JP2023034932A - Method for predicting smell perception for or7a17 ligand - Google Patents

Abstract

To provide a method for predicting smell perception for OR7A17 ligand.SOLUTION: A method for predicting smell perception of a subject for OR7A17 ligand includes the step of detecting a genotype of a single nucleotide polymorphism of OR7A17 gene.SELECTED DRAWING: None

Description

The present invention relates to a method of predicting odor perception for OR7A17 ligands.

In recent years, with the diversification of lifestyles and lifestyle values, products and services that match each value are being developed on a daily basis. For example, in the medical field, appropriate health care (personalized health care) has been proposed in accordance with individual differences in genes, environments, and lifestyles. Similarly, in the fragrance industry, there is a demand for the provision of fragrances adapted to diverse values and fragrances tailored to individual olfactory characteristics.

External odorants are mainly captured by olfactory neurons located in the deepest part of the nasal cavity. Molecules that olfactory nerve cells use as odor sensors are olfactory receptors. Olfactory receptors bound to odorants excite olfactory neurons by triggering intracellular signals. Odorants that activate olfactory receptors and generate signals in this way are called agonists. The excitation of olfactory neurons associated with the activation of olfactory receptors is transmitted to higher-order neurons via synapses, ultimately producing odor perception in the brain.
At present, there are about 400 types of olfactory receptor genes, which are expected to play a role in odor recognition. Basically, each olfactory receptor binds multiple species of odorants that share chemical structural features. The enormous number of types of these olfactory receptors and the ability of individual receptors to recognize multiple odorants are the molecular basis for humans to detect a large number of odorants.

Ambergris, which is an intestinal calculus of the Persian whale, is a perfume that has been loved by people since ancient times, as represented by the fact that it was a tribute to the royal family in ancient Persia. However, since commercial whaling is currently prohibited, the main aroma component (-)-ambroxide ([3aR-(3aα,5aβ,9aα,9bβ)]-dodecahydro-3a,6,6,9a-tetramethylnaphto[2 ,1-b]furan) are used in a wide range of products. Due to this demand, several companies have launched fragrances containing (-)-ambroxide as the main ingredient. For example, AMBROXAN (registered trademark) (Kao Chemical), CETALOX (registered trademark) (Firmenich), Ambrox Super (registered trademark) (Firmenich) and the like are known.

Patent Document 1 identifies OR7A17 as an olfactory receptor for (−)-ambroxide. In addition, Patent Document 2 reports AMBROXAN and Orbitone (registered trademark) (Takasago International Corporation) as agonist perfumes for OR7A17.

However, with regard to ambergris and (−)-ambroxide, the existence of humans with different preferences and low susceptibility has been plausibly discussed. Historically, ambergris was brought to East Asia from Europe and the Middle East, where it was not valued for its fragrance. As a reason for this, Kentaro Yamada, a researcher of the history of fragrances, points out the possibility that East Asians' sensitivity to and preference for ambergris aromas may be different from that of Europeans (Non-Patent Document 1). It has also been reported that about 20% of humans are AMBROXAN-low sensitive (Non-Patent Document 2). Elucidating the mechanism of specific olfactory blindness, in which specific odors cannot be sensed or are difficult to sense, will enable the development of perfumes that are appropriate for individual olfactory characteristics.

Single nucleotide polymorphism (SNP) is a phenomenon in which one base on the genome is replaced with another base at a rate of 1% or more in a population. Based on the base sequence of the gene, it is determined which amino acid to be translated into, and a polypeptide consisting of consecutive amino acids is expressed. When this is appropriately modified, it becomes a functional protein. Where SNPs are present, substitution of one amino acid by another amino acid as defined by the base sequence often results in a protein with reduced or no function. It has been reported that this SNP-induced deterioration or loss of function of olfactory receptors affects odor perception in humans (Non-Patent Documents 3 to 8). For example, it is known that the genetic polymorphism of the guaiacol olfactory receptor OR10G4 affects the strength and pleasure evaluation of guaiacol (Non-Patent Document 7).

On the other hand, however, even if it is the same OR10G4 agonist, the genetic polymorphism of OR10G4 does not affect the strength and comfort evaluation of vanillin or ethylvanillin (Non-Patent Document 7). This is considered to be caused by the presence of olfactory receptors other than OR10G4 that accept vanillin and ethylvanillin. Thus, the functionality of a single olfactory receptor in vitro does not necessarily reflect the perception of actual agonist perfumes. So far, an in vitro human olfactory receptor ligand assay system has succeeded in identifying ligands for only 12% of olfactory receptors (Non-Patent Document 8). Therefore, a ligand for an olfactory receptor may also be accepted by unknown olfactory receptors that are currently unanalyzable. Therefore, the influence on odor perception caused by genetic polymorphism of a single olfactory receptor gene and its functionality in vitro will be clarified for the first time by verifying actual odor perception.

OR7A17 has a SNP (rs10405129, A>G, I46T) in which the 46th amino acid in the amino acid sequence is substituted with threonine from isoleucine and a SNP (rs10404119, C>A, A69S) in which the 69th amino acid is substituted from alanine to serine. ) exists. That is, OR7A17 has 4 types of variants, OR7A17 IA, IS, TA, and TS, due to differences in the 46th and 69th amino acids. Both SNPs are only 68 bp apart on the genome, indicating linkage disequilibrium. Actually referring to the data of the Japanese population of the 1000 Genome Project Phase 3, the linkage disequilibrium coefficient r ² =1.000 (Non-Patent Document 9). That is, in the Japanese population, OR7A17 is mostly occupied by IA and TS. However, the relationship between such SNPs and OR7A17 ligands in odor perception is completely unknown.

JP 2018-74944 A International Publication No. 2018/190118

Kentaro Yamada: "East and West Perfume History" (publisher: Fukumura Shoten Co., Ltd.) (1956) Hummel, T. et al., Front. Psychol. 4, 1-8 (2013). Keller, A. et al., Nature 449, 468-472 (2007). Menashe, I. et al., PLoS Biol. 5, 2462-2468 (2007). McRae, J.F. et al., Chem. Senses 37, 585-593 (2012). Jaeger, S. R. et al., Curr. Biol. 23, 1601-1605 (2013). Mainland, J. D. et al., Nat. Neurosci. 17, 114-120 (2014). Trimmer, C. et al., Proc. Natl. Acad. Sci. Auton, A. et al., Nature 526, 68-74 (2015).

Specific anosmia has been reported for Ambergris and AMBROXAN, which are industrially important perfumes. Although OR7A17 is known as an olfactory receptor that responds to (−)-ambroxide, the main odorant component of these perfumes, the mechanism of specific olfactory blindness was unclear. The present invention relates to clarifying what individual characteristics are involved in this phenomenon, and to provide a method for predicting odor perception for OR7A17 ligands using these characteristics as indicators.

The present inventors have found that responsiveness to OR7A17 ligands varies depending on the genotype of the OR7A17 SNP, and that odor perception to OR7A17 ligands varies depending on the genotype.

Accordingly, the present invention provides a method of predicting a subject's odor perception to an OR7A17 ligand, comprising detecting genotypes of SNPs in the OR7A17 gene.
The present invention also provides a reagent for predicting odor perception of a subject for an OR7A17 ligand, which contains a probe and/or a primer that hybridizes under stringent conditions to a region of genomic DNA containing a base at the SNP site of the OR7A17 gene. offer.
The present invention also provides a kit for predicting the odor perception of a subject for an OR7A17 ligand, which contains the reagent described above.
The present invention also provides a method of predicting the genotype of SNPs in the OR7A17 gene of a subject, comprising the step of measuring odor perception to an OR7A17 ligand.
The present invention also provides a method for selecting a perfume material having at least one odor quality selected from the group consisting of trees and grasses, comprising:
OR7A17 consisting of the amino acid sequence shown in SEQ ID NO: 2 and OR7A17 consisting of an amino acid sequence having at least 80% identity with the amino acid sequence shown in SEQ ID NO: 2 and having an amino acid sequence shown in SEQ ID NO: 2 in the presence of a test substance measuring the response of at least one olfactory receptor polypeptide selected from the group consisting of polypeptides having isoleucine at the position corresponding to the 46th amino acid; and a test substance to which the olfactory receptor polypeptide responds the step of selecting,
A method is provided, comprising:

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to simply and objectively predict a subject's odor perception to an OR7A17 ligand. This makes it possible to provide personalized fragrances according to each individual's olfactory characteristics. Moreover, according to the present invention, it is possible to efficiently search for or select perfume materials having specific odor qualities such as trees and grasses.

(A) Responsiveness of OR7A17 IA to odor samples. The horizontal axis represents odor samples (abbreviations), and the vertical axis represents receptor response intensity. Mean values of three independent experiments are shown. Error bars are standard errors. (B) Responsiveness of OR7A17 IA to AMBROXAN (purified), Iso E Super®, Orbitone. The horizontal axis represents the perfume concentration, and the vertical axis represents the receptor response intensity. Mean values of three independent experiments are shown. Error bars are standard errors. (A) Responsiveness of each OR7A17 variant to AMBROXAN. The horizontal axis represents AMBROXAN concentration, and the vertical axis represents receptor response intensity. Shown are the average values of two independent experiments for 300 μM alone and three independent experiments for others. Error bars are standard errors. (B) Responsiveness of each OR7A17 variant to mixed perfume solutions. The horizontal axis represents the perfume mixed solution, and the vertical axis represents the receptor response intensity. Mean values of three independent experiments are shown. Error bars are standard errors. (C) Responsiveness of each OR7A17 variant to amber fragrances. The horizontal axis represents the amber fragrance, and the vertical axis represents the receptor response intensity. Mean values of three replicates in one experiment are shown. Error bars are standard errors. (A) Detection threshold data for AMBROXAN (purified) and 8-Drimanol. The color of the plot represents the genotype of OR7A17, white: AA, gray: AG, black: GG. The horizontal axis column represents the genotype of OR7A17, and the vertical axis represents the detection threshold concentration. n. s. indicates not significant (Mann-Whitney U test, p>0.05). (B) Intensity evaluation data for odor samples. The color of the plot represents the genotype of OR7A17, white: AA, gray: AG, black: GG. The horizontal axis column represents the genotype of OR7A17, and the vertical axis represents the sensory intensity value. Boxed ABS, ABX, ABXP, and CTLX are odor samples containing the OR7A17 agonist (−)-ambroxide, respectively. (C) Differences in intensity evaluation between genotypes in odor samples and summary of statistical analysis results. Bar graphs show differences between genotypes in median intensity (GG-AA/AG). Positive and negative values indicate that GG feels strongly or weakly, respectively. Dark gray bars indicate odor samples containing (−)-ambroxide. The plot is AA/AG vs. GG Mann-Whitney U test results (p value). (A) Pleasant evaluation data for odor samples. The color of the plot represents the genotype of OR7A17, white: AA, gray: AG, black: GG. The horizontal axis column represents the genotype of OR7A17, and the vertical axis represents the comfort evaluation value. Boxed ABX and ABXP are odor samples containing the OR7A17 agonist (−)-ambroxide, respectively. (B) Summary of differences in pleasure between genotypes in odor samples and results of statistical analysis. Bar graphs show differences between genotypes in median intensity (GG-AA/AG). A negative value indicates that GG feels less comfortable than AA/AG. Dark gray bars indicate odor samples containing (−)-ambroxide. The plot is AA/AG vs. GG Mann-Whitney U test results (p value). (A), (B), and (C) show how the odor quality is perceived when the odor samples are smelled. The color of the plot represents the genotype of OR7A17, white: AA, gray: AG, black: GG. The horizontal axis column indicates the genotype of OR7A17, and the vertical axis indicates the degree of fit to each texture item. (A) is AMBROXAN (purified), (B) is AMBROXAN, and (C) is data when smelling 8-Drimanol. (A) (B) (C) Differences in fit between genotypes in odor quality of odor samples and summary of statistical analysis results. Results for (A) AMBROXAN (purified), (B) AMBROXAN, and (C) 8-Drimanol. Bar graphs are median genotype differences (AA/AG-GG). A positive value indicates that AA/AG fits the odor quality better than GG. The plot is AA/AG vs. GG Mann-Whitney U test results (p value). Asterisks represent less than the 5% significance level (p<0.00108) after 45 multiple testing corrections (Bonferroni). (A) (C) (E) Percentage of study participants who perceived odor quality when smelling the odor samples. Results for (A) Cedryl methyl ether, (C) Orbitone, and (E) Iso E Super. (B) (D) (F) Perceived rate difference (%) between OR7A17 genotypes in the odor quality item. A positive value indicates that a greater percentage of people do not feel AA/AG than GG. The hatched bars represent trees and grass items, and the black bars represent other items. Results for (B) Cedryl methyl ether, (D) 8-Drimanol, and (F) Iso E Super.

