purchased from Clea Japan (Tokyo, Japan) or SLC (Shizuoka, Japan). Zc3h12d-/- mice (J Immunol 192, 1512-1524, 2014) were used for experiments. All animal experimental procedures were performed in accordance with the guidelines of the Animal Care and Use Committee of Shinshu University and Tokyo Women's Medical University.

(3) Tumor cell lines and tumor cell culture supernatant Regarding mouse tumor cell lines, E0771 breast cancer cells were established by Dr Sirotnak (Memorial Sloan-Kettering Cancer Center, New York, NY) and Dr Mihich (Roswell Park Memorial Institute, Buffalo , NY) (Anticancer Research 25, 3905-3915, 2015). Lewis lung cancer-derived cell line RAW264.7 was purchased from RIKEN BioResource Research Center. LLC (3LL) cells (JCRB Cell Bank) and 3LL in vivo passaged cells were provided by the Foundation for Cancer Research (Tokyo). Mouse cells were grown, prepared as stock samples, and used for passages of less than 2-3 months. They were cultured in Dulbecco's Modified Eagle medium supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin G sodium, and 100 μg/mL streptomycin sulfate. Human breast cancer cells 786-O were purchased from ATCC. The human cells were cultured in DMEM/Han's F-12 medium. Tumor cell culture supernatant (TCM) was obtained by incubating cells in serum-free medium without cell death. The collected TCM was centrifuged at 1,500 rpm for 5 minutes and the supernatant was further centrifuged at 15,000 rpm for 10 minutes. TCM was stored at -80°C prior to experiments.

(4) CD45 ⁺ cell culture system using tissue culture medium and biological tissue In biological tissue culture experiments, 2-mm ² lung or liver tissue specimens were serum-free cultured in high-glucose DMEM supplemented with gentamicin. After collecting the culture medium, the samples were first centrifuged at 1,500 rpm for 10 minutes, then the supernatant was further centrifuged at 15,000 rpm for 30 minutes at 4°C. For the tissue-CD45 co-culture system, lungs were incubated with DMEM supplemented with FBS (1%) in culture inserts (400-nm pores) in the upper wells and CD45 ⁺ cells isolated from the lungs were added to the lower wells. and stimulated for 24-48 hours with biological tissue from the upper wells.

(5) Primary Culture of Human Cells Primary human PBMCs (HPBMCs; Lonza) were cultured in LGM-3 medium (Lonza) supplemented with 200 IU/mL IL2.

(6) Experimental metastasis model
B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from the spleen of TCM-stimulated mice were stimulated with IL1β-RNA for 16-18 hours and 2×10 ⁴ cells per mouse were transferred to another TCM-stimulated mouse. Injected intravenously (iv). Subsequently, 2×10 ⁴ metastatic cells labeled with a fluorescent dye (PKH26; Sigma-Aldrich, St. Louis, MO, USA) were intravenously administered to pretreated mice to examine the homing of metastatic tumor cells. . Forty-eight hours after tumor cell injection, the lungs were perfused with phosphate buffered saline (PBS) under physiological pressure to exclude circulating tumor cells. Six pieces of lung tissue (3 mm in diameter) were randomly excised and four 10 μm sections per piece were subjected to confocal microscopy (LSM-710; Carl Zeiss MicroImaging GmbH, Germany) or fluorescence microscopy (BZ-9000). ; Keyence, Osaka, Japan). The number of labeled tumor cells was normalized to total tissue surface area. Age- and sex-matched littermates were used for the experiments.

For the spontaneous metastasis assay, E0771 cells were detected microscopically in the lungs of tumor-bearing mice after primary tumor resection. Syngeneic tumor grafts were generated via subcutaneous (sc) or mammalian fat pad (mfp) implantation of 5×10 ⁶ tumor cells into 7- or 8-week-old mice.

(7) flow cytometry, cell sorting, and cell staining
To collect B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type, Zc3h12d+/- and Zc3h12d−/− mouse spleens, we purified the cells with a cell sorter (MoFlo Astrios ^EQ and FACSAria ^™ III). bottom. B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from wild type were not prestimulated with TCM. Human CD56 ⁺ CD3 ⁻ NK cells were obtained from FACSAria ^™ III (BD Bioscience). Mouse liver and lung were digested with 0.5 mg/mL collagenase, 1 mg/mL dispase, and Dnase for 45 minutes at 37°C to obtain B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells. Cell supernatants were incubated with mouse CD45-μ beads (MACS, Miltenyi Biotec, Auburn, Calif.) and captured cells were used for in vitro culture as shown in FIG. For the detection of ZC3H12D in mouse peripheral blood mononuclear cells (PBMC) shown in FIG. 1B, we performed the following staining and analyzed the cells using a flow cytometer (Cytomics FC500 Beckman Coulter). For cell surface staining, PBMCs were collected using Ficoll-Paque (Histopaque ^R -1083, Sigma-Aldrich) and/or hemolysis, and they were treated with 0.5 μg antibody per 10 ⁶ cells in a volume of 100 μL. dyed. For intracellular staining, a cell fixation/permeabilization kit (BD Pharmingen) treatment was administered prior to the addition of antibodies.

(8) Immunoprecipitation For cross-linking of protein-RNA complexes, cells cultured in 10 cm dishes were washed twice with PBS and irradiated with UV at 254 nm (1,500 J/m ² ) before protein extraction. Cells were dispersed in 10 mM HEPES, pH 7.6, 15 mM KCl, ₂ mM MgCl2, and 0.1 mM EDTA plus protease inhibitors (Promega, G6521), then NP was added to a final concentration of 0.2%. Added -40. After initial centrifugation (2,500 rpm, 1 minute), the supernatant was further centrifuged (15,000 rpm, 15 minutes) to obtain the nuclear fraction. Nuclear proteins were extracted with RIPA buffer (50 mM HEPES, pH 7.6, 150 mM NaCl, 0.5% Triton X-100, and 0.5% sodium cholate) supplemented with protease inhibitors (Promega, G6521) and RNase OUT (Thermo). bottom. Antibodies preincubated with protein G magnetic beads (Thermo) were added to the extracts in the presence of RQ1 RNase-Free DNase (Promega) and incubated for 1 hour at 4°C. The magnetic beads were washed 4 times with TBST and further washed with TBST + 1 M NaCl. The beads were then incubated with Protease K (1 hr at 37°C), followed by phenol-chloroform extraction and ethanol precipitation.

