JP2023088612A - Method for making falling-resistant plant - Google Patents

Abstract

To provide means and methods for achieving falling resistance in plant cultivation.SOLUTION: A method for making a falling-resistant plant includes increasing trehalose-6-phosphate in at least part of a plant.SELECTED DRAWING: None

Description

TECHNICAL FIELD The present invention relates to substances and genes involved in lodging resistance of plants, particularly rice, methods for producing plants having lodging resistance, and lodging-resistant plants. The invention also relates to methods and means for determining or selecting lodging-resistant plants.

Lodging is the most important obstacle in plant cultivation, resulting in productivity and quality declines that directly lead to income loss for growers. For example, wheat (Triticum aestivum), barley (Hordeum vulgare), oat (Avena sativa), maize (Zea mays), sorghum (Sorghum bicolor), soybean (Glycine max), tomato (Lycopersicon esculentum), tobacco (Nicotiana tabacum), etc. yield, quality of production, and mechanical harvest efficiency. There are mainly the following three countermeasures to reduce the damage caused by lodging of plants. The first is lodging mitigation agents, and various mitigation agents including gibberellin inhibitors and the like are on the market. Lodging-reducing agents have problems in that they are administered only during the middle stage of growth and are not fast-acting because they inhibit gibberellin and suppress the elongation of the upper part of the plant body, and they cause an increase in labor hours and costs. The second is a lodging combine harvester, which is capable of harvesting fallen plants (eg rice) while raising them. The introduction cost of the lodging combine is high. In addition, although it is effective for lodging just before harvesting, it cannot cope with lodging that takes a long time from emergence to harvest.

The third is the creation of resistant strains, which has the lowest risk and is superior in terms of cost. Targets for increasing lodging resistance include short culms, strong culms, and enhancement of plant bearing capacity. Semi-dwarf gene sd-1, which is related to shortening of the culm, is utilized in the breeding of resistant cultivars, and many cultivars in Japan and overseas have sd-1. While the semi-dwarf gene sd-1 has made the "green revolution" possible, sd-1 has the disadvantage of lowering nitrogen absorption and requires high input of nitrogen fertilizer during cultivation (Non-Patent Document 1 ). A high fertilizer input causes a decrease in soil fertility and a load on the existing environment due to residual nitrogen. In order to achieve the Sustainable Development Goals (SDGs) and comply with the Green Food System Strategy, there is a demand for the development of lodging resistance improvement technology to replace sd-1.

In addition, in the production of resistant lines targeting strong culm formation, the introduction of the gene SCM2 improves lodging resistance by increasing the physical strength of the culm, but decreases the number of stems due to ambiguous effects. The strains that can be introduced are limited (Non-Patent Document 2). The effectiveness of the creation of resistant lines targeting the enhancement of bearing capacity has been shown for a long time, but there is no information on markers that can be used for breeding, and there are no reports of its use in breeding.

Japanese Patent Publication No. 2001-523110 Japanese Patent Publication No. 2000-510691

Wang, F and Matsuoka, M, Nature 560:563-564, 2018 Ookawa, T. et al., Nat Commun 1:132, 2010

Therefore, means and methods for obtaining lodging resistance in plant cultivation have been desired.

On the other hand, artificially varying the amount of trehalose-6-phosphate in cells to modify the development and contents of cells and tissues has been described (Patent Documents 1 and 2). It is described that the trehalose-6-phosphate synthase gene is expressed under the control of a high expression promoter (35S CaMV promoter) in order to increase the However, there is no description of improving the expression level of the trehalose-6-phosphate synthase gene using SNPs in the promoter region of the trehalose-6-phosphate synthase gene. Moreover, it was not known that trehalose-6-phosphate synthase is involved in lodging resistance of plants.

The present inventors conducted studies to solve the above problems, and found that the lodging resistance of rice is related to the amount of trehalose-6-phosphate. The inventors have found that lodging resistance can be imparted to plants by increasing the amount. The present inventors also found that the promoter sequence of trehalose-6-phosphate synthase contains an SNP associated with increased expression of the gene. The present invention has been completed based on the above findings.

The present invention includes, for example, the following embodiments.
[1] A method of producing a lodging-resistant plant, comprising increasing trehalose-6-phosphate in at least a part of the plant.
[2] A method for removing weed plants in plant cultivation, which comprises cultivating plants in which trehalose-6-phosphate is increased in at least a part of the plants.
[3] A method for cultivating rice with a high proportion of high quality rice, which comprises cultivating rice in which trehalose-6-phosphate is increased in at least a part of the rice.
[4] The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is performed by an increase in trehalose-6-phosphate synthase.
[5] The increase in trehalose-6-phosphate synthase results in expression of a trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2, or trehalose The method according to [4], which is carried out by introducing a -6-phosphate synthase gene.
[6] The method of [5], wherein the trehalose-6-phosphate synthase gene comprises at least one gene selected from the group consisting of OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4 and OsTPS5.
[7] The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is performed by applying a signaling precursor of trehalose-6-phosphate.
[8] The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is achieved by decreasing or inhibiting trehalose-6-phosphate phosphatase.
[9] [1], [2], and [4]-[ 8].
[10] The method according to any one of [1], [2], and [4] to [9], wherein the plant is rice.
[11] The method according to any one of [1] to [10], wherein at least part of the plant or rice contains at least one selected from the group consisting of stems, roots and leaves.

[12] the promoter sequence of the trehalose-6-phosphate synthase gene has the sequence shown in SEQ ID NO: 2, or has at least 90% sequence identity with the sequence shown in SEQ ID NO: 2; and a promoter sequence having promoter activity, or a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 is mutated to another base, or the nucleotide motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted 1. A plant or plant part thereof, comprising a promoter sequence having the following sequence:
[13] The plant or plant part thereof according to [12], wherein the plant part is at least one selected from the group consisting of plant seedlings, roots and seeds.
[14] The plant according to [12] or [13], or the plant thereof, wherein the plant comprises at least one selected from the group consisting of gramineous plants, leguminous plants, cruciferous plants, and solanaceous plants part.
[15] The plant or plant part thereof according to any one of [12] to [14], wherein the plant is rice.
[16] The plant or plant part thereof according to any one of [12] to [15], wherein the plant has lodging resistance, or the plant part has lodging resistance when it becomes a plant individual.

[17] A method for determining or selecting a lodging-resistant plant, wherein the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant has the sequence shown in SEQ ID NO: 2, or the sequence A promoter sequence having at least 90% sequence identity to the sequence shown in number 2 and having promoter activity, or a mutation of base G at position 883 of the promoter sequence shown in SEQ ID NO: 1 to another base, or A method comprising detecting whether or not the promoter sequence shown in SEQ ID NO: 1 contains disruption of the base motif GCGG at positions 883-886.
[18] The method of [17], wherein the mutation is detected using polymerase chain reaction (PCR), hybridization, or sequencing.

