JP2022523766A - Recombinant adeno-associated virus for the treatment of GRN-related adult-onset neurodegenerative disease - Google Patents

Abstract

Recombinant AAV (rAAV) suitable for use in the treatment of adult-onset neurodegenerative disease caused by granulin (GRN) haploinsufficiency, such as progranulin (PGRN) -related frontotemporal dementia (FTD), is provided. .. rAAV comprises (a) an adeno-associated virus 1 capsid, and (b) a vector genome packaged in the AAV capsid, which is the AAV inverted terminal repeat, the coding sequence for human progranulin, and the program. Contains regulatory sequences that direct the expression of neurin. Also provided is a method for treating human patients with PGRN-FTD and other adult-onset neurodegenerative diseases caused by granulin (GRN) haplo deficiency, which method comprises an adeno-associated virus 1 (AAV1) capsid. Containing delivery of recombinant adeno-associated virus (rAAV) to the central nervous system (CNS), the rAAV further comprises a vector genome packaged within the AAV capsid, which is the AAV inversion. Includes terminal repeats, coding sequences for human progranulin, and regulatory sequences that direct expression of the progranulin. [Selection diagram]

Description

Mutual reference to related applications This application is a US provisional application No. 62 / 809,329 filed on February 22, 2019, and a US provisional application No. 62 / 923,812 filed on October 21, 2019. , And claim the interests and priorities of US Provisional Application No. 62 / 969,108, filed February 2, 2020, which, for all purposes, are hereby incorporated by reference in their entirety. It will be used.

Frontotemporal dementia (FTD) is a fatal neurodegenerative disease that typically appears in the 60s or 70s of life and is associated with impaired executive function, behavior, speech, or language comprehension. These symptoms are associated with a characteristic pattern of cerebral atrophy that affects the frontal and temporal cortex. Patients have a universally progressive course with an average survival time of 8 years from the onset of symptoms (Coile-Gillrist IT, et al. Neurology. 2016; 86 (18): 1736-43).

FTD is highly hereditary and about 40% of patients have a positive family history (Roherer JD, et al. Neurology. 2009; 73 (18): 1451-6.). In 5-10% of FTD patients, pathogenic loss-of-function mutations can be identified in the granulin (GRN) gene, which encodes the ubiquitous lysosomal protein progranulin (PGRN) (Roherer JD, et al. Neurology. 2009; 73 (18): 1451-6). Carriers of GRN mutations exhibit rapid and widespread brain atrophy of other neurodegenerative diseases such as progressive supranuclear palsy, basal nucleus syndrome, Parkinson's disease, dementia with Levy bodies, or Alzheimer's disease. It may exhibit clinical features (Le Ber I, et al. Brain: a journalal of neurology. 2008; 131 (3): 732-46.). GRN mutations are inherited in an autosomal dominant form and have a penetration rate of> 90% by age 70 years (Gass J, et al. Human molecular genetics. 2006; 15 (20): 2988-3001). Inheritance of a single GRN mutation causes FTD and other late-onset neurodegenerative diseases, whereas patients with homozygous loss-of-function mutations have neuronal ceroid lipofuscinosis (NCL, Batten) much earlier in life. Disease), characterized by accumulation of self-fluorescent substances (lipofuscin) in neurosomes of neurons, rapid cognitive decline and retinal degeneration (Smith Katherine R, et al. American Journal of Human Genetics. 2012; 90 (6)). : 1102-7). Patients who are heterozygous to the GRN mutation develop lysosomal accumulation lesions in the same brain and retina as NCL patients, although the onset of symptoms is much delayed, and they also experience progressive neurodegeneration. (Word ME, et al. Science Transitional Medicine. 2017; 9 (385), Gotzl JK, et al. Acta neuropathological. 2014; 127 (6): 845-60). Progranulin has recently been found to play an important role in lysosomal function by promoting acidification of lysosomes and acting as a chapellon for lysosomal proteases containing cathepsin D (CTSD) (Beel S, et al. Human molecular genetics. 2017 Aug 1; 26 (15): 2850-2863, Tanaka Y, et al. Human molecular genetics. 2017; 26 (5): 969-88). Mutations in the gene encoding the CTSD also result in an NCL phenotype, supporting the general pathophysiology associated with deficient lysosomal protease activity (Siintola E, et al. Brain: a journal o).
f neurology. 2006; 129 (Pt 6): 1438-45).

Currently, there is no therapy to modify the disease of adult-onset neurodegenerative disease caused by GRN haploinsufficiency. Disease management includes supportive care and out-of-indication treatment aimed at reducing disease-related behavioral, cognitive, and / or motor symptoms (Tsai and Boxer, 2016, J Neurochem. 138 Supplement 1: 211). -21). In addition, by screening individuals with a family history of dementia, more patients may arrive earlier, but are not currently indicated due to lack of treatment. Therefore, this disease spectrum represents areas of unmet medical needs.

What is needed is treatment for adult-onset neurodegenerative diseases associated with GRN haploinsufficiency and associated symptoms.

Suitable recombinant AAV (rAAV) for use in the treatment of neurodegenerative diseases caused by progranulin (PGRN) -related frontotemporal dementia (FTD) and other adult-onset neurodegenerative diseases associated with GRN haploinsufficiency. ) Is provided. rAAV comprises an adeno-associated virus 1 capsid and a vector genome packaged in the AAV capsid, which is the AAV inverted terminal repeat (ITR), coding sequence encoding human progranulin, and progranu. Contains regulatory sequences that direct the expression of phosphorus. In certain embodiments, the vector genome comprises an AAV 5'inverted terminal repeat (ITR), a human PGRN coding sequence, and regulatory elements that direct its expression, as well as an AAV 5'ITR.

Pharmaceutical compositions comprising an aqueous liquid and recombinant AAV (rAAV) are also provided. In certain embodiments, the aqueous fluid comprises an artificial cerebrospinal fluid containing a surfactant suitable for intrathecal administration.

A method of treating a human patient with progranulin-related frontotemporal dementia (FTD) neurodegenerative disease or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency is provided. The method comprises delivering rAAV containing the coding sequence of human progranulin to the central nervous system (CNS). A recombinant adeno-associated virus (rAAV) with an adeno-associated virus 1 (AAV1) capsid, wherein the rAAV further comprises a vector genome packaged in the AAV capsid, wherein the vector genome is an AAV inverted terminal repeat. A recombinant adeno-associated virus (rAAV) comprising a coding sequence for human progranulin and a regulatory sequence that directs expression of progranulin.

RAAV1 for use in the treatment of human patients with PGRN-FTD or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. hPGRN is provided. The method comprises administering to the CNS rAAV with an adeno-associated virus 1 capsid encoding human progranulin that targets ependymal cells. rAAV1 further comprises a vector genome packaged in an AAV capsid, which is an AAV inverted terminal repeat, a coding sequence for human progranulin, a regulatory sequence that directs expression of progranulin in ependymal cells. include. In one embodiment, secretible human progranulin is expressed after delivery of rAAV1 gene therapy.

Methods are provided for treating human patients with brain lesions associated with progranulin-related frontotemporal dementia (FTD) neurodegenerative disease or other adult-onset neurodegenerative disease caused by GRN haploinsufficiency. The method comprises administering to the central nervous system (CNS) a recombinant adeno-associated virus (rAAV) having an adeno-associated virus 1 (AAV1) capsid, wherein the rAAV comprises a vector genome packaged in the AAV capsid. Further included, the vector genome contains AAV inverted terminal repeats, coding sequences for human progranulin, and regulatory sequences that direct expression of progranulin.

In certain embodiments, the methods provided herein are: (a) non-invasively assessing a patient for reduction of retinal accumulation lesions as a predictor of reduction of brain lesions, (b) magnetic resonance imaging. And / or (c) measuring the concentration of progranulin concentration in the CSF may further be included.

These and other aspects of the invention will become apparent from the detailed description of the invention below.

AAV1. It is a linear map of the hPGRN vector genome. AAV1. CB7. CI. hPGRN. The rBG vector genome contains the coding sequence for human PGRN under the control of the ubiquitous CB7 promoter, which is composed of a hybrid between the CMV IE enhancer and the chicken β-actin promoter. Abbreviations: BA: β-actin, bp: base pair, CMV IE: cytomegalovirus earliest, ITR: inverted terminal repeat, PolyA: polyadenylation, rBG: rabbit β-globin. It is a linear vector map of a cis plasmid carrying a vector genome. GRN ^{− / −} provides a natural history of lipofuscin accumulation and hexosaminidase activity in the brain of mice. GRN ^{− / −} mouse (KO) or GRN +/ + (WT) controls were sacrificed at the indicated age (n = 10 ^/ time point). Unstained brain sections were imaged for autofluorescent material (lipofuscin) in the hippocampus, thalamus, and frontal cortex, and lipofuscin deposits were quantified and averaged by three blind reviewers (FIGS. 3A-3C). The number of lipofuscins is expressed relative to the total area of interest. Hexosaminidase activity was measured in brain samples and normalized to total protein concentration (Fig. 3D). Values are expressed as a ratio to wild-type controls. AAV-mediated PGRN expression indicates correction of lysosomal pathology in the brain of young adult GRN ^{− / −} mice. GRN ^{− / −} mouse (KO) or GRN ^+/+ (WT) controls were treated with a single ICV infusion of AAVhu68 vector expressing vehicle (PBS) or human PGRN (101 ¹ GC) at 2 months of age (group). Per n = 10). Animals were sacrificed on day 60 of infusion and were measured by ELISA for human PGRN in the CSF (FIG. 4A) and the frontal lobe of the brain (FIG. 4B). Hexosaminidase activity was measured in brain samples (Fig. 4C). Brain PGRN concentration and Hex activity were normalized to total protein. Unstained brain sections were imaged for autofluorescent material (lipofuscin) in the hippocampus, thalamus, and frontal cortex. Lipofuscin deposits in the hippocampus, thalamus, and frontal cortex were quantified by a blind reviewer (FIGS. 4D-4G). The lipofuscin number is expressed for each high-power field. Except for KO + PBS hippocampus (n = 8), n = 10 per group. * P <0.05, ** p <0.005, *** p <0.001, *** p <0.0001, one-way ANOVA, followed by Tukey's multiple comparison test. Hexosaminidase activity was measured in serum (Fig. 4G). AAV-mediated expression of human PGRN indicates correction of lysosomal pathology in the brain of aged GRN ^{− / −} mice. At 7 months of age, GRN ^{− / −} mouse (KO) or GRN ^+/+ (WT) controls were treated with a single ICV infusion of AAVhu68 vector expressing vehicle (PBS) or human PGRN (101 ¹ GC). Animals were sacrificed 4 months after injection. Hexosaminidase activity was measured in brain samples (FIG. 5A) and lipofuscin deposits were quantified in the hippocampus, thalamus, and cortex by a blind reviewer (FIGS. 5B-5D). The lipofuscin number is expressed for each high-power field. * P <0.05, ** p <0.005, one-way ANOVA, followed by Tukey's multiple comparison test. The correction of brain microgliosis in aged GRN ^{− / −} mice by AAV-mediated PGRN expression is shown. At 7 months of age, GRN ^{− / −} mouse (KO) or GRN ^+/+ (WT) controls were treated with a single ICV infusion of AAVhu68 vector expressing vehicle (PBS) or human PGRN (101 ¹ GC). Animals were sacrificed 4 months after injection and brain sections were stained for CD68. CD68-positive regions in images of the hippocampus, thalamus, and frontal cortex were quantified by a blind reviewer using ImageJ software (FIGS. 6A-6C). The area is represented for each high-power field. * P <0.05, ** p <0.005, *** p <0.001, *** p <0.0001, one-way ANOVA, followed by Tukey's multiple comparison test. Human PGRN expression in rhesus macaques after AAV delivery is shown. On day 0 of the test, adult rhesus monkeys were administered AAV1, AAV5, or AAVhu68 vector (3 × 10 ¹³ GC) expressing human PGRN from the chicken beta actin promoter by ICM infusion (n = 2 per vector). Two additional macaques were administered an AAVhu68 vector expressing hPGRN from the ubiquitin C promoter (AAVhu68 V2). ICM injection was performed under fluoroscopic guidance. After confirming needle placement and CSF return injection of contrast medium by fluoroscopy, distribution within the cisterna magna was shown. Subsequent vector injections revealed displacement of the contrast agent. Human PGRN was measured by ELISA in CSF of treated macaques (FIG. 7A) and healthy adult human subjects (FIG. 7B), as well as serum of treated macaques (FIG. 7C). In FIGS. 7A and 7B, the dotted line points to the lower limit of quantification of hPGRN diluted 1: 5 in CSF. Vector Treatment Shows an immune response to human PGRN in non-human primates. After ICM administration of AAV1, AAV5 or AAVhu68 vector (3 × 10 ¹³ GC) expressing human PGRN from the chicken beta actin promoter or ubiquitin C promoter (AAVhu68 V2), CSF was administered for chemistry and cytopathological analysis. Collected weekly. An increase in white blood cell count (mainly small lymphocytes) was evident in most animals (Fig. 8A). Antibody responses to human PGRN were measured by ELISA in CSF (FIG. 8B) and serum (FIG. 8C) of animals treated with AAVhu68 or AAV1. Antibodies to human PGRN were not evaluated in AAV5 treated animal-derived serum or CSF samples. The levels of brain transduction after ICM administration of AAV1 and AAVhu68 vectors to non-human primates are shown. Adult rhesus monkeys were administered a 3x10 ¹³ GC AAVhu68 (n = 2) or AAV1 (n = 2) vector expressing GFP from the chicken beta actin promoter by ICM infusion. Twenty-eight days after vector administration, animals were necropsied and sections of five regions of the right hemisphere of the brain were analyzed by GFP immunohistochemistry or immunofluorescence by staining with GFP and DAPI. Co-staining with markers of specific cell types (NeuN, GFAP, and Oligo2) allowed the quantification of transduced astrocytes and oligodendrocytes. Mean transduction of each cell type was calculated for all sampled brain regions. Error bar = SEM of 5 sections. A table is provided showing the rate of neuronal, astrocyte and oligodendrocyte transduction after ICM administration of AAV1 (animal IDs 1826 and 2068) and AAVhu68 (animal IDs 1518 and 2076) vectors to non-human primates. On day 0 of the test, adult rhesus monkeys were administered a 3 × 10 ¹³ GC AAVhu68 (n = 2) or AAV1 (n = 2) vector expressing GFP from the chicken beta actin promoter by ICM infusion. Twenty-eight days after vector administration, animals were necropsied and sections of five regions of the right hemisphere of the brain were analyzed by GFP immunofluorescence by co-staining for specific cell types (NeuN, GFAP, and Olig2). The total number of cells of each cell type and the number of GFP-expressing cells of each type were quantified using HALO software. For each region, the percentage of each transduced cell type is shown. For some animals, two sections from region 5 were analyzed. The results of the median sensory nerve conduction test in non-human primates are shown. The Y-axis is the initiation measured over time (x-axis) after administration of 3 different doses (3 × 10 ¹² GC, 1 × 10 ¹³ GC, or 3 × 10 ¹³ GC of rAAV1.hPGRN or vehicle control). Represents the latency from to the peak amplitude (peak latency). rAAV1. The results of neuropathological studies of the dorsal root ganglion (DRG), median nerve, and spinal cord (SC) in non-human primates (NHP) 90 days after treatment with hPGRN are shown. The flow diagram of the manufacturing process for vector generation is shown. Abbreviations: AEX: anion exchange, CRL: Charles River Laboratories, ddPCR: digital droplet polymerase chain reaction, DMEM: Dulbecco modified Eagle's medium, DNA: deoxyribonucleic acid, FFB: final preparation buffer, GC: genome copy, HEK293: human fetal Origin kidney 293 cells, ITFFB: intramedullary final preparation buffer, PEI: polyethyleneimine, SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis, TFF: tangential flow filtration, USP: US Pharmacy, WCB: working cells bank. The flow chart of the manufacturing process for a vector formulation is shown. GTP-205 Manufacturing process for producing pharmaceutical products. Abbreviations: Ad5: Adenovirus serum type 5, AUC: Ultracentrifugation for analysis, BDS: Bulk drug substance, BSA: Bovine serum albumin, CZ: Crystal Zenith, ddPCR: Droplet digital polymerase chain reaction, E1A: Initial region 1A ( Gene), ELISA: Enzyme-bound immunoadsorption assay, FDP: Final preparation, GC: Genome copy, HEK293: Human fetal kidney 293 cells, ITFFB: Intrathecal final preparation buffer, KanR: Canamycin resistance (gene), MS: Mass Analysis, NGS: Next Generation Sequencing, qPCR: Quantitative Polymerase Chain Reaction, SDS-PAGE: Dodecyl Sulfate Sodium Polyacrylamide Gel Electrophoresis, TCID5050% Tissue Culture Infection, UPLC: Ultrafast Liquid Chromatography, USP: US Pharmacy ..