(9) Uptake of RNA
Primary cells were incubated in 1% FBS medium for 1 hour prior to RNA application. Cell lines were preincubated with or without 1% FBS for 3 hours. Human NK cells were not starved. To hasten RNA uptake, 4% paraformaldehyde was added for 5 minutes (2% final concentration) and washed three times. For intracellular staining of ZC3H12D, 0.1% Triton X was used prior to staining. To obtain confocal z-stack images (Leica TCS SP8 confocal microscopy), the top and bottom of the nucleus were orientated by the DAPI signal and a series of 15 images were captured from top to bottom of the nucleus to obtain a three-dimensional image of the cell. It was constructed. All cells were checked with a single image of the central part of the nucleus to confirm nuclear RNA uptake.

(10) Migration Assay Cell migration was evaluated using a chemotaxis Boyden chamber (Neuro Probe). Upper and lower wells were separated by 5-μm pore size polyvinylpyrrolidone-free polycarbonate filters (Nucleopore, Costar). Various RNAs were applied to the lower wells. Aliquots (50 μL) of cell suspension (2×10 ⁵ to 2×10 ⁶ cells/mL) were inoculated into each of the upper wells and incubated for 3.5 hours.

(11) IFNγ induction and tumor killing assay
After incubating B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells with 20 ng/mL mIL1β-RNA for 16-24 hours, the cells were stained with an anti-mouse IFNγ antibody. After stimulation with 50 ng/mL hIL1β-RNA for 48 hours in LGM-3 medium (Lonza) supplemented with 200 IU/mL IL2, human CD56 ⁺ CD3 ⁻ NK cells were stained with anti-human IFNγ antibody. For positive control of IFNγ induction, cells were incubated with 40 ng/mL hIL-12 for 48 hours. PKH26-stained tumor cells dead after 24 hours incubation with B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells stimulated with 20 ng/mL mIL1β-RNA for 16-18 hours using Zombie Green Fixable Viability Kit (BioLegend). detected.

(12) Real-time apoptosis and necrosis assay
ZC ⁺ RAW cells, B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells and hZC58 cells were traced after application of IL1β-mRNA or βactin-mRNA. The RealTime-Glo ^™ Annexin V Apoptosis and Necrosis Assay (Promega) was used to detect cell death.

(13) Vector construction and establishment of cells stably expressing ZC3H12D The human ZC3H12D expression vectors (hZC58 and hZC36) were cloned into the human ZC3H12D coding region pCMV6-entry vector (C-terminal myc-FLAG tag). was purchased from OriGene Technologies Inc. (Rockville, MD USA). Mouse ZC3H12D was PCR amplified using the primer set 5'-GGTACCATGGAGCATCGGAGCAAGATGG-3' (SEQ ID NO:24) and 5'-CTCGAGTTAAGGATCCCCCAACGGAGCACC-3' (SEQ ID NO:25) and then cloned into the pCR Blunt II vector (Thermo). The cloned fragment was double-stranded digested with KpnI-XhoI and subcloned with pcDNA3 attached with a C-terminal FLAG-tag. To establish cell lines stably expressing murine or human ZC3H12D, the cell lines were transfected with one of the constructs described above and the cells were cultured in the presence of 400 μg/mL G418 for >2 weeks. . After G418 selection, cell lysates were tested by Western blotting using a DDDDK antibody (MBL Co., Ltd, Japan) probe to confirm the expression of ZC3H12D-FLAG protein.

(14) Vector construction for RNA synthesis Mouse IL1β was amplified by PCR (primer set for full length: 5′-AACAAACCCTGCAGTGGTTCGAG-3′ (SEQ ID NO: 26) and 5′-GTTTGTTTGTTTTAATGAAATTTATTTCATACTCATCAAAGCAATG-3′ (SEQ ID NO: 27); Primer set: 5'-AACAAACCCTGCAGTGGTTCGAG-3' (SEQ ID NO: 28) and 5'-TTAGGAAGACACGGATTCCATGGTGAAG-3' (SEQ ID NO: 29); Primer set against UTR: 5'-AGTATGGGCTGGACTGTTTCTAATGC-3' (SEQ ID NO: 30) and 5'- GTTTGTTTGTTTTAATGAAATTTATTTCATACTCATCAAAGCAATG-3′ (SEQ ID NO: 31), cloned in pCR Blunt II vector.Human IL1β was PCR amplified (primer set: 5′-ACCAAACCTCTTCGAGGCACAAGG-3′ (SEQ ID NO: 32) and 5′-CTTCAGTGAAGTTTATTTCAGAACCATTGAACAGTATGATATTTGCTC-3′ (SEQ ID NO: 32). No. 33)) was cloned in the pCR Blunt II vector.To prepare the human-mouse chimeric IL1β construct, the NotI-NdeI fragment in the mouse IL1β/pCR Blunt II was excised from the human IL1β plasmid by a double-strand digestion fragment. As a result, this chimera has human IL1β (5′UTR and first half of CDS, 502 bp) with mouse IL1β (second half of CDS and 3′UTR, 843 bp) at the NdeI site. The mouse IL1β 3′UTR was further divided into four fragments, and the following primer set was used to amplify each fragment (first fragment: 5′-AGTATGGGCTGGACTGTTTTCTAATGC-3′ (SEQ ID NO: 34). and 5′-AACAGAATGTGCCATGGTTTCTTGTG-3′ (SEQ ID NO:35); second fragment: 5′-CGGCCAAGACAGTCGCTC-3′ (SEQ ID NO:36) and 5′-CTTGAATCAACTTAAATAGATCAACCAATCAATAAATAC-3′ (SEQ ID NO:37); third fragment: 5′-TATTTATTTATGTATTTATTGATTGGTTGATCTATTTAAGTTGATTCAAG-3′ (SEQ ID NO:38) and 5′-TTCTCAGCTTCAATGAAAGACCTCAGTG-3′ (SEQ ID NO:39); Fourth fragment: 5′-GGGATGAATTGGTCATAGCCCG-3′ (SEQ ID NO:40) and 5′-GTTTGTTTGTTTTAATGAAATTTATTTCATACTCATCAAAGCAATG -3 ' (SEQ ID NO: 41). The amplificate was then cloned into the pCR Blunt II vector. These fragments were 148-153 bp and each had at least a 50-bp overlap with its adjacent fragments. These constructs were linearized by SpeI digestion and used in an in vitro translation systemm (RiboMAX Large-Scale RNA Production System-T7, Promega, WI, USA). To prepare fluorescently labeled RNA, Fluorescein RNA Labeling Mix (Sigma-Aldrich, MO USA) was mixed in the RNA synthesis reaction. In order to introduce Cap modification, the synthesized RNA was mixed with Vaccinia virus Capping enzyme (New England Biolabs (NEB), MA, USA, M2080) and Cap 2'-O-Methyltransferase (NEB, M0366). RNA was extracted by phenol-chloroform and ethanol precipitation. A portion of the resulting RNA was then mixed with poly(A) polymerase (NEB, M0276) to obtain poly(A) adducts. Prior to use, all RNA was purified by a spin column-based purification system (PureLink RNA Mini Kit, Thermo).