The present invention makes it possible to produce lodging-resistant plants and plant parts thereof. In particular, the locus prl5, which contains genes involved in lodging resistance, does not negatively affect other agronomic traits, making it a highly practical locus for improving lodging resistance. Further, according to the present invention, it becomes possible to determine whether or not a certain plant has lodging resistance, and select the plant. Therefore, the present invention is useful in fields such as agriculture, plant improvement, and food production.

FIG. 2 is a diagram showing a sequence comparison between the sequence of the region containing the TPS6 gene promoter of Kasalasu cultivar (SEQ ID NO: 2) and the sequence of the region containing the TPS6 gene promoter of Koshihikari or Nipponbare cultivar (SEQ ID NO: 1). FIG. 2 shows the results of positional cloning using CSSLs between Koshihikari and Kasalath. Fig. 3 is a graph showing relative expression levels of OsTPS6 in NILprl5 lines. Fig. 3 is a graph showing (A) the expression level of OsTPS6, (B) the chlorophyll content in lower leaves (measured by Konica Minolta SPAD-502), and (C) the pushing resistance value in each rice line. The rice lines are 1: Nipponbare, 2: null, 3-5: recombinant (n=3). This is a photograph of the individual with increased OsTPS6 expression (NILprl5) and the control Koshihikari on the day after Typhoon No. 9 hit directly on August 23, 2016 (maximum wind speed 26.9 m/s). Fig. 10 is a photograph showing the results of a cultivation test of an individual (NILprl5) with an increased OsTPS6 expression level and Koshihikari as a control. Koshihikari on the left and NILprl5 on the right. Arrows indicate weedy rice.

The present invention will be described in detail below.
The present invention is based on the discovery that trehalose-6-phosphate is involved in lodging resistance of plants. Trehalose-6-phosphate is produced from glucose-6-phosphate by trehalose-6-phosphate synthase (TPS), and from trehalose-6-phosphate by trehalose-6-phosphate phosphatase (TPP). is generated.

glucose-6-phosphate → trehalose-6-phosphate → trehalose
TPS TPP

Therefore, the present invention relates to a lodging-resistant plant focusing on trehalose-6-phosphate, a method for producing the lodging-resistant plant, and a method and means for judging or selecting lodging-resistant plants.

Here, the terms "lodging resistance" or "lodging resistance" and "lodging resistance" refer to the fact that plant individuals have the property of being resistant to lodging, and specifically, when the present invention is not applied. It means that lodging property is improved in comparison. Lodging resistance can be confirmed by a method known in the art. can be measured.

1. Methods of Producing Lodging Resistant Plants In one aspect, the present invention relates to a method of producing lodging resistant plants comprising increasing trehalose-6-phosphate in at least a portion of the plant. Trehalose-6-phosphate may be increased, for example, by increasing trehalose-6-phosphate synthase, which catalyzes the production of trehalose-6-phosphate from glucose-6-phosphate, and/or This may be achieved by application of signaling precursors of trehalose-6-phosphate and/or by reduction or inhibition of trehalose-6-phosphate phosphatase, which catalyzes the production of trehalose-6-phosphate to trehalose. may

An increase in trehalose-6-phosphate may occur in at least a part of the plant. Preferably, trehalose-6-phosphate is increased in at least one portion selected from the group consisting of stems, roots and leaves where lodging resistance is desired to be imparted.

As used herein, plants or parts thereof refer to whole plants, plant organs (e.g. leaves, petals, stems, roots, seeds, etc.), plant tissues (e.g. epidermis, phloem, parenchyma, xylem, vascular bundles). , palisade, spongy tissue, etc.) or plant cultured cells, or various forms of plant cells (eg, suspension cultured cells), protoplasts, leaf segments, callus, etc. are contemplated.

In one embodiment, increasing trehalose-6-phosphate is accomplished by increasing trehalose-6-phosphate synthase. Trehalose-6-phosphate synthase (TPS) is known in the art and its gene and protein have been isolated in various plants. As trehalose-6-phosphate synthase genes, for example, OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4, OsTPS5 and the like are known, and at least one gene can be used. In this specification, the trehalose-6-phosphate synthase (TPS) gene is mainly TPS6 protein (GenBank Accession No. AK072066.1) derived from Koshihikari variety or TPS6 gene (SEQ ID NO: 20, GenBank Accession No. BAF17964. 1 (genome sequence)), but it is known in the art that there are homologous TPS proteins and TPS genes derived from other rice cultivars and other plants (e.g., cereals of the Gramineae family). . For example, wheat, Arabidopsis, soybean, sorghum, etc. (for example, Xie et al., Journal of Genetics, Vol.94, No.1, pp.55-65, Hu et al, Agronomy 10(7), 969 , 2020) are known, and the sequence information can be obtained from the literature and databases such as GenBank and UniProt. Such homologous proteins and homologous genes can equally be used. Homologous proteins and homologous genes and their regulatory sequences (such as promoter sequences) have sequence homology with the reference proteins and genes and their regulatory sequences, and the "corresponding positions" described herein are Refers to the position of a homologous protein or gene or regulatory sequence (promoter sequence) corresponding to the position of a reference protein or gene or regulatory sequence (promoter sequence), which can be easily determined according to techniques known in the art .

Trehalose-6-phosphate synthase can be increased by a method known in the art, and is not particularly limited. In one embodiment, it can be carried out by highly expressing the trehalose-6-phosphate synthase gene in plants. High expression of the trehalose-6-phosphate synthase gene can be achieved, for example, by introducing the trehalose-6-phosphate synthase gene into a target plant, or by introducing a strong promoter sequence or the sequence shown in SEQ ID NO: 2. It can be carried out, for example, by expressing a trehalose-6-phosphate synthase gene using a promoter sequence having a trehalose-6-phosphate synthase gene.

A gene recombination method known in the art can be used to introduce a gene of interest or a specific promoter into a plant. For example, a gene of interest or a specific promoter can be introduced into a plant by constructing a recombinant vector and introducing the recombinant vector into the plant. Such recombinant vectors can be constructed by inserting a gene of interest or a specific promoter into an appropriate vector. As a vector for introducing a target gene or a specific promoter into a plant cell and expressing it, a pBI-based vector, a pUC-based vector, or a pTRA-based vector is preferably used. pBI-based and pTRA-based vectors can introduce a target gene or a specific promoter into a plant via Agrobacterium. A pBI-based binary vector or intermediate vector is preferably used, and examples thereof include pBI121, pBI101, pBI101.2, pBI101.3 and the like. pUC-based vectors can directly introduce genes or promoters into plants, and examples thereof include pUC18, pUC19, pUC9 and the like.