All patents, non-patents, and other publications cited herein are hereby incorporated by reference in their entirety.

1. Definition of terms used in this specification The abbreviations of base sequences (nucleotide sequences), nucleic acids, amino acid sequences, amino acids, etc. in this specification are defined by IUPAC-IUB (IUPAC-IUB communication on Biological Nomenclature, Eur.J Biochem., 138, 9, 1984), "Guidelines for Preparation of Specifications Containing Nucleotide Sequences or Amino Acid Sequences" (edited by the Patent Office), and common symbols in the field.

As used herein, the term "nucleic acid" or "polynucleotide" means DNA or RNA. DNA includes cDNA, genomic DNA, and synthetic DNA, and "RNA" includes total RNA, mRNA, rRNA, tRNA, non-coding RNA, and synthetic RNA.

As used herein, the term "gene" refers to double-stranded DNA containing human genomic DNA, single-stranded DNA (positive strand) containing cDNA, and single-stranded DNA (complementary strand) having a sequence complementary to the positive strand. strands), and fragments thereof, which contain some biological information in the sequence information of the bases that make up the DNA. In addition, the term "gene" as used herein refers to regulatory regions, coding regions, exons, and introns without distinction, unless otherwise specified. In addition, the "gene" includes not only a "gene" represented by a specific nucleotide sequence, but also homologues (that is, homologues or orthologs), mutants such as polymorphisms, and derivatives thereof. The above variants include naturally occurring allelic variants, non-naturally occurring variants, and variants having nucleotide sequences altered by artificial deletion, substitution, addition and insertion. be. The above-mentioned mutants are 80% or more, more preferably 90% or more, still more preferably 95% or more, even more preferably 98% or more, still more preferably 99% or more in the base sequence of a gene or polynucleotide without mutation. % or more identity can be mentioned.

As used herein, "protein" includes not only "protein" represented by a specific nucleotide sequence or amino acid sequence, but also fragments, homologues (i.e., homologues or orthologs), variants, and derivatives thereof. . The above variants include naturally occurring allelic variants, non-naturally occurring variants, and variants with amino acid sequences altered by artificial deletion, substitution, addition and insertion. be. In addition, the above-mentioned mutants are 80% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% or more, still more preferably 80% or more, more preferably 90% or more, and even more preferably 98% or more of the amino acid sequence of the protein or polypeptide without mutation. can include those having 99% or more identity.

As used herein, the identity of nucleotide sequences and amino acid sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-41). Specifically, using the homology analysis (Search homology) program of genetic information processing software Genetyx-Win (Ver.5.1.1; software development), Unit size to compare (ktup) is set to 2 and analysis is performed. Calculated by

As used herein, the term "corresponding position" on the amino acid sequence refers to the alignment of the target sequence and the reference sequence (in the present invention, the amino acid sequence represented by SEQ ID NO: 2) so as to give maximum homology. can be determined by letting Amino acid sequence alignments can be performed using known algorithms, the procedures of which are known to those skilled in the art. For example, alignments can be performed using the Clustal W multiple alignment program (Thompson, JD et al, 1994, Nucleic Acids Res. 22:4673-4680) with default settings. Alternatively, Clustal W2, which is a revised version of Clustal W, or Clustal omega can also be used. Clustal W, Clustal W2 and Clustal omega are, for example, European Bioinformatics Institute: EBI [www.ebi.ac.uk/index.html]) and Japan DNA data operated by the National Institute of Genetics It is available on the website of the bank (DDBJ [www.ddbj.nig.ac.jp/searches-j.html]). A position in the target sequence that is aligned to any position in the reference sequence by the above alignment is considered to be the "corresponding position" to that arbitrary position.

As used herein, "Single Nucleotide Polymorphism (SNP)" means that one base at a specific site in the genome is substituted with another base at a rate of 1% or more in the population. . As used herein, the term "genotype" refers to the combination of alleles at a locus. Hereinafter, the genotypes of SNPs may be represented in the order of allele 1 and allele 2. If both alleles are the same as in AA, the genotype is homozygous, and if both alleles are different as in AT, the genotype is heterozygous. As used herein, "SNP" includes allele 1, allele 2 and their complementary strands. SNPs disclosed herein may be represented by an ID in the dbSNP database (http://www.ncbi.nlm.nih.gov/SNP/).

In the present specification, "detection of genotype" can also be replaced by terms such as genotype testing, identification, discrimination, measurement, or determination. "Detection of genotype" includes both detection of one allele at a locus and detection of both alleles at the locus.

As used herein, the term "olfactory receptor polypeptide" refers to an olfactory receptor or a polypeptide having a function equivalent thereto, and a polypeptide having a function equivalent to an olfactory receptor , which can be expressed on the cell membrane, is activated by the binding of odorant molecules, and when activated, increases the amount of intracellular cAMP by coupling with intracellular Gas and activating adenylate cyclase. (Nat. Neurosci., 2004, 5:263-278).

As used herein, “OR7A17” refers to human olfactory receptor OR7A17 (olfactory receptor family 7 subfamily A member 17). OR7A17 is an olfactory receptor expressed in human olfactory cells. OR7A17 is registered with GenBank ([www.ncbi.nlm.nih.gov/genbank/]) as GI: 13775161. OR7A17 is a protein consisting of the amino acid sequence shown in SEQ ID NO:2 encoded by the gene having the nucleotide sequence shown in SEQ ID NO:1.

As used herein, the term "OR7A17 ligand", also referred to as an OR7A17 agonist, refers to a substance capable of binding to OR7A17. Examples of the ligand include (−)-ambroxide ([3aR-(3aα,5aβ,9aα,9bβ)]-Dodecahydro-3a,6,6,9a-tetramethylnaphto[2,1-b]furan, 1), fragrance containing (-)-ambroxide as a main component (for example, AMBROXAN (registered trademark) (Kao Chemical)), 1-(1,2,3,4,5,6,7,8-octahydro -2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one, 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8- Fragrances containing tetramethyl-2-naphthyl)ethan-1-one as a main component (e.g., Orbitone (registered trademark) (Takasago International Corporation, Patent Document 2), Iso E Super (registered trademark) (IFF)), etc. is mentioned.

As used herein, the term "smell perception" is a concept that includes how to perceive smells recognized by the brain, such as the pleasantness of smells (pleasantness) and the quality of smells (what kind of smell it is). . Conventionally, odor perception has been evaluated by means of sensory evaluation and odor sensors. It was measured by evaluating whether The quality of the odor can be evaluated, for example, by presenting an odorant to a subject and evaluating whether or not the odor of the odorant corresponds to a pre-prepared phrase expressing the quality of the odor, or was measured by subjects expressing themselves freely in their own words.

In the present specification, phrases expressing the quality of smell are not particularly limited, and examples include “sweet”, “food”, “grass”, “tree”, “soap”, “flower”, “perfume”, Phrases such as "cool feeling", "warm", "chemical smell", "spicy", "sweaty smell", "sour", "burnt smell", and "greasy" can be mentioned. Of these, the smells corresponding to "food", "grass", "trees", "soap", "flowers" and "perfume" are, respectively, some kind of "food", "grass", "trees" and "soap". ”, “flower”, and “perfume”. For example, the odor that evokes the presence of "grass" is the odor that gives the impression of grass, and the odor that gives the impression of "tree" is the odor that gives the impression of trees. "Grass", "tree", and "flower" can also be called green note, woody note, and floral note, respectively.

2. Method for Predicting Odor Perception for OR7A17 Ligand The research group of the present inventors previously identified OR7A17 as an olfactory receptor that specifically responds to (−)-ambroxide (Patent Document 1). (−)-Ambroxide is a main component of ambergris odor, and is one of amber-based perfumes having an ambergris-like odor. On the other hand, with regard to ambergris and AMBROXAN, it has been pointed out that there are humans who exhibit specific olfactory blindness who do not perceive or hardly perceive these odors despite having a normal sense of smell (Non-Patent Documents 1 and 2). . However, the molecular mechanism that causes such individual differences has remained unclear.

The OR7A17 gene is located at the 137th base (T in SEQ ID NO: 1) of the nucleotide sequence shown in SEQ ID NO: 1, and isoleucine is substituted with threonine at the 46th amino acid of the amino acid sequence shown in SEQ ID NO: 2. SNP (rs10405129, A>G, I46T) and the 205th base (G in SEQ ID NO: 1) in the nucleotide sequence shown in SEQ ID NO: 1, and the 69th amino acid in the amino acid sequence shown in SEQ ID NO: 2 Alanine to serine (rs10404119, C>A, A69S) exists, and OR7A17 has a total of 4 variants (OR7A17 IA, IS, TA, TS) due to these amino acid differences. OR7A17 IA is encoded by the nucleotide sequence shown in SEQ ID NO:1 and consists of the amino acid sequence shown in SEQ ID NO:2. OR7A17 IS consists of an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1 in which the 205th base is T, and the amino acid sequence shown in SEQ ID NO: 2 in which the 69th amino acid is serine. OR7A17 TA is encoded by the nucleotide sequence shown in SEQ ID NO: 1 in which the 137th base is C, and the amino acid sequence shown in SEQ ID NO: 2 in which the 46th amino acid is threonine. OR7A17 TS is encoded by a nucleotide sequence in which the 137th base is C and the 205th base is T in the nucleotide sequence shown by SEQ ID NO: 1, and the 46th base in the amino acid sequence shown by SEQ ID NO: 2. It consists of an amino acid sequence in which the amino acid is threonine and the 69th amino acid is serine. In addition, since the OR7A17 gene is transcribed in the opposite direction to the direction of the genome sequence registered in dbSNP, the 137th base of the base sequence shown in SEQ ID NO: 1 corresponding to the A allele and G allele of rs10405129 is , are T and C, respectively, and the 205th base of the nucleotide sequence shown in SEQ ID NO: 1 corresponding to the C and A alleles of rs10404119 is G and T, respectively.