(15) EMSA
Single-stranded RNA oligonucleotides were purchased from Eurofins genomics. A biotin label was introduced at the 3' end of the oligonucleotide using the Biotin Labeling Kit (Thermo, 89818). The LightShift Chemiluminescent RNA EMSA kit (Thermo, 20158) was used to investigate interactions between RNA oligonucleotides and ZC3H12D protein. Purified ZC3H12D protein supplied with biotinylated oligonucleotides and glycerol, reaction buffer components (final concentrations: 100 mM HEPES, pH 7.3, 200 mM KCl, 10 mM _MgCl2 , and 10 mM dithiothreitol), and kit. were mixed in the presence of the tRNA, and the mixture was run on a 5%-20% gradient gel (Fujifilm Wako Pure Chemical, Japan). RNA was then electrotransferred to a nylon membrane, fixed to the membrane by UV irradiation (1,200 J/m ² ), and probed with a stretavidin-HRP conjugate. To visualize the biotin-labeled RNA, a chemiluminescent reagent was applied to the membrane and the luminescence signal was detected by a CCD imager.

(16) Immunoprecipitation for Western Blot or qPCR To crosslink protein-RNA complexes, cells cultured in 10-cm dishes were washed twice with PBS prior to protein extraction and irradiated with 254 nm UV (1,500 J). /m ² ). Intracellular proteins were extracted with RIPA buffer (50 mM HEPES, pH 7.6, 150 mM NaCl, 0.5% Triton X-100, and 0.5% sodium cholate) supplemented with protease inhibitors (Promega, G6521). Anti-DYKDDDDK tag antibody magnetic beads (Fujifilm Wako Pure Chemical) were added to the lysate and incubated for 1 hour at 4°C. The magnetic beads were washed 4 times with TBST and further washed with TBST + 1 M NaCl. For Western blotting analysis, washed beads were mixed with SDS-containing sample buffer and heated to 95°C. To recover RNA, the beads were treated with RQ1 RNase-Free DNase (Promega), washed with TBST, and incubated with Protease K (1 hour, 37°C). Phenol-chloroform extraction and ethanol precipitation were then performed.
RNA preparation from cytoplasm and nuclear fractions Cells were dispersed in 10 mM HEPES, pH 7.6, 15 mM KCl, 2 mM MgCl ₂ , and 0.1 mM EDTA plus protease inhibitors (Promega, G6521), then NP-40 was added to a final concentration of 0.2%. After an initial centrifugation (2,500 rpm, 1 minute), the supernatant was further centrifuged (15,000 rpm, 15 minutes) and a pellet containing RNA was obtained by phenol-chloroform extraction and ethanol precipitation. After centrifugation at 2,500-rpm, the sedimented nuclear fraction was mixed with TRIzol (Thermo) and RNA was isolated.

(17) Protein Purification and Protein Column A human ZC36 expression vector (hZC36/pCMV6-Entry) was transfected into HEK293T cells. Forty-eight hours after transfection, cells were harvested and stored at -80°C. RIPA buffer supplemented with protease inhibitors was added to the frozen cells and the lysate was centrifuged at 15,000 rpm for 15 minutes. The supernatant was filtered through a 0.22-μm filter and loaded onto a column containing anti-DYKDDDDK tag beads (Fujifilm Wako Pure Chemical). The column was then packed with PBS (10 bed volumes), PBS + 1 M NaCl (10 bed volumes) and PBS (10 bed volumes). This column was used as a ZC3H12D protein column for adsorbing substances that can bind to ZC3H12D protein. The ZC3H12D protein on the column was eluted with PBS, 0.5 M NaCl and 100 ng/mL DYKDDDDK peptide (Fujifilm Wako Pure Chemical), and the eluate was concentrated with an Amicon Ultra centrifugal filter unit (Merck, NJ USA).

(18) Immunohistochemistry and cell count Using anti-ZC3H12D (ab1000862, Abcam) antibody, splenocytes, B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells, ZC ⁺ RAW cells, hZC36 cells, and hZC58 cells, CD56 ⁺ CD3 ⁻ NK cells and frozen tissue sections were stained. In FIG. 1, the numerical values of the immunostained cell area are shown as the number of pixels normalized to the DAPI signal. Labeled tumor cells were detected by confocal or fluorescence microscopy and normalized to total surface area.

(19) Knockdown using siRNA
For ZC3H12D knockdown, CD56 ⁺ CD3 ^- NK cells were treated with 300-1,000 nM siRNA (ON-TARGET plus human ZC3H12D (340152) (SMARTpool)) using electroporation with the Amaxa Nucleofector system (Lonza). bottom. ON-TARGET plus Non-targeting pool (Dharmacon Horizon Discovery) was used as control siRNA. Knockdown efficiency at the protein level was examined by IHI staining. RNA uptake assays were performed 27 hours after application of 300 nM siRNA.