To insert a target gene or specific promoter into a vector, first, the purified DNA is cleaved with an appropriate restriction enzyme, inserted into an appropriate restriction enzyme site or multicloning site of the vector DNA, and ligated into the vector. methods are adopted. A gene of interest or a specific promoter must be incorporated into a vector so that the function of the gene can be exhibited. Therefore, in addition to the promoter, the vector can optionally be ligated with an enhancer, a splicing signal, a polyA addition signal, a 5'-UTR sequence, a selectable marker gene, and the like.

A "promoter" is any DNA that functions in a plant cell and is capable of directing expression in a particular plant tissue (especially a tissue desired to impart lodging resistance, e.g. stem) or at a particular developmental stage. For example, it may or may not be plant-derived.

In the present invention, a promoter capable of enhancing the expression of the trehalose-6-phosphate synthase gene is used. In one embodiment, strong promoter sequences such as cauliflower mosaic virus 35S promoter, Agrobacterium T-DNA opine synthase gene-derived promoter, nopaline synthase (nos) promoter, octopine synthase (ocs) promoter, mannopine The synthase (mas) promoter, tomato ubiquitin promoter, etc. can be used to enhance gene expression. In another embodiment, promoter sequences with mutations that enhance expression of the trehalose-6-phosphate synthase gene can be used. For example, a promoter sequence having the sequence shown in SEQ ID NO: 2, or having at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and promoter activity can be used. Here, the identity of nucleotide sequences can be easily determined by methods known in the art, for example, using known sequence programs (such as BLAST provided by NIBI). Alternatively, mutation of base T corresponding to position 48 of SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare variety) to another base (e.g., A, C or G, preferably C), corresponding to positions 68 and 69 Deletion of base T (e.g. 1, 2 or 3, preferably 2 TT) corresponding to position 86 from base G to another base (e.g. A, T or C, preferably A) Mutation, mutation from base C corresponding to number 210 to another base (e.g., G, T or A, preferably A), mutation from base T corresponding to number 305 to another base (e.g., G, A or C, Preferably, mutation to A), mutation from base A corresponding to position 517 to another base (e.g., G, T or C, preferably G), mutation from base C corresponding to position 696 to another base (e.g., G, T or A, preferably A), mutation from base G corresponding to position 825 to another base (e.g., A, T or C, preferably A), mutation from base G corresponding to position 883 At least one selected from the group consisting of mutations to other bases (e.g., A, T or C, preferably A) and deletion of bases corresponding to positions 1113 and 1115 (e.g., base GAG) Promoter sequences can be used. FIG. 1 shows the result of sequence comparison between SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare cultivar) and SEQ ID NO: 2 (promoter sequence of Kasalasu cultivar). In a preferred embodiment, a promoter sequence having at least a mutation from base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T or C, preferably A), or the sequence shown in SEQ ID NO: 1 883-886 of which the base motif GCGG is disrupted. The promoter sequence lacks 1 to 30, preferably 1 to 20, more preferably 1 to 10, for example 1 to 3 bases in the base sequence of SEQ ID NO: 1 or 2, as long as it has promoter activity. It may contain deleted, substituted or added sequences. Promoter activity refers to having the ability and function to produce the gene product of the target gene inside or outside the host when the target gene is ligated downstream of the promoter in an expressible state and introduced into a host. Such DNA maintains promoter activity to the extent that it can be used under the same conditions as those under which a promoter consisting of a full-length nucleotide sequence without mutation (deletion, substitution or addition) functions. It means that there is For example, a DNA that maintains about 0.01-100 fold, preferably about 0.5-20 fold, more preferably about 0.5-2 fold the promoter activity of the full-length sequence.

A “terminator” may be any sequence that can terminate transcription of a gene transcribed by the promoter. An "enhancer" is used to increase the expression efficiency of a target gene. A "selection marker" is used to facilitate selection of transformants, and includes, for example, a hygromycin resistance gene, a neomycin resistance gene, and the like.

The constructed recombinant vector is introduced into plants so that the target gene can be expressed or the gene can be expressed under a specific promoter. Plants to be targeted in the present invention can be applied to plants in general, such as various monocotyledonous plants, dicotyledonous plants, cereal plants, and trees. For example, monocotyledonous plants include gramineous plants (rice, wheat, barley, oats, corn, sorghum, rye, pearl barley, sugarcane, etc.), orchidaceous plants including Cattleya plants, rushaceous plants, and the like. be able to. The cereal plants mainly refer to plants having starchy seeds (especially edible seeds), and include plants of the family Poaceae, Leguminosae, and the like.

In addition, dicotyledonous plants include, for example, Convolvulaceae plants including Ipomoea spp. (Arabidopsis thaliana, cabbage, radish, wasabi, bay mustard, broccoli, etc.), leguminous plants (soybeans, etc.), flaxaceous plants, terrestris plants, umbelliferous plants, solanaceous plants (tomatoes, tobacco, etc.), Asteraceous plants (Shungiku) , lettuce, burdock, Japanese butterbur, etc.).

In a preferred embodiment, the plant is a gramineous plant, especially rice. Rice varieties (for example, non-glutinous rice varieties) are not limited, and examples include Koshihikari, Hitomebore, Hinohikari, Akitakomachi, Nanatsuboshi, Haenuki, Masshigura, Kinuhikari, Asahi no Yume, Yumepirika, Kinumusume, Koshiibuki, and Tsuya. Hime, Yume Tsukushi, Fusakogane, Tsugaru Roman, Aichi no Kaori, Aya no Kagayaki, Ten no Tsubu, and Kirara 397.

A target plant means any of a whole plant body, plant organs (e.g. leaves, roots, seeds, etc.), plant tissues (e.g. epidermis, phloem, parenchyma, xylem, vascular bundles, etc.) or plant cultured cells. It is something to do. In the case of cultured plant cells, in order to regenerate transformants from the obtained transformed cells, organs or individuals may be regenerated by known tissue culture methods.

Methods for introducing a gene of interest, a specific promoter, or a recombinant vector into plants include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, the liposome method, the particle gun method, the microinjection method, and the like. For example, when using the Agrobacterium method, there are cases where protoplasts and tissue pieces are used. When using protoplasts, co-culture with Agrobacterium containing Ti plasmids, fusing with spheroplasted Agrobacterium (spheroplast method), and when using tissue pieces, target plants by leaf discs. It can be carried out by a method of infecting sterile cultured leaf discs (leaf disc method) or by infecting callus (undifferentiated cultured cells).