This time, the present inventor found that the responsiveness of OR7A17 to AMBROXAN, which is an OR7A17 ligand, differs depending on the variant, as shown in Examples below. That is, OR7A17 IA shows concentration-dependent responsiveness to AMBROXAN, but OR7A17 IS shows a decrease in response intensity, and OR7A17 TA and TS completely abolish the responsiveness (Fig. 2A). Such results indicate that the 46th amino acid substitution (I46T) and/or the 69th amino acid substitution (A69S) in the amino acid sequence shown in SEQ ID NO: 2 impairs the responsiveness of OR7A17 to ligands, particularly the former amino acid. It suggests that the substitution impairs the responsiveness of OR7A17 to ligands. In other words, if the genotype of the rs10405129 SNP in the OR7A17 gene is AA or AG (functional type), that is, if the A allele exists, the OR7A17 variant expressed from the gene responds to the ligand. On the other hand, if the genotype of the rs10405129 SNP in the OR7A17 gene is GG (non-functional), that is, if the A allele is absent, the OR7A17 variant expressed from the gene responds to the ligand I can't. In addition, when the genotype of the rs10404119 SNP in the OR7A17 gene is CC or CA (functional type), that is, when the C allele is present, the OR7A17 variant expressed from the gene can respond to the ligand. On the other hand, if the genotype of the rs10404119 SNP in the OR7A17 gene is AA (low functional type), that is, if the C allele does not exist, the OR7A17 variant expressed from the gene is responsive to the ligand. The extent of those who have is reduced.

In addition, as shown in Examples below, the present inventors have found that there is no significant difference in the detection threshold and sensory intensity of AMBROXAN between the genotypes of the rs10405129 SNP in the OR7A17 gene, AA or AG and GG. were found (FIGS. 3A-C). This is probably because there are olfactory receptors other than OR7A17 that recognize (−)-ambroxide.

Furthermore, as shown in the examples below, the present inventors found that when the genotype of the rs10405129 SNP in the OR7A17 gene is GG, compared to AA or AG, the amount of fragrances containing AMBROXAN and (−)-ambroxide It was found that it was difficult to feel comfortable with the smell (Fig. 4A, B). Therefore, it was clarified that, in the case of genotypes in which OR7A17 is not functioning, the odor of the OR7A17 ligand is less pleasant to smell.

Furthermore, as shown in Examples below, the present inventors found that when the genotype of the rs10405129 SNP in the OR7A17 gene is GG, compared to AA or AG, the odor qualities of AMBROXAN are "treey" and " It was found that the feeling of "grass" was hardly felt, and that the feeling of "tree" was particularly difficult to be felt significantly (Figs. 5A, B, 6A, B). Therefore, it was clarified that genotypes in which OR7A17 does not function are less likely to perceive a “tree” and/or “grass” odor quality of the OR7A17 ligand. In addition, with respect to Orbitone and Iso E Super, which are other OR7A17 ligands, it was found that the genotype of the OR7A17 gene similarly affects the perception of "tree" and/or "grass" as odor qualities. (FIGS. 7C-F).

Therefore, the genotype of SNPs in the OR7A17 gene can serve as an index for predicting odor perception to OR7A17 ligands. Accordingly, the present invention provides a method of predicting a subject's odor perception to an OR7A17 ligand (hereinafter referred to as the method of the present invention). The method includes the step of detecting the genotype of SNPs in the OR7A17 gene.

In the method of predicting odor perception for OR7A17 ligands of the present invention, OR7A17 ligands include any substance that can bind to OR7A17. Examples of such ligands include (-)-ambroxide, (-)-ambroxide-containing fragrances, 1-(1,2,3,4,5,6,7,8-octahydro-2,3, 8,8-tetramethyl-2-naphthyl)ethan-1-one, 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl ) fragrances containing ethan-1-one, preferably at least one selected from the group consisting of these, more preferably containing (−)-ambroxide and (−)-ambroxide It is at least one selected from the group consisting of fragrances, more preferably (-)-ambroxide.

In the method of the present invention, the odor perception to be predicted includes how to perceive an odor, such as the pleasantness of the odor and the quality of the odor. As for odor perception, it is preferably selected from the group consisting of how to perceive the pleasantness of the odor, such as whether the odor is pleasant or not, and how to perceive the quality of the odor, such as what kind of odor quality it has. at least one

In the present invention, it is possible to predict the odor perception of a subject for an OR7A17 ligand based on the genotype of the SNP in the OR7A17 gene. The SNP genotype of the OR7A17 gene can be detected using a biological sample collected from a subject. The biological sample is not particularly limited as long as it contains genomic DNA, and may be any cell, tissue, or biological material collected from a subject, a clinical sample thereof, or the like. Specifically, serum prepared from cells such as oral mucosal epithelial cells, tissues, organs, skin, blood, urine, saliva, sweat, stratum corneum, superficial skin lipids (SSL), body fluids such as tissue exudates, and blood , blood plasma, feces, hair, nails, teeth, bones, etc., preferably saliva or blood, more preferably saliva.
Genomic DNA can be extracted from a biological sample by methods commonly used for genomic DNA extraction or purification, such as the phenol method, CTAB method, alkaline SDS method, and the like. A crude extract of the genomic DNA may be used as it is, or if necessary, it may be purified by a known method. Reagents and kits for genomic DNA extraction are commercially available and may be used.

In the method of the present invention, the genotype of the SNP of the OR7A17 gene is detected. The genotype of at least one SNP selected from the group consisting of SNP (rs10404119) is preferred, and the genotype of SNP rs10405129 is more preferred. The SNP whose genotype is detected may be any one of the above SNPs, or may be two or more.

Methods commonly used for SNP detection can be used to detect the SNP genotype. Hereafter, conventionally known typical SNP genotype detection methods are listed, but the present invention is not limited to these. (a) RFLP (restriction fragment length polymorphism) method, (b) PCR-SSCP method (single-stranded DNA conformation polymorphism analysis, Biotechniques, 16, p296-297, 1994, and Biotechniques, 21, p510 -514, 1996), (c) ASO hybridization method (Lin.Chim.Acta., 189, p153-157, 1990), (d) direct sequencing method (Biotechniques, 11, p246-249, 1991), (e ) ARMS method (Nuc.Acids Res., 19, p3561-3567, 1991 and Nuc.Acids Res., 20, p4831-4837, 1992), (f) Denaturant concentration gradient gel electrophoresis (DGGE) method (Biotechniques , 27, p1016-1018, 1999), (g) RNase A cleavage method (DNA Cell Biol., 14, p87-94, 1995), (h) chemical cleavage method (Biotechniques, 21, p216-218, 1996), ( i) DOL method (Genome Res., 8, p549-556, 1998), (j) TaqMan-PCR method (Genet. Anal., 14, p143-149, 1999, and J. Clin. Microbiol., 34, p2933 -2936, 1996), (k) Invader method (Science, 5109, p778-783, 1993, J.Bio.Chem., 30, p21387-21394, 1999, and Nat.Biotechnol., 17, p292-296, 1999 ), (l) MALDI-TOF/MS method (Genome Res., 7, p378-388, 1997 and Eur.J.Clin.Chem.Clin.Biochem., 35, p545-548, 1997), (m) USA, 94, p10756-10761, 1997), (n) molecular beacon method (Nat.Biotechnol., 16, p49-53, 1998), (o) dynamic allyl Specific hybridization (DASH) method (Nat.Biotechnol., 17, p87-88, 1999), (p) Padro (Nat. Genet., 3, p225-232, 1998), (q) DNA chip or DNA microarray (Yusuke Nakamura et al., "SNP gene polymorphism strategy", Nakayama Shoten, p128-135). , 2000), (r) ECA method (Anal.Chem., 72, p1334-1341, 2000), (s) cycling probe method (International Publication No. 2003/074696), (t) smart amplifier method (Nat.Methods , 4, p257-262, 2007).

The above are typical SNP genotype detection methods, but the method of the present invention is not limited to these, and other known or future genotype detection methods can be widely used. Moreover, in detecting the genotype of the SNP of the present invention, these detection methods may be used alone, or two or more of them may be used in combination. The direct sequencing method, the TaqMan-PCR method, and the invader method will be described in more detail below as representative methods.

(1) Direct sequencing method In the direct sequencing method, the region is amplified by PCR using primers that specifically amplify the region containing the SNP site in the base sequence shown in SEQ ID NO: 1 in the genomic DNA derived from the biological sample. Then, the genotype of the SNP site can be detected by sequencing the base sequence of the amplified product using the primers used for PCR or primers separately designed inside the amplified region as sequencing primers.

(2) TaqMan-PCR Method The TaqMan-PCR method is a method that utilizes fluorescently labeled allele-specific oligonucleotides (TaqMan probes) and PCR using Taq DNA polymerase. The TaqMan probe contains a partial nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 1 in human genomic DNA, which is a continuous nucleotide sequence of about 15 to about 30 nucleotides including the nucleotides of any of the above polymorphic sites. Oligonucleotides (for example, nucleic acid probes contained in reagents for predicting odor perception of the OR7A17 ligand of the present invention, which will be described later) are used. The probe is labeled at its 5′ end with a fluorescent dye such as FAM or VIC and at its 3′ end with a quencher (quencher) such as TAMRA, and the quencher absorbs fluorescence energy in its intact state. Therefore no fluorescence is detected. Probes are preferably prepared for both alleles and labeled with fluorescent dyes having different fluorescence wavelengths (for example, FAM for one allele and VIC for the other) for collective detection. In addition, the 3' end is phosphorylated to prevent PCR elongation from the TaqMan probe. When PCR is performed with Taq DNA polymerase and primers designed to amplify a partial sequence of genomic DNA containing a region that hybridizes with the TaqMan probe, the TaqMan probe hybridizes with the template DNA and simultaneously initiates an extension reaction from the PCR primers. However, as the elongation reaction proceeds, the hybridized TaqMan probe is cleaved by the 5' nuclease activity of Taq DNA polymerase, the fluorescent dye is liberated and is no longer affected by the quencher, and fluorescence is detected. Fluorescence intensity increases exponentially with template amplification. For example, in the detection of the SNP (rs10405129) at the 137th base of the nucleotide sequence shown in SEQ ID NO: 1, an allele-specific oligonucleotide containing the base (about 15 to about 30 bases long; A allele is FAM, G allele is labeled with VIC at the 5' end and labeled with TAMRA at the 3' end). , the fluorescence of the other is hardly observed. On the other hand, if the subject's genotype is AG, both FAM and VIC fluorescence are detected.