Recombinant AAV (rAAV) suitable for use in the treatment of neurodegenerative conditions associated with GRN-haploinsufficiency, such as progranulin (PGRN) -related frontotemporal dementia (FTD), and compositions containing them. Provided. In certain preferred embodiments, rAAV comprises an adeno-associated virus 1 capsid and a vector genome packaged within the AAV capsid, wherein the vector genome is an AAV inverted terminal repeat, a coding sequence for human progranulin, and. Contains regulatory sequences that direct the expression of progranulin. In certain embodiments, the vector genome comprises an AAV 5'inverted terminal repeat (ITR), a human PGRN coding sequence, and regulatory elements that direct its expression, as well as an AAV 3'ITR. Pharmaceutical compositions comprising an aqueous liquid and recombinant AAV (rAAV) are also provided. In certain embodiments, the aqueous fluid comprises an artificial cerebrospinal fluid containing a surfactant suitable for intrathecal administration. Also provided are methods for treating human patients with PGRN-FTD and / or for patients with brain lesions associated with PGRN-FTD. In certain embodiments, methods are provided for treating or reducing microgliosis in a patient. This method is described in rAAV. Includes delivering PGRN to the central nervous system (CNS). In certain embodiments, the methods provided herein are: (a) non-invasively assessing a patient for reduction of retinal accumulation lesions as a predictor of reduction of brain lesions, (b) magnetic resonance imaging. And / or (c) monitoring the treatment by measuring the concentration of PGRN concentration in the CSF. Optionally, the concentration of PGRN in plasma may be measured.

As used herein, the term "AAV.hPGRN" or "rAAV.hPGRN" is a set having an AAV capsid containing a vector genome containing the coding sequence of human progranulin under the control of regulatory sequences. Used to refer to recombinant adeno-associated virus. A particular capsid type may be specified, eg, AAV1. hPGRN refers to recombinant AAV with the AAV1 capsid, AAVhu68. hPGRN is AAVhu
Refers to recombinant AAV with 68 capsids, AAV5. hPGRN refers to recombinant AAV with an AAV5 capsid.

A "recombinant AAV" or "rAAV" is a DNAse-resistant viral particle comprising a vector genome comprising two components, an AAV capsid, and at least a non-AAV coding sequence packaged within the AAV capsid. Unless otherwise stated, the term may be used interchangeably with the phrase "rAAV vector". rAAV is a "replication defect virus" or "replication defect virus vector" because it lacks any functional AAV rep gene or functional AAV cap gene and is unable to produce progeny. In certain embodiments, the only AAV sequence is the AAV reverse terminal repeat sequence (ITR), typically to allow genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid. It is located at the 5'and 3'ends of the vector genome.

As used herein, "vector genome" refers to a nucleic acid sequence packaged inside an rAAV capsid that forms a viral particle. Such nucleic acid sequences include AAV reverse end repeats (ITRs). In the examples herein, the vector genome comprises at least 5'to 3'AAV 5'ITRs, coding sequences, and AAV 3'ITRs. Other than ITR from AAV2, source AAV different from capsid, or full-length ITR may be selected. In certain embodiments, the ITR is derived from the same AAV source as the AAV that provides the rep function or trans-complementary AAV in production. In addition, other ITRs may be used. In addition, the vector genome contains regulatory sequences that direct the expression of the gene product. Suitable components of the vector genome are discussed in more detail herein.

Therapeutic protein and coding sequence:
rAAV comprises the coding sequence of a human progranulin (hPGRN) protein or a variant thereof and performs one or more of the biological functions of hPGRN. The coding sequence for this protein is engineered into a vector genome for expression in the central nervous system (CNS).

HuPGRN1 is most commonly characterized by the sequence of 593 amino acids of GenBank NP_002078 reproduced in SEQ ID NO: 1. This sequence has a signal peptide at positions 1-17 with a secreted granulin protein or secreted granulin containing amino acids 18-593. This protein refers to Granulin 1 (also known as Granulin G: about aa58 about amino acid 113), Granulin 2 (about amino acids 123-about 179), Granulin 3 (about amino acids 206-about amino acids 261), with reference to the numbering of SEQ ID NO: 1. ), Granulin 4 (about amino acids 281 to about amino acids 336), granulin 5 (about amino acids 364 to about amino acids 417), granulin 6 (about amino acids 442 to about amino acids 496), and granulin 7 (about amino acids 518 to about amino acids 573). Can be cut into eight chains of. In certain embodiments, the native signal peptide can be replaced with a heterologous signal peptide. However, other embodiments may include progranulin having an extrinsic signal peptide (eg, a human IL2 reader). Also, for example, www. signalpeptide. de / index. php? See m = listspdb_mammalia. Therefore, fusion proteins containing progranulin and / or fragments thereof are contemplated. Such fusion proteins may comprise one or more of the active GRNs (eg, GRN1, 2, 3, 4, 4, 6, or 7) in various combinations with each other, or among these peptides. One or more of may be combined with a full-length PGRN or another protein or peptide (eg, another active protein or peptide, and / or a signal peptide exogenous to human PGRN).

The vector genome carries the coding sequence for this protein and is carried in human cells (particularly).
Manipulated to express proteins (in the central nervous system). In certain embodiments, the coding sequence is found in GenBank: NM_002087.3. And is reproduced in SEQ ID NO: 2.

In certain embodiments, the coding sequence is provided in SEQ ID NO: 3. Certain other embodiments include coding sequences that are 95% -99.9% or 100% identical to SEQ ID NO: 3 and include values between them. In some embodiments, the coding sequence is codon-optimized for better therapeutic outcome (eg, enhanced expression in mammalian cells). Identity is across the coding sequence of the full-length progranulin with a signal (leader) sequence, across the progranulin without a signal (leader) sequence, or the length of the coding sequence of the fusion protein as defined herein. Can be evaluated over. In certain embodiments, the coding sequence is provided in SEQ ID NO: 3. Certain other embodiments include coding sequences that are 95% to less than 100% identical to SEQ ID NO: 4. Identity is across the coding sequence of the full-length progranulin with a signal (leader) sequence, across the progranulin without a signal (leader) sequence, or the length of the coding sequence of the fusion protein as defined herein. Can be evaluated over.

Preferably, these coding sequences encode a full-length progranulin. However, other embodiments may comprise an active granulin chain having a heterologous signal peptide (eg, a human IL2 leader). Also, for example, www. signalpeptide. de / index. php? See m = listspdb_mammalia.

In certain embodiments, fragments of the coding sequence of human PGRN (eg, SEQ ID NO: 3 or SEQ ID NO: 4), or sequences that are approximately 95% -99.9% or 100% identical thereto may be utilized. Such fragments may encode an active human GRN (aa18-593), or a fusion peptide comprising a heterologous signal peptide with the active human GRN. In certain embodiments, one or more of one or more coding sequences of an active GRN (eg, GRN1, 2, 3, 4, 4, 6, or 7) are in various combinations with each other in a vector genome. Or one or more of these peptides can be combined with a full length PGRN or another coding sequence.

Although not intended to be bound by theory, AAV-mediated PGRN expression in a cellular subset of CNS (eg, ependymal cells) is believed to provide a depot of secreted proteins. The secreted PGRN protein (and / or one or more GRNs) is taken up by other cells via the sortylin or mannose-6-phosphate receptor and then transported to the lysosome. In certain embodiments, the secreted protein is progranulin. In certain embodiments, the secreted protein is granulin. In certain embodiments, the secreted protein comprises a mixture of progranulin and granulin.

In certain embodiments, in addition to the coding sequence for progranulin, another non-AAV coding sequence, such as the peptide, polypeptide, protein, functional RNA molecule of interest (eg, miRNA, miRNA inhibitor), or the like. May contain the gene product of. Useful gene products also include miRNAs. MiRNAs and other small interfering nucleic acids regulate gene expression through cleavage / degradation of target RNA transcripts or suppression of translation of target messenger RNA (mRNA). MiRNAs are typically naturally expressed as the final 19-25 untranslated RNA products. MiRNAs exhibit their activity through sequence-specific interactions with the 3'untranslated region (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA double strands and further into "mature" single strand miRNA molecules. This mature miRNA induces a multiprotein complex miRISC that identifies the target site of the target mRNA within the 3'UTR region, for example, based on its complementarity with the mature miRNA.

In certain embodiments, the expression cassette further comprises one or more miRNA target sequences that suppress the expression of hPGRN in the dorsal root ganglion (drg). In certain embodiments, the expression cassette comprises at least two tandem repeats of a drg-specific miRNA target sequence, at least two tandem repeats of at least a second miRNA that may be the same as or different from at least the first miRNA target sequence. Includes target sequences. In certain embodiments, the tandem miRNA target sequence is continuous or separated by 1-10 nucleic acid spacers, which are not miRNA target sequences. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 3'of the hPGRN coding sequence. In certain embodiments, the first initiation of at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3'end of the hPGRN coding sequence. In certain embodiments, the first initiation of at least two drg-specific miRNA tandem repeats is at least 100 nucleotides from the 3'end of the hPGRN coding sequence. In certain embodiments, the miRNA tandem repeat comprises 200-1200 nucleotides in length. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 5'of the hPGRN coding sequence. In certain embodiments, at least two drg-specific miRNA target sequences are located on both 5'and 3'of the hPGRN coding sequence. In certain embodiments, the expression cassette mRNA or DNA plus strand of at least the first miRNA target sequence and / or at least the second miRNA target sequence is (i) AGTGAATTCTACAGTGCCATA (miR183, SEQ ID NO: 32), (ii) AGCAAAAATGTGTGAGTGCCAAA. It is selected from (SEQ ID NO: 33), (iii) AGTGTGAGTTCACTACTTGCCAAA (SEQ ID NO: 34), and (iv) AGGGATTCCTGGAAAACTGGAC (SEQ ID NO: 35). In certain embodiments, the two or more contiguous miRNA target sequences are contiguous and are not separated by spacers. In certain embodiments, the two or more miRNA target sequences are separated by spacers, each spacer independently being one of (A) GGAT, (B) CACGTG, or (C) GCATGC. It is selected from the above. In certain embodiments, the spacers located between the miRNA target sequences can be located at 3'and / or 5'of the last miRNA target sequence of the first miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same. See US Provisional Patent Application No. 62 / 783,956 filed December 21, 2018, and International Patent Application No. PCT / US19 / 67872 filed February 12, 2020 (these are). , Incorporated herein by reference).

AAV1
AAVhu68 from Clade F can be used to generate vectors that target and express hPGRN within the CNS. However, AAV1-mediated PGRN delivery was unexpectedly observed to provide better PGRN expression in CNS than AAVhu68, even though comparable plasma concentrations were observed. The present inventors have rAAV1. It has been discovered that intrathecal delivery of PGRN is an attractive route of delivery for the therapies described herein. Therefore, in a particularly desirable embodiment, the AAV1 capsid is selected.

In certain embodiments, the composition is provided and comprises an aqueous liquid suitable for intrathecal injection and a stock of rAAV with an AAV capsid that preferentially targets ependymal cells, wherein the rAAV is the central nervous system ( Further comprises a vector genome having a PGRN coding sequence for delivery to CNS). In certain embodiments, the composition is formulated for occipital infusion into the cisterna (intra-cisterna). In certain embodiments, rAAV is guided by computer tomography (CT).
Administered via AAV infusion. In certain embodiments, the patient is administered a single dose of the composition.

AAV1 capsid refers to a capsid having an AAV vp1 protein, an AAV vp2 protein, and an AAV vp3 protein. In certain embodiments, the AAV1 capsid is composed of a predetermined ratio of AAV vp1 protein, AAV vp2 protein, and AAV vp3 protein in a predetermined ratio of about 1: 1:10, and is a T1 icosahedron capsid of 60 total vp proteins. Assembled to. The AAV1 capsid can package the genomic sequence to form AAV particles (eg, recombinant AAV whose genome is a vector genome). Typically, the capsid nucleic acid sequence encoding the longest vp protein (ie, VP1) is transexpressed during the production of rAAV with the AAV1 capsid. For example, US Pat. No. 6,759,237, US Pat. No. 7,105,345, US Pat. No. 7,186,552, US Pat. No. 8,637,255, and US Pat. No. 9,567, 607, which is incorporated herein by reference.

The coding sequence for the capsid was the final assembled rAAV1. It does not exist in hPGRN. However, such sequences are utilized for the production of recombinant AAV. In certain embodiments, the coding sequence for the AAV1 capsid is the full-length AAV1 VP1 protein of SEQ ID NO: 26, or any nucleic acid sequence encoding the VP2 or VP3 region thereof. For example, US Pat. No. 6,759,237, US Pat. No. 7,105,345, US Pat. No. 7,186,552, US Pat. No. 8,637,255, and US Pat. No. 9,567, See 607 (these are incorporated herein by reference). In certain embodiments, the coding sequence for the AAV1 capsid is SEQ ID NO: 25. In some embodiments, the AAV1 capsid is a protein produced from the coding sequence of SEQ ID NO: 25 with or without post-translational modification. However, variants of this coding sequence can be engineered and / or other coding sequences are reverse translated for the desired expression system using the amino acid sequences of AAV1 VP1, AAV1 VP2, and / or AAV VP3. Can be done.

In certain embodiments, the composition comprising recombinant AAV1 with a capsid comprises the five amino acids in which AAV1 is highly deamidated, based on the numbering of the primary sequence of AAV1 VP1 reproduced in SEQ ID NO: 26. (N57, N383, N512, and N718) are included.

In certain embodiments, AAV1 is a heterologous population of VP isoforms deamidated as defined in the table below, based on the total amount of VP protein in the capsid determined using mass spectrometry. Characterized by capsid composition. In certain embodiments, the AAV capsid is modified with one or more of the following positions, as provided below, as determined using mass spectrometry. The residue number is based on the published AAV1 sequence reproduced in SEQ ID NO: 26.

Suitable modifications include the modifications described in the above paragraph labeled with deamidation and are incorporated herein. In certain embodiments, the following positions, or one or more of the glycines following N, are modified as described herein. In certain embodiments, an AAV1 mutation is constructed in which glycine following N at positions 57, 383, 512, and / or 718 is conserved (ie, remains unmodified). In certain embodiments, the NGs at the four positions shown in the preamble are conserved in their natural sequence. The residue number is based on the published AAV1 VP1 reproduced in SEQ ID NO: 26. In certain embodiments, the artificial NG is introduced at a position different from one of the positions specified in the table above.

rAAV Vector As mentioned above, recombinant AAV with the AAV1 capsid is the preferred vector described herein for the treatment of FTD. In certain embodiments, for example, in the following examples (eg, AAVhu68 or AAV5), other AAV capsids can be used to generate rAAV. In certain embodiments, the AAV1 capsid can be selected and one or more of the elements of the vector genome containing the coding sequence for hPGRN can be replaced.