Alternatively, plants may be subjected to random mutagenesis to introduce mutations into the promoter sequence of the trehalose-6-phosphate synthase gene. Such random mutagenesis includes treatment with known mutagens (eg, ultraviolet light, radiation, heavy ion beams, chemical mutagens, etc.). Alternatively, genome editing may be performed in plants to introduce mutations into the promoter sequence of the trehalose-6-phosphate synthase gene. Preferably, by introducing a mutation into the promoter sequence from base G corresponding to position 883 of SEQ ID NO: 1 to at least one other base (e.g., A, T or C, preferably A), or SEQ ID NO: 1 It is also possible to enhance the expression of the trehalose-6-phosphate synthase gene by destroying the nucleotide motif GCGG at positions 883-886 of the sequence shown in .

To confirm whether or not the target gene or specific promoter has been incorporated into the plant, whether or not a mutation has been introduced at a specific position of the promoter, or whether or not the GCGG motif has been disrupted, PCR, Southern hybridization, Northern high It can be carried out by a hybridization method or the like. For example, DNA is prepared from a transformed plant, DNA-specific primers are designed, and PCR is performed. After PCR, the amplified product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., stained with ethidium bromide, SYBR Green solution, etc., and the amplified product is detected as a single band. By doing so, it is possible to confirm the transformation. In addition, PCR can be performed using primers that have been labeled with a fluorescent dye or the like in advance, and amplification products can be detected. Furthermore, a method of binding the amplification product to a solid phase such as a microplate and confirming the amplification product by fluorescence, enzymatic reaction, or the like may also be used.

Subsequently, it is confirmed whether the obtained plants have lodging-resistant traits. That is, the lodging resistance of the resulting plants is measured. Measurement of lodging resistance can be carried out by a method commonly used in the art. 2004) can measure lodging resistance.

In another embodiment, increasing trehalose-6-phosphate is effected by application of a signaling precursor of trehalose-6-phosphate. As a signaling precursor of trehalose-6-phosphate, a plant-permeable synthetic small molecule has been reported to be readily taken up by plants to induce photoactivated release of T6P (Griffiths et al. ., Nature 540: 574-578, 2016). For example, 6-O-bis-(2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O-bis-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O- in plants using bis-[1-(2-nitrophenyl)-ethoxyphosphoryl]-D-trehalose, 6-O-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, etc. It is possible to increase trehalose-6-phosphate.

In yet another embodiment, increasing trehalose-6-phosphate is by decreasing or inhibiting trehalose-6-phosphate phosphatase. Trehalose-6-phosphate phosphatase (TPP) is also known in the art and its gene and protein have been isolated in various plants. For example, rice (accession number GenBank AP008208) is known. Reduction or inhibition of trehalose-6-phosphate phosphatase can be achieved using methods known in the art, such as antisense methods, RNAi technology, antibodies, and the like.

The plants obtained as described above acquire lodging resistance traits. That is, by increasing trehalose-6-phosphate in a plant, lodging resistance can be imparted to the plant. Therefore, according to the present invention, lodging-resistant traits can be imparted to plants that have conventionally been prone to lodging, such as the rice cultivar Koshihikari.

2. Methods for Eliminating Weed Plants As mentioned above, plants with increased trehalose-6-phosphate have lodging resistance traits, making it possible to visually distinguish weed plants from non-lodging plants (target plants). Weed plants can be removed easily and quickly (eg, Example 4). If a plant lodges during cultivation, it becomes difficult to distinguish between other varieties and weed plants (Fig. 5), so the present invention is also useful for removing weed plants.

Accordingly, in one aspect, the present invention relates to a method of removing weedy plants in plant cultivation comprising cultivating plants having increased trehalose-6-phosphate in at least a portion of the plant. Plants with increased trehalose-6-phosphate in at least part of the plant can be produced as described elsewhere herein.

A weed plant refers to a plant other than the target plant for cultivation (ie, a plant with increased trehalose-6-phosphate according to the present invention). In the present invention, weedy plants are visually distinguished and removed because cultivated plants are less prone to lodging. A person skilled in the art can employ an appropriate removal method depending on the type of target plant and the type of plant to be removed.

3. Method for Cultivating Rice with High Rice Ratio Rice with increased trehalose-6-phosphate yields seeds with a high ratio of good rice (eg, Example 4). Fine rice refers to rice that is sorted through a sieve with a sieve mesh of 2.00 mm among the sieves used for sorting brown rice (generally, the sieve mesh is 1.7 mm to 2.00 mm). The high-quality rice ratio refers to the ratio (% by weight) of rice that has been sorted out of the rice that has been subjected to a sieve with a sieve mesh of 2.00 mm. It means 28%, preferably at least 30%, more preferably at least 40% or more.

Therefore, in another aspect, the present invention relates to a method for cultivating rice with a high percentage of top rice, comprising cultivating rice with increased trehalose-6-phosphate in at least a portion of the rice. Rice with increased trehalose-6-phosphate in at least a portion of the rice can be produced as described elsewhere herein.

4. A plant having a mutation in the trehalose-6-phosphate synthase gene promoter In one aspect, the present invention provides a promoter sequence in which the promoter sequence of the trehalose-6-phosphate synthase gene has the sequence shown in SEQ ID NO: 2, Or a plant comprising a promoter sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity with the sequence shown in SEQ ID NO: 2 and having promoter activity or Concerning plant parts. The present invention also provides mutations from base T corresponding to position 48 of SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare variety) to other bases (e.g., A, C or G, preferably C), positions 68 and 69. deletion of base T (e.g. 1, 2 or 3, preferably 2 TT) corresponding to number 86, base G corresponding to number 86 to another base (e.g. A, T or C, preferably A ), a mutation from base C corresponding to number 210 to another base (e.g., G, T or A, preferably A), a base T corresponding to number 305 to another base (e.g., G, A or C, preferably A), mutation from base A corresponding to position 517 to another base (e.g., G, T or C, preferably G), mutation from base C corresponding to position 696 to another base (e.g., G, T or A, preferably A), mutation of base G corresponding to number 825 to another base (e.g., A, T or C, preferably A), corresponding to number 883 At least one selected from the group consisting of mutation of base G to another base (e.g., A, T or C, preferably A), and deletion of bases corresponding to positions 1113 and 1115 (e.g., base GAG) plant or plant part thereof comprising a promoter sequence with In a preferred embodiment, the plant or plant part thereof has at least a mutation of base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g. A, T or C, preferably A), or It contains a promoter sequence in which the nucleotide motif GCGG at positions 883-886 of the sequence shown in SEQ ID NO: 1 is disrupted.

As described above, a plant having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene or a plant part thereof has an increased amount of trehalose-6-phosphate. It has a nature. Here, the plant is not particularly limited as long as acquisition of the lodging-resistant trait is desired, and examples thereof include the plants described above. Plant parts are not particularly limited as long as they are plant parts, and include seedlings, plant organs (eg, leaves, roots, seeds, etc.), plant cultured cells, and the like.