(3) Invader method In the Invader method, unlike the TaqMan-PCR method, the allele-specific oligonucleotide (allyl probe) itself is not labeled, and a sequence ( flap) and has a template-specific complementary sequence on the 3' side. In the Invader method, an oligonucleotide (Invader probe; the base corresponding to the polymorphic site at the 5' end of the probe is arbitrary) having a specific complementary sequence on the 3' side of the polymorphic site of the template, and The 5' side has a sequence capable of forming a hairpin structure, and the sequence continuous to the 3' side from the base paired with the base at the 5' end when the hairpin structure is formed is a sequence complementary to the flap of the allyl probe. A FRET (Fluorescence Resonance Energy Transfer) probe characterized by: The 5′ end of the FRET probe is fluorescently labeled (eg, FAM, VIC, etc.), and a quencher (eg, TAMRA, etc.) is bound in the vicinity thereof, and fluorescence is not detected in the intact state (hairpin structure). When the allele probe and the invader probe are reacted with the template genomic DNA, the 3′ end of the invader probe intrudes into the polymorphic site when the three are complementarily bound. An enzyme (Cleavase) that recognizes the structure of this polymorphic site is used to cut out the single-stranded portion of the allyl probe (that is, the flap portion on the 5′ side from the base of the polymorphic site), and the flap is complementary to the FRET probe. and the polymorphic site of the flap penetrates the hairpin structure of the FRET probe. When this structure is recognized and cleaved by Cleavase, the end-labeled fluorescent dye of the FRET probe is liberated and is no longer affected by the quencher, and fluorescence is detected. Allyl probes whose bases at the polymorphic site do not match the template are not cleaved by Cleavase, but uncleaved allyl probes can also hybridize to FRET probes and thus fluorescence is detected as well. However, since the reaction efficiencies are different, allyl probes with matching bases at the polymorphic site show significantly higher fluorescence intensity than non-matching allyl probes. Usually, before reacting with the three probes and Cleavase, the template DNA is preferably amplified by PCR using primers capable of amplifying the region containing the hybridized portion of the allele probe and the invader probe.

Thus, the genotype of the SNP of the OR7A17 gene in the biological sample collected from the subject is detected, and the odor perception to the OR7A17 ligand is predicted based on the genotype. Specifically, the prediction is performed by comparing the detected genotype with the genotype (control) of the SNP of the OR7A17 gene consisting of the nucleotide sequence shown in SEQ ID NO:1. Therefore, the method of the present invention preferably further comprises the step of predicting odor perception for an OR7A17 ligand based on said detected genotype.

In a more preferred embodiment, the method of the present invention includes either or both of the following steps (1) and (2) as the above steps.
(1) When the genotype of the SNP (rs10405129) at the 137th base of the nucleotide sequence shown by SEQ ID NO: 1 in the subject-derived genomic DNA is AA or AG, the subject feels comfortable with the odor of the OR7A17 ligand. If it is determined that the odor of the OR7A17 ligand is easy to feel, and the genotype of the SNP is GG, the subject does not feel comfortable with the odor of the OR7A17 ligand. and (2) the genotype of the SNP (rs10404119) at the 205th base of the base sequence shown by SEQ ID NO: 1 in the subject-derived genomic DNA is CC. Or if it is CA, the subject is likely to feel comfortable with the odor of the OR7A17 ligand, and it is determined that the odor of the OR7A17 ligand tends to have a woody and/or grassy feeling, and if the genotype of the SNP is AA, A step of determining that the test subject does not easily perceive the odor of the OR7A17 ligand as pleasant and the odor of the OR7A17 ligand as less woody and/or grassy.

In a further preferred embodiment, in the method of the present invention, when the OR7A17 ligand is (-)-ambroxide or a perfume containing (-)-ambroxide, the following (3) and (4) are performed as the above steps. Either or both steps are included.
(3) When the genotype of the rs10405129 SNP in the genomic DNA derived from the subject is AA or AG, the subject tends to feel comfortable with the odor of the OR7A17 ligand, and the odor of the OR7A17 ligand has a woody and/or grassy feel. and determining that when the genotype of the SNP is GG, the subject is less likely to feel a pleasant odor of the OR7A17 ligand and less likely to feel a woody and/or grassy odor to the odor of the OR7A17 ligand. and (4) when the genotype of the rs10404119 SNP in the genomic DNA derived from the subject is CC or CA, the subject tends to feel comfortable with the odor of the OR7A17 ligand, and the odor of the OR7A17 ligand has a woody feeling and / or If the genotype of the SNP is AA, it is determined that the subject is less likely to feel the comfort of the odor of the OR7A17 ligand, and that the odor of the OR7A17 ligand is less likely to feel the feeling of wood and/or the feeling of grass. process to do.
Alternatively, in another more preferred embodiment, the method of the invention comprises the method wherein the OR7A17 ligand is 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl -2-naphthyl)ethan-1-one or 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)ethan-1- In the case of a perfume containing one, the above steps include either or both of the following steps (5) and (6).
(5) When the genotype of the rs10405129 SNP in the genomic DNA derived from the subject is AA or AG, it is determined that the subject is likely to feel the odor of the OR7A17 ligand with a woody and / or grassy feeling, and the inheritance of the SNP is determined. (6) determining that the subject is less likely to perceive the odor of the OR7A17 ligand as a tree and/or grass when the type is GG; , the subject is determined to be likely to feel a sense of wood and/or grass to the odor of the OR7A17 ligand. The process of judging that it is difficult to feel the feeling.

INDUSTRIAL APPLICABILITY According to the method of the present invention, it is possible to easily and objectively predict the odor perception when a subject smells a substance that is an OR7A17 ligand, without requiring sensory evaluation. As a result, it is possible to provide personalized fragrances according to individual olfactory characteristics, and to distribute appropriate amounts of fragrances to appropriate locations in consideration of regional characteristics of olfactory characteristics.

3. Reagents for Predicting Odor Perception of OR7A17 Ligand and Kits Containing the Reagents The present invention also provides reagents for use in the methods of the present invention and kits containing the reagents. A reagent for predicting odor perception of an OR7A17 ligand of the present invention and a kit containing the reagent comprise nucleic acid probes and/or primers capable of detecting genotypes of SNPs in the OR7A17 gene.

In one aspect, the reagent of the present invention and the nucleic acid probe used in the kit containing the reagent specifically hybridize with a region of genomic DNA containing the bases of the SNP site whose genotype is to be detected in the method of the present invention. Nucleic acid. As long as the nucleic acid probe is specific to the target site to be hybridized and the genotype of the SNP can be easily detected, there is no particular limitation on the length (the base length of the portion that hybridizes with the genomic DNA). For example, 10 bases or more, preferably 15 bases or more, more preferably 15 to 600 bases, even more preferably 15 to 200 bases, still more preferably 15 to 50 bases. The term "specifically hybridizes to the target site (sequence)" means normal hybridization conditions, preferably stringent hybridization conditions (e.g., Joseph Sambrook et al., Molecular Cloning: A Laboratory Manual (3 Vol. Set), Cold Spring Harbor Laboratory, NY, 2001) does not significantly cross-hybridize with other DNA. Preferably, the nucleic acid probe has a nucleotide sequence complementary to the nucleotide sequence of the region containing the nucleotides of the SNP site to be detected. They do not have to be complementary.

The nucleic acid probe may contain additional sequences (sequences that are not complementary to genomic DNA) suitable for detecting genotypes of SNPs. For example, the allele probe used in the above-mentioned Invader method has an additional sequence called flap at the 5' end of the base of the SNP site. In addition, the probe may be labeled with an appropriate labeling agent such as a radioactive isotope (eg, ¹²⁵ I, ¹³¹ I, ³ H, ¹⁴ C, etc.), an enzyme (eg, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase). , malate dehydrogenase, etc.), fluorescent substances (eg, fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg, luminol, luminol derivatives, luciferin, lucigenin, etc.). Alternatively, a quencher (quenching substance) that absorbs fluorescence energy emitted by the fluorescent substance may be further bound in the vicinity of the fluorescent substance (eg FAM, VIC, etc.). In such embodiments, fluorescence is detected upon separation of the fluorescent substance and the quencher during the detection reaction.

The nucleic acid probe can also be used by immobilizing it on any solid phase. For this reason, the reagent of the present invention and a kit containing the reagent also include immobilized probes in which the above probes are immobilized on any solid phase carrier (for example, gene chips, cDNA microarrays, oligo DNA arrays, membrane filters, etc., in which probes are immobilized). can be provided as

The nucleic acid primers used in the reagents of the present invention and kits containing the reagents specifically hybridize to regions of genomic DNA containing the bases of the SNP sites whose genotypes are to be detected in the method of the present invention. Anything can be used as long as it is designed to be able to specifically amplify . Here, "specifically hybridize to a target site (sequence)" is the same as in the case of probes.

A method for amplifying a nucleic acid sequence using the primers is not particularly limited as long as it is a method commonly used in the relevant field. The number and types of such nucleic acid primers required for amplification may vary depending on the amplification method. For example, when using the PCR method, the necessary primer is a partial base sequence of genomic DNA and specifically hybridizes to a part of the complementary strand sequence on the 5′ side of the base of the SNP site to be detected. A nucleic acid containing a base sequence of 10 to 50 bases, preferably 15 to 50 bases, more preferably 15 to 30 bases, and a complementary strand sequence that is the partial base sequence and is on the 3' side of the base of the polymorphic site. A combination with a nucleic acid containing a base sequence of 10 to 50 bases, preferably 15 to 50 bases, more preferably 15 to 30 bases, which specifically hybridizes to a part, and the length of the nucleic acid fragment amplified by them is 50-1000 bases, preferably 50-500 bases, more preferably 50-200 bases.

The primers may contain additional sequences suitable for detection of SNP genotypes (sequences not complementary to genomic DNA) such as linker sequences. In addition, the primers may be labeled with appropriate labeling agents such as radioactive isotopes (eg, ¹²⁵ I, ¹³¹ I, ³ H, ¹⁴ C, etc.), enzymes (eg, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, etc.). , malate dehydrogenase, etc.), fluorescent substances (eg, fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg, luminol, luminol derivatives, luciferin, lucigenin, etc.).

Preferably, the nucleic acid probe and/or primer used in the reagent of the present invention and the kit containing the reagent is the 137th base (rs10405129) and/or the 205th base (rs10404119) of the nucleotide sequence shown in SEQ ID NO: 1. including.

Depending on the SNP detection method used, the nucleic acid probe having bases at the SNP site may be a nucleic acid having one allele base for each SNP site, or a base corresponding to each allele. It is also possible to use two types of nucleic acids having For the invader probe used in the above invader method, the base at the SNP site (that is, the base at the 3' end) may be any base.

The nucleic acid probes and/or primers used in the reagents of the present invention and kits containing the reagents may be DNA or RNA, and may be single-stranded or double-stranded. . If it is double-stranded, it may be double-stranded DNA, double-stranded RNA, or a DNA/RNA hybrid. The above-mentioned nucleic acid probes and/or primers can be prepared according to conventional methods, for example, using a commercially available nucleotide synthesizer, based on base sequence information.

Depending on the SNP genotype detection method used, the reagent of the present invention and a kit containing the reagent may contain other components necessary for the method, such as a hybridization reaction buffer and a nucleic acid amplification reaction buffer. Enzymes, buffers and other necessary reagents, labeling reagents, label detection reagents, positive control DNA, negative control DNA, and instruments necessary for these reactions and procedures may be further included as components. For example, when the reagent and a kit containing the reagent are for polymorphism detection by the TaqMan-PCR method, the reagent and the kit containing the reagent are 10× PCR reaction buffer, 10× MgCl ₂ aqueous solution, 10 xdNTPs aqueous solution, Taq DNA polymerase (5 U/μL), etc. can be further included.