(20) Quantitative PCR
Extracellular RNA samples were isolated from 5-10 mL of TCM, lung-TCM, liver-TCM and human lung EC-CM using RNAiso Blood (Takara) supplemented with Ethachinmate (Nippon GENE). Total RNA samples were isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, Calif., USA) and used to generate cDNA using reverse transcriptase (SuperScript VILO, Invitrogen). For reverse transcription with gene-specific primers, SuperScript III Reverse Transcriptase (Invitrogen) was used. Complementary DNA was amplified from extracellular RNA using TaqMan PreAmp Master Mix (Applied Biosystems, Foster City, Calif., USA) prior to quantitative PCR analysis. Quantitative PCR was performed using SYBR Green Master Mix or TaqMan Fast Advanced Master Mix (Applied Biosystems) for the detection system (StepOnePlus, Applied Biosystems). Gene expression levels were calculated from the Ct values and the linear relationship between the Ct values and the logarithm of the target gene copy number was confirmed using serial dilutions of the corresponding isolated DNA as standards. In addition, gene expression levels of nuclear and cytoplasmic samples were normalized to gene expression levels of Hotair and β-actin, respectively. The primer sequences and probes are shown below.
TaqMan Primer and Probe Set Human Interleukin 1 beta (IL1β): NM_000576
Hs01555410_m1
Human ACTB: NM_001101
Hs01060665_g1
Mouse IL1β: NM_008361
Mm00434228_m1
Mouse actin: NM_007393
Mm00607939_s1
Mouse Zc3h12d: NM_172785
Mm01191870_m1
Human IL1β: NM_000576 (custom designed)
Forward: CCCTAAACAGATGAAGTGCTCC (SEQ ID NO: 42)
Reverse direction: ATTCTCCTCAGCTTGTCCATG (SEQ ID NO: 43)
Probe: AATCTCCGACCACCACTACAGCAAG (SEQ ID NO: 44) SYBR qPCR primers
Dusp 1: NM_013642
Forward: TGTGCCTGACAGTGCAGAAT (SEQ ID NO: 45)
Reverse direction: CCTTCCGAGAAGCGTGATAG (SEQ ID NO: 46)
Il1rn: NM_001039701
Forward: CAGCTCATTGCTGGGTACTT (SEQ ID NO: 47)
Reverse orientation: CTCAGAGGCGGATGAAGGTAAAG (SEQ ID NO: 48)
HOX transcript antisense (Hotair): NR_047528
Forward: GCTAAGTCCTTCCAGAGAGAAAG (SEQ ID NO: 49)
Reverse direction: GCTCTTACTCTCTCTGCCTTTAC (SEQ ID NO: 50)
Mouse gene-specific primers for mouse IL1β
mIL1β-1195R: GTTGACAGCTAGGTTCTGTTCT (SEQ ID NO: 51)

2. Examples Example 1 RNA binding proteins located on the cell surface
To determine whether migration of ZC3H12D ⁺ leukocytes was caused by the primary tumor, we performed immunohistochemistry of the lungs of tumor-bearing mice. Mouse tumors were derived from E0771 breast cancer cells or Lewis Lung Carcinoma (LLC) cells. The number of ZC3H12D ⁺ CD45 ⁺ cells in the lung increased with primary tumor growth (Fig. 1A). Also, in an in vitro co-culture system, Zc3h12d expression in leukocytes from tumor-bearing mice was enhanced by tumor-bearing lungs (FIG. 1B). ZC3H12D was identified as a tumor suppressor gene in patients with follicular lymphoma and lung cancer (Cancer Res January 1 2007 67 (1) 93-99; DOI:10.1158/0008-5472.CAN-06-2723; British Journal of Haematology, 139(1), 161-163. It was more severe in Zc3h12d−/− mice than in Zc3h12d−/− wild-type mice (FIGS. 1C, 1D). This suggests that ZC3H12D acted as a tumor suppressor molecule in metastasis.

To define the ZC3H12D localization pattern in tumor-stimulated immune cells, we used a flow cytometer to examine peripheral blood from tumor-free and tumor-bearing mice. ZC3H12D protein in mononuclear cells (PBMC) was observed. ZC3H12D was detected on PBMC cell surfaces from tumor-free mice (Fig. 2A, upper panel). It should be noted that the use of knockout samples allowed us to confirm the specificity of this ZC3H12D antibody. In contrast, in PBMCs from tumor-bearing mice, ZC3H12D was detected within intracellular spheres rather than on the cell surface (Fig. 2A, bottom panel). We further confirmed this tumor-mediated alteration of ZC3H12D localization patterns using two other anti-ZC3H12D antibodies. Tumor conditioned medium (TCM), which has been used as a tumor cell medium because it is expected to contain components secreted by tumor cells, upregulates ZC3H12D 30 min after stimulation of cells derived from the spleen. After 3 hours, the ZC3H12D protein was completely translocated inside the cells (Fig. 2B). ZC3H12D is expressed in the mouse RAW 264.7 macrophage cell line (J Immunol 192, 1512-1524, doi:10.4049/jimmunol.1301619 (2014); Cell Signal 24, 569-576, doi:10.1016/j.cellsig. 2011.10.011 (2012)), we used these cells to look for factors that cause localization changes of ZC3H12D. We again found that intracellular translocation of ZC3H12D from the plasma membrane occurred 3 hours after application of TCM in RAW cells (Fig. 2C). ZC3H12D is an RNA binding protein (J Biol Chem 290, 20782-20792, doi:10.1074/jbc.M114.635870 (2015); J Cell Biochem 118, 487-498, doi:10.1002/jcb.25665 (2017)). We suspected that nucleic acids were the explanatory factor for this phenomenon. Remarkably, pretreatment of TCM with Rnase affected the localization pattern of ZC3H12D (right column of FIG. 2C). Pretreatment of TCM with deoxyribonuclease did not affect the localization pattern of ZC3H12D (data not shown). The same phenomenon occurred when RNA isolated from TCM was added (Fig. 2D).

Example 2 ZC3H12D transports IL1β-mRNA into the nucleus
To determine the intracellular dynamics of IL1β-mRNA captured by ZC3H12D, we performed 3D cell analysis using a series of z-stack confocal microscopy images. The 5'cap and 3'-poly(A) are hallmarks of eukaryotic mRNAs. Therefore, FITC-labeled mouse naked IL1β-mRNA (SEQ ID NO: 6) and its 5′ cap and 3′-poly(A) adduct (IL1β-mRNA-Cap(+)PolyA(+)-FITC) were used in this tested in the assay. Surprisingly, both were observed in the nuclei of ZC ⁺ RAW cells 30 minutes after application. In the nucleus, IL1β-mRNA-Cap(+)PolyA(+)-FITC was observed more clearly than naked IL1β-mRNA-FITC, whereas control β-actin-mRNA-Cap(+)PolyA(+)-FITC +)-FITC gave almost no signal (Fig. 3A). To quantify the amount of foreign RNA transported into the nucleus, we synthesized chimeric IL1β-mRNA by combining 5′-human IL1β-mRNA and 3′-mouse IL1β-mRNA (Fig. 3B). It should be noted that the qPCR probe was designed to amplify human IL1β-mRNA located in the 5' region, but not the endogenous mouse transcript (upper panel, Figure 3B). Our data show that the chimeric RNA was transported into the nucleus regardless of cap or polyA modification (lower left panel, FIG. 3B), and only a small amount was detected in the cytoplasm (lower right panel). panel, Fig. 3B). To confirm the involvement of ZC3H12D in this phenomenon, we repeated this assay using B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type and Zc3h12d−/− mice. bottom. Thirty minutes to three hours after application, localization of IL1β-mRNA-FITC in the nuclei of wild-type mouse cells was prominent (Fig. 3C, left). On the other hand, the signal in the nucleus of Zc3h12d−/− mouse cells was minimal (FIG. 3C, right).