Plants or plant parts thereof having mutations in the promoter sequence of the trehalose-6-phosphate synthase gene can be produced as described above.

5. Determination or Selection of Lodging-Resistant Plants Plants having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene described above are considered to have an increased amount of trehalose-6-phosphate. Lodging-resistant plants can be determined or selected by detecting the

Plants to be judged or selected in the present invention are not particularly limited, and can be applied to all plants such as various monocotyledonous plants, dicotyledonous plants, and trees. For example, monocotyledonous plants include gramineous plants (rice, wheat, barley, oats, corn, sorghum, rye, pearl barley, sugarcane, etc.), orchidaceous plants including Cattleya plants, rushaceous plants, and the like. be able to.

In addition, dicotyledonous plants include, for example, Convolvulaceae plants including Ipomoea spp. (Arabidopsis thaliana, cabbage, radish, wasabi, bay mustard, broccoli, etc.), leguminous plants (soybeans, etc.), flaxaceous plants, terrestris plants, umbelliferous plants, solanaceous plants (tomatoes, tobacco, etc.), Asteraceous plants (Shungiku) , lettuce, burdock, Japanese butterbur, etc.). Plants to be the subject of the present invention may be not only wild-type plants exemplified above, but also mutants, transformants, transgenic plants, and genome-edited plants.

In one aspect, the present invention is a method for determining or selecting a lodging-resistant plant, wherein the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant has the sequence shown in SEQ ID NO: 2. detecting whether it comprises a promoter sequence or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO:2 and having promoter activity. The present invention also provides a method for determining or selecting a lodging-resistant plant, wherein the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant is SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare cultivar) Mutation from base T corresponding to position 48 to another base (e.g., A, C or G, preferably C), base T corresponding to positions 68 and 69 (e.g., 1, 2 or 3, preferably is two TT) deletion, mutation of base G corresponding to position 86 to another base (e.g., A, T or C, preferably A), base C corresponding to position 210 to another base ( For example, mutation to G, T or A, preferably A), mutation from base T corresponding to position 305 to another base (e.g., G, A or C, preferably A), base corresponding to position 517 Mutation from A to another base (e.g., G, T or C, preferably G), mutation from base C corresponding to number 696 to another base (e.g., G, T or A, preferably A), Mutation from base G corresponding to number 825 to another base (e.g., A, T or C, preferably A), mutation from base G corresponding to number 883 to another base (e.g., A, T or C, preferably A), and a promoter sequence having at least one selected from the group consisting of deletions of bases corresponding to positions 1113 and 1115 (e.g. base GAG). Regarding the method. In a preferred embodiment, the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant extends from base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T or C, preferably A ) or a promoter sequence in which the nucleotide motif GCGG at positions 883-886 of the sequence shown in SEQ ID NO: 1 is disrupted.

In one embodiment, genomic DNA is prepared from the plant to be determined or selected. Genomic DNA can be prepared by a known method such as the phenol/chloroform method. Genomic DNA may also be prepared from positive and/or negative control plants, if desired. The source from which DNA is prepared is not particularly limited, and can be extracted from any plant tissue. can do.

Detection of mutations in genomic DNA can be performed by any method known in the art, including, but not limited to, amplification reactions, such as polymerase chain reaction (PCR)-based methods, hybridization methods, direct A sequencing method, a method using restriction fragment length polymorphism (RFLP), and the like can be mentioned. All of these methods are well known to those skilled in the art. An outline of a typical method is described below.

(1) Method using amplification reaction (PCR method)
In the present invention, for example, the polymerase chain reaction (PCR) can be used to detect the mutation of interest easily and with high accuracy.

First, based on Koshihikari or Nipponbare cultivars, the nucleotide sequence of the trehalose-6-phosphate synthase promoter without mutation (eg, SEQ ID NO: 1) and the nucleotide sequence of the mutant promoter (eg, SEQ ID NO: 2). From the comparison, primers are designed that can distinguish between the two and amplify, or primers that can amplify so as to contain the mutated portion. Specifically, mutation of the promoter sequence (in particular, mutation of base G corresponding to position 883 of SEQ ID NO: 1 to another base or disruption of the base motif GCGG at positions 883-886 of the sequence shown in SEQ ID NO: 1). A primer set is designed so that the region containing is amplified. The primer set is based on the genomic sequence (SEQ ID NO: 2) of the trehalose-6-phosphate synthase and the mutant promoter, or based on the Koshihikari or Nipponbare cultivar, the trehalose-6-phosphate synthase and the promoter without mutation. It can be designed based on the genome sequence (SEQ ID NO: 1). SEQ ID NOS: 1 and 2 show the genomic sequence of the surrounding region containing the promoter of the trehalose-6-phosphate synthase gene.

Techniques for designing primers are well known in the art, and primers that can be used in the present invention satisfy conditions that allow specific annealing, such as length and base composition (melting temperature) that allow specific annealing designed to have For example, the length that functions as a primer is preferably 10 bases or more, more preferably 15 to 50 bases, and still more preferably 15 to 30 bases. In designing, it is preferable to confirm the GC content of the primer and the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any given nucleic acid strand forms a hybrid with its complementary strand. Need to optimize. On the other hand, if the temperature is too low, non-specific reactions will occur, so the temperature should be as high as possible. Known primer design software can be used to confirm the Tm. The designed primer can be chemically synthesized by a known oligonucleotide synthesis technique, but is usually synthesized using a commercially available chemical synthesizer.

In a specific embodiment, the primer set that can be used in the present invention is not limited, but for example, a primer having a nucleotide sequence of CTGGGCAGAAGCTACTTTACTC (SEQ ID NO: 3) and a nucleotide sequence of CAGCGCCTCGAAGTTCCC (SEQ ID NO: 4) and primer sets containing primers with These primer sets are capable of amplifying the region containing the mutation of interest.

When a primer set designed in this way is used, the base sequences of the amplification product obtained using a DNA containing a mutation as a template and the amplification product obtained using other DNA as a template are different. Therefore, from the difference in the sequence of the amplification product obtained by the amplification reaction using the primer set, it is possible to determine whether or not the target plant has a mutation related to lodging resistance in the promoter sequence of the trehalose-6-phosphate synthase gene. can be discriminated.

Although the amplification reaction is not particularly limited, a known method using the principle of the polymerase chain reaction (PCR) method can be mentioned. Amplification is performed until the amplification product reaches detectable levels. Optimal PCR conditions can be readily determined by those skilled in the art.

As described above, a nucleic acid fragment containing a desired mutated portion can be specifically amplified using a genomic DNA derived from a target plant as a template.