4. Method for Predicting Genotype of SNP in OR7A17 Gene As described above, since the odor perception of the OR7A17 ligand changes depending on the genotype of the SNP of the OR7A17 gene, conversely, using the odor perception of the OR7A17 ligand as an index, the SNP of the OR7A17 gene genotype can be predicted. Therefore, the present invention also provides a method for predicting the genotype of SNPs in the OR7A17 gene (hereinafter referred to as the method of the present invention). The method comprises measuring odor perception to an OR7A17 ligand.

The OR7A17 ligand used in the method for predicting the genotype of the SNP of the OR7A17 gene of the present invention may be any substance capable of binding to OR7A17, including (-)-ambroxide and (-)-ambroxide. 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one, and 1-(1, at least one selected from the group consisting of perfumes containing 2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one Preferably, at least one selected from the group consisting of (-)-ambroxide and perfumes containing (-)-ambroxide is more preferred, and (-)-ambroxide is even more preferred. Odor perception for any one of the above ligands may be measured, or odor perception for two or more ligands may be measured.

In the method of the present invention, the odor perception to be measured includes how to perceive odors, such as the pleasantness of odors and the quality of odors. The odor perception is preferably at least one selected from the group consisting of how to perceive pleasantness of smell and how to perceive quality of smell, and more preferably how to perceive pleasantness of smell and how to perceive quality of smell. and at least one selected from the group consisting of how to perceive the feeling of wood as the quality of the smell, and how to perceive the feeling of grass as the quality of the smell, and more preferably how to perceive the pleasantness of the smell and the feeling of the wood as the quality of the smell. is at least one selected from the group consisting of how to feel the smell, and more preferably how to feel the pleasantness of the smell. Any one of the above odor perceptions may be measured, or two or more may be measured.
In one example, when the OR7A17 ligand is (-)-ambroxide or a perfume containing (-)-ambroxide, the odor perception is preferably the group consisting of perception of odor pleasure and perception of odor quality. At least one more selected, more preferably selected from the group consisting of how to feel pleasantness of smell, how to feel woody feeling as quality of smell, and how to feel grassy feeling as quality of smell At least one, more preferably at least one selected from the group consisting of how to perceive pleasantness of smell and how to perceive tree feeling as quality of smell, and more preferably, how to perceive pleasantness of smell. It's how you feel.
In another example, the OR7A17 ligand is 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one, and For perfumes containing 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one, odor perception is Preferably, it is how to perceive the quality of the smell, and more preferably at least one selected from the group consisting of how to perceive the feeling of wood as the quality of the smell and how to perceive the feeling of grass as the quality of the smell. More preferably, it is how to perceive the feeling of wood as the quality of smell.

As a method for measuring odor perception, a method such as sensory evaluation that is commonly used for measuring odor perception can be used. For example, the pleasantness of an odor can be measured by presenting an odorant to a subject and evaluating whether the odor of the odorant is pleasant or not. In addition, the quality of the odor can be evaluated, for example, by presenting an odorant to a subject and evaluating whether the odor of the odorant corresponds to a pre-prepared phrase expressing the quality of the odor, or by evaluating the odor of the odorant. Measured by subjects expressing themselves freely, or by presenting two samples to subjects (e.g., perfume formulations with and without odorants) and evaluating the similarity in odor quality between the samples. can do. The degree of odor perception is preferably scored by various evaluation scores such as Visual Analog Scaling (VAS). Evaluation by VAS score is performed by drawing a line segment of a predetermined length on a piece of paper, setting the lowest possible evaluation on the left end and the highest possible evaluation on the right end, and determining the degree of odor perception by the subject himself/herself. This is a method in which the person is asked to mark which part of the line segment corresponds, and the degree of odor perception is scored based on the length from the left end of the line segment to the position of the mark. For example, the pleasantness of an odor ranges from ``I don't feel anything in particular'' to ``Very pleasant. It can be scored in the range of "not at all" to "very similar", or in the range of "not at all similar" to "very similar" in terms of the similarity of odor quality between samples. The degree of odor perception can be compared on the basis of magnitude.

Thus, the subject's odor perception for the OR7A17 ligand is measured, and the genotype of the subject's OR7A17 gene SNP genotype is predicted based on the measured odor perception. Therefore, the method of the present invention preferably further comprises the step of predicting the genotype of the SNP of the OR7A17 gene based on the measured odor perception. The prediction is made in particular by comparing the measured odor perception with a control value or a preset cut-off value (reference value).
Here, the “control value” includes measurement results of odor perception for the OR7A17 ligand in a human population having the OR7A17 gene consisting of the nucleotide sequence shown in SEQ ID NO:1. The measurement result may be a value determined with reference to statistical values such as the average value and standard deviation of the measurement results of the odor perception measured from the population. A "reference value" can be determined in advance based on the genotype of the SNP in the OR7A17 gene and the relationship between odor perception to the OR7A17 ligand. For example, a population is divided into a group having the OR7A17 gene consisting of the base sequence shown in SEQ ID NO: 1 and a group having the OR7A17 gene consisting of the base sequence having C at the 137th base in the base sequence shown in SEQ ID NO: 1. A value determined with reference to statistical values such as the average value and standard deviation of the measurement results of odor perception in each group can be determined as a reference value for determining belonging to each group. When there are multiple odor perceptions to be measured, it is preferable to obtain a control value or a reference value for each odor perception.

Specific techniques for setting a reference value or a reference value and predicting the genotype of the SNP of the OR7A17 gene based on the reference value or the reference value can be appropriately carried out according to the common general knowledge of those skilled in the art.

5. Method for selecting a perfume material having at least one odor quality selected from the group consisting of trees and grasses As described above, functional OR7A17 responds to OR7A17 ligands in a Humans with OR7A17 can perceive the odor of OR7A17 ligands as woody and/or grassy as the odor quality. In other words, the substance that increases the response of functional OR7A17 and olfactory receptor polypeptides having response selectivity similar to OR7A17 is an odor having at least one odor quality selected from the group consisting of trees and grasses. It is a fragrance material that can exhibit

Therefore, the present invention also provides a method for selecting a perfume material having at least one odor quality selected from the group consisting of trees and grasses (hereinafter referred to as the method of the present invention). The method comprises a step of measuring the response of at least one olfactory receptor polypeptide selected from the group consisting of functional OR7A17 and a polypeptide having response selectivity similar to OR7A17; selecting test substances to which the peptides responded.

The above method of the invention may be performed in vitro or ex vivo.

The test substance used in the method of the present invention includes at least one substance selected from the group consisting of trees and grasses to be evaluated for odor quality, or at least one selected from the group consisting of trees and grasses. There is no particular limitation as long as it is a substance that is desired to be used as a perfume material having one type of odor quality. The test substance may be a naturally occurring substance, a substance artificially synthesized by chemical or biological methods, or a compound, composition or mixture. good.

The olfactory receptor polypeptide used in the method of the present invention is at least one olfactory receptor polypeptide selected from the group consisting of functional OR7A17 and polypeptides having response selectivity similar to OR7A17. Functional forms of OR7A17 include OR7A17 IA and OR7A17 IS, of which OR7A17 IA is preferred. The OR7A17 IA is a protein consisting of the amino acid sequence shown in SEQ ID NO:2 encoded by the gene having the nucleotide sequence shown in SEQ ID NO:1.

Examples of polypeptides having response selectivity similar to that of functional OR7A17 include polypeptides having at least 80% identity in amino acid sequence with functional OR7A17 and exhibiting response to (−)-ambroxide. and polypeptides having specific properties. More specifically, at least 80%, for example, 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, still more preferably 98% or more of the amino acid sequence shown in SEQ ID NO: 2, More preferably, a polypeptide consisting of an amino acid sequence having an identity of 99% or more and having isoleucine at the position corresponding to the 46th amino acid in the amino acid sequence shown in SEQ ID NO: 2, and (−)-ambroxide include polypeptides that are responsive to As used herein, a certain polypeptide "has responsiveness to (-)-ambroxide" means that the response strength of the polypeptide to (-)-ambroxide is less than that in the absence of (-)-ambroxide. 120% or more, preferably 150% or more, more preferably 200% or more, or the response intensity of the polypeptide to (−)-ambroxide is 10% or more of the response intensity of OR7A17 (SEQ ID NO: 2) , preferably 30% or more, more preferably 50% or more.

In the method of the present invention, any one of the above-described olfactory receptor polypeptides may be used, but any two or more of them may be used in combination. Preferably, the olfactory receptor polypeptide used in the method of the present invention is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2.

In the method of the present invention, the olfactory receptor polypeptide can be used in any form as long as it does not lose responsiveness to (−)-ambroxide. For example, the olfactory receptor polypeptide is a tissue or cell that naturally expresses the olfactory receptor polypeptide, such as an olfactory receptor or olfactory cell isolated from a living body, or a culture thereof; olfactory cell membranes bearing the polypeptide; recombinant cells or cultures thereof genetically engineered to express the olfactory receptor polypeptide; membranes of the recombinant cells carrying the olfactory receptor polypeptide; It can be used in a form such as an artificial lipid bilayer membrane having the olfactory receptor polypeptide. All of these forms are included within the scope of the olfactory receptor polypeptides used in the present invention.

In a preferred embodiment, the olfactory receptor polypeptide is a cell that naturally expresses the olfactory receptor polypeptide, such as an olfactory cell, or a recombinant cell that has been genetically engineered to express the olfactory receptor polypeptide. , or cultures thereof are used. The recombinant cells can be produced, for example, by transforming cells with a vector containing a gene encoding an olfactory receptor polypeptide.

Preferably, in order to promote cell membrane expression of the olfactory receptor polypeptide, a gene encoding an RTP (receptor-transporting protein) is introduced into cells together with the gene encoding the olfactory receptor polypeptide. Preferably, the gene encoding RTP1S is introduced into the cell together with the gene encoding the olfactory receptor polypeptide. RTPs including RTP1S have the function of translocating olfactory receptor proteins to the cell membrane surface. Examples of RTP1S include human RTP1S. Human RTP1S is a protein registered in GenBank as GI:50234917.

In the method of the invention, a test substance is applied to the olfactory receptor polypeptide. Means for applying a test substance to an olfactory receptor polypeptide include a method of adding the test substance to a medium in which cells expressing the olfactory receptor polypeptide are cultured, a method of directly dropping the test substance onto the olfactory receptor polypeptide, Examples include, but are not limited to, a method of spraying or spraying.