Example 3 ZC3H12D Recognizes the 3'UTR of IL1β-mRNA We investigated sequence-specific uptake via the ZC3H12D protein by using IL1β-mRNA. The full-length nucleotide sequence of mouse IL1β-mRNA is represented by SEQ ID NO:6. For this purpose, we first prepared two partial IL1β-mRNAs: the coding sequence (CDS) (SEQ ID NO: 7) and the 3' untranslated region (3' UTR) (SEQ ID NO: 8). . The former consists of a short 5'UTR and CDS, giving a total length of 897 nucleotides (nts). The latter is 451 nucleotides in total length. These RNAs were tested in a cell uptake assay (Figure 4A). The assay is performed by incubating with 90 ng/ml of various unlabeled RNAs for 10 minutes, followed by incubation with 10 ng/ml of FITC-labeled IL1β(full)-RNA for 30 minutes, after which the nuclear FITC signal is measured. Uptake of FITC-labeled IL1β-(3'UTR)-mRNA in ZC ⁺ RAW was greater than that of IL1β-(CDS)-mRNA. Furthermore, preincubation with IL1β-(3'UTR)-mRNA inhibited the uptake of FITC-labeled full-length IL1β-mRNA in the nucleus, but neither IL1β-(CDS)-mRNA nor β-actin-mRNA exerted this effect ( Figure 4B). Taken together, the 3'UTR-mRNA in IL1β-mRNA is recognized by ZC ⁺ RAW cells in a region-specific manner.

Several RNA-binding proteins have been reported to recognize AU-rich elements (AREs) and/or stem-loop structures in the 3′ UTR for regulation of target mRNA stability (Int Immunol 29, 149-155, doi:10.1093/intimm/dxx015 (2017)). In our study, electrophoretic mobility shift assay (EMSA) showed that ZC3H12D binds to a specific region of single-stranded RNA (ssRNA) at 50 nucleotides in the 3′ UTR of IL1β-mRNA. (No. 5 probe in FIGS. 5A and 5B, SEQ ID NO: 9). This binding was confirmed by an inhibition assay using cold RNA oligonucleotides (Figs. 5A, 5C). This data indicates that ZC3H12D interacts with a relatively large element surrounding the ARE in IL1β-mRNA that lacks a typical stem-loop sequence. Competition assays described below show that the binding site of ZC3H12D contains a normal AU-rich sequence (UAUUUAU), but a shorter fragment (20 nucleotides, peptides 5-1 to 5-7 in Figure 5E is SEQ ID NO: 10). 16) was found to exhibit much lower affinity than the above 50 oligonucleotides (FIGS. 5A, 5D, 5E).

Example 4 Function of Internalized IL1β-mRNA in the Nucleus When we applied IL1β-mRNA to B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells with/without Cap(+)PolyA(+), wild-type IL1β-mRNA-Cap(+)PolyA(+)-FITC was more clearly detected than naked IL1β-mRNA-FITC in the nuclei of mouse-derived B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells. In contrast, IL1β-mRNA-FITC was pooled outside the nucleus of Zc3h12d−/− mice. Interestingly, some of the wild-type cells exhibited irregular nuclei 6 hours after application of 100 ng/mL Cap (+)PolyA(+) (Fig. 6A, upper right DAPI panel). To rule out the possibility that this irregular nuclear shape was due to the addition of FITC modifiers, we observed the same phenomenon using unlabeled IL1β-mRNA. In this case, we demonstrated histone H2AX phosphorylation (a marker of DNA stress/damage, Nucleic Acids Res 43, 2489-2498, doi:10.1093) in the nuclei of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from wild-type mice. /nar/gkv061 (2015)), but not in the nuclei of the same cells in Zc3h12d-/- mice (Fig. 6B). It should be noted that H2AX has structural and functional roles in chromatin regulation beyond specific DNA double-strand break (DSB) markers.

We next sought to determine whether uptake of IL1β-mRNA in the nucleus causes cell death due to increased cellular stress (Fig. 6B). We examined the time course of cell death after treatment with IL1β-mRNA. In this assay, B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from TCM-stimulated wild-type and Zc3h12d−/− mice showed a slight increase in necrotic signal (FIG. 6C). When 10 nm/ml IL1β-mRNA was applied, the signal intensity of B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells from wild-type was lower than that of the same cells from Zc3h12d−/− mice (Fig. 6C). ), indicating that nuclear uptake of IL1β-mRNA may contribute to NK cell survival.

Subsequently, the present inventors investigated whether nuclear uptake of IL1β-mRNA affected nuclear activities such as transcription. The present inventors first investigated the nuclear transport of IL1β-mRNA, RNA polymerase II (Pol II) (Science 357, 921-924, doi:10.1126/science.aan8552 (2017) ) was investigated to see if it was related to To distinguish the applied IL1β-mRNA from endogenous IL1β-mRNA, we designed qPCR probes that anneal only to human-specific sequences. ZC⁺After application of chimeric IL1β-mRNA to RAW, transferred chimeric IL1β-mRNA was fixed by UV irradiation and co-immunoprecipitated with anti-Pol II antibody (FIG. 6D). We then looked for gene expression changes that were influenced by IL1β-mRNA uptake. Seven genes (Dusp1: NM_013642, Errfi1: NM_133753, S100a8: NM_013650, S100a9: NM_001281852, Il1rn: NM_001039701, Nlrp12: NM_00 1033431, Cebpd: NM_--7679) were selected: they are classified as nuclear-associated genes by Gene Ontology (GO) and are more prominent in Zc3h12d than in wild-type mice in our microarray dataset. It shows a relatively high expression level. Gene expression levels of these seven genes were analyzed by RAW and ZC after treatment with IL1β-mRNA.⁺RAW cells were compared. According to qPCR, more ZC than in control RAW⁺RAW showed that the anti-apoptotic genes Dusp1 and IL1rn were expressed at high levels (not shown). . Also, the abundance of these transcripts in nuclear RNA increased with IL1β-mRNA uptake (FIGS. 6E, 6F).