In order to detect whether or not a specific amplification reaction has occurred after the amplification reaction described above, known means capable of specifically recognizing an amplification product obtained by the amplification reaction can be used. For example, a specific amplification reaction can be detected by confirming whether or not an amplified fragment of a specific size is amplified using agarose gel electrophoresis or the like. The size of the amplified product can be estimated based on the nucleotide sequence between the designed primers. Alternatively, by determining the nucleotide sequence of the resulting amplified fragment, it can be determined whether or not the sequence containing the desired mutation is amplified.

Alternatively, the presence or absence of amplification of the nucleic acid fragment is detected based on the label attached to the primer or substrate. For example, dNTPs incorporated during the amplification reaction can be reacted with a label such as a radioactive isotope, a fluorescent substance, or a luminescent substance, and the label can be detected. ³² P, ¹²⁵ I, ³⁵ S and the like can be used as radioactive isotopes. As fluorescent substances, for example, fluorescein (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), etc. can be used. In addition, luciferin or the like can be used as the light-emitting substance. There are no particular restrictions on the types of these labels, the method of introducing the labels, and the like, and conventionally known various means can be used. For example, a method for introducing a label includes a random prime method using a radioactive isotope.

Any method known in the art for detecting the above-described label may be used for observing the amplified product incorporating the labeled dNTP. For example, when a radioactive isotope is used as the label, the radioactivity can be measured using a liquid scintillation counter, a γ-counter, or the like. Moreover, when fluorescence is used as the label, the fluorescence can be detected using a fluorescence microscope, a fluorescence plate reader, or the like.

As a result, the target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene (in particular, a mutation from base G corresponding to position 883 in SEQ ID NO: 1 to another base, or a mutation shown in SEQ ID NO: 1). Destruction of nucleotide motif GCGG at positions 883-886 of the sequence), that is, plants having lodging resistance can be determined and selected.

(2) Hybridization method The mutation of interest can also be detected using a hybridization method. Hybridization methods are methods of determining whether genomic DNA from a plant of interest has a mutation based on its ability to hybridize to a DNA molecule complementary thereto (eg, an oligonucleotide probe). A variety of techniques for hybridization and detection can be used to perform this hybridization method.

First, based on Koshihikari or Nipponbare cultivars, the base sequence of the trehalose-6-phosphate synthase promoter without mutation is compared with the base sequence of the mutant promoter, and a probe capable of distinguishing between the two is hybridized. to design. For example, probes can be designed to span the mutation of interest. For example, probes are designed so that they can hybridize to promoter sequences that are unmutated, but cannot hybridize to promoter sequences that contain mutations. Whether or not the genomic DNA of the target plant contains the target mutation can be detected based on the presence or absence of hybridization using such probes.

Techniques for designing probes are well known in the art, and probes that can be used in the present invention satisfy conditions that allow specific hybridization, such as length and base composition (melting) that allow specific hybridization. temperature). The length of the probe is preferably 10 bases or more, more preferably 20-50 bases, still more preferably 20-30 bases.

In this method, the presence of the target mutation is detected by performing a hybridization reaction with the target plant-derived genomic DNA using a probe and detecting the specific binding (hybrid). Hybridization reactions should be performed under stringent conditions. Such stringent conditions are well known in the art and are not particularly limited.

When hybridization is carried out in this method, the probe may be labeled with an appropriate label such as fluorescent label (fluorescein, rhodamine, etc.), radioactive label ( ³² P, etc.), enzyme label (alkaline phosphatase, horseradish peroxidase, etc.), biotin label, or the like. can be added.

Detection using a labeled probe involves contacting the genomic DNA from the plant of interest with the probe so that it can hybridize. Specifically, for example, genomic DNA derived from a plant of interest is digested with appropriate restriction enzymes if necessary, immobilized on a suitable carrier such as a slide glass, membrane, microtiter plate, etc., and labeled probes are added. Thus, the probe and genomic DNA are brought into contact with each other to carry out a hybridization reaction, and after removing the unhybridized probe, the label of the probe hybridized with the genomic DNA is detected. If the label is detected, the plant of interest has the mutation of interest.

Alternatively, hybridization can be detected using DNA chips. In this method, probes are attached to a solid support. Genomic DNA derived from the target plant is brought into contact with a DNA chip to detect hybridization

(3) Direct sequencing method Mutations in the promoter sequence of the trehalose-6-phosphate synthase gene can be detected by direct sequencing method using genomic DNA. In direct sequencing methods, genomic DNA is first prepared from the plant of interest and the region containing the mutation to be detected is cloned into a vector and amplified in a host cell (eg, bacteria). Alternatively, PCR can be used to amplify the DNA within the region containing the mutation to be detected. After amplification, the DNA within the region of interest is sequenced. Sequencing methods include, but are not limited to, manual sequencing methods or automated sequencing methods. Automatic sequencing methods include methods using dye terminators, next-generation sequencing (NGS), and the like. Based on the sequencing results, it is determined whether the plant of interest has the mutation of interest.

By the above method, it is detected whether or not the target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene, and based on the result, whether or not the target plant has the lodging-resistant trait. It is possible to judge and select. Since the method of the present invention utilizes a genetic technique, lodging-resistant plants can be determined and selected simply and with high accuracy.

6. Kit The above-described method for determining or selecting lodging-resistant plants can be carried out more simply by using a kit. This kit contains at least means capable of detecting mutations in the promoter region of the trehalose-6-phosphate synthase gene as described above, specifically primers or probes.

In one embodiment, the present invention includes a primer set comprising a primer having a nucleotide sequence shown in SEQ ID NO: 3 and a primer having a nucleotide sequence shown in SEQ ID NO: 4. Determination of lodging-resistant plants Or it relates to a selection kit.

In addition, when the kit contains primers, it may further contain buffers constituting reaction solutions, dNTP mixtures, enzymes (reverse transcriptase, RNaseH, etc.), standard samples for calibration, and the like. When probes are included, they may further include hybridization buffers, washing buffers, microplates, nylon membranes, and the like.

EXAMPLES The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[Example 1]
Isolation of OsTPS6, a causal gene that enhances plant bearing capacity In a previous report (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), a QTL (prl5) that enhances plant bearing capacity was identified. A method of evaluating the phenotype (bearing capacity of the lower part of the plant body) by removing the plant body above 40 cm from the earth pole and measuring the pushing down resistance value of the lower part has also been reported. In this example, an attempt was made to isolate causative genes involved in plant bearing capacity by genotype and phenotype.

The identified QTL region (pr15) was further analyzed using a chromosome fragment replacement phylogeny (CSSL) in which part of the chromosome of the Japanese rice cultivar Koshihikari was replaced with the Indian rice cultivar Kasalath. Specifically, CSSL was crossed with _Koshihikari to produce _BC1F1 .