As used herein, AAVhu68 capsid refers to a capsid as defined in WO2018 / 160582 (incorporated herein by reference). As described herein, rAAVhu68 has the rAAVhu68 capsid, the AAVhu68 nucleic acid sequence encoding the bp1 amino acid sequence of SEQ ID NO: 31 (SEQ ID NO: 30), and optionally additional nucleic acid sequences (eg, eg. , Vp1 and / or a sequence encoding a vp3 protein that does not contain the eigenregion of vp2) is produced in a production system that expresses capsids. The rAAVhu68 obtained from production using a single nucleic acid sequence vp1 produces a heterologous population of vp1 protein, vp2 protein, and vp3 protein. The AAVhu68 capsid contains subpopulations within the vp1 protein, vp2 protein, and vp3 protein and has modifications from the predicted amino acid residue of SEQ ID NO: 31. These subpopulations contain at least deamidated asparagine (N or Asn) residues. For example, asparagine in the asparagine-glycine pair is highly deamidated. In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 30, or a strand complementary thereto, such as the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 protein can be expressed additionally or alternatively, eg, from a nucleic acid sequence different from vp1 in order to change the ratio of the vp protein in the selected expression system. In certain embodiments, the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 31 (about aa203-736) or complementary to it does not include the vp1 eigenregion (about aa1 to about aa137) and / or the vp2 eigenregion (about aa1 to about aa202). Also provided is a nucleic acid sequence encoding a strand, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 30). In certain embodiments, the AAVhu68 vp2 amino acid sequence (about aa138-736) of SEQ ID NO: 31, which does not contain the vp1 eigenregion (about aa1-about 137), or a complementary strand, the corresponding mRNA or tRNA (of SEQ ID NO: 30). Nucleic acid sequences encoding nt411-2211) are also provided.

As used herein, the AAV5 capsid has the predicted amino acid sequence of SEQ ID NO: 29. In certain embodiments, the AAV5 capsid is expressed from the nucleic acid sequence of SEQ ID NO: 28.

The genomic sequence packaged in the AAV capsid and delivered to the host cell is typically composed of at least a trans gene and its regulatory sequence, and an AAV reverse terminal repeat (ITR). Both single-stranded AAV and self-complementary (sc) AAV are included in rAAV. The transgene is a nucleic acid coding sequence that is heterologous to the vector sequence encoding the polypeptide, protein, functional RNA molecule (eg, miRNA, miRNA inhibitor), or other gene product of interest. Nucleic acid coding sequences are operably linked to regulatory elements in a manner that allows transgene transcription, translation, and / or expression in cells of the target tissue.

The AAV sequence of the vector typically comprises cis-acting 5'and 3'inverted terminal repeats (eg, BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC. Press, pp. 155 168 (1990)). The ITR sequence is about 145 bp long. Preferably, the entire ITR-encoding sequence is used intramolecularly, although some minor modification of these sequences is acceptable. The ability to modify these ITR sequences is within the skill of the art. (For example, Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989); an
d K. Fisher et al. , J. Vilol. , 70: 520 532 (1996)). An example of such a molecule utilized in the present invention is a "cis-acting" plasmid containing a selected transgene sequence and associated regulatory elements flanking the 5'and 3'AAV ITR sequences. In one embodiment, the ITR is from an AAV different from that supplying the capsid. In one embodiment, it is an ITR sequence derived from AAV2. A shortened version of the 5'ITR called ΔITR has been described, lacking the D sequence and the terminal separation site (trs). In other embodiments, full-length AAV 5'and 3'ITRs are used. However, ITRs from other AAV sources may be selected. If the origin of the ITR is from AAV2 and the AAV capsid is from another AAV origin, the resulting vector can be referred to as a pseudotype. However, other configurations of these elements may also be suitable.

In addition to the key elements described above for recombinant AAV vectors, the vector allows its transcription, translation, and / or expression in virus-infected cells transfected with a plasmid vector or produced according to the invention. It also includes the necessary conventional regulatory elements that are operably linked to the transgene in such a manner. As used herein, an "operably linked" sequence is an expression control sequence flanking the gene of interest and an expression control sequence that acts trans or distantly to control the gene of interest. Both are included.

The regulatory control element typically comprises, for example, a promoter sequence located between the selected 5'ITR sequence and the coding sequence as part of the expression control sequence. Constitutive promoters, regulatory promoters [see, eg, WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters that respond to physiological hints are used in the vectors described herein. obtain. Promoters can be from different sources, such as human cytomegalovirus (CMV) earliest enhancer / promoter, SV40 earliest enhancer / promoter, JC polymomavirus promoter, myelin basic protein (MBP) or glaucoma fibrous acid protein (GFAP). ) Promoter, Simple Herpesvirus (HSV-1) Latent Related Promoter (LAP), Laus Sarcoma Virus (RSV) Long End Repeat (LTR) Promoter, Neuron Specific Promoter (NSE), Thrombocytopenic Growth Factor (PDGF) Promoter, hSYN , Melanin Aggregating Hormone (MCH) Promoter, CBA, Matrix Metal Protein Promoter (MPP), and Chicken Beta Actin Promoter. In addition to the promoter, the vector contains one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, For example, it may include a WPRE, a sequence that enhances translation efficiency (ie, a Kozak consensus sequence), a sequence that enhances protein stability, and optionally a sequence that enhances the secretion of the encoded product. An example of a suitable enhancer is a CMV enhancer. Other suitable enhancers include those suitable for the desired target tissue indication. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette comprises two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include an early pre-CMV enhancer. This enhancer can be present in two copies located adjacent to each other. Alternatively, the double copy of the enhancer is fragmented by one or more sequences. In yet another embodiment, the expression cassette further comprises an intron, eg, a chicken beta actin intron. Other suitable introns include those known in the art and are described, for example, in International Publication No. WO2011 / 126808. Examples of suitable poly A sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic poly A. Optionally, one or more sequences can be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be engineered upstream of the poly A sequence and downstream of the coding sequence (eg, MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). Please refer to).

In one embodiment, the vector genome comprises an AAV 5'ITR, a promoter, an optional enhancer, an optional intron, a coding sequence for human PGRN, or a fusion protein containing them, a poly A, and an AAV 3'ITR. include. In certain embodiments, the vector genome is an AAV 5'ITR, promoter, optional enhancer, optional intron, coding sequence for human PGRN, or a fusion protein containing them, poly A, and AAV 3'ITR. including. In certain embodiments, the vector genome comprises an AAV 5'ITR, a promoter, an optional enhancer, an optional intron, a huPGRN coding sequence, a poly A, and an AAV 3'ITR. In certain embodiments, the vector genome comprises an AAV2 5'ITR, an EF1a promoter, an optional enhancer, an optional promoter, huPGRN, SV40 poly A, and an AAV2 3'ITR. In certain embodiments, the vector genomes are AAV2 5'ITR, UbC promoter, optional enhancer, optional intron, huPGRN, SV40 poly A, and AAV2 3'ITR. In certain embodiments, the vector genomes are AAV2 5'ITR, CB7 promoter, intron, huPGRN, SV40 poly A, and AAV2 3'ITR. In certain embodiments, the vector genomes are AAV2 5'ITR, CB7 promoter, intron, huPGRN, rabbit β-globinpoly A, and AAV2 3'ITR. See, for example, SEQ ID NO: 22 (EF1a.huPGRN.SV40), SEQ ID NO: 23 (UbC.PI.huPGRN.SV40), or SEQ ID NO: 24 (CB7.CI.hPGRN1.rGB). The coding sequence for huPGRN is selected from the sequences defined herein. See, for example, SEQ ID NO: 3 or a sequence 95% to 99.9% identical to SEQ ID NO: 3 or a sequence 95% to 99.9% identical to SEQ ID NO: 4 or a fragment thereof as defined herein. Exemplary sequences of vector elements used in the following examples are, for example, SEQ ID NO: 6 (rabbit globin poly A), AAV ITR (SEQ ID NOs: 7 and 8), human CMV IE promoter (SEQ ID NO: 9), CB. Promoter (SEQ ID NO: 10), chimeric intron (SEQ ID NO: 11), UbC promoter (SEQ ID NO: 12), EF-1a promoter (SEQ ID NO: 17), intron (SEQ ID NO: 13), and SV40 late poly A (SEQ ID NO: 14). Provided at. Other elements of the vector genome or variations on their sequences may be selected for the vector genome for a particular embodiment of the invention.

For use in the production of vector-producing AAV viral vectors (eg, recombinant (r) AAV), the expression cassette can be carried on any suitable vector delivered to the packaging host cell, eg, a plasmid. The plasmids useful in the present invention can be engineered to be suitable for in vitro replication and packaging, among other things, in prokaryotic cells, insect cells, and mammalian cells. Suitable transfection techniques and packaged host cells are known and / or can be readily designed by one of ordinary skill in the art.

Methods for producing and isolating AAVs suitable for use as vectors are known in the art. In general, for example, Creator & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, product and cultural applications". Biochem. Engin / Biotechnol. 99: 119-145, Buning et al. , 2008, "Recent developments in adeno-associated virus vector technology," J. Mol. Gene Med. See 10: 717-733, and references cited below (each of which is incorporated herein by reference in its entirety). To package the transgene into a virion, ITR is the only AAV component required for cis in the same construct as the nucleic acid molecule containing the expression cassette. The cap and rep genes can be supplied trans.

In one embodiment, the expression cassette described herein is a genetic element (eg, a shuttle plasmid) that introduces an immunoglobulin construct sequence carried onto it into a packaging host cell in order to produce a viral vector. Be manipulated. In one embodiment, the selected genetic element is delivered to AAV packaged cells by any suitable method including transfection, electroporation, liposome delivery, membrane fusion techniques, fast DNA coated pellets, viral infections, and protoplast fusion. Can be done. Stable AAV packaged cells can also be produced. Alternatively, expression cassettes can be used to generate viral vectors other than AAV, or for the production of mixtures of antibodies in vitro. The methods used to make such constructs are known to engineers in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. For example, Molecular Cloning: A Laboratory Manual, ed. See Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid that lacks the desired genomic sequence packaged in it. These can be referred to as "empty" capsids. Such capsids may not contain the detectable genomic sequence of the expression cassette, or may contain only the partially packaged genomic sequence that is insufficient to achieve expression of the gene product. .. These empty capsids are non-functional for introducing the gene of interest into the host cell.

The recombinant adeno-associated virus (AAV) described herein may be produced using known techniques. See, for example, WO2003 / 042397; WO2005 / 033321, WO2006 / 110689, US758772B2. Such a method comprises packaging an expression cassette consisting of a nucleic acid sequence encoding the AAV capsid protein, a functional rep gene, at a minimum AAV reverse terminal repeat (ITR) and a transgene, and an expression cassette into the AAV capsid protein. Includes culturing host cells with sufficient helper function to allow. A method for producing a capsid, a coding sequence for it, and a method for producing an rAAV viral vector are described. For example, Gao, et al, Proc. Natl. Acad. Sci. U. S. A. See 100 (10), 6081-6086 (2003) and US2013 / 0045186A1.

In one embodiment, a production cell culture useful for producing recombinant AAV is provided. Such cell cultures direct the expression of nucleic acids expressing the AAV capsid protein in host cells, nucleic acid molecules suitable for packaging in AAV capsids, eg, vector genomes containing AAV ITR, and products in host cells. Includes a non-AAV nucleic acid sequence encoding a genetic product that is operably linked to the sequence, as well as sufficient AAV rep and adenovirus helper functions to allow packaging of the nucleic acid molecule into a recombinant AAV capsid. In one embodiment, the cell culture is composed of mammalian cells (eg, especially human embryonic kidney 293 cells) or insect cells (eg, baculovirus).

Typically, the rep function is derived from the same AAV source as the AAV that provides the ITR flanking the vector genome. In the examples herein, AAV2 ITR is selected and AAV2
Use rep. The coding sequence is reproduced in SEQ ID NO: 27. Optional other r
An ep sequence or another rep source (and optionally another ITR source) may be selected. For example, rep can be, but is not limited to, AAV1 rep protein, AAV2 rep protein, or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52, or fragments thereof. Optionally, the rep and cap sequences are on the same genetic element in the cell culture. There may be a spacer between the rep sequence and the cap gene. Either of these AAV or mutant AAV capsid sequences can be regulated by exogenous regulatory regulatory sequences that direct their expression in host cells.

In one embodiment, the cells are produced in suitable cell culture (eg, HEK293) cells. The methods for producing the gene therapy vectors described herein are well known in the art, such as the production of plasmid DNA used for the production of gene therapy vectors, the production of vectors, and the production of vectors. And vector purification. In some embodiments, the gene therapy vector is an AAV vector and the resulting plasmid is an AAV trans-plasmid containing the AAV cis-plasmid, AAV rep and cap genes encoding the AAV genome and the gene of interest. , As well as adenovirus helper plasmids. The vector generation process includes initiation of cell culture, cell passage, cell dissemination, cell transfection with plasmid DNA, media exchange to serum-free medium after transfection, recovery of cells containing the vector and culture medium. May include method steps.

In certain embodiments, rAAV. The process for producing hPGRN involves transient transfection of HEK293 cells with plasmid DNA. Single or multiple batches are produced in the PALL iCELLis bioreactor by PEI-mediated triple transfection of HEK293 cells. When possible, the recovered AAV material is sequentially purified by clarification, TFF, affinity chromatography, and anion exchange chromatography in a disposable closed bioprocessing system.

The cells and culture medium containing the recovered vector are referred to herein as crude cell recovers. In yet another system, the gene therapy vector is introduced into insect cells by infection with a baculovirus-based vector. For reviews of these production systems, generally see, for example, Zhang et al. , 2009, "Adenovirus-adeno-associated virus for range-scale recombinant adeno-associated virus product," see 20 Incorporated). The manufacture and use of these and other AAV production systems are also described in the following US patents, the contents of which are incorporated herein by reference in their entirety: 5,139,941, 5,741, 683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065 (these are incorporated herein by reference).

The crude cell recovery is then crudely purified by concentration of the vector recovery, dialysis filtration of the vector recovery, microsolution of the vector recovery, nuclease digestion of the vector recovery, filtration of the microsolution intermediate, and chromatography. , Crude purification by ultracentrifugation, buffer exchange by tangential filtration, and / or formulation and filtration for preparing bulk vectors, and so on.

Affinity chromatography purification at high salt concentrations in two steps, followed by anion exchange resin chromatography, is used to purify the vector drug product and remove empty capsids. These methods are described in more detail in International Patent Application No. PCT / US2016 / 065970, filed December 9, 2016 (which is incorporated herein by reference). Purification method of AAV8: International Patent Application No. PCT / US2016 / 065976 filed on December 9, 2016, and Purification method of rh10: filed on December 9, 2016, with "Scalable Purification Method for AAVrh10". Titled International Patent Application No. PCT / US16 / 66013 (also filed on December 11, 2015), and Method for Purifying AAV1: International Patent Application No. PCT / US2016 / filed on December 9, 2016. 065974, "Scalable Patentation Method for AAV1", filed December 11, 2015, is hereby incorporated by reference in its entirety.

For selected samples to calculate the content of empty and filled particles (eg, in the examples herein, preparations purified with an iodixanol gradient, where the number of GCs = the number of particles). The VP3 band capacitance is plotted against the loaded GC particles. Using the obtained linear equation (y = mx + c), the number of particles in the band capacitance of the test peak is calculated. The number of particles per 20 μL loaded (pt) is then multiplied by 50 to give the particles (pt) / mL. Divide Pt / mL by GC / mL to obtain the ratio of particles to genomic copy (pt / GC). Pt / mL to GC / mL give an empty pt / mL. The empty pt / mL is divided by pt / mL and then multiplied by 100 to obtain the percentage of empty particles.