In the methods of the invention, following the addition of a test substance to the olfactory receptor polypeptide, the response of the olfactory receptor polypeptide to the test substance is measured. Measurement may be performed by any method known in the art as a method for measuring responses of olfactory receptors, such as intracellular cAMP level measurement. For example, when olfactory receptors are activated by odorants, they increase intracellular cAMP levels by coupling with intracellular G protein α-subunits that belong to the Gs family and activating adenylate cyclase. (Nat. Neurosci., 2004, 5:263-278). On the other hand, when an olfactory receptor is activated by an odorant molecule, it can also couple with a protein belonging to the Gq family such as Gα15 in the cell and increase the amount of calcium ions in the cell. Therefore, the response of the olfactory receptor polypeptide can be measured by using the amount of intracellular cAMP or calcium ion after the addition of odorant molecules, or the behavior of downstream molecules activated via them as an indicator. Methods for measuring the amount of cAMP include ELISA, reporter gene assay, and the like. Methods for measuring the calcium ion concentration include calcium imaging and TGFα shedding assay. In addition, as an example of a method using the behavior of downstream molecules activated via cAMP levels as an index, in Xenopus laevis oocytes, cystic fibrosis transmembrane conductance regulator CFTR activated by cAMP signals A two-electrode membrane voltage clamp method, which measures changes in the potential of the membrane, is also effective.

The test substance is then evaluated based on the measured olfactory receptor polypeptide response. A test substance that induces a response of the olfactory receptor polypeptide can be used as a perfume material having at least one odor quality selected from the group consisting of trees and grasses. Therefore, in the method of the present invention, a test substance to which the olfactory receptor polypeptide responds is selected as a target substance.

Preferably, the response of the olfactory receptor polypeptide to the test substance is determined by comparing the response of the olfactory receptor polypeptide to which the test substance has been added (test group) with the response of the olfactory receptor polypeptide in the control group. can be evaluated. As a control group, the olfactory receptor polypeptide to which no test substance was added, the olfactory receptor polypeptide to which a control substance was added, the olfactory receptor polypeptide to which a lower concentration of the test substance was added, and the test substance were added. and the olfactory receptor polypeptide before addition. Alternatively, non-functional OR7A17 to which the test substance was added may be used as a control group. The non-functional OR7A17 is at least 80%, for example, 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% of the amino acid sequence shown in SEQ ID NO: 2 % or more, more preferably 99% or more, and has a threonine at the position corresponding to the 46th amino acid in the amino acid sequence shown in SEQ ID NO: 2, and (-) - include polypeptides that have no responsiveness to ambroxide. Specific examples of non-functional OR7A17 include OR7A17 TA and OR7A17 TS. As used herein, a certain polypeptide "does not have responsiveness to (-)-ambroxide" means that the response strength of the polypeptide to (-)-ambroxide is less than 120%, preferably 110% or less, more preferably 105% or less, or the response intensity of the polypeptide to (-)-ambroxide is 10 of that of OR7A17 (SEQ ID NO: 2) %, preferably 5% or less, more preferably 3% or less. If the response in the test group is higher than in the control group, the olfactory receptor polypeptide is assessed as responsive to the test substance and the test substance is selected as the target substance.

Thus, in one embodiment of the methods of the invention, the response of an olfactory receptor polypeptide in the presence and absence of a test substance is measured, and then the response in the presence of the test substance is measured in the absence of the test substance. It is determined whether it is higher than the response below. If the response in the presence of the test substance is higher, the test substance is selected as the target substance. In a preferred embodiment, the response strength of the olfactory receptor polypeptide in the presence of the test substance is preferably 120% or more, more preferably 150% or more, and still more preferably 200% of that in the absence of the test substance. % or higher, the test substance is selected as the target substance. In another preferred embodiment, if the response strength of the olfactory receptor polypeptide in the presence of the test substance is statistically significantly increased compared to the absence of the test substance, the test substance is Selected as a target substance.

Alternatively, the response of an olfactory receptor polypeptide to a test substance can be assessed by comparing the response of the olfactory receptor polypeptide to (−)-ambroxide. Thus, in another embodiment of the method of the invention, the olfactory receptor polypeptide response in the presence of a test substance and in the presence of (−)-ambroxide is measured. If the olfactory receptor polypeptide was evaluated as responsive to the test substance based on a comparison of the response in the presence of the test substance and the response in the presence of (−)-ambroxide, the test substance is Selected as a target substance. In a preferred embodiment, the response strength of the olfactory receptor polypeptide in the presence of the test substance is preferably 10% or more, more preferably 30% or more, and more preferably 30% or more compared to that in the presence of (−)-ambroxide. Preferably, if it is 50% or more, the test substance is selected as the target substance. In another preferred embodiment, if the response strength of the olfactory receptor polypeptide in the presence of the test substance is not statistically significantly lower than in the presence of (−)-ambroxide, the test substance is selected as the target substance.

Alternatively, the response of an olfactory receptor polypeptide to a test substance can be evaluated by comparing it to the response of a non-functional olfactory receptor polypeptide to the test substance. Accordingly, in another embodiment of the method of the invention, the response of the olfactory receptor polypeptide and the non-functional olfactory receptor polypeptide in the presence of a test substance is measured. If the response of the olfactory receptor polypeptide is higher, the test substance is selected as the target substance. In a preferred embodiment, the response intensity of the olfactory receptor polypeptide in the presence of the test substance is preferably 120% or more, more preferably 150%, compared to the response intensity of the non-functional olfactory receptor polypeptide. Above, more preferably 200% or more, the test substance is selected as the target substance. In another preferred embodiment, if the response intensity of the olfactory receptor polypeptide is statistically significantly increased compared to the response intensity of the non-functional olfactory receptor polypeptide, the test substance is selected as a substance.

Optionally, the odor of the selected test substance may be further evaluated. That is, in one embodiment of the method of the present invention, the test substance selected by the above procedure is obtained as a candidate substance for a perfume material having at least one odor quality selected from the group consisting of trees and grasses. . The odor of the candidate substance is then evaluated. Evaluation of the odor of a candidate substance can be carried out by means of odor evaluation procedures commonly used in the art, such as sensory evaluation by experts, odor sensors, and the like. Candidate substances with better results in this odor evaluation are selected as perfume materials having at least one odor quality selected from the group consisting of trees and grasses.

Further disclosed herein are the following materials, methods of manufacture, uses, methods, etc., as exemplary embodiments of the present invention. However, the invention is not limited to these embodiments.

[1] A method for predicting the odor perception of a subject for an OR7A17 ligand, comprising the step of detecting the genotype of SNPs in the OR7A17 gene.
[2] The method of [1], further comprising the step of predicting odor perception for an OR7A17 ligand based on the genotype of the SNP.
[3] The SNP is preferably at least selected from the group consisting of the SNP at the 137th base (dbSNP database ID: rs10405129) and the SNP at the 205th base (rs10404119) of the base sequence shown in SEQ ID NO: 1 The method of [1] or [2], wherein the SNP is one SNP, more preferably the SNP rs10405129.
[4] The OR7A17 ligand is preferably (-)-ambroxide, (-)-ambroxide-containing perfume, 1-(1,2,3,4,5,6,7,8-octahydro- 2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one and 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8- At least one selected from the group consisting of perfumes containing tetramethyl-2-naphthyl)ethan-1-one, more preferably (-)-ambroxide and perfumes containing (-)-ambroxide The method according to any one of [1] to [3], which is at least one selected from the group consisting of, more preferably (−)-ambroxide.
[5] A group in which the odor perception of the OR7A17 ligand preferably consists of the pleasantness of the odor of the OR7A17 ligand, woodiness as the odor quality of the OR7A17 ligand, and grassiness as the odor quality of the OR7A17 ligand. At least one selected from the group consisting of woody feeling as the odor quality of the OR7A17 ligand and grassy feeling as the odor quality of the OR7A17 ligand. More preferably, the method according to any one of [1] to [4], which is how the OR7A17 ligand perceives a woody sensation as the odor quality.
[6] The method according to any one of [1] to [5], wherein the genotype of the SNP of the OR7A17 gene is detected in the biological sample collected from the subject.
[7] The method according to any one of [1] to [6], wherein the genotype of the SNP in the OR7A17 gene is detected by a direct sequencing method.
[8] Any of [1] to [7], wherein the genotype of the detected SNP is compared with the genotype of the OR7A17 gene consisting of the base sequence shown in SEQ ID NO: 1 to predict the odor perception of the OR7A17 ligand. or the method according to item 1.

[9] A probe capable of detecting a SNP of the OR7A17 gene that hybridizes under stringent conditions to a region of genomic DNA containing the base of the SNP site of the OR7A17 gene of any one of [1] to [8]. and/or a reagent for predicting a subject's odor perception for an OR7A17 ligand.
[10] The reagent of [9], wherein the probe and/or primer hybridize with the genomic region containing the SNP.
[11] A kit for predicting the odor perception of a subject for an OR7A17 ligand, comprising the reagent of [9] or [10].

[12] A method for predicting the genotype of SNPs in the OR7A17 gene of a subject, comprising the step of measuring odor perception to an OR7A17 ligand.
[13] The method of [12], further comprising the step of predicting the genotype of the SNP of the OR7A17 gene based on the odor perception of the OR7A17 ligand.
[14] The SNP is preferably at least one SNP selected from the group consisting of the SNP at the 137th base (rs10405129) and the SNP at the 205th base (rs10404119) of the nucleotide sequence shown in SEQ ID NO: 1 and more preferably the SNP of rs10405129, the method of [12] or [13].
[15] The OR7A17 ligand is preferably (-)-ambroxide, (-)-ambroxide-containing perfume, 1-(1,2,3,4,5,6,7,8-octahydro- 2,3,8,8-tetramethyl-2-naphthyl)ethan-1-one and 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8- At least one selected from the group consisting of perfumes containing tetramethyl-2-naphthyl)ethan-1-one, more preferably (-)-ambroxide and perfumes containing (-)-ambroxide The method according to any one of [12] to [14], which is at least one selected from the group consisting of, more preferably (−)-ambroxide.
[16] The group in which the odor perception of the OR7A17 ligand preferably consists of the pleasantness of the odor of the OR7A17 ligand, the woodiness as the odor quality of the OR7A17 ligand, and the grassiness as the odor quality of the OR7A17 ligand. At least one selected from the group consisting of woody feeling as the odor quality of the OR7A17 ligand and grassy feeling as the odor quality of the OR7A17 ligand. More preferably, the method according to any one of [12] to [15], which is how the OR7A17 ligand perceives a woody sensation as the odor quality.
[17] The method according to any one of [12] to [16], wherein the odor perception of the OR7A17 ligand is preferably measured by sensory evaluation, more preferably by VAS.
[18] The method of any one of [12] to [17], wherein the genotype of the SNP in the OR7A17 gene is predicted by comparing the measured odor perception for the OR7A17 ligand with a control value or a reference value.