Next, DNA markers were set at both ends of the region where the causative gene was thought to exist, and individuals in which recombination occurred within the region were selected from 2,000 BC ₁ F ₂ individuals of the self-breeding progeny of BC ₁ F ₁ . . Specifically, at 10:30 a.m., the first leaf under the flag leaf of cultivated rice was sampled, cooled with liquid nitrogen, stored in a -80°C freezer, and then 100 mg of the leaves were pulverized in a mortar using liquid nitrogen. DNA was extracted with Qiagen DNeasy Plant Mini Kit. Positional cloning was then performed using the primers shown in Table 1. For SSR1896, TAKARA EX TAQ (Takara Bio Inc.) was used for 30 cycles of 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute. 30 cycles were performed at 95°C for 1 minute, 68°C for 1 minute, and 72°C for 1 minute.

The 6 lines of _BC1F2 that had undergone recombination within the region were then selfed to produce their _{progeny BC1F3 .} From this BC ₁ F ₃ , an individual whose Kasalath-derived region was homozygous for Kasalath was selected for each line and self-fertilized to obtain progeny seeds.

BC ₁ F ₄ (20 individuals for each line) was cultivated in the field of the National Institute for Agro-Environmental Sciences (currently Agricultural Environmental Research Institute, National Agriculture and Food Research Organization, Kannondai, Tsukuba City, hereinafter also referred to as "Agricultural Environmental Research Institute"). Based on the genotyping and phenotype, the region where the causative gene exists was narrowed down to 137 kb (upper part of Fig. 2). The phenotype was measured according to a previously reported evaluation method (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004). Narrowed down.

Furthermore, the analysis was repeated using the same method, and the region was narrowed down to 12.1 kb. The candidate gene was narrowed down to Os05g0517200 (OsTPS6) from the rice genome annotation data.

Next, genomic DNA was extracted from the leaf tissue of BC ₁ F ₄ two weeks after transplantation in the same manner as above, and OsTPS6 was sequenced to compare the base sequences of the ORFs of Koshihikari and Kasalasu. The primers used for sequencing were forward primer Os05g0517200_Fw (CTGGGCAGAAGCTACTTTACTC: SEQ ID NO: 3) and reverse primer Os05g0517200_Rv (CAGCGCCTCGAAGTTCCC: SEQ ID NO: 4), yielding an amplification product of 1160 bp.

As a result, as shown in Table 2, 5 SNPs were present in Kasalath, but no amino acid substitutions were found.

A near-isogenic line NIL having a genetic background of Koshihikari into which the TPS6 locus derived from Kasalath was introduced was selected by the above method. The second leaf counted from flag leaves of Koshihikari and NIL cultivated in the paddy fields of the National Institute of Agricultural and Environmental Sciences was sampled using liquid nitrogen after heading and stored in a freezer set at -80°C. Methods of RNA extraction and real-time PCR were performed according to a previous report (Ishimaru et al., Nature Genet vol.45, pp.707-713, 2013). Specifically, leaves (100 mg) were collected from Koshihikari and NILprl5, and total RNA was extracted using Qiagen's Plant RNeasy kit according to its protocol. Next, using the total RNA as a template, cDNA was obtained by reaction using AMV reverse transcriptase from WAKO. Using the resulting cDNA as a template, the expression levels of genes such as OsTPS6 were compared by real-time PCR using the primers shown in the table below. Both plant bodies were used 60 days after transplantation.

The results are shown in FIG. From the results of FIG. 3, it was found that OsTPS6 was significantly highly expressed in NIL among the RNAs in the TPS6 locus, and the expression level was about 3.8 times higher in NILprl5 than in Koshihikari.

[Example 2]
Demonstration Experiment Using OsTPS6 Recombinant In this example, a recombinant was produced that highly expressed OsTPS6, which was thought to be the causative gene in Example 1, under the control of a strong 35S promoter.

Specifically, Nipponbare OsTPS6 cDNA (accession number AK072066) was inserted into pSTAH301G (containing the hygromycin resistance gene) between the cauliflower 35S protein promoter and nos terminator using XgaI and SacI to construct a vector. bottom.

The constructed vector was introduced into Nipponbare by the Agrobacterium method, and the recombinant (T0) was selected with hygromycin. In addition, introduction of OsTPS6 into the recombinant (T0) was confirmed using OsTPS6 cDNA-specific primers (SEQ ID NOs: 3 and 4).

Subsequently, the self-fertilized progeny (T1) was selected, and 10 individuals of each strain of the recombinant (T3) were confirmed by PCR. Three strains that could be identified as homozygous for the OsTPS6 gene and a strain in which the introduced gene could not be confirmed (null; control) were selected.

6 individuals each of 3 lines of Nipponbare, null and recombinant were cultivated in an isolated greenhouse and used for analysis. Samples two weeks after heading (-2 leaves) were measured using a green meter (SPAD: KONIKA-MINOLTA 501), then sampled, and the expression level of OsTPS6 was measured by the method described in Example 1. . In addition, the push-down resistance value was measured four weeks after heading according to a previous report (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004).

The results are shown in FIG. In FIG. 4, A shows the OsTPS6 expression level in each individual, B shows SPAD (lower leaf chlorophyll) in -2 leaves, and C shows push-down resistance values. 1 is Nipponbare, 2 is null, and 3 to 5 are recombinants, all of which are averages of 3 units (n=3). As a result of highly expressing OsTPS6 cDNA under the 35S promoter, the OsTPS6 expression level, -2 leaf SPAD, and pushing resistance were significantly higher than those of Koshihikari, except for individual 4's pushing resistance ( p < 0.01). Therefore, it was suggested that the increased expression of OsTPS6 suppressed the senescence of the lower leaves and increased the bearing capacity of the plants.

[Example 3]
Examination of OsTPS6 Promoter Sequence In this Example, the promoter region of the OsTPS6 gene was identified. Specifically, we sequenced 1 kb upstream of the start codon and compared the sequences between Kasalath and Koshihikari. Nine SNPs were found between Kasalath and Koshihikari.

Among them, the -188 (G/A) SNP disrupted the GCGG motif in the Kasalath type. A previous report (Non-Patent Document 1) reports that excessive DELLa protein (gibberellin signaling promoter) binds to the GCGG motif (−148 bp) under sd1, thereby reducing the expression level of OsTPS6.

To examine the relationship between the GCGG motif and the expression level of the OsTPS6 gene, we examined the expression level of OsTPS6 in multiple NIL individuals. First, NILprl5 (GCGG motif disrupted) and NILsd1 (excessive DELLa protein accumulation) were crossed to produce self-fertilized progeny F2 of the resulting F1. Based on the results of genotyping of 200 F2 individuals, the prl5, sd1 locus selected Kasalath-type or short-legged oolong-type lines to obtain progeny seeds. Seedlings obtained by sowing progeny seeds were sampled one month after transplanting, and the OsTPS6 expression level was measured in the same manner as in Example 1. The results are shown in Table 4.