Example 5 ZC3H12D-IL1β-mRNA Axis in Human NK Cells We investigated whether human (h)ZC3H12D plays an important role in the mRNA uptake system. There are two alternative spliced gene products in human ZC3H12D: one is the long form (58 kDa: hZC58), whose primary structure is very similar to that of the mouse protein, and the other is Short form (36 kDa: hZC36) lacking the C-terminal region. Although these two isoforms share an RNA binding region and a zinc finger region, the proline-rich region) is unique to hZC58 (Fig. 7A). For the mRNA uptake assay, we first established 786-O cells, human kidney cancer cells stably expressing hZC58 or hZC36. Our immunohistochemical analysis revealed that ZC3H12D was widely distributed in the plasma membrane and cytoplasm of hZC58 cells, whereas ZC3H12D was found in relatively restricted areas in hZC36 cells (Fig. 7B). ). When these cells were incubated with FITC-labeled human IL1β (hIL1β-mRNA), the resulting images show that hIL1β-mRNA-FITC is detected more frequently in the nuclei of hZC58 cells than in the nuclei of hZC36 cells. (Fig. 7C), indicating that the C-terminal region of hZC58 (including the proline-rich region) plays a critical role in the transport of mRNA into the nucleus. The present inventors next performed human CD56 ⁺ CD3 ⁻ NK cells isolated from human PBMC (Hum Immunol 62, 1092-1098, doi:10.1016/s0198-8859(01)00313-5 (2001), J Exp Med 209, 2351-2365, doi:10.1084/jem.20120944 (2012)) was tested for hIL1β-mRNA uptake. Flow cytometric analysis detected ZC3H12D on the cell surface of 46% of CD56 ⁺ CD3 ⁻ NK cells. FITC-labeled hIL1β-mRNA mRNA was integrated into the nuclei of CD56 ⁺ CD3 ⁻ NK cells, but control hβ-actin mRNA was not (FIG. 7D).

The present inventors examined NK activation after uptake of hIL1β-mRNA. Although INFγ production in NK cells is generally thought to indicate the activation status of NK cells, IFNγ immunostaining revealed that CD56 ⁺ CD3 ⁻ NK cells increased IFNγ positivity after hIL1β-mRNA stimulation. (Fig. 7E), and this IFNγ expression level was also induced by recombinant IL12 (J Exp Med 209, 2351-2365, doi:10.1084/jem.20120944 (2012)), an IFNγ inducer for NK cells. was similarly high.

Example 6 Sequestration of IL1β-mRNA by ZC3H12D induces antimetastatic activity
Because ZC3H12D ⁺ NK cells migrate from liver to lung in tumor-bearing mice, we investigated whether IL1β-mRNA triggers the migratory activity of ZC3H12D ⁺ NK cells. B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells from wild-type mice showed migratory activity with IL1β-mRNA, but not with β-actin mRNA. This migratory activity was also absent in Zc3h12d−/− mouse cells (FIG. 8A). To demonstrate that the ZC3H12D protein can capture naturally produced IL1β-mRNA, we performed a migration assay using exRNA isolated from tumor conditioned medium (TCM). To determine the effect of the ZC3H12D protein, the TCM was split in two and these samples were passed over anti-FLAG beads with or without the ZC3H12D-FLAG tag protein to isolate exRNA from each sample individually. The first round exRNA was expected to have less IL1β-mRNA than the second round exRNA because it was captured by ZC3H12D-FLAG beads. According to our migration assay, in B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells, exRNA treated with ZC3H12D(+) column showed higher migration activity compared to exRNA treated with ZC3H12D(-) column. decreased (FIG. 8B), suggesting that the IL1β-mRNA-ZC3H12D interaction plays an essential role in cell migratory activity.

We sought to assess the effect of IL1β-mRNA on IFNγ production in B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells. Cells from Zc3h12d+/- mice were clearly stimulated by IL1β-mRNA, whereas only weak induction was observed in cells from Zc3h12d−/− mice (FIG. 8C). Furthermore, to determine the tumor-destructive effects of B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells, we co-cultured rhodamine-labeled E0771 cells with IL1β-mRNA-stimulated NK cells, The number of dead tumor cells was determined by staining with the green fluorescent dye Zombie (Fig. 8D, upper panel). Our data showed that stimulation with IL1β-mRNA increased the tumor-killing activity of NK cells from Zc3h12d+/- but not Zc3h12d-/- mice ( Figure 8D, bottom panel).

Since ZC3H12D recognizes the 3'UTR of IL1β-mRNA, we further investigated functional regions within the 3'UTR. To define the functional elements of the 3′ UTR in IL1β-mRNA, IL1β-mRNA was further divided into four fragments (Fr1-Fr4) containing 150 nucleotides (represented by SEQ ID NOS: 17-20, respectively). bottom. Each fragment had at least one 50 nucleotide overlap with adjacent fragments. A third fragment (SEQ ID NO: 19) exhibited higher activity than other fragments in the migration assay of B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells from wild-type mice, but not in cells from Zc3h12d−/− mice. It was barely noticeable (Fig. 9A). Next, in a migration assay, full-length IL1β-mRNA (SEQ ID NO: 6) and 3′ UTR IL1β-mRNA (SEQ ID NO: 8) induced migratory activity of NK cells from wild-type mice, whereas CDS IL1β-mRNA produced approximately the same level of activity as control RNA (Fig. 9B). Thus, our data indicate that the central portion of the 3′ UTR in IL1β-mRNA is recognized in a protein-dependent manner by ZC3H12D.

In cancer, IL1β protein is widely found in tumor promotion in association with post-inflammatory immune cells. We investigated whether B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells stimulated with IL1β-mRNA have anti-metastatic potential in vivo. In this assay system, NK cells were obtained from TCM-stimulated mouse spleens and stimulated with synthetic IL1β-mRNA. The NK cells were then applied to another TCM-stimulated mouse, after which rhodamine-labeled tumor cells were injected via the posterior vein. To assess lung metastasis, lungs were isolated after injection and cell numbers were counted in the lungs (FIG. 10A, model). Zc3h12d+/- B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells stimulated with IL1β-mRNA had reduced numbers of metastatic tumor cells present in the lung compared to unstimulated cells (Fig. 10B, middle bar graph). In contrast, IL1β-mRNA-stimulated NK cells from Zc3h12d−/− mice show only a modest anti-tumor effect (FIG. 10B, right bar). In summary, NK cell ZC3H12D selectively sequesters IL1β-mRNA, which is enriched in the tumor-stimulated lung microenvironment and transported into the nucleus. Localization of the ZC3H12D protein to the cell surface requires the proline-rich C-terminal region of ZC3H12D, which is separate from the RNA binding site. Transport of IL1β-mRNA into the nucleus triggered three functions: 1) enhancement of cell migration ability and tumor destruction activity through IFNγ production, 2) regulation of several gene expression through cooperation with RNA Pol II, 3). ) regulation of NK cell survival and prolonged IFNγ production in the tumor microenvironment (Fig. 10B).