[19] A method for selecting a perfume material having at least one odor quality selected from the group consisting of trees and grasses, comprising:
OR7A17 consisting of the amino acid sequence shown in SEQ ID NO: 2 and OR7A17 consisting of an amino acid sequence having at least 80% identity with the amino acid sequence shown in SEQ ID NO: 2 and having an amino acid sequence shown in SEQ ID NO: 2 in the presence of a test substance measuring the response of at least one olfactory receptor polypeptide selected from the group consisting of polypeptides having isoleucine at the position corresponding to the 46th amino acid; and a test substance to which the olfactory receptor polypeptide responds the step of selecting,
A method, including
[20] The method of [19], wherein the olfactory receptor polypeptide is OR7A17 consisting of the amino acid sequence shown in SEQ ID NO:2.
[21] a polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence shown in SEQ ID NO:2 and having isoleucine at the position corresponding to the 46th amino acid in the amino acid sequence shown in SEQ ID NO:2; The method of [19] or [20], wherein the polypeptide is responsive to , (−)-ambroxide.
[22] The method of any one of [19] to [21], further comprising the step of measuring the response of the olfactory receptor polypeptide in the absence of the test substance.
[23] The method of [22], wherein a test substance that increases the response of the olfactory receptor polypeptide in the presence of the test substance to 120% or more of the response in the absence of the test substance is selected.
[24] Selecting a test substance that statistically significantly increases the response of the olfactory receptor polypeptide in the presence of the test substance compared to the response in the absence of the test substance, [22] the method of.
[25] The method of any one of [19] to [21], further comprising the step of measuring the response of the olfactory receptor polypeptide in the presence of (-)-ambroxide.
[26] selecting a test substance that increases the response of the olfactory receptor polypeptide in the presence of the test substance to 10% or more of the response in the presence of (-)-ambroxide; Method.
[27] selecting a test substance that does not statistically significantly reduce the response of the olfactory receptor polypeptide in the presence of the test substance compared to the response in the presence of (−)-ambroxide; 25] The method described.
[28] any one of [19] to [27], wherein the olfactory receptor polypeptide is expressed on a recombinant cell that has been genetically engineered to express the olfactory receptor polypeptide; described method.
[29] The method of [28], wherein the recombinant cell is a cell introduced with the gene encoding the olfactory receptor polypeptide and the gene encoding RTP1S.
[30] The method of any one of [19] to [27], wherein the recombinant cell of [28] or [29] or a culture thereof is used as the olfactory receptor polypeptide.
Method.
[31] The response of the olfactory receptor polypeptide is determined by intracellular cAMP level measurement by ELISA or reporter gene assay, calcium ion level measurement by calcium imaging or TGFα shedding assay, or two-electrode membrane voltage clamp using Xenopus laevis oocytes. The method according to any one of [19] to [30], which is measured by measuring the potential change inside and outside the cell membrane according to the method.
[32] The method according to any one of [19] to [31], further comprising the step of evaluating the odor of the selected test substance.
[33] The method of [32], wherein the odor evaluation is performed by sensory evaluation.

EXAMPLES Hereinafter, the present invention will be described more specifically by showing examples.

Reference Example 1 Preparation of Human Olfactory Receptor-Expressing Cells 1) Cloning of Human Olfactory Receptor Gene The human olfactory receptor OR7A17 gene (SEQ ID NO: 1) contains the SNP ( rs10405129, A>G, I46T) and the SNP at the 205th base (rs10404119, C>A, A69S). Due to these SNPs, OR7A17 has four variants, OR7A17 IA, IS, TA, TS, which differ in the 46th and/or 69th amino acid of the amino acid sequence shown in SEQ ID NO:2. First, based on the sequence information registered in GenBank, the gene encoding the human olfactory receptor OR7A17 IA variant was cloned. Cloning was performed by PCR using a human genomic DNA female (G1521: Promega) as a template. The OR7A17 gene amplified by the PCR method was incorporated into the pENTR vector (Invitrogen) according to the manual, and the NotI and AscI sites present on the pENTR vector were used to create NotI and AscI downstream of the Flag-Rho tag sequence on the pME18S vector. Recombined to site.
Then, using primers designed to introduce mutations corresponding to rs10405129 or rs10404119, mutations were added to the nucleotide sequences by PCR to construct vectors expressing OR7A17 IS, OR7A17 TA, and OR7A17 TS.

2) Preparation of pME18S-human RTP1S vector A gene encoding human RTP1S that translocates an olfactory receptor protein produced in cultured cells to the cell membrane surface was inserted into EcoRI and XhoI sites of another pME18S vector.

3) Production of Olfactory Receptor-Expressing Cells HEK293 cells expressing the above human olfactory receptors were produced. A reaction solution having the composition shown in Table 1 was prepared, allowed to stand for 15 minutes in a clean bench, and then added to each well of a 96-well plate (BD). Then, 100 μL of HEK293 cells suspended in DMEM (Nacalai) were seeded in each well at 2×10 ⁵ cells/cm ² and cultured for 24 or 48 hours in an incubator maintained at 37° C. and 5% CO ₂ . bottom. As a control, cells (mock) transfected with an empty vector containing no olfactory receptor gene to express no olfactory receptor were prepared.

Reference Example 2 Luciferase Assay The olfactory receptor expressed in HEK293 cells increases intracellular cAMP levels by activating adenylate cyclase by coupling with intracellular Gas. A luciferase reporter gene assay was used to measure the odor response in this study, in which the increase in intracellular cAMP level was monitored as the luminescence value derived from the firefly luciferase gene (fluc2P-CRE-hygro). A Renilla luciferase gene fused downstream of the CMV promoter (hRluc-CMV) was simultaneously transfected and used as an internal standard for correcting errors in gene transfer efficiency and cell number. Luciferase activity was measured using Dual-Glo ^™ luciferase assay system (Promega) according to the product's operation manual. For various stimulation conditions, the value fLuc/hRluc was calculated by dividing the firefly luciferase-derived luminescence value by the Renilla luciferase-derived luminescence value. The value obtained by dividing fLuc/hRluc induced by odorant stimulation by fLuc/hRluc in cells not stimulated with odorant was calculated as fold increase and used as an index of response strength. Analysis of dose-response curves was performed using GraphPad Prism.

Reference Example 3 OR7A17 Responsiveness of Odorants Used in Sensory Test According to the methods of Reference Examples 1 and 2, the responsiveness of OR7A17 IA (that is, OR7A17) to various odorants shown in Table 4 below was confirmed. #3 (AMBROXAN (purified)) is a recrystallized product of #2 (AMBROXAN (registered trademark)) and purified by the following method. First, 90.0 g of acetone was added to 60.0 g of #2 and dissolved at 45 to 50° C., and the mixture was allowed to stand for 3 nights or longer, and 33.2 g of precipitated crystals were recovered. After adding 51.6 g of ethanol to the crystals and dissolving them at 45 to 50° C., the crystals were allowed to stand for 3 nights or more. Next, 20.0 g of acetone was added to 20.9 g of the precipitated and collected crystals, dissolved at 45 to 50° C., and allowed to stand for two nights. The precipitated crystal was used for the test as a recrystallized AMBROXAN product (#3 AMBROXAN (purified)). The results are shown in FIG. Examples of samples to which OR7A17 responds include #2 and #3 containing (−)-ambroxide, #7 (Orbitone®) mentioned as an agonist in Patent Document 2, and #7 which has the same main component. One #5 (Iso E Super®) was identified (Fig. 1A). A dose-response comparison of #3, #5, and #7 revealed that they activated OR7A17 in the order of #3, #7, and #5 (Fig. 1B). No apparent response was observed for the other test samples (#1, #4, #6) (Fig. 1A).

Example 1 Evaluation of Responsiveness of OR7A17 Genotype According to Reference Example 2, AMBROXAN responsiveness of each OR7A17 variant was verified. We also evaluated the responsiveness of each OR7A17 variant to various odorants.

1) Method According to the procedure shown in Reference Example 1, cultured cells expressing each OR7A17 variant were prepared. Next, according to the procedure of Reference Example 2, the functionality of each OR7A17 variant was verified.

2) Perfume used i) Responsiveness of each OR7A17 variant to AMBROXAN:
AMBROXAN (Kao Chemical) was used at concentrations of 10, 30, 100 and 300 μM.
ii) Responsiveness of each OR7A17 variant to perfume mix solutions:
Eleven kinds of odorants containing no amber-based fragrance shown in Table 2 below were prepared. Each of them is a mixture of 4-7 perfumes with a characteristic functional group. Twelve types of odorant, including AMBROXAN, were used at a concentration of 100 μM each.
iii) Responsiveness of each OR7A17 variant to amber fragrances:
Each amber-based fragrance shown in Table 3 below was used at a concentration of 100 μM each.

3) Results The results are shown in FIG. First, regarding responsiveness to AMBROXAN, OR7A17 IS had a lower response intensity than OR7A17 IA, but did not completely lose its responsiveness (Fig. 2A). On the other hand, OR7A17 TA, TS responsiveness was completely abolished (Fig. 2A). Specifically, it was shown that the SNP (rs1040512) associated with the 46th amino acid substitution (I46T) impairs the function of OR7A17. Furthermore, each variant of OR7A17 did not respond to all perfumes tested except AMBROXAN (Fig. 2B,C).

Example 2 Effect of OR7A17 genotype (−)-ambroxide on detection threshold and sensory intensity The results of Example 1 reveal that the amino acid substitution with rs10405129 completely impairs the functionality of OR7A17 in vitro. rice field. Therefore, attention is focused on rs10405129 (A>G) below. Then, we decided to verify whether the SNP affected the odor perception of the OR7A17 ligand in vivo. Of the test participants who completed all test steps, the number of genotypes of the OR7A17 gene was 10 for AA, 9 for AG, and 12 for GG. In the present study, we decided to compare two groups, AA or AG with a functional OR7A17 variant (denoted as AA/AG) and GG with only a non-functional OR7A17 variant.

1) Method i) Genotyping Study participants were genotyped for rs10405129 of the OR7A17 gene. Specifically, saliva (2 ml) was collected using the OraGene DNA kit (genotek). The saliva samples were collected by the test participants themselves. DNA in saliva was extracted according to the method described in the same kit. A DNA fragment containing the OR7A17 gene was amplified from the extracted genomic DNA by PCR using the following PCR primers. Next, sequence analysis was entrusted to Eurofins Genomics, Inc., and the genotype of the OR7A17 gene was identified. In addition, when collecting samples from test participants, after obtaining the approval of the ethics committee in advance, the person in charge of informed consent will explain the research content to the subjects in writing and give written consent. got
・PCR primer 1: ATGGAACCAGAGAATGACACAGGGATTTCA (SEQ ID NO: 3)
・ PCR primer 2: GGAATAAGCTCAAAGTGAAAAACTGTCTTC (SEQ ID NO: 4)
- Sequence primer 1: ATGGAACCAGAGAATGACACAGGGATTTCA (SEQ ID NO: 5)
- Sequence primer 2: CAAGGAATTCAGGGCAGCAATCATCCAGG (SEQ ID NO: 6)