In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. For example, Grimm et al. , Gene Therapy (1999) 6: 1322-1330, Somer et al. , Molec. The. (2003) 7: 122-128. To test for denatured capsids, the method consists of an SDS- consisting of any gel capable of separating three capsid proteins (eg, a gradient gel containing 3-8% Tris-acetate in buffer). Polyacrylamide gel electrophoresis involves subjecting the treated AAV stock, the gel is then run until the sample material is separated, and the gel is blotted onto a nylon or nitrocellulose membrane (preferably nylon). The anti-AAV capsid antibody is then used as a primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Mol. Vol. (2000) 74: 9281-9293). It then binds to the primary antibody, more preferably an anti-IgG antibody containing the detection molecule covalently bound to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. Secondary antibodies are used, including means for detecting. Methods for detecting binding are used to determine the binding between the primary and secondary antibodies semi-quantitatively, preferably detecting radioactive isotope radiation, electromagnetic radiation, or color change. A detection method capable of this, most preferably a chemiluminescence detection kit is used. For example, in SDS-PAGE, a sample from a column fraction can be taken and heated in an SDS-PAGE filling buffer containing a reducing agent (eg, DTT), where the capsid protein is a precast gradient polyacrylamide gel (eg, DTT). For example, it was decomposed in Novex). SilverXpress (Invitrogen, CA) may be used according to the manufacturer's instructions to perform silver staining, or other suitable staining methods, ie SYPRO ruby or Coomassie staining, may be performed. In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove the exogenous DNA. After inactivation of the nuclease, the sample is further diluted and amplified using the TaqMan ™ fluorescence generator specific for the primers and the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on the Applied Biosystems Prism 7700 sequence detection system. A plasmid DNA containing the same sequence as that contained in the AAV vector is used to create a standard curve for the Q-PCR reaction. The vector genome titer was determined by using the cycle threshold (Ct) value obtained from the sample and normalizing it to the Ct value of the plasmid standard curve. Endpoint assays based on digital PCR can also be used.

In one aspect, an optimized q-PCR method utilizing broad spectrum serine proteases such as proteinase K (eg, commercially available from Qiagen) is used. More specifically, an optimized qPCR genomic titer assay, except that after DNase I digestion, the sample is diluted with Protease K buffer, treated with Protease K, followed by heat deactivation. Similar to a standard assay. Appropriately, the sample is diluted with a proteinase K buffer equal to the sample size. Proteinase K buffer can be concentrated more than twice. Typically, proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally performed at about 55 ° C. for about 15 minutes, but at a lower temperature (eg, about 37 ° C. to about 50 ° C.) for a longer time (eg, about 20 minutes to about 30 minutes), or. It may be carried out at a higher temperature (eg, up to about 60 ° C.) for a shorter period of time (eg, about 5-10 minutes). Similarly, heat deactivation is generally at about 95 ° C. for about 15 minutes, but the temperature may be lowered (eg, about 70-about 90 ° C.) and the time may be extended (eg, about 20 minutes). ~ About 30 minutes). The sample is then diluted (eg, 1000-fold) and subjected to TaqMan analysis as described in the standard assay.

Additional or alternative, droplet digital PCR (ddPCR) may be used. For example, methods for measuring single-stranded and self-complementary AAV vector genomic titers by ddPCR have been described. For example, M. Lock et al, Hu Gene Therapy Methods, Hum Gene The Methods. 2014 Apr; 25 (2): 115-25. doi: 10.1089 / hgtb. 2013.131. See EPub 2014 Feb 14.

Briefly, a method for separating rAAV particles with a packaged genomic sequence from genomic-deficient AAV intermediates provides a suspension containing recombinant AAV virus particles and AAV capsid intermediates for high performance liquid chromatography. AAV virus particles and AAV intermediates are bound to a strong anion exchange resin equilibrated at high pH and subjected to a salt gradient while monitoring the eluent for ultraviolet absorbance at about 260 and about 280. Will be done. The pH can be adjusted according to the selected AAV. See, for example, WO2017 / 160360 (AAV9), WO2017 / 100704 (AAVrh10), WO2017 / 100676 (eg, AAV8), and WO2017 / 100674 (AAV1) (these are incorporated herein by reference). .. In this method, the AAV complete capsid is recovered from the fraction that elutes when the A260 / A280 ratio reaches the point of infection. In one example, for the affinity chromatography step, the dialysis-filtered product may be applied to Capture Select ™ Poros-AAV2 / 9 affinity resin (Life Technologies) that efficiently captures the AAV2 serotype. .. Under these ionic conditions, a significant percentage of residual cellular DNA and protein will flow through the column and AAV particles will be efficiently captured.

Compositions In the present specification, at least one rAAV. Compositions comprising hPGRN stock (eg, rAAV stock) and optional carriers, excipients and / or preservatives are provided. rAAV stock refers to multiple rAAV vectors that are the same, eg, the amounts described below in the discussion of concentration and dose units.

In certain embodiments, the composition comprises a viral stock that is a recombinant AAV (rAAV) suitable for use in treating progranulin-related frontal temporal dementia (FTD), wherein the rAAV is ( a) adeno-associated virus 1 capsid and (b) a vector genome packaged in an AAV capsid, wherein the vector genome is of AAV inverted terminal repeats, human progranulin coding sequences, and progranulin. Includes a vector genome, which contains regulatory sequences that direct expression. In certain embodiments, the vector genome comprises a promoter, enhancer, intron, human PGRN coding sequence, and polyadenylation signal. In certain embodiments, the intron consists of elements of the chicken beta actin splice donor and the rabbit β splice acceptor. In certain embodiments, the vector genome further comprises an AAV2 5'ITR and an AAV2 3'ITR, which are flanked by all elements of the vector genome.

rAAV. The hPGRN is preferably suspended in a physiologically compatible carrier and can be administered to human or non-human mammalian patients. In certain embodiments, for administration to a human patient, rAAV is suitably suspended in an aqueous solution containing a saline solution, a surfactant, and a physiologically compatible salt, or a mixture of salts. Is done. Preferably, the pharmaceutical product is adjusted to a physiologically acceptable pH, for example, pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. Will be done. The pH of cerebrospinal fluid is about 7.28 to about 7.32, or about 7.2 to about 7.4 for intrathecal delivery, so a pH within this range is desirable, but intravenous delivery. In the case of, a pH of about 6.8 to about 7.2 may be desirable. However, other pH within the widest range, and these subranges, may be selected for other delivery routes.

In certain embodiments, the pharmaceutical product may contain a buffered physiological saline solution that does not contain sodium bicarbonate. Such formulations may contain a buffered physiological saline solution, such as Harvard buffer, in which one or more of sodium chloride, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof. include. The aqueous solution may further contain the poloxamer Kolliphor® P188, which was commercially available from BASF and previously sold under the trade name Lutrol® F68. The aqueous solution can have a pH of 7.2 or a pH of 7.4.

In another embodiment, the formulation may comprise a buffered physiological saline solution, 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2). ), 0.8 mM magnesium chloride (MgCl2), and 0.001% Kolliphor® 188. For example, haradapparatus. com / hard-apparatus-perfusion-fluid. html. Please refer to. In certain embodiments, Harvard buffer is preferred.

In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprice, sodium lauryl sulfate, polyoxyethylene-9-lauryl. It may contain ether or EDTA.

In another embodiment, the composition comprises a carrier, diluent, excipient and / or adjuvant. Suitable carriers can be readily selected by one of ordinary skill in the art, taking into account the indications to which the introduced virus is directed. For example, one suitable carrier contains saline and can be formulated with various buffer solutions (eg, phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the infusion tube but do not interfere with rAAV binding activity in vivo.

Optionally, the composition may include other conventional pharmaceutical ingredients such as preservatives or chemical stabilizers in addition to rAAV and carriers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl asbestosate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

As used herein, "carrier" is any solvent and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption retarders, buffers, carriers. Includes solutions, suspensions, colloids, etc. The use of such vehicles and agents for pharmaceutically active substances is well known in the art. Supplement The active ingredient can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to a molecular entity and composition that does not cause an allergic or similar adverse reaction when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles and the like can be used to introduce the compositions of the invention into suitable host cells. In particular, the rAAV vector delivery transgene can be formulated for either lipid particles, liposomes, vesicles, nanospheres, or delivery encapsulated in nanoparticles and the like.

In one embodiment, the composition comprises an aqueous liquid suspension suitable for delivery to the subject, eg, buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be transported as a concentrate that is diluted for administration to a subject. In other embodiments, the composition can be lyophilized and reconstituted upon administration.

Suitable surfactants or combinations of surfactants may be selected from among the non-toxic nonionic surfactants. In one embodiment, a secondary hydroxyl group-terminated bifunctional block copolymer interface, such as Pluronic® F68 [BASF], also known as poloxamer 188, which has a neutral pH and an average molecular weight of 8400. The activator is selected. Non-ionic consisting of other surfactants and other poloxamers, ie, the central hydrophobic chain of polyoxypropylene (poly (propylene oxide)) adjacent to the two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)). Triblock copolymers, SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic glyceride), polyoxy10 oleyl ethers, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol, and polyethylene glycol can be selected. In one embodiment, the pharmaceutical product contains a poloxamer. These copolymers are generally named with the letter "P" (for poloxamers) followed by a three digit number, where the first two digit number x100 gives the approximate molecular weight of the polyoxypropylene core. The final number x10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant may be present in an amount of up to about 0.0005% to about 0.001% of the suspension.

The vector is administered in an amount sufficient to transfect cells and provides sufficient levels of gene transfer and expression for therapeutic effects without undue adverse effects or with medically acceptable physiological effects. Provided, which can be determined by one of ordinary skill in the art. Optionally, direct delivery, oral, inhalation to routes other than intrathecal administration, eg, to the desired organ (eg, liver (optionally via hepatic artery), lung, heart, eye, kidney). , Intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration can be used. Routes of administration may be combined if desired.

The dose of viral vector depends primarily on factors such as the condition being treated, the patient's age, weight, and health, and can therefore vary from patient to patient. For example, a therapeutically effective human dosage of a viral vector generally ranges from about 25 to about 1000 microliters to about 100 mL, and is about 1 × 10 ⁹ (to treat an average subject weighing 70 kg). Concentrations of the ~ 1 × 10 ¹⁶ genomic viral vector, including all integers or fractions within that range, preferably 1.0 × 10 ¹² GC to 1.0 × 10 ¹⁴ GC for human patients. It is a containing solution. In one embodiment, the composition comprises at least 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 per dose, comprising all integers or fractions within the range. It is formulated to contain × 10 ⁹ , 7 × 10 ⁹ , 8 × 10 ⁹ , or 9 × 10 ⁹ GC. In another embodiment, the composition comprises at least 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , 5 × 10 ¹⁰ per dose, comprising all integers or fractions within the range. It is formulated to contain 6 × 10 ¹⁰ , 7 × 10 ¹⁰ , 8 × 10 ¹⁰ , or 9 × 10 ¹⁰ GC. In another embodiment, the composition comprises at least 1 × 10 ¹¹ , 2 × 10 ¹¹ , 3 × 10 ¹¹ , 4 × 10 ¹¹ , 5 × 10 ¹¹ , 6 per dose, comprising all integers or fractions within the range. It is formulated to contain × 10 ¹¹ , 7 × 10 ¹¹ , 8 × 10 ¹¹ , or 9 × 10 ¹¹ GC. In another embodiment, the composition comprises at least 1 × 10 ¹² , 2 × 10 ¹² , 3 × 10 ¹² , 4 × 10 ¹² , 5 × 10 ¹² , per dose, comprising all integers or fractions within the range. It is formulated to contain 6 × 10 ¹² , 7 × 10 ¹² , 8 × 10 ¹² , or 9 × 10 ¹² GC. In another embodiment, the composition comprises at least 1 × 10 ¹³ , 2 × 10 ¹³ , 3 × 10 ¹³ , 4 × 10 ¹³ , 5 × 10 ¹³ , per dose, comprising all integers or fractions within the range. It is formulated to contain 6 × 10 ¹³ , 7 × 10 ¹³ , 8 × 10 ¹³ , or 9 × 10 ¹³ GC. In another embodiment, the composition comprises at least 1x10 ¹⁴ , 2x10 ¹⁴ , 3x10 ¹⁴ , 4x10 ¹⁴ , 5x10 ¹⁴ , per dose, comprising all integers or fractions within the range. It is formulated to contain 6 × 10 ¹⁴ , 7 × 10 ¹⁴ , 8 × 10 ¹⁴ , or 9 × 10 ¹⁴ GC. In another embodiment, the composition comprises at least 1 × 10 ¹⁵ , 2 × 10 ¹⁵ , 3 × 10 ¹⁵ , 4 × 10 ¹⁵ , 5 × 10 ¹⁵ , per dose, comprising all integers or fractions within the range. It is formulated to contain 6 × 10 ¹⁵ , 7 × 10 ¹⁵ , 8 × 10 ¹⁵ , or 9 × 10 ¹⁵ GC. In one embodiment, for human application, the dose can range from 1 × 10 ¹⁰ to about 1 × 10 ¹² GC per dose, including all integers or fractions within the range.

In certain embodiments, the dose ranges from about 1 × 10 ⁹ GC / g brain mass to about 1 × 10 ¹² GC / g brain mass. In certain embodiments, the dose ranges from about 1 × 10 ¹⁰ GC / g brain mass to about 3.33 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose ranges from about 3.33 × 10 ¹¹ GC / g brain mass to about 1.1 × 10 ¹² GC / g brain mass. In certain embodiments, the dose ranges from about 1 × 10 ¹² GC / g brain mass to about 3.33 × 10 ¹³ GC / g brain mass. In certain embodiments, the dose is lower than 3.33 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose is lower than 1.1 × 10 ¹² GC / g brain mass. In certain embodiments, the dose is lower than 3.33 × 10 ¹³ GC / g brain mass.

In certain embodiments, the dose is about 1 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 2 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 2 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 3 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 4 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 5 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 6 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 7 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 8 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 9 × 10 ¹⁰ GC / g brain mass. In certain embodiments, the dose is about 1 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose is about 2 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose is about 3 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose is about 4 × 10 ¹¹ GC / g brain mass.

In certain embodiments, the dose is administered to humans as a uniform dose in the range of about 1.44 × 10 ¹³ to 4.33 × 10 ¹⁴ GC of rAAV. In certain embodiments, the dose is administered to humans as a uniform dose in the range of about 1.44 × 10 ¹³ to 2 × 10 ¹⁴ GC of rAAV. In certain embodiments, the dose is administered to humans as a uniform dose in the range of about 3 × 10 ¹³ to 1 × 10 ¹⁴ GC of rAAV. In certain embodiments, the dose is administered to humans as a uniform dose in the range of about 5 × 10 ¹³ to 1 × 10 ¹⁴ GC of rAAV.

In some embodiments, the composition is formulated in dosage units and may contain an amount of AAV in the range of about 1 × ¹⁰ 13-8 × 10 ¹⁴ GC of rAAV. In some embodiments, the composition is formulated in dosage units and may contain an amount of rAAV in the range of about 1.44 × 10 ¹³ to 4.33 × 10 ¹⁴ GC of rAAV. In some embodiments, the composition is formulated in dosage units and may contain an amount of rAAV in the range of about 3 × 10 ¹³ to 1 × 10 ¹⁴ GC of rAAV. In some embodiments, the composition is formulated in dosage units and may contain an amount of rAAV in the range of about 5 × 10 ¹³ to 1 × 10 ¹⁴ GC of rAAV.

In certain embodiments, rAAV is administered to the subject in a single dose. In certain embodiments, multiple doses (eg, 2 doses) are desired.

Dosages may be adjusted to balance the therapeutic benefit for any side effect, such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized. The expression level of the transgene can be monitored to determine the dosing frequency that results in the viral vector, preferably the AAV vector containing the minigene. Optionally, a dosing regimen similar to that described for therapeutic purposes may be utilized for immunization using the compositions of the invention.

As used herein, the term "intrathecal delivery" or "intrathecal administration" is intended to reach cerebrospinal fluid (CSF), more specifically, via injection into the spinal canal. Refers to the route of administration of a drug by injection into the subarachnoid space. Intrathecal delivery may include lumbar puncture, intraventricular (including lateral ventricle (ICV)), suboccipital / intratubular, and / or C1-2 puncture. For example, the material can be introduced for diffusion over the subarachnoid space by lumbar puncture. In another embodiment, the infusion may be in the cisterna magna or via intraparenchymal delivery. In certain embodiments, rAAV is administered via a (intra-cisterna) occipital infusion into the cisterna magna guided by computer tomography (CT). In certain embodiments, the patient is administered in a single dose.