Example 7 IL1β-mRNA Activates the Cell Migratory Ability of Cultured Macrophage Cells Mouse IL1β RNA was divided into four fragments (Fr1 to Fr4) (represented by SEQ ID NOS: 17 to 20, respectively) in the same manner as in Example 6. Fragmented RNA prepared by division was administered to cultured mouse macrophage cells (RAW264.7), and cell migration ability was measured. As shown in Figure 11, the third fragment was found to be more activating than the other fragments. This suggests that a specific region in the IL1β sequence activates immune cells.

Example 8 Promotion of transport of IL1β-mRNA into the nucleus by mutation of IL1β-mRNA
To determine the intracellular dynamics of IL1β-mRNA captured by ZC3H12D, we performed 3D cell analysis using a series of z-stack confocal microscopy images. All RNAs were 5′-capped and 3′-poly(A)-added (Cap(+)PolyA(+)), FITC-unlabeled IL1β-mRNA, β-actin RNA, GAPDH RNA, FITC-labeled IL1β-mRNA, and A nonsense mutant IL1β-mRNA that introduces three stop codons into the coding region of the FITC-tagged IL1β mRNA was tested in this assay. FITC-labeled IL1β-mRNA without 5′ cap and 3′-poly(A) addition (Cap(−)PolyA(−)) was also tested. The nucleotide sequence of this mouse nonsense mutant IL1β-mRNA (SEQ ID NO: 22) has adenine at the 189th base (cytosine in the natural sequence), adenine at the 399th base (thymine in the natural sequence), and adenine at the 651st base (thymine in the natural sequence). A cDNA corresponding to IL1β (which is thymine in the native sequence) was generated and prepared by transcription using T7 RNA polymerase. The analysis was performed under the same conditions as in Example 2. The nucleotide sequence of human nonsense mutant IL1β-mRNA corresponding to mouse nonsense mutant IL1β-mRNA represented by SEQ ID NO:22 is SEQ ID NO:23.

As in Example 2, IL1β-mRNA-Cap(+)PolyA(+)-FITC (Fig. 12A, bottom) was observed more clearly than unlabeled IL1β-mRNA (Fig. 12A, top). top), control β-actin-mRNA-Cap(+)PolyA(+)-FITC (Fig. 12A, second from top) and IL1β-mRNA-Cap(-)PolyA(-)-FITC (Fig. 12A, top) or third) produced little signal. Quantification of various Cap(+)PolyA(+)RNAs in the nucleus of ZC+RAW cells revealed that the localization of nonsense mutant IL1β-mRNA-FITC in the nucleus was more pronounced than that of IL1β-mRNA-FITC. There was (Fig. 12B).

Furthermore, similar to Example 2, when this assay was repeated with B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells, 30 minutes to 3 hours after application, nonsense mutant IL1β-mRNA-FITC signals in the nuclei of wild-type mouse cells. was significantly greater than IL1β-mRNA-FITC (FIGS. 12C and 12D, left). On the other hand, the signal in the nucleus of Zc3h12d−/− mouse cells was minimal with either RNA application (FIGS. 12C and 12D, right).

Example 9 Function of nonsense ^mutant IL1β ^- mRNA incorporated in the nucleus Next, β-actin mRNA-Cap(+) ^PolyA ( +)-FITC, IL1β-mRNA-Cap(+)PolyA(+)-FITC, nonsense mutant IL1β-mRNA-Cap(+)PolyA(+)-FITC were applied, and after treatment with mRNA in the same manner as in Example 4, were examined for the time course of cell death. As a result, application of 10 ng/ml IL1β-mRNA to TCM-stimulated B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from wild-type mice resulted in a lower cell signal intensity than that of β-actin mRNA. . Also, when 10 ng/ml of nonsense mutant IL1β-mRNA was applied, the cell signal intensity was lower than when IL1β-mRNA was applied. This indicates that nuclear uptake of IL1β-mRNA and nonsense mutant IL1β-mRNA contributes to NK cell survival, and that nonsense mutant IL1β-mRNA enhances NK cell survival rate more than IL1β-mRNA. . Although the signal intensity of B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells from Zc3h12d-/- mice was low before and after treatment with mRNA, the cellular signal was enhanced by the application of β-actin mRNA, IL1β-mRNA and nonsense mutant IL1β-mRNA, respectively. Differences in intensity tended to be similar to those of wild-type mouse-derived B220 ⁺ CD11c ⁺ NK1.1 ⁺ cells.

Example 10 Sequestration of IL1β-mRNA by ZC3H12D induces antimetastatic activity
Since ZC3H12D ⁺ NK cells migrate from the liver to the lungs of tumor-bearing mice, we, similarly to Example 6, investigated the effects of various mRNAs on IFNγ production in B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells. tried to evaluate. Cells from wild-type Zc3h12d+/- mice were clearly stimulated by IL1β-mRNA and nonsense mutant IL1β-mRNA (FIG. 14A left), whereas weak induction was observed in cells from wild-type Zc3h12d−/− mice ( Figure 14A right).

In addition, to determine the tumor-destructive effects of B220 ⁺ CD11c ⁺ NK1.1 ⁺ NK cells, we co-cultured rhodamine-labeled E0771 cells with NK cells stimulated with various mRNAs, resulting in green The number of dead tumor cells was determined by staining with the fluorescent dye Zombie. Stimulation with IL1β-mRNA increased the tumor-destructive activity of NK cells from Zc3h12d+/- mice, which was even greater with nonsense mutant IL1β-mRNA than with IL1β-mRNA (Fig. 14B left), whereas IL1β-mRNA and nonsense mutant IL1β-mRNA Neither IL1β-mRNA increased the tumor killing activity of NK cells from Zc3h12d−/− mice (FIG. 14B, right).

Example 11 Activation of cell migration ability by chemically modified IL1β mRNA in ZC3H12D overexpressing cells
A human β-actin mRNA partial sequence consisting of 130 bases and a human IL1β mRNA partial sequence consisting of 130 bases were added to a medium containing 786-O cells (derived from human kidney cancer) overexpressing ZC3H12D. and the average number of migrated cells was used to measure the cell migration ability. The concentration of RNA was 10 ng/mL.