ii) Detection Threshold Test AMBROXAN (purified) obtained by recrystallizing AMBROXAN by the method described in Reference Example 3 and increasing the purity of (−)-ambroxide was used.
8-Drimanol, a representative by-product, was also used as a negative control that does not activate OR7A17.
A total of 23 concentration solutions were prepared using mineral oil as a solvent for each of the above two kinds of fragrances. A test was conducted to select a glass vial for a perfume solution from among three glass vials, two blanks (mineral oil only) and one perfume solution of a certain concentration. More specifically, first, a glass vial to which 1 ml of each concentration of perfume was added was presented as an odor evaluation sample. Test participants sniffed for a few seconds the odor that was volatilized in each vial for a total of 3 vials, 2 blanks and 1 perfume solution, and asked if the vial smelled or had a different odor than the other two. I chose the vial that I want. For the flavoring solution vial, the test was started from the lowest concentration, and if the flavoring solution vial could not be selected (if all three were evaluated as the same) or if the correct vial could not be selected, the flavoring solution vial was increased by two levels. Changed concentration and retested. When the correct vial reached a concentration that was correct three times in a row, the next concentration tested was switched to one lower concentration. After that, the test was performed twice at the same concentration, and if the test was made incorrectly even once, the test was switched to a higher concentration, and if the test was correct twice, the concentration was further reduced by one step. After recording a total of 4 times of switching, the average value of the concentrations at which the latter 2 times of switching occurred was recorded as the detection threshold. Since the highest concentration of 8-Drimanol is insoluble in mineral oil at room temperature, all vials were warmed to 60° C. in a water bath and tested. Test sample concentrations are shown below.
AMBROXAN (purified): 300 mM, 100 mM, 30 mM, 10 mM, 3 mM, 1 mM, 300 μM, 100 μM, 30 μM, 10 μM, 3 μM, 1 μM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 300 pM, 100 pM, 30 pM, 10 pM, 3 pM (Total 23 levels)
8-Drimanol: 300 mM, 100 mM, 30 mM, 10 mM, 3 mM, 1 mM, 300 μM, 100 μM, 30 μM, 10 μM, 3 μM, 1 μM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 300 pM, 100 pM, 30 pM, 10 pM, 3 pM ( 23 levels in total)

iii) Evaluation of odor intensity The test participants evaluated the odor intensity and pleasantness of each of the odorants 1 to 7 shown in Table 4 below. The following concentrations and amounts of odorants were placed in glass vials (Maruem, No. 2, 6 mL). The test participants sniffed the odor emitted in each vial for several seconds, and the strength of the odor was evaluated as 0: not felt, 1: faintly felt, 2: weakly felt, 3: somewhat strongly felt, 4: strongly felt, 5. : Feels very strong, 6: Feels extremely strong. Evaluated by 7 tests, and then evaluated comfort on a 75mm visual analogue scale, each with an intuition between "not feeling anything" and "very comfortable." evaluated.

2) Results The results are shown in FIG. There was no statistically significant difference between the OR7A17 genotypes in the detection threshold and sensory intensity of 8-Drimanol, the control perfume. In addition, although the in vitro functionality of OR7A17 differs depending on the OR7A17 genotype, no statistically significant difference was observed in the detection threshold and sensory intensity of the ligand AMBROXAN (purified) depending on the OR7A17 genotype. . Furthermore, no statistically significant difference was observed in the sensory intensity of other OR7A17 ligands depending on the OR7A17 genotype. It is considered that there are olfactory receptors other than OR7A17 that recognize (−)-ambroxide, and therefore the threshold and sensory intensity did not change.

Example 3 Effect of OR7A17 genotype on (-)-ambroxide pleasure From the previous studies, no clear effect of OR7A17 genotype on the odor sensitivity and sensory intensity of AMBROXAN (purified) was observed. Therefore, next, we decided to verify the pleasantness of AMBROXAN (purified).

1) Method Investigation was carried out according to the evaluation method for odor comfort described in 1) iii) Evaluation of odor intensity in Example 2.

2) Results The results are shown in FIG. As a result, GG was less comfortable with AMBROXAN (purified) than AA/AG (Fig. 4A, B). In addition to AMBROXAN (purified), an analysis of the pleasantness of various AMBROXAN perfumes and perfumes with various fragrance notes revealed that GG consistently felt more pleasant than AA/AG in perfumes containing (−)-ambroxide. (Fig. 4B). In summary, it was clarified that genotypes in which OR7A17 is not functioning are less likely to feel comfortable when smelling (−)-Ambroxide.

Example 4 Influence of OR7A17 genotype on the odor quality of (−)-Ambroxide Next, it was verified whether the OR7A17 genotype affects how the odor quality of AMBROXAN is perceived. The test participants were asked to sniff AMBROXAN (purified), AMBROXAN), and 8-Drimanol, respectively, and evaluate the degree of relevance to 15 phrases representing the quality of odors.

1) Method Put 30 mg of AMBROXAN (purified), AMBROXAN, and 8-Drimanol in each vial, sniff the odor that volatilizes in the vial, and measure the degree of conformity to each item representing the quality of the odor with a visual analog scale of 75 mm. Intuitively rated between "does not apply" to "strongly applies". The items expressing the quality of odors used in this test were 3 perfumes by 3 persons in charge, referring to the phrases used in Keller, A. et al. (BMC Neurosci. 17, 1-17 (2016)). "sweet", "food", "grass", "tree", "soap", "flower", "perfume", "coolness", "warm", Fifteen items of "chemical odor", "spicy", "sweaty odor", "sour", "burnt odor", and "oily" were adopted.

2) Results As a result, it was consistently observed that AMBROXAN (purified) and AMBROXAN were less likely to give a “tree” feeling and “grass” feeling to GG than AA/AG (Figs. 5A, B, 6A, B). In particular, there was a statistically significant difference between GG and AA/AG with respect to how to perceive a “tree” feeling as an odor quality of AMBROXAN (Fig. 6B). Therefore, it is concluded that GG is less likely to perceive the odor of (−)-Ambroxide as having a “tree” feel.

Example 5 Influence of OR7A17 genotype Orbitone and Iso E Super on odor quality OR7A17 discloses Orbitone as an agonist perfume other than AMBROXAN (Patent Document 2). In addition, as shown in Reference Example 3, Iso E Super also activates OR7A17. Therefore, it was verified whether there is a difference in the perception of this perfume between the OR7A17 genotypes. Orbitone and Iso E Super are 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl)-ethan-1- It consists of one and its isomers, and the scent differs depending on the ratio of isomers. Therefore, Orbitone and Iso E Super were expected to activate olfactory receptors other than OR7A17 as a whole of the compounds they contain. In other words, even if OR7A17 is non-functional, it is possible to perceive the odor of this fragrance using other olfactory receptors. . Therefore, the following examination was conducted on the quality of odor, which is a more detailed feature of odor. From the examination of Example 4 above, it was expected that GG would not be able to perceive "tree" and "grass", which are considered to be the qualities of the odor transmitted by OR7A17.

1) Method In this experiment, test participants selected all of the 14 odor quality phrases from the 15 items evaluated in Example 4, excluding "oily", that they felt from each test product. For each odor quality, the percentage perceived was compared between the genotypes. Cedryl methyl ether was used as a control flavor for the OR7A17 non-agonist.

2) Results As a result, the percentage of people who felt the "tree" feeling and "grass" feeling of the odors of Orbitone and Iso E Super was lower in the GG group, in which OR7A17 was not functioning, than in the AA/AG group (Fig. 7C). , E). Furthermore, when compared with AA/AG, the odor quality to which GG was least sensitive was "tree" or "grass" (Fig. 7D, F). On the other hand, neither of the above tendencies was observed for cedryl methyl ether, which is not an OR7A17 ligand (FIGS. 7A and 7B). From the above, it is clear that the genotype of OR7A17 also affects the perception of “tree” and “grass” as odor qualities for other OR7A17 agonists other than (−)-Ambroxide, such as Orbitone and Iso E Super. Became.

Claims (17)

A method of predicting a subject's odor perception to an OR7A17 ligand, comprising detecting the genotype of a single nucleotide polymorphism in the OR7A17 gene. 2. The method of claim 1, further comprising predicting odor perception for an OR7A17 ligand based on the genotype of said single nucleotide polymorphism. The single nucleotide polymorphism is selected from the group consisting of a single nucleotide polymorphism at the 137th base (dbSNP database ID: rs10405129) and a single nucleotide polymorphism at the 205th base (rs10404119) of the base sequence shown in SEQ ID NO: 1. 3. The method of claim 1 or 2, wherein at least one single nucleotide polymorphism is selected. wherein the OR7A17 ligand is (-)-ambroxide, a perfume containing (-)-ambroxide, 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8, 8-tetramethyl-2-naphthyl)ethan-1-one and 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl) The method according to any one of claims 1 to 3, wherein the perfume is at least one selected from the group consisting of perfumes containing ethan-1-one. The odor perception of the OR7A17 ligand is at least one selected from the group consisting of odor pleasure of the OR7A17 ligand, woodiness as the odor quality of the OR7A17 ligand, and grassiness as the odor quality of the OR7A17 ligand. The method according to any one of claims 1 to 4, wherein there are two ways of feeling. A single nucleotide polymorphism in the OR7A17 gene that hybridizes under stringent conditions to a genomic DNA region containing the base of the single nucleotide polymorphism site in the OR7A17 gene according to any one of claims 1 to 5 can be detected. A reagent for predicting a subject's odor perception for an OR7A17 ligand, comprising a probe and/or primer. A kit for predicting the odor perception of a subject for an OR7A17 ligand, comprising the reagent according to claim 6. A method of predicting the genotype of a single nucleotide polymorphism of the OR7A17 gene in a subject, comprising the step of measuring odor perception to an OR7A17 ligand. 9. The method of claim 8, further comprising predicting the genotype of the single nucleotide polymorphism of the OR7A17 gene based on the odor perception to said OR7A17 ligand. The single nucleotide polymorphism is selected from the group consisting of a single nucleotide polymorphism at the 137th base (dbSNP database ID: rs10405129) and a single nucleotide polymorphism at the 205th base (rs10404119) of the base sequence shown in SEQ ID NO: 1. 10. The method of claim 8 or 9, wherein at least one single nucleotide polymorphism is selected. wherein the OR7A17 ligand is (-)-ambroxide, a perfume containing (-)-ambroxide, 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8, 8-tetramethyl-2-naphthyl)ethan-1-one and 1-(1,2,3,4,5,6,7,8-octahydro-2,3,8,8-tetramethyl-2-naphthyl) The method according to any one of claims 8 to 10, wherein the perfume is at least one selected from the group consisting of perfumes containing ethan-1-one. The odor perception of the OR7A17 ligand is at least one selected from the group consisting of odor pleasure of the OR7A17 ligand, woodiness as the odor quality of the OR7A17 ligand, and grassiness as the odor quality of the OR7A17 ligand. The method according to any one of claims 8 to 11, wherein there are two ways of feeling. A method for selecting a perfume material having at least one odor quality selected from the group consisting of trees and grasses, comprising:
In the presence of a test substance, OR7A17 consisting of the amino acid sequence shown in SEQ ID NO: 2, and having at least 80% identity with the amino acid sequence shown in SEQ ID NO: 2 and the 46th position of the amino acid sequence shown in SEQ ID NO: 2 measuring the response of at least one olfactory receptor polypeptide selected from the group consisting of a polypeptide consisting of an amino acid sequence in which the amino acid or the amino acid at the position corresponding thereto is isoleucine; selecting a responding test substance;
A method, including 14. The method of claim 13, wherein said olfactory receptor polypeptide is OR7A17 consisting of the amino acid sequence shown in SEQ ID NO:2. 15. The method of claim 13 or 14, further comprising measuring the response of said olfactory receptor polypeptide in the absence of a test substance. 16. The method of claim 15, wherein a test substance is selected that increases the response of said olfactory receptor polypeptide in the presence of said test substance to 120% or more of the response in the absence of said test substance. 16. The method of claim 15, wherein a test substance is selected that statistically significantly increases the response of the olfactory receptor polypeptide in the presence of the test substance compared to the response in the absence of the test substance.

Images