As used herein, the term "intra-cisterna magna" or "intra-cisterna magna" refers to the direct route of administration of the drug to the cerebrospinal fluid of the cerebellar medulla oblongata, more specifically the occipital region. Refers to the route of administration of the drug by inferior puncture, by direct infusion into the cisterna magna, or by a permanently placed tube.

In certain embodiments, rAAV. The stock of hPGRN is formulated in an intrathecal final product buffer (ITFFB; artificial CSF containing 0.001% Pluronic F-68). Batches are frozen, then thawed, pooled as needed, adjusted to target concentration, sterile filtered through a 0.22 μm filter and filled with vials. In certain embodiments, rAAV1. The suspension containing the formulation buffer of hPGRN is adjusted to pH 7.2-7.4.

In one embodiment, rAAV1 provided herein. The volume for delivery of a dose of hPGRN can be determined by one of ordinary skill in the art. For example, volumes of about 1 μL to 150 mL may be selected, and higher volumes may be selected for adults. Typically, a suitable volume for newborns may be selected from about 0.5 mL to about 10 mL, and for older babies, from about 0.5 mL to about 15 mL. For infants, volumes of about 0.5 mL to about 20 mL may be selected. For children, capacities of up to about 30 mL may be selected. For preteen and teen generations, capacities of up to about 50 mL may be selected. In yet another embodiment, the patient can receive intrathecal administration in a selected volume of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable doses and dosages may be determined. Dosages may be adjusted to balance the therapeutic benefit for any side effect, such dosages may vary depending on the therapeutic application for which the recombinant vector is utilized.

In certain embodiments, the composition is rAAV. EF1a. huPGRN. SV40, rAAV. UbC. PI. huPGRN. SV40, or rAAVCB7. CI. hPGRN1. Includes rGB. The composition in which the rAAV capsid is AAVhu68, AAV5, or AAV1 is exemplified in the following examples. In a particularly preferred embodiment, the rAAV is AAV1. In certain embodiments, the huPGRN coding sequence is selected from the sequences defined herein. See, for example, SEQ ID NO: 3 or a sequence 95% to 99.9% identical to SEQ ID NO: 3 or a sequence 95% to 99.9% identical to SEQ ID NO: 4 or a fragment thereof as defined herein. Exemplary sequences of vector elements used in the following examples are, for example, SEQ ID NO: 6 (rabbit globin poly A), AAV ITR (SEQ ID NOs: 7 and 8), human CMV IE promoter (SEQ ID NO: 9), CB. Promoter (SEQ ID NO: 10), chimeric intron (SEQ ID NO: 11), UbC promoter (SEQ ID NO: 12), EF-1a promoter (SEQ ID NO: 17), intron (SEQ ID NO: 13), and SV40 late poly A (SEQ ID NO: 14). Provided at.

Use As used herein, PGRN haploinsufficiency refers to a patient with a mutation in the PGRN gene that results in deficient levels of PGRN and / or GRN. Target populations for rAAV1-PGRN therapy include patients with PGRN haploinsufficiency and / or other deficient levels of PGRN or GRN. In certain embodiments, the patient is heterozygous for the PGRN mutation. In yet another embodiment, the patient is homozygous from the PGRN mutation. In certain embodiments, the patient is administered an immunosuppressive regimen in combination with the rAAV1-mediated hPGRN therapy provided herein.

In certain embodiments, rAAV1. PGRN is useful in the treatment of patients with GRN haploinsufficiency. Such patients may have been diagnosed with adult-onset neurodegenerative disease caused by GRN haploinsufficiency or may be presymptomatic. rAAV1. PGRN can be administered as a single dose via a computer tomography (CT) -guided intracisterna magna (intra-cisterna [ICM]) occipital injection. Single doses are administered at a given dose level. This route of administration was selected due to the excellent brain transduction achieved by a single ICM infusion at NHP. In certain embodiments, administration of the vector to the ICM also results in a reduced anti-PGRN T cell response as compared to another route of administration (eg, injection into the lateral ventricle). In a general procedure, ICM injection (also known as occipital puncture) was previously replaced by lumbar puncture. However, other dosing levels and delivery routes may be selected and / or used in conjunction with this rAAV1-mediated hPGRN therapy.

In certain embodiments, the rAAV1-mediated therapies described herein may provide PGRN expression at approximately average and normal physiological levels for humans without GRN mutations (haploinsufficiency). However, treatment can provide a therapeutic effect even when the increase in PGRN expression is lower than normal levels, about 40% to 99% of normal average levels, eg, 35%, 40%, 45%. , 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or other values between these. In certain embodiments, this can result from an increase in PGRN levels of at least 5% to about 70% or more, which exceeds the expression levels of the patient before treatment. In certain embodiments, the treatment provides therapeutic efficacy in which administration of rAAV1-mediated hPGRN results in elevated levels of PGRN in CSF (eg, 10-40 fold higher than normal levels).

In certain embodiments, efficacy is assessed by one or more of increased levels of PGRN protein in CSF and / or changes in cerebral cortex thickness. In certain embodiments, the efficacy of rAAV1-mediated therapy is assessed after administration of a single ICM dose, long-term survival, as well as minimal state test (MMSE), clinical general impression change (CGI-C), frontotemporal lobe function test ( FAB), Frontotemporal Dementia Rating Scale (FRS), Frontotemporal Behavior Questionnaire (FBI), Unified Parkinson's Disease Rating Scale (UPDRS), Language Fluency Test, Frontotemporal Lobe Dementia Clinical Dementia Scale Rating Measured by item total (CDR-FTLD sb) and / or one or more of clinical symptoms and improvement in daily function assessed by the Neuropsychiatric Symptoms Questionnaire (NPI). In certain embodiments, efficacy is demonstrated by improved CSF levels of nerve filament light chains (NFLs), tau, phosphorylated tau, and inflammatory markers, and / or increased plasma levels of PGRN. In certain embodiments, efficacy is assessed by measuring the reduction or reversal of levels of microgliosis.

In certain embodiments, efficacy is measured by amelioration of one or more of the clinical symptoms associated with GRN patients, which may include, for example, behavioral deficits (disinhibition, apathy, loss of compassion or empathy). Includes, compulsive or parenchymal behavior, or lip tendencies) and cognitive deficits (decreased executive function that does not significantly affect episodic memory or visual space skills).

In certain embodiments, improvement is observed in some other more atypical symptoms, with psychiatric features (delusions, illusions, and compulsive behavior) and / or other cognitive impairment (episode memory impairment, loss). Assessments, including row and visuospatial dysfunction), may be performed using FTDC criteria, brain imaging for signs of frontotemporal degeneration and / or frontotemporal lobar degeneration, a clinical evaluation scale (frontotemporal lobe). Evaluation of reduction on the clinical dementia scale for dementia [CDR-FTLD], frontotemporal behavioral questionnaire [FBI], neuropsychiatric symptom questionnaire [NPI], and frontotemporal dementia evaluation scale [FRS]) , And finally, genetic testing to confirm pathogenic GRN mutations. Cerebrospinal fluid (CSF) biomarkers may be used and include positron emission tomography (PET) imaging of tau and amyloid-β, as well as amyloid.

In certain embodiments, improvement is observed in GRN mutation carriers with primary progressive aphasia (PPA), which is characterized by speech and language-related symptoms. These can be diagnosed using guidelines based on Meslam criteria that distinguish between the three clinical types of PPA: semantic PPA (svPPA), non-fluent PPA (nfvPPA), and logopenic PPA (lvPPA) (Gorno). -Tempini et al., (2011) "Classification of primary progressive aphasia and variants." Neurology. 76 (11): 1006-14). nfvPPA exhibits a defect in the ability to generate utterances, and basic features include agrammatism in language generation, effort utterances, and apraxia of utterances. svPPA presents a deficiency in the ability to understand the meaning of a word, and basic features include impaired word naming and word comprehension. lvPPA is characterized by difficulty in finding suitable words during conversation, but without diminished comprehension of the words. The basic main feature of lvPPA is a defect in the ability to recall words and repeat sentences. GRN mutation carriers, which are most common in nfvPPA, may have broader symptoms across the clinical spectrum of PPA, leading to a diagnosis of "PPA-nototherwise specified" (Gorno-Tempini). et al., 2011; Woollacott and Roherer, 2016).

A method of treating a human patient with a neurodegenerative condition associated with GRN haploinsufficiency is provided. In certain embodiments, the condition is progranulin-related frontotemporal dementia (FTD). The method comprises delivering the coding sequence of progranulin to the central nervous system (CNS) via a recombinant adeno-associated virus (rAAV) with an adeno-associated virus 1 (AAV1) capsid. It further comprises a vector genome packaged in an AAV capsid, which contains an AAV inverted terminal repeat, a coding sequence for human progranulin, and a regulatory sequence that directs expression of progranulin.

Methods are provided for treating human patients with brain lesions associated with frontotemporal dementia associated with progranulin or another neurodegenerative condition associated with GRN haploinsufficiency. The method comprises administering the coding sequence of progranulin to the central nervous system (CNS) via a recombinant adeno-associated virus (rAAV) with an adeno-associated virus 1 (AAV1) capsid. It further comprises a vector genome packaged in an AAV capsid, which contains an AAV inverted terminal repeat, a coding sequence for human progranulin, and a regulatory sequence indicating the expression of progranulin.

In certain embodiments, the methods provided herein are: (a) non-invasively assessing a patient for reduction of retinal accumulation lesions as a predictor of reduction of brain lesions, (b) magnetic resonance imaging. And / or (c) monitoring the treatment by measuring the concentration of progranulin in the CSF. Optionally, plasma progranulin concentration may be assessed.

In certain embodiments, rAAV. The effectiveness of the hPGRN composition is assessed primarily by one or more of cognitive, predominantly behavioral, or cognitive / other methods. The suitable evaluation will be described below.

The main cognitive assessments include verbal fluency tests, FTLD clinical dementia rates, or the Mini-Mental State Examination (MMSE). The verbal fluency test may be performed by presenting the same picture / photo to each subject and asking for oral explanation. During the description, speech rate (words / minute) is counted, recorded, and finally compared to a rate that reflects a typical developing adult. CDR-FTLD is an extended version of the classic CDR and has historically been used to assess the severity of spectral disorders in Alzheimer's disease. This assessment includes the original six domains of CDR (memory, orientation, judgment and problem-solving, social adaptation, family and hobbies, long-term care), and two additional domains of language and behavior. Sensitivity is increased in detecting a decrease in FTLD. A rating of "0" indicates normal behavior or language, and a score of "1", "2", or "3" indicates mild to severe disability. "Sum of boxes", or the sum of individual domain scores, is used to determine the overall severity of dementia. The MMSE is an 11-question overall cognitive assessment that is widely used in clinical and research practice. As a question, for example, "What year is this year? When is the season? What day? What day of the week? What month?", One point is given for each correct answer, and the question is asked. The highest score is given for each. The upper limit of the total score is 30 points, and there are two cutoffs, 24 points and 27 points. These cutoffs are indicators of cognitive decline.

Major exercise assessments include, for example, the Unified Parkinson's Disease Assessment Scale (UPDRS). UPDRS is a 42-item, four-part assessment of several domains related to Parkinsonism, such as mentation, behavior, and mood and activity in daily life. Each item typically contains a rating scale ranging from 0 (typically indicating no disability) to 4 (typically indicating the most severe disability). Scores for each part are aggregated to provide severity of the disease, with a high score of 199 indicating the worst / most complete disability.

Key behavioral assessments include, for example, the Neuropsychiatric Symptom Questionnaire (NPI) or the Frontal Lobe Behavioral Questionnaire (FBI). NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially developed for use in populations with Alzheimer's disease, it may be useful in assessing behavioral changes in other conditions. This assessment consists of 10 behavioral domains and 2 autonomic areas, including 4 scores: frequency, severity, overall burden, and caregiver burden. The total NPI score is obtained by adding the domain score of the behavioral domain and subtracting the caregiver-paid score. The FBI is a 24-item assessment aimed at assessing behavioral and personality changes specifically associated with bvFTD and distinguishing between FTD and other dementias. This is performed as a face-to-face interview with the primary caregiver, as patients diagnosed with bvFTD generally do not have sufficient insight into these types of changes. Each question is graded from 0 (none) to 3 (severe / most often), focusing on several areas related to behavior and personality. The total score provides insight into the severity of the disease and can be used to assess changes over time.

Other / cognitive and motor assessments include, for example, Columbia Suicide Severity Rating Scale (C-SSRS), Clinical General Impression Changes (CGI-C), Frontal Lobe Function Test (FAB), and / or Frontotemporal. Includes the Type Dementia Rating Scale (FDR). C-SSRS is a three-part scale that measures suicidal ideation, intensity of thought, and suicidal behavior through questions to assess suicidal ideation and behavior. The result of this assessment consists of a suicidal ideation rate assessment, a suicidal ideation score, and a suicidal ideation intensity assessment obtained directly from the scale. A thought score above 0 may indicate the need for intervention, based on evaluation guidelines. The intensity rating ranges from 0 to 25, where 0 represents no support for suicidal ideation. CGI-C is one of three concise and widely used assessments, consisting of three items and assessed by clinicians and observers. CGI-C is rated on a 7-point scale, ranging from 1 (very improved) to 7 (very worse), starting with enrollment in the study, whether or not the improvement is entirely therapeutic. Will be done. FAB is a simplified assessment to aid in the distinction between frontal lobe executive dysfunction phenotypic dementia and Alzheimer's disease. This is particularly useful in patients with mild dementia (MMSE> 24). The assessment consists of six parts that address the areas of cognition, movement, and behavior, with a total score of 18 and higher scores indicating better performance. FDR is a simplified staging assessment for patients with frontotemporal dementia that detects differences in disease progression of the FTD subtype over time. This brief interview is conducted with the primary caregiver and consists of 30 items, classified as "not happening", "occasionally happening", or "always happening". The percentage score is then calculated and converted into a logit score and finally a severity score. Severity scores range from "very mild" to "most severe."

Another measure of efficacy is the increase in survival time from the time of diagnosis after the onset of symptoms, which is a measure of efficacy. Currently, the average life expectancy of patients diagnosed with neurodegenerative disease caused by GRN mutations is 7 to 11 years after the onset of symptoms. Another measure of efficacy is the stabilization and / or increase in atrophy in the thickness of the medial prefrontal cortex and parietal region, which are the most commonly affected brain regions across all clinical manifestations in the target population. This can be evaluated using MRI or other diagnostic imaging techniques. Yet other assessments include biochemical biomarkers. Levels of PGRN protein in CSF and plasma are measured as readouts of AAV transduction, rAAV1. It is expected to increase in patients after administration of hPGRN. In other embodiments, CSF levels of nerve filament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers are assessed. In certain embodiments, regulation and / or reduction of levels of these biomarkers correlates with efficacy.

The following examples focus on the treatment of certain conditions associated with heterozygous GRN haploinsufficiency, but in certain embodiments, the vectors and compositions described herein are other diseases such as, for example. , Neuroseloid lipofustinosis, cancer (eg, ovarian cancer, breast cancer, adrenal cancer, and / or pancreatic cancer), atherosclerosis, type 2 diabetes, and homozygous mutations in GRN genes such as metabolic diseases Can be used to treat related diseases.

As used herein, the term computer tomography (CT) refers to radiography in which a computer constructs a three-dimensional image of a body structure from a series of planar cross-sectional images created along an axis.

When the term "substantial homology" or "substantial similarity" refers to a nucleic acid or fragment thereof, it is optimally aligned with another nucleic acid (or its complementary strand) with the insertion or deletion of the appropriate nucleotide. If so, there is nucleotide sequence identity in at least about 95-99% of the aligned sequences. Preferably, the homology spans a full-length sequence, or an open reading frame thereof, or another suitable fragment that is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

In the context of nucleic acid sequences, the terms "sequence identity," "percent sequence identity," or "percent identity" refer to residues in two sequences that are the same when aligned for maximum correspondence. .. The length of the sequence identity comparison can span the full length of the genome, the full length of the genetic coding sequence, or preferably at least about 500-5000 nucleotide fragments. However, identity between smaller fragments of, for example, at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 or more nucleotides is also desired. obtain. Similarly, "percent sequence identity" can be easily determined for a full-length amino acid sequence or fragment thereof of a protein. Preferably, the fragment is at least about 8 amino acids long and can be up to about 700 amino acids long. Examples of suitable fragments are described herein.

The term "substantial homology" or "substantial similarity", when referred to for an amino acid or fragment thereof, with another amino acid (or its complementary strand) with the insertion or deletion of the appropriate amino acid. When optimally aligned, there is amino acid sequence identity in at least about 95-99% of the aligned sequences. Preferably, the homology spans a full-length sequence, or a protein thereof, such as a cap protein, a rep protein, or a fragment thereof that is at least 8 amino acids long, or more preferably at least 15 amino acids long. Examples of suitable fragments are described herein.

The term "highly conserved" means at least 80% identity, preferably at least 90% identity, more preferably greater than 97% identity. Identity is readily determined by one of ordinary skill in the art by using algorithms and computer programs known to those of skill in the art.

In general, when referring to "identity,""homology," or "similarity" between two different adeno-associated viruses, "identity,""homology," or "similarity" is "aligned." It is determined by referring to the sequence. "Aligned" or "aligned" refers to multiple nucleic acid or protein (amino acid) sequences, often including corrections for defects or additional bases or amino acids as compared to the reference sequence. In the embodiment, the published AAV9 sequence is used as a reference point for AAV alignment. Alignment is performed using various multi-sequence alignment programs, either public or commercially available. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "MAP", and "MEME" accessible through a web server on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, the Vector NTI utility is also used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using the GCG version 6.1 program FASTA ™. FASTA ™ provides the best overlap region alignment and percent sequence identity between query sequences and search sequences. For example, percent sequence identity between nucleic acid sequences makes FASTA ™ its default parameters (word size 6 and scoring matrix) as provided in GCG version 6.1 (incorporated herein by reference). Can be determined by use with the NOPAM factor). Multiple sequence alignment programs such as the "Clustal Omega", "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME", and "Match-Box" programs are also for amino acid sequences. Is available. Generally, any of these programs will be used with default settings, but one of ordinary skill in the art can change these settings if desired. Alternatively, one of ordinary skill in the art may utilize another algorithm or computer program to provide at least a level of identity or alignment as provided by the reference algorithm and program. For example, J. D. Thomason et al, Nucl. Acids. Res. , "A
See Comprehensive Comprehensive of Multiple Sequence Alignments ”, 27 (13): 2682-2690 (1999).

Note that the term "a" or "an" refers to one or more.
Therefore, the terms "a" (or "an"), "one or more", and "at least one" are used interchangeably herein.

The terms "comprise," "comprises," and "comprising" should be interpreted comprehensively rather than exclusively. The terms "consist", "consisting", and their variants should be interpreted exclusively, not inclusively. Although various embodiments herein are referred to using the term "comprising," in other situations, the relevant embodiments are "consisting of" or "essentially." It is also intended to be interpreted and described using the term "consisting essentially of".

As used herein, the term "about" is 10% (± 10%, eg ± 1, ± 2, ± 3, ± 4, ± 5, ± 10%, unless specified otherwise. It means the variability of ± 6, ± 7, ± 8, ± 9, ± 10, or values between them).

As used herein, "disease," "disorder," and "condition" are used interchangeably to indicate an abnormal condition in a subject.

Unless otherwise defined herein, the technical and scientific terms used herein provide general guidance to one of ordinary skill in the art and to a number of terms used herein. By referring to the published documents provided, it has the same meaning as generally understood.

The term "expression" is used in the broadest sense herein and includes the production of RNA or RNA and proteins. With respect to RNA, the term "expression" or "translation" specifically relates to the production of peptides or proteins. Expression can be transient or stable.

As used herein, "expression cassette" refers to a nucleic acid molecule containing a coding sequence, a promoter, which may include other regulatory sequences for them, the cassette being by a genetic element (eg, a plasmid). Packaging Can be delivered to host cells and packaged into viral vector capsids (eg, viral particles). Typically, such expression cassettes for producing a viral vector are the coding sequences of the gene products described herein adjacent to the packaging signal of the viral genome, as well as others such as those described herein. Contains expression control sequences.

As used herein, the term "operably linked" refers to an expression control sequence that is contiguous to a gene of interest, and expression control that acts trans or distantly to control the gene of interest. Refers to both arrays.

When used with reference to a protein or nucleic acid, the term "heterogeneous" refers to a protein or nucleic acid comprising two or more sequences or partial sequences that are not found in the same relationship with each other in nature. For example, nucleic acids with two or more sequences from unrelated genes arranged to make novel functional nucleic acids are typically produced by recombination. For example, in one embodiment, the nucleic acid has a promoter derived from one gene that is arranged to direct the expression of the coding sequence from different genes. Therefore, with respect to the coding sequence, the promoter is heterologous.

The term "translation" in the context of the present invention relates to processes in the ribosome, where the mRNA chain regulates the set of amino acid sequences to produce a protein or peptide.

The following examples are merely exemplary and are not intended to limit the invention.

Example 1: Materials and methods:
Vector-engineered human PGRN cDNA was cloned into an expression construct containing a chick beta actin promoter with a cytomegalovirus early enhancer, a chimeric intron, and a rabbit β-globin polyadenylation sequence (FIG. 1). The second engineered human PGRN cDNA was cloned into an expression construct containing the human ubiquitin C promoter. The expression construct was flanked by AAV2 inverted terminal repeats. Adeno-associated virus serotypes 1, 5 and human 68 (AAVhu68) were generated from this construct by triple transfection of HEK293 cells and purification of iodixanol as described above (Lock M, et al. Hum Gene Ther. 2010; 21 (10): 1259-71).

Animal Procedures All animal protocols have been approved by the Instituteal Animal Care and Use Committee of the University of Pennsylvania. A pair of GRN knockout mice was purchased from The Jackson Laboratory (stock number 0131175) and the colonies were maintained at the University of Pennsylvania. Wild-type C57BL / 6 (stock number 000664) served as a control. In the first study, 2-month-old mice were anesthetized with isoflurane and injected into the lateral ventricle (ICV) in an amount of 5 μL of 1 × 10 ¹¹ vector genomic copy (GC). Sixty days after injection, mice were euthanized by blood loss under ketamine / xylazine anesthesia, and death was confirmed by cervical dislocation. In the second study, mice were treated at 7 months of age and sacrificed at 11 months of age. At necropsy, serum was collected by cardiac puncture and CSF was collected by suboccipital puncture using a 32 gauge needle connected to a polyethylene tube. Serum and CSF samples were immediately frozen on dry ice and stored at -80 ° C until analysis. The frontal cortex was harvested for biochemistry and immediately frozen on dry ice, and the rest of the brain was fixed with 10% formalin for histology.

Rhesus monkeys aged 3-4 years were purchased from Covance. For vector administration, animals were sedated with intramuscular dexmedetomidine and ketamine, and 3 × 10 ¹³ GC AAV vectors in 1 mL artificial CSF were administered by a single intramagnatic (ICM) infusion. The placement of the needle was verified by myelography using a fluoroscope (OEC9800 C-Arm, GE) as described above (Kazz N, et al. Hum Gene Ther Methods 2018 Oct; 29 (5): 212. -219). Animals were euthanized by overdose of barbituric acid. The recovered tissue was immediately frozen on dry ice or fixed with 10% formalin for histology.

Histology and Imaging Mice brains were fixed with 10% formalin, cryopreserved in sucrose, embedded in Optimal Cleavage Temperature (OCT) compound and sectioned with cryostat. A low-magnification image of the self-fluorescent substance (lipofuscin) in the target area was taken. Lipofuscin deposits were blindly quantified using ImageJ software. Non-human primate tissues were fixed with 10% formalin, embedded in paraffin and stained with hematoxylin and eosin (H & E). The slides were reviewed by a Commission-certified Veterinary Pathologist (ELB). For animals treated with the GFP vector, brain sections were stained with antibodies against olig2, GFAP, or NeuN. All sections were co-stained with antibodies to DAPI and GFP followed by fluorescent secondary antibodies. Slides were scanned with a Leica Aero Versa 200 slide scanner, downloaded from the eSlide Manager and analyzed with HALO imaging software (Indica Labs). Five regions of the right hemisphere were sampled for each animal and cells were quantified using each cell type marker. Cells were detected by adjusting the following settings: "Minimum Nuclear Strength", "Nuclear Size", "Nuclear Segmentation Aggressiveness", and "Minimum Nuclear Roundness" under the Nuclear Detection tab. Criteria were then defined for each individual dye to further identify cells and generate a quantitative total cell number for each marker. The settings were empirically determined based on the sensitivity and reliability of detection of the desired cell type. In some cases, settings such as the detection of NeuN in the cytoplasm did not reflect the true intracellular localization of the marker, but provided higher specificity and sensitivity detection. All cells detected by automated means were manually verified. For neurons, the "Nuclear Positive Threshold" and "Cytoplasmic Positive Threshold" were adjusted under the "Dye 1" tab to detect only cells with NeuN present in both the nucleus and cytoplasm. For astrocytes, DAPI and GFAP markers were selected and included in the count if they were present in both the nucleus and cytoplasm of the cell. For oligodendrocytes, cells were counted if both DAPI and olig2 were present in the nucleus but not in the cytoplasm of the cells. For colocalization, the same settings were used, but in neurons both in the nucleus and in astrocytes both in the nucleus and cytoplasm, GFP was included as an additional dye. Cells that did not express all selected markers were excluded from the resulting table generated by "masking" using the "mask" function of the nucleus or cytoplasm. Transduced oligodendrocytes were manually counted because GFP-positive cells co-localized with olig2 are rare. In some cases, parts of the autofluorescent vessel or choroid plexus were manually contoured and excluded using the "scissors" tool. The obtained values were expressed as the percentage of GFP-positive cells for each cell type marker.

Sample preparation for the hexosaminidase (Hex) assay The serum was used directly in the Hex activity assay, while the brain sample was lysis buffer (0.2% Triton-X100, 0.9% NaCl, pH 4). After homogenization in (0), clarification was performed by three freeze-thaw cycles and centrifugation. Protein concentration was determined by the Bradford assay. Hex activity measurements were performed as previously described (Hinderer C, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2014; 22 (12): 2018-27).

ELISA
Human PGRN was measured using the DuoSet ELISA kit (R & D # DY2420) with minor modifications. Briefly, a highly bound polystyrene ELISA plate was coated overnight at 4 ° C. with 5 ug / ml human PGRN capture antibody diluted in phosphate buffered saline (PBS). After washing, the plates were blocked with 1% bovine serum albumin (BSA) in PBS for 2 hours, followed by incubation of the samples for 1 hour. Human and non-human primate CSFs were diluted 1: 5 in PBS, while mouse CSF samples were diluted 1:40. Brain samples were diluted with lysis buffer to a total protein concentration of 2 mg / ml. Bound antibody was detected using biotinylated mouse anti-human progranulin antibody and streptavidin-HRP. The plate was developed with a tetramethylbenzidine substrate for 20 minutes, the reaction was stopped with 2N sulfuric acid, and then the absorbance was measured at 450 nm.

Neutralizing antibody assay Neutralizing antibodies against AAVhu68 were evaluated as described above (Calcedo R, et al. J Infect Dis. 2009; 199 (3): 381-90).

Statistics Comparison of Hex enzyme activity, lipofuscin count, and CD68 + region in wild-type mice, GRN knockout mice, and AAV-treated GRN knockout mice was performed using a one-way ANOVA followed by a post-Tuky multiple comparison test.

Example 2: AAV-mediated delivery of human GRN transgene in a mouse disease model A recombinant AAV vector (CB7.CI.hPGRN) with an AAVhu68 capsid expressing human PGRN (SEQ ID NO: 3) under the control of the CB7 promoter and chimeric intron. .RBG) was produced, for example, using the published triple transgene technique described in WO2018 / 160582.

We evaluated AAV-mediated delivery of the human GRN transgene in a GRN knockout mouse model. Heterozygous GRN mutant mice (GRN ^+/- ) show no pathological features of GRN-related neurodegenerative disease. This is probably due to the inability of mice to develop the sequelae of GRN haploinsufficiency, which first appears decades later in humans. In contrast, complete PGRN deficiency in GRN ^{− / −} mice has some early features of GRN haploinsufficiency in humans (eg, impaired lysosomal function, accumulation of autofluorescent lysosomal stores (lipofuscin), and microglia. (Activation) is reproduced, but GRN ^{− / −} mice show no neuronal loss even up to 2 years of age (Lui H, et al. Cell. 2016; 165 (4): 921-35, Ward ME, et
al. Sci Transfer Med. 2017 Apr 12; 9 (385): pii: eaah5642). Both GRN ^+/- mice and GRN ^{− / −} mice have been reported to exhibit behavioral abnormalities, but the findings are inconsistent between the groups (Ahmed Z, et al. Am J Pathol. 2010; 177). (1): 31-24, Wills H, et al. The Journal of Pathology. 2012; 228 (1): 67-76, Ghoshal N, et al. Neuroscience of Disease. 2012; 45 (1): 395-408. , Filio AJ, et al. The Journal of neuroscience: the
official journal of the Society for Neuroscience. 2013; 33 (12): 5352-61, Yin F, et al. The FASEB Journal. 2010; 24 (12): 4639-47). Similarly, some reports have shown reduced survival in GRN ^{− / −} mice, while others have found that GRN ^{− / −} mice have a normal lifespan, and the present invention. Consistent with their experience (Ahmed Z, et al. Am J Pathology. 2010; 177 (1): 311-24, Wills H, et al. The Journal of Pathology. 2012; 228 (1): 67-76). .. GRN ^{− / −} mice show no overt neurodegenerative or neurological signs, but have the potential to evaluate new therapies due to their prominent biochemical and histological similarities to GRN haploinsufficiency in humans. It will be a useful model for. Therefore, we focused our analysis on these biochemical and histological findings in GRN ^{− / −} mice.

The purpose of this study was to assess whether delivery of the human GRN gene to the brain could eliminate existing lysosomal storage substances and normalize lysosomal function in GRN ^{− / −} mice. In response to lysosomal accumulation, cells upregulate the expression of lysosomal enzymes and can be used as a biomarker for lysosomal storage (Hinderer C, et al. Molecular therapy: the journal of).
the American Society of Gene Therapy. 2014; 22 (12): 2018-27, Gurda BL, et al. Molecular therapy: the journal of the American Society of Gene Therapy. 2016; 24 (2): 206-16, Karageorgos LE, et al. Experimental Cell Research. 1997; 234 (1): 85-97). We evaluated the activity of the lysosomal enzyme hexosaminidase in brain tissue from lipofuscin deposits in GRN ^{− / −} and GRN ^+/+ mice of different ages, as well as in the cortex, hippocampus, and thalamus (FIGS. 3A-3D). ). Increased hexosaminidase activity was apparent throughout life, but lipofuscin showed progressive accumulation. Lipofuscin was apparent as early as 2 months of age and was consistent with previous findings (Klein ZA, et al. Neuron 2017; 95 (2): 281-96 e6). The first work of the present inventors was carried out using an AAV vector based on the natural isolate AAVhu68, which is closely related to the isolate AAV9 of Clade F. 2-3 month old GRN ^{− / −} mice were treated with intraventricular (ICV) infusion of either AAVhu68 vector expressing human GRN or vehicle (PBS) (N = 10 per group). In addition, a cohort of wild-type mice was injected with vehicle (N = 10). ICV ROA (ventricular ventricles) is difficult to reliably administer the vector via the ICM pathway (the ROA used in NHP studies and proposed FIH clinical trials) in small 2-month-old mice. With direct injection of the AAV vector into the CSF) was used. Previous studies have shown that ICV administration of AAVhu68 at the dose selected for this study (101 ¹ GC) is confined to the brain region near the ventricles infused with transduction, with a small cell population. Secretion of PGRN provides a useful system for assessing whether overall amelioration of brain lesions can be achieved.

Two months after vector administration, animals were euthanized and brain, CSF, and serum were collected. Quantification of human PGRN protein levels in the brain confirmed transduction in the AAV-treated group (FIGS. 4A-4F). PGRN is a measurable secretory protein in CSF and is reduced in CSF of human GRN mutation carriers (Lui H, et al. Cell. 2016; 165 (4): 921-35, Meeter LH. , Et al. Dement Geriator Cogn Dis Extra. 2016; 6 (2): 330-40). Therefore, we evaluated PGRN protein levels in CSF of AAV-treated GRN ^/ -mice and found that the average CSF concentration was 14 ng / mL, whereas in the vehicle-treated group, human PGRN was It was below the detection level (FIGS. 4A-4F). Expression of PGRN was accompanied by normalization of lysosomal enzyme expression, and Hex activity levels in the brains of AAV-treated GRN ^{− / −} mice returned to near normal levels (FIGS. 4A-4F).

After confirming PGRN expression in the brains of GRN ^{− / −} mice, it was assessed whether PGRN expression reduced the number of lipofuscin deposits in the hippocampus, thalamus, and cortex. For that purpose, unstained fixed brain sections were placed on a cover glass and blindly imaged autofluorescent lipofuscin. AAV-treated GRN ^{− / −} mice showed a reduction in lipofuscin in all brain regions compared to vehicle-treated GRN − / − mice, showing similar levels to age-matched wild-type controls (FIGS. 4A-Figure). 4F).

The first evidence of a conceptual study demonstrated the therapeutic activity of AAV-mediated PGRN expression in treated mice early in the early stages of accumulation in the brain. After that, the effect of gene transfer in aged mice with more serious existing pathological conditions was evaluated. In this study, 7-month-old GRN ^{− / −} mice received a single ICV injection of AAVhu68 vector expressing human PGRN or vehicle and were sacrificed at 11 months of age. In addition to extensive brain lipofuscin deposits (FIGS. 5A-5D), 11-month-old GRN ^{− / −} mice are extensive, as are patients with FTD caused by GRN mutations (FIGS. 6A-6C). Microgliosis was shown (Ahmed Z, et al. Journal of neuroinflammation. J Neuroinflammation. 2007 Feb 11; 4: 7). GRN gene transfer reduced brain Hex activity and lipofuscin deposits in aged mice, similar to the findings in younger animals (FIGS. 5A-5D). In addition, the size and number of microglia were normalized in the brains of treated mice (FIGS. 6A-6C).

Together, ICV delivery of an AAV vector expressing human PGRN to the brain of GRN ^{− / −} mice removes lipofuscin aggregates, almost completely normalizes the activity of lysosomal enzymes, and delivery of the PGRN gene results in GRN. Demonstrate that important aspects of pathophysiology underlying related neurodegenerative diseases can be effectively modified.

Example 3: AAV-mediated GRN gene transfer in non-human primates GRN ^{− / −} Findings in mice show that delivery of the AAV vector to CSF produces therapeutic levels of PGRN, biochemical and associated with PGRN deficiency. Demonstrate that sufficient brain transduction can be achieved to prevent or reverse histological findings. To replace this approach with humans, studies were performed on non-human primates using ICM delivery, a clinically relevant vector route of administration. Intrathecal AAV delivery by infusion into the cisterna magna is a minimally invasive approach that results in broader brain transduction than administration by lumbar puncture (Hinderer C, et al. Molecular therapy Methods & clinical development. 2014; 1). : 14051). The reason for using NHP of 3 to 10 years old is to represent the intended adult patient population. Rhesus monkeys (N = 2 per group) were administered a single ICM infusion with an image-guided AAV1, AAV5, or AAVhu68 vector, which were referred to as the chicken BA promoter and CMV IE enhancer (referred to as the CB7 promoter). Under the control of, human GRN is expressed from a transgene called hPGRN (SEQ ID NO: 3). An additional group was treated with an AAVhu68 vector carrying a different transgenic transgene sequence (hPGRN v2, SEQ ID NO: 4) expressed from the ubiquitin C promoter (UbC). Human progranulin levels in CSF were measured weekly and 35 days after infusion, animals were sacrificed for histopathological analysis. Preliminary safety analysis was performed, with daily cage observations, a series of physical examinations, total blood cell counts, serum chemistry panel, CSF chemistry and cytopathology, and a complete autopsy with microscopic evaluation of the brain and spinal cord. Was included. The following table summarizes the treatment groups.

Robust PGRN expression was detected in all NHP CSFs after vector administration (FIG. 7A). Two animals treated with the AAVhu68 vector showed human PGRN levels of CSF up to 10-fold higher than those of healthy human controls, similar to levels that reverse lysosomal abnormalities in the brains of GRN ^{− / −} mice. rice field. AAV5 treatment resulted in CSF expression levels approximately comparable to AAVhu68. Expression of human PGRN was maximal in animals treated with the AAV1 vector, reaching more than 40-fold higher than normal human levels. Samples of NHP-derived CSF and plasma treated with AAVhu68 and AAV1 vectors were tested for antibodies to human PGRN. All four animals express antibodies against the human-introduced gene product (FIGS. 8A-8C), which may explain the reduced expression levels at the end of the study. The initiation of the anti-human PGRN antibody response in CSF correlated with the expression level of the transgene and peaked early in the AAV1 group.

ICM delivery of AAV was well tolerated in all treatment groups. Daily observations, physical examinations, total blood cell counts, or serum chemistry panels did not reveal any treatment-related abnormalities. Similar to other ICM AAV studies utilizing heterologous transgenes (Hordeux J, et al. Mol Ther Methods Clin Dev. 2018; 10 (79-88), 7 of injections for all vector serotypes from CSF analysis. Asymptomatic lymphocyte increases beginning after ~ 21 days were revealed, reflecting the antibody response to the transgene product (FIGS. 8A-8C). CSF cell numbers decreased from peak levels, but for most animals It remained elevated at necropsy. Brain and spinal cord histopathology was assessed for the group treated with AAV1 and AAVhu68. Findings were made in a previous ICM AAV study (Hordeaux J, et al. Mol Ther Methods Clin). Dev.2018; 10: 79-88, Holdaux J, et al. Mol Ther
Methods Clin Dev. Similar to 2018; 10: 68-78), with minimal lymphocyte infiltration occasionally observed in the meninges and choroidal plexus, as well as sensory neurons and sensory neurons in some dorsal root ganglion (DRG) and spinal cord sections. With associated axonal degeneration. Similar to previous ICM AAV studies, sensory neuron findings were typically minimal to mild and had no clinical signs (Gurda BL, et al. Molecular therapy: the journal of the). American Society of Gene Therapy. 2016; 24 (2): 206-16, Hordeaux J, et al. Mol The Thehods Clin Dev. 2018; 10: 79-88, Holdeax J, et al. 10: 68-78). No vector-related abnormalities were observed in the brain parenchyma of any animal.

Different Patterns of CNS Transduction After ICM Administration of AAV1 and AAVhu68 Vectors to Non-Human Primates We found that the AAV1, AAV5, and AAVhu68 vectors showed significantly higher PGRN expression in the CSF of NHP treated with the AAV1 vector. We decided to further explore the differences in transduction patterns. A single ICM infusion of AAV1, AAV5, or AAVhu68 vector (3 × 10 ¹³ GC, n = 2 per vector) expressing the GFP reporter gene was administered to NHP. Animals were sacrificed 28 days after infusion due to histological analysis of brain transduction.

Immunohistochemistry revealed scattered patchy transductions throughout the brain of NHP treated with AAV1 and AAVhu68 vectors (not shown). Minimal transduction was significant in the brains of animals that received the AAV5 vector. To more accurately characterize the differences in transduction between AAV1 and AAVhu68, we have developed a semi-automated method for quantifying transduced cells in sections recovered from multiple brain regions. Neurons, oligodendrosites, respectively, by staining NeuN, olig2, and GFAP using sections stained with fluorescently labeled antibodies against GFP and markers of specific cell types, followed by quantification of each type of GFP-expressing cells. , And the total number of astrocytes was quantified (FIGS. 9 and 10). AAV1 and AAVhu68 each transduced less than 1 percent of each cell type in all regions examined. Neuronal transduction was similar between the two vectors, but AAVhu68 appeared to transduce slightly more astrocytes and oligodendrocytes.

Given the dramatically higher CSF PGRN levels achieved with AAV1, the near-equivalent brain transduction observed with the AAV1 and AAVhu68 vectors was unexpected. Ependymal cell transduction was assessed by immunohistochemistry in multiple regions of the lateral and fourth ventricles of animals treated with AAVhu68 and animals RA1826 treated with AAV1. Interestingly, multiple brain sections from AAV1 treated animals (RA1826) contained part of the ventricular system and showed extensive transduction of ependymal cells along the ventricles, which was treated with AAVhu68. Not observed in any of the animals (not shown). An average of 48% ependymal cells were transduced across all sampled regions, including the anterior, lateral and dorsal horns of the lateral ventricles and the fourth ventricle. In contrast, in the same brain region of animals fed the AAVhu68 vector, only 1-2% ependymal cells were transduced. Only a small segment of one lateral ventricle was evaluable in the second AAV1-treated animal, showing about 1% ependymal cell transduction, but analysis was limited to a small sampling area. These findings indicate that ependymal cells that are highly transduced in AAV1-treated animals have high levels of CSF, given that transduction of other cell types appears to be similar between the two serotypes. It suggests that it can be a source of PGRN. Due to the bystander effect mediated by secreted PGRN, FTD caused by GRN mutations is exceptionally suitable for AAV gene therapy. Because extracellular PGRN can be taken up by neurons, the high CSF PGRN levels achieved with the AAV1 vector (apparently mediated by robust ependymal cell transduction) allow AAV1 to be used for GRN gene therapy. It's an ideal choice.

Example 4: Recombinant AAV 1. PGRN
rAAV1. PGRN encodes 1) the AAV cis plasmid (referred to as pENN.AAV.CB7.CI.hPGRN.rBG.KanR) encoding the transgene cassette flanking the AAV ITR, and 2) the genes for AAV2 rep and AAV1 cap. It is produced by triple plasmid transfection of HEK293 cells with an AAV trans-plasmid (referred to as pAAV2 / 1.KanR) and 3) helper adenovirus plasmid (referred to as pAdΔF6.KanR). rAAV1. The size of the vector genome packaged in PGRN is 4129 bases.

A. Sequence element of AAV vector genome plasmid See FIG. 2 for a linear map of the vector genome from the cis plasmid (referred to as pENN.AAV.CB7.CI.hPGRN.rBG.KanR (p4862)).

The cis plasmid contains the following vector genomic sequence elements:
1. 1. Inverted end repeats (ITRs): ITRs are identical inverse complementary sequences, and AAV2 (130 base pairs [bp], GenBank: NC_001401) flanks all elements of the vector genome. The ITR sequence serves as both the origin of replication of the vector DNA and the packaging signal of the vector genome when the AAV and adenovirus helper functions are provided by trans. Therefore, the ITR sequence represents only the cis sequence required for the replication and packaging of the vector genome.
2. 2. Human Cytomegalovirus Early Enhancer (CMV IE): This enhancer sequence increases the expression of human-derived CMV (382bp, GenBank: K03104.1) downstream transfer genes.
3. 3. Chicken β-actin promoter (BA): This ubiquitous promoter (282bp, GenBank: X00182.1) was selected to drive expression of the transgene in any CNS cell type.
4. Chimeric Intron (CI): The hybrid intron contains elements of chicken β-actin splice donor (973bp, GenBank: X00182.1) and rabbit β-globin splice acceptor. The intron is transcribed, but is removed from the mature messenger RNA (mRNA) by splicing along with the sequences at either end of it. The presence of introns in the expression cassette has been shown to promote mRNA transport from the nucleus to the cytoplasm, thereby increasing the accumulation of certain levels of mRNA for translation. This is a common feature in gene vectors intended to increase gene expression levels.
5. Code sequence: Manipulation of the human GRN gene The cDNA encodes the human PGRN (hPGRN) protein and is involved in lysosomal function and other nervous system roles (1785bp, GenBank: NM_002087.3, 593 amino acids [aa], GenBank: NP_002078).
6. Rabbit β-globin polyadenylation signal (rBG PolyA): The rBG PolyA signal (127bp, GenBank: V0088.21) promotes efficient polyadenylation of transgene mRNA in cis. This element serves as a signal for transcription termination, specific cleavage events at the 3'end of the nascent transcript, and the addition of long polyadenyl chains.

B. AAV1 transplasmid: pAAV2 / 1. KanR (p0069)
The AAV2 / 1 transplasmid is pAAV2 / 1. It is KanR (p0069). pAAV2 / 1. The KanR plasmid has a chain length of 8113 bp and encodes four wild-type AAV2 replicase (Rep) proteins required for replication and packaging of the AAV vector genome. pAAV2 / 1. KanR also encodes three wild-type AAV1 virion protein capsid (Cap) proteins and is assembled into an AAV serotype 1 (AAV1) virion shell to contain the AAV vector genome. pAAV2 / 1. The AAV1 cap gene contained in KanR was isolated from a monkey source.

pAAV2 / 1. Incorporating a 3.0 kilobase (kb) fragment from p5E18 (2/2), a 2.3 kb fragment from pAV1H, and a 1.7 kb fragment from p5E18 (2/2) to make a KanR construct. , PAAV2 / 1 (p0001), which contains AAV2 rep and AAV1 cap in an ampicillin resistant (AmpR) cassette (referred to in the literature as p5E18 [2/1]). In this cloning strategy, AA
The V p5 promoter (which normally drives rep expression) is transferred from the 5'end of the rep to the 3'end of the cap, leaving a truncated p5 promoter upstream of the rep. This truncated promoter plays a role in downregulating rep expression and, as a result, maximizing vector production (Xiao et al., (1999) Gene therapy vectors.
Based on adeno-associated virus type 1. J Vilol. 73 (5): 3994-4003).

PAAV2 / 1 for the manufacture of clinical products. To generate KanR, the ampicillin resistance (AmpR) gene in the skeletal sequence of pAAV2 / 1 was replaced with the kanamycin resistance (KanR) gene. All components of the transplasmid were validated by direct sequencing.

C. Adenovirus helper plasmid: pAdDeltaF6 (KanR)
The plasmid pAdDeltaF6 (KanR) was prepared by Jame M. et al., University of Pennsylvania. Built in the laboratory of Dr. Wilson and colleagues, it is 15,774 bp in size. This plasmid contains regions of the adenovirus genome that are important for AAV replication, namely E2A, E4, and VA RNA (the function of adenovirus E1 is provided by HEK293 cells). However, this plasmid does not contain replication genes or structural genes of other adenoviruses. The plasmid does not contain cis elements important for replication, such as adenovirus ITR, and therefore infectious adenovirus is not expected to be produced. The plasmid was derived from an E1, E3 deleted molecular clone of Ad5 (pBHG10, pBR322-based plasmid). Deletions were introduced into Ad5 to eliminate unwanted adenovirus gene expression and reduce the amount of adenovirus DNA (from 32 kb to 12 kb). Finally, the ampicillin resistance gene was replaced with the kanamycin resistance gene to prepare pAdeltaF6 (KanR). The E2, E4, and VAI adenovirus genes remaining on this plasmid, along with E1 present in HEK293 cells, are required for AAV vector production. Vectors are generated according to the following flowcharts shown in FIGS. 13 and 14.

The final product is determined by pH in the range 6.2-7.7 determined by USP <791>, osmolality of 260-320 mOsm / kg determined by USP <785>, and by ddPCR. It is necessary to have a GC titer of 5 × 10 ¹³ GC / mL or more (Lock et al, (2014). Hum Gene Ther Methods. 25 (2): 115-25.

Example 5: rAAV1 in GRN ^{− / −} mice. Identification of the minimum effective dose of PGRN

Different doses of rAAV1 for CNS lesions in the Grn ^{− / −} mouse model. The effect of PGRN is evaluated as follows. Efficacy is assessed by the degree of reduction in brain accumulation pathology (lipofuscin), which serves as a quantitative outcome measure directly related to pathophysiology. In addition, total blood cell counts and final blood draws for the serum chemistry panel, as well as histopathology of the target organ, are included to identify disease-specific toxicity that may not be detected by the NHP toxicity test. Mice are treated at 5-6 months of age in the presence of extensive lipofuscin accumulation to reproduce the disease state in older subjects with GRN haploinsufficiency. Grn ^{− / −} mice were administered a 4-dose rAAV1 by ICV infusion. Of PGRN (1.30x10 ¹¹ GC, 4.40x10 ¹⁰ GC, 1.30x10 ¹⁰ GC, or 4.40x10 ⁹ GC) or vehicle (ITFFB [artificial CSF containing 0.001% Pluronic F-68]). Receive one (N = 15 per group). Grn ^+/+ mice treated with vehicle (N = 15) serve as normal controls. 90 days after treatment, the animal is sacrificed, the brain is harvested, sectioned and lipofuscin lesions are quantified. MED was determined by a dose that showed a significant reduction in brain accumulation lesions compared to vehicle-treated Grn ^{− / −} mice. Significance is determined using one-way ANOVA followed by Tukey's multiple comparison test (α = 0.05), if applicable.

Example 6: Toxicity test in non-human primates rAAV1. CB7. CI. hPGRN. rBG is a non-replicating recombinant adeno-associated (AAV) vector consisting of serotype AAV1 which is an engineered human progranulin (PGRN) cDNA under the control of a chicken beta actin promoter with a cytomegalovirus enhancer. And a rabbit β-globin polyadenylation sequence flanking the AAV serotype 2 inverted terminal repeat, which was formulated in an intrathecal final formulation buffer (ITFFB). The ddPCR titer was 2.04 × 10 ¹³ GC / mL. The pH of ITFFB was adjusted to pH 7.4 to maximize the solubility of the test article product. Control articles were prepared on the day of administration. Diluted articles are kept on moist ice or at 2-8 ° C until dosing the same day.

RAAV1 after ICM administration. A 90-day GLP-compliant safety test was performed on adult rhesus monkeys to investigate the toxicity of PGRN. NHPs aged 3 to 10 years were used in this study to represent the intended adult human patient population. A 90-day evaluation period was selected to give sufficient time for the secreted transgene product to reach stable steady-state levels after AAV administration of ICM. Rhesus monkeys are at one of three dose levels, a total of 3.00 x 10 ¹² GC, a total of 1.00 x 10 ¹³ GC, or a total of 3.00 x 10 ¹³ GC (N = 3 per dose). rAAV1. Received hPGRN or vehicle (ITFFB, N = 2). Dose levels were selected to be comparable to those evaluated in the planned minimum effective dose (MED) study when scaled by brain mass (assuming 0.4 g in mice and 90 g in rhesus monkeys). .. Baseline neurological examination, clinical pathology (cell count with differentiation, clinical chemistry, and coagulation panel), CSF chemistry, and CSF cytology were performed. rAAV1. After administration of PGRN or vehicle, animals were monitored daily for signs of distress and abnormal behavior.

Blood and CSF clinical pathological assessments and neurological examinations are available in rAAV1. It was performed weekly for 30 days after administration of PGRN or vehicle, and every 30 days thereafter. At baseline and every 30 days thereafter, anti-AAV1 neutralizing antibody (Nab), as well as AAV1 and rAAV1. The response of cytotoxic T lymphocytes (CTL) to the PGRN-introduced gene product was evaluated by the interferon gamma (IFN-γ) enzyme-bound immune spot (ELISpot) assay.

rAAV1. 90 days after administration of PGRN or vehicle, animals were euthanized, tissues were harvested and a comprehensive microscopic histopathological examination was performed. In addition, lymphocytes are harvested from the liver, spleen, and bone marrow to assess the presence of T cells that respond to both capsids and transgene products within these organs at necropsy.

The biodistribution of the vector is assessed by qPCR in the tissue sample. Also, the vector genome is quantified in serum and CSF samples. Vector excretion was assessed by analysis of the vector genome detected in urine and feces. In previous studies, the pattern of vector distribution after ICM administration was dose-independent, and the higher the vector dose, the greater the overall signal in the qPCR-based biodistribution assay, and the vector deposition in the target tissue. It was demonstrated that the sensitivity was the highest in the detection of. Therefore, these analyzes were performed only on the highest dose cohort (Hordeux et al., 2018b).

Nerve conduction velocity assessment Animals were sedated with a ketamine / dexmedetomidine combination. The sedated animals were placed on the operating table in the recumbent or supine position and maintained at body temperature with a heat pack. Electronic warmers have not been recommended as they can interfere with the acquisition of electrical signals.

In the sensory nerve conduction test (NCS), the probe of the stimulator was placed on the median nerve so that the cathode was closest to the recording site, and the two needle electrodes were placed at the level of the terminal bone of the II finger (reference electrode). ) And at the level of the basal bone (recording electrode), while the ground electrode was placed proximal to the stimulating probe (cathode). A pediatric stimulator was used. The evoked response was incrementally amplified and displayed on the monitor. The initial acquisition stimulus intensity was set to 0.0 mA and the lack of background electrical signals was confirmed. To find the optimal stimulus position, the stimulus intensity was increased to 10.0 mA and the probe was moved along the median nerve to generate a series of stimuli until the optimal position determined by the definitive waveform was found. While keeping the probe in the optimal position, the stimulus intensity was gradually increased until the peak amplitude response did not increase. Each stimulus response was recorded and stored in software. Up to 10 maximal stimuli were averaged and reported on the median nerve. The distance (cm) from the recording site to the stimulating cathode was measured, input into the software, and the conduction velocity was calculated using the rising latency and distance (cm) of the response. Both conduction velocity and mean mean sensory nerve action potential (SNAP) amplitude were reported. Bilateral median nerves were tested. All raw data generated by the instrument was retained as part of the study material.

11A and 11B show the results of the median sensory nerve conduction study at NHP. No effect on median sensory nerve conduction was observed at the dose administered. Preliminary histological analysis primarily showed findings in the dorsal white matter tract of the DRG, TRG, spinal cord and peripheral nerves (FIGS. 12A-12D). These findings consisted of neuronal degeneration within the DRG / TRG and axonal degeneration within the dorsal white matter tract of the spinal cord and peripheral nerves (ie, axonal disorders). Overall, these findings were observed across all treatment groups, but at both time points tended to be higher in incidence and severity in individual animals in the medium and high dose groups. ..

Considering the severity of GRN-related neurodegenerative diseases, rAAV1. It is expected that the benefit / risk characteristics of ICM administration of PGRN will remain favorable.

Example 7: Human study rAAV1 in a patient with adult-onset neurodegenerative disease caused by a mutation in the GRN gene. A single-dose human initial (FIH) Phase 1/2 dose escalation study of hPGRN is performed (see table below). rAAV1. hPGRN is designed to replace the GRN gene. This FIH test evaluates safety and tolerability and collects preliminary data on efficacy. Up to 12 symptomatic heterozygous GRN mutation-carrying patients were treated with rAAV1. Treat with hPGRN, first follow up for a period of 2 years (24 months), and continue long-term follow-up for 5 years after dosing. This study provides data supporting the start of the enrollment study and utilizes the Phase 1/2 Maximum Tolerated Dose (MTD). This enrollment study was conducted on rAAV1 for disease-related clinical outcomes and biomarkers. Evaluate the effect of hPGRN. All studies included a single ICM dose of rAAV1 in adult patients with GRN-related neurodegenerative disease. Includes administration of hPGRN.

Route of administration and treatment rAAV1. hPGRN is administered to the subject as a single dose on day 1 via CT-guided occipital infusion into the cisterna magna. On day 1, rAAV1 with an appropriate titer of 5.6 mL. A syringe containing hPGRN is prepared by the investigational drug department (Investigative Pharmacy) associated with the study and delivered to the treatment room.

Prior to administration of the investigational drug, the subject is anesthetized, intubated, and using sterile techniques, the injection site is prepared and covered. Perform LP to remove a given volume of CSF and then
Iodine contrast is injected intrathecally (IT) to aid in visualization of the associated anatomy of the cisterna magna. Intravenous (IV) contrast agents can be administered as an alternative to IT contrast agents before or during needle puncture. The decision to use IV or IT contrast media is left to the discretion of the intervening physician. Under fluoroscopy guide, advance the spinal cord needle (22-25G) into the cisterna magna. Larger guide needles may be used to assist in needle placement. After confirming the needle placement, the extension set is attached to the spinal needle and filled with CSF. At the discretion of the intervening physician, a syringe containing the contrast agent may be connected to the extension set, and a small injection can confirm that the needle is located in the cisterna magna. After confirming the arrangement of the needles, rAAV1. Connect the syringe containing hPGRN to the extension set. Syringe contents are slowly infused over 1-2 minutes to deliver a volume of 5.0 mL.

Collection of adverse events (AEs), physical / neurological tests, vital signs, clinical tests (serum chemistry, hematology, coagulation, LFT, urinalysis), ECG, nerve conduction tests, and CSF cytology and chemistry tests ( Safety assessments including cell count, protein, sera) will be performed at the time indicated in the study schedule.

No statistical comparisons are planned for safety assessment. All results are for explanation only. Enumerate the data and create a summary table.

Perform statistical comparisons for secondary and exploratory endpoints. Measurements at each time point are compared to baseline values for each subject and, if available for each endpoint, natural history data from healthy volunteers and GRN patients with comparable cohort characteristics. All data are shown in the target data list. Category variables are summarized using frequency and percentage, and continuous variables are summarized using descriptive statistics (number of missed observations, mean, standard deviation, median, minimum, and maximum). To. The graph display is presented appropriately.

The initial clinical manifestations of adult-onset neurodegeneration caused by GRN haploinsufficiency are heterogeneous. This heterogeneity leads to various diagnoses with additional symptoms that appear as the disease progresses. Patients with a diagnosis of any of the neurodegenerative diseases can be treated as long as they have a confirmed pathogenic heterojunction GRN mutation, as the number of patients typically declines rapidly after the onset of symptoms. Patients may be screened using the CDR-FTLD global score. This rating scale is designed to assess the severity of the disease in patients with FTLD spectral diagnosis. Overlapping with other GRN-related diagnoses of FTLD-related symptoms, and captured by the CDR-FTLD global score (memory, orientation, judgment and problem-solving, social adaptation, family and hobbies, care status, behavior, and language) Depending on the number of domains, this measure can be used for diagnosis. Symptomatic early stages of neurodegenerative disease, where the benefit of gene therapy is likely to be maximized if the CDR-FTLD global score is greater than 0.5 (including patients with mild symptoms) and 1 or less. It will be possible to treat the patient. Treating the patient at this early stage allows detection of subsequent changes or stabilization of disease progression and delayed onset of additional symptoms. However, in this population, the requirement for a CDR-FTLD global score of at least 0.5 excludes entry into exercise-specific diagnostics because the scale is not optimized to capture motor phenotypic disorders. ..

This gene therapy is not expected to result in expression of PGRN above physiological levels. RAAV1 in nonclinical NHP studies. Using the dose of hPGRN (higher than the dose used in the FIH study), rAAV1. After ICM administration of hPGRN, it was found that PGRN was expressed in serum at near normal levels. Subjects enrolled in the FIH study initially had circulating PGRN levels of approximately 30% of normal, so it is expected that circulating serum PGRN levels may recover to normal. The patient's blood test is a complete blood count (CB)
C) Screened through a panel, patients will be monitored for tumors at 5 year follow-up via MRI with gadolinium contrast in the brain and upper spine.

In addition to measuring safety and tolerability as primary endpoints, secondary and exploratory efficacy endpoints are top-notch based on recent literature and specializing in the study of GRN-related neurodegenerative diseases. Selected for this study in consultation with the clinician. These endpoints follow clinical outcomes and disease biomarkers with the aim of identifying suitable endpoints for subsequent enrollment trials.

Since the neurodegeneration caused by the GRN mutation ultimately leads to death, rAAV1. The effect of hPGRN on patient survival is also the efficacy endpoint of this study. However, study duration and sample size may not be sufficient to demonstrate survival benefits, as most patients have an average lifespan of 7-11 years from onset of symptoms.

RAAV1 for clinical symptoms and daily function of the patient. Evaluate the effect of hPGRN. Due to the heterogeneity of phenotypes exhibited by the target patient population, functional and clinical measures are used to capture the progression of symptoms manifested over a range of clinical symptoms. The proposed study utilizes FAB, FRS, MMSE, CGI-C, NPI, and FBI to measure changes over time. These measures primarily measure cognitive, verbal, neuropsychological behavior, and ability associated with day-to-day functions that provide information on the progression or stabilization of various clinical manifestations of the disease. UPDRS is also included to capture changes in motor symptoms. In FIH, these efficacy assessments are exploratory in nature and stabilize the reduction of symptoms rAAV. It is intended to capture the capabilities of hPGRN over time. Data from FIH on the rate of further decline across different clinical parameters in patients with different clinical manifestations further informs the selection of appropriate endpoints and defines clinically meaningful changes in enrollment trials. Used for.

Each clinical scale is briefly described below.
CDR-FTLD, a clinical scale that primarily measures cognitive function: CDR-FTLD is an extended version of the classic clinical dementia assessment (CDR) scale historically used to assess the severity of AD spectral disorders. Is. This assessment includes the six original domains of CDR (memory, orientation, judgment and problem-solving, social adaptation, family and hobbies, and long-term care). It also contains two additional domains of language and behavior that allow the detection of diminished FTLD spectrum patients with higher sensitivity. A rating score of 0 indicates normal behavior or language, and a score of 1, 2, or 3 indicates mild to severe disability. The CDR-FTLD endpoint total (CDR-FTLD sb) represents the total of the individual domains and is used to determine the overall severity of dementia.

MMSE: The MMSE is an 11-question overall cognitive assessment that is widely used in clinical and research practice. As a question, for example, "What year is this year? When is the season? What day? What day of the week? What month?", One point is given for each correct answer, and the question is asked. The highest score is given for each. The upper limit of the total score is 30 points, and there are two cutoffs, 24 points and 27 points. These cutoffs are indicators of cognitive decline.

Verbal fluency test: Although not one of the proposed exploratory efficacy endpoints, verbal fluency tests are performed throughout the FIH study. This may be done by presenting the same picture to each subject and asking for oral explanation. During the description, speech rate (words / minute) is counted, recorded, and finally compared to a rate that reflects a typical developing adult.

UPDRS: A clinical measure that primarily measures motor function. UPDRS is a four-part, 42-item assessment of several domains related to parkinsonism, such as mental state, behavior and mood, and activities in daily life. .. Each item includes a rating scale ranging from 0 (indicating no disability) to 4 (indicating the most severe disability). Scores for each part are aggregated to provide the severity of the disease, with a high score of 199 indicating the worst / most severe disability.

Clinical scales that primarily measure behavior NPI: NPI is used to elucidate the presence of psychopathology in patients with brain disorders. Initially developed for use in AD populations, it is believed to be useful in assessing behavioral changes in other conditions. This assessment consists of 10 behavioral domains and 2 autonomic areas, including 4 scores: frequency, severity, overall burden, and caregiver burden. The total NPI score is obtained by adding the domain score of the behavioral domain and subtracting the caregiver-paid score.

FBI: The FBI is a 24-item assessment of behavioral and personality changes specifically associated with bvFTD, distinguishing between bvFTD and other dementias. This is performed as a face-to-face interview with the primary nurse, as patients diagnosed with bvFTD are generally unaware of these types of changes. Each question is graded from 0 (none) to 3 (severe / most often), focusing on several areas related to behavior and personality. The total score typically correlates with the severity of the disease and can be used to assess changes over time.

A clinical scale that measures both cognitive and motor function CGI-C: CGI-C is one of three concise and widely used assessments. It consists of three items and is evaluated by the clinician. CGI-C is rated on a 7-point scale, ranging from 1 (very improved) to 7 (very worse), starting with enrollment in the study, whether or not the improvement is entirely therapeutic. Will be done.

FAB: FAB is a simplified assessment to aid in the