A partial sequence of β-actin mRNA (SEQ ID NO: 52) and a partial sequence of human IL1β mRNA (SEQ ID NO: 4) are shown below. The partial sequence of human IL1β mRNA corresponds to 130 bases from base 1201 to base 1331 of full-length human IL1β (SEQ ID NO: 1), but G at position 1300 is replaced with A for convenience of synthesis ( underlined ). In all RNAs, uridine is replaced with 1-methylpseudouridine (Me-pU).
UGACGUGGAC AUCCGCAAAG ACCUGUACGC CAACACAGUG CUGUCUGGCG GCACCACCAU GUACCCUGGC
AUUGCCGACAGGAUGCAGAA GGAGAUCACU GCCCUGGCAC CCAGCACAAU GAAGAUCAAG (SEQ ID NO: 52)
CUGUCAUUCG CUCCCACAUU CUGAUGAGCA ACCGCUUCCC UAUUUAUUUA UUUAUUUGUU UGUUUGUUUU
AUUCAUUGGU CUAAUUUAUU CAAAGGGG AC AAGAAGUAGC AGUGUCUGUA AAAGAGCCUA (SEQ ID NO: 4)
As shown in FIG. 15(A), the partial sequence of human IL1β mRNA chemically modified with 1-methylpseudouridine was shown to have higher cell migration activity than when β-actin of the same base length was added. rice field.

Example 12 Activation of Cell Migratory Activity by Chemically Modified IL1β mRNA in ZC3H12D Overexpressing Cells Native human IL1β partial sequence (130mer IL1β) and all uridines in the partial sequence replaced with 1-methylpseudouridine (130mer IL1β) IL1β Me-pU) was added to the medium containing 786-O cells (derived from human kidney cancer) overexpressing ZC3H12D, and the average number of migrated cells was used to measure the cell migration ability. The concentration of RNA was 10 ng/mL.

As shown in FIG. 15(B), the partial sequence of human IL1β mRNA chemically modified with 1-methylpseudouridine was shown to have higher cell migration activity than the partial sequence mRNA without chemical modification. .

Example 13 Activation of Cell Migratory Activity by Chemically Modified IL1β mRNA in ZC3H12D Overexpressing Cells Full-length IL1β-mRNA in which all uridines in human native β-actin (SEQ ID NO: 52) mRNA are mutated to 1-methylpseudouridine All uridines (389 positions) in the middle are mutated to 1-methylpseudouridine (IL1β/Me-pU). ), all uridines (390 positions) in the mRNA were further mutated to 1-methylpseudouridine (IL1β-stop), and the native mouse full-length IL1β-mRNA (IL1β , SEQ ID NO: 1) was administered into a medium containing 786-O cells overexpressing ZC3H12D, and the cell migration ability was measured by the average number of migrated cells. The concentration of RNA was 10 ng/mL.

In SEQ ID NO: 3, the nucleotide sequence of SEQ ID NO: 1 is substituted at the position of the stop codon (196th C is replaced with U, 411th G is replaced with A, and 648th C is replaced with A). there is

The results in FIG. 16(A) indicate that IL1b/Me-pU, in which uridine in mRNA is chemically modified to 1-methylpseudouridine, also has an equivalent cell migration activity.

Example 14 Activation of Cell Migratory Activity by Chemically Modified IL1β mRNA in ZC3H12D Overexpressing Cells Native β-actin (SEQ ID NO: 52), IL1b partial sequence (SEQ ID NO: 4), all uridines in the sequences of β-actin - substitution of methylpseudouridine and substitution of all uridines in the partial sequence of IL1b (SEQ ID NO: 4) with 1-methylpseudouridine in medium containing 786-O cells overexpressing ZC3H12D Cell migration ability was measured by the average number of cells that were administered and migrated. The concentration of RNA was 100ng/mL.

The results in FIG. 16(B) show that when the mRNA is a partial sequence of the mRNA, the mRNA in which uridine in the mRNA is chemically modified with 1-methylpseudouridine has a cell migration activity equivalent to that of the unmodified mRNA. was done.

Claims (15)

An antitumor agent comprising, as an active ingredient, an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences The at least one chemical modification is such that 80% or more of the total number of uridine nucleosides in the RNA is pseudouridine, 1-methylpseudouridine, 1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methyl Cytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- Dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza- 2. The antitumor agent according to claim 1, comprising a uridine analogue selected from the group consisting of uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine. The RNA is a variant of RNA having the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, and the coding sequence from 88th to 897th of the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 has bases substituted to have 1 to 5 additional stop codons compared to the native coding sequence. 3. The antitumor agent according to claim 1, wherein the RNA has a length of 20 to 200 bases. 3. The antitumor agent according to claim 2, which has the following base sequence (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences A method for activating immune cells in vitro or in a non-human animal, comprising administering to cells an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification: .
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) a nucleotide sequence having at least 20 to 200 consecutive nucleotides among the nucleotide sequences of (i) or (ii) above Suppression of metastasis of tumor cells in vitro or in a non-human animal comprising administering to cells an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification: Method.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences The at least one chemical modification is such that 80% or more of the total number of nucleosides in the RNA are uridine pseudouridine, 1-methyl pseudouridine, 1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 5-methyl Cytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- Dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza- 8. The method of claim 6 or 7, comprising a uridine analogue selected from the group consisting of uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine. The RNA is a variant of RNA having the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6, and the coding sequence from 88th to 897th of the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 6 has bases substituted to have 1-5 additional stop codons compared to the native coding sequence. The method according to any one of claims 6 to 8, wherein the RNA has a length of 20 to 200 bases. 9. The method according to claim 8, which has the following base sequences (i), (ii), or (iii).
(i) the base sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 21
(iii) a base sequence having at least 20 to 150 consecutive base sequences among the above (i) or (ii) base sequences An immunostimulant comprising, as an active ingredient, an RNA having the following base sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences Enhancement of the immunostimulatory effect of an immunostimulatory agent or the antitumor effect of an antitumor agent, comprising an RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification agent.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences A pharmaceutical composition containing RNA having the following nucleotide sequence (i), (ii), or (iii) and containing at least one chemical modification.
(i) the base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(ii) a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 8
(iii) A base sequence having at least 20 to 200 consecutive base sequences among the above (i) or (ii) base sequences 15. The pharmaceutical composition according to claim 14, which is a pharmaceutical composition for the prevention and/or treatment of tumors.

Images