NILprl5 (GCGG motif disruption) and NILprl5sd1 (GCGG motif disruption and DELLa protein overexpression) showed increased expression of OsTPS6 compared to NILsd1 (DELLa protein over-accumulation). From this result, -188 (G/A) in the promoter sequence of OsTPS6 was identified as FNP. That is, under sd1, excess DELLa protein binds to the GCGG motif and reduces the expression level of OsTPS6 (Non-Patent Document 1), whereas under the promoter sequence with FNP, the DELLa protein binds to the GCGG motif. It was suggested that the expression level of OsTPS6 is increased because the expression level of OsTPS6 does not decrease. Therefore, based on the unmutated promoter sequence (SEQ ID NO: 1), mutation from base G at position 883 (base corresponding to position 883) to another base (for example, base A), and at positions 883-886 Disruption of the motif GCGG may contribute to increased expression of OsTPS6.

[Example 4]
Investigation of Characteristics of Individual with Increased OsTPS6 Expression Level (NILprl5) In this Example, characteristics of an individual with increased OsTPS6 expression level (NILprl5) were examined.

(1) lodging resistance
Fig. 5 shows photographs of the individual with increased OsTPS6 expression (NILprl5) and the control Koshihikari on the day after Typhoon No. 9 hit on August 23, 2016 (maximum wind speed 26.9 m/s). Unlike Koshihikari (front), NILprl5 (back of photo in Fig. 5) does not fall down even when hit by a typhoon, indicating that it has lodging resistance.

(2) Yield Characteristics and High Rice Ratio Control Koshihikari and NIL were cultivated under the method and schedule of neighboring farmers (row spacing 30 cm, plant spacing 18 cm, mechanical planting). After harvesting the rice, the ratio of fine rice was determined using a sieve for brown rice. Table 5 shows the results.

From Table 5, it can be seen that the yield characteristics of NIL are comparable to Koshihikari. In addition, it can be seen that the proportion of fine rice with a sieve mesh size of 2.0 or more is higher than that of Koshihikari. As a recent trend, there is a tendency to choose rice with good grains (large grains). Therefore, NIL has the advantage of having excellent characteristics with a high percentage of rice.

(3) Possibility of identification and removal of weedy rice In recent years, rice that grows wild in fields grows mixed with cultivated varieties, and the resulting colored seeds (red rice) are mixed with harvested unpolished rice, causing a serious problem. This spontaneously mixed rice is called "weedy rice", and it proliferates in various parts of the world, causing great damage to paddy rice cultivation. In normal paddy rice cultivation, herbicides are used to control weeds, but since herbicides are extremely safe for paddy rice, it is not possible to control weedy rice, which is the same plant species as paddy rice, with herbicides for paddy rice. Extremely difficult.

Fig. 6 shows the results of a cultivation test conducted at the farm of University of Miyazaki, Miyazaki Prefecture, for an individual (NILprl5) with an increased OsTPS6 expression level and Koshihikari as a control. The left side of the photograph in Fig. 6 is Koshihikari, and the right side is NILprl5. Koshihikari on the left side of Fig. 6 lodged and weedy rice contamination was unknown, but NILprl5 on the right side did not lodge, indicating that weedy rice could be identified and removed as indicated by the arrow.

SEQ ID NOS: 3-19: Artificial, Synthetic Primers

Claims (18)

A method of producing a lodging resistant plant comprising increasing trehalose-6-phosphate in at least a portion of the plant. A method of eliminating weedy plants in plant cultivation comprising growing plants having increased trehalose-6-phosphate in at least a portion of the plant. A method for cultivating rice with a high ratio of high quality rice, comprising cultivating rice in which trehalose-6-phosphate is increased in at least a part of the rice. The method according to any one of claims 1 to 3, wherein the increase in trehalose-6-phosphate is performed by an increase in trehalose-6-phosphate synthase. The increase in trehalose-6-phosphate synthase results in expression of a trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2, or trehalose-6- 5. The method according to claim 4, which is carried out by introducing a phosphate synthase gene. 6. The method of claim 5, wherein the trehalose-6-phosphate synthase gene comprises at least one gene selected from the group consisting of OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4 and OsTPS5. A method according to any one of claims 1 to 3, wherein said increasing of trehalose-6-phosphate is effected by application of a signaling precursor of trehalose-6-phosphate. The method according to any one of claims 1 to 3, wherein said increasing trehalose-6-phosphate is achieved by decreasing or inhibiting trehalose-6-phosphate phosphatase. 9. The plant according to any one of claims 1, 2, and 4 to 8, wherein the plant comprises at least one selected from the group consisting of gramineous plants, leguminous plants, cruciferous plants, and solanaceous plants. the method of. The method according to any one of claims 1, 2 and 4-9, wherein the plant is rice. The method according to any one of claims 1 to 10, wherein at least part of said plant or rice comprises at least one selected from the group consisting of stems, roots and leaves. The promoter sequence of the trehalose-6-phosphate synthase gene has the sequence shown in SEQ ID NO: 2, or has at least 90% sequence identity with the sequence shown in SEQ ID NO: 2 and has promoter activity or a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 is mutated to another base or a sequence in which the nucleotide motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted 1. A plant or plant part thereof, comprising a promoter sequence having a 13. The plant or plant part thereof according to claim 12, wherein said plant part is at least one selected from the group consisting of plant seedlings, roots and seeds. 14. The plant or plant part thereof according to claim 12 or 13, wherein said plant comprises at least one species selected from the group consisting of grasses, legumes, cruciferous plants, and solanaceous plants. The plant or plant part thereof according to any one of claims 12 to 14, wherein said plant is rice. 16. A plant or plant part thereof according to any one of claims 12 to 15, wherein said plant is lodging resistant or said plant part is lodging resistant when it becomes a whole plant. A method for determining or selecting a lodging-resistant plant, wherein the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant has the sequence shown in SEQ ID NO: 2, or a promoter sequence having the sequence shown in SEQ ID NO: 2 A promoter sequence having at least 90% sequence identity to the sequence shown and having promoter activity, or a mutation of base G at position 883 of the promoter sequence shown in SEQ ID NO: 1 to another base or SEQ ID NO: 1 detecting whether it contains a disruption of the base motif GCGG at positions 883-886 of the promoter sequence shown in . 18. The method of claim 17, wherein detection of said mutation is performed using polymerase chain reaction (PCR), hybridization, or sequencing methods.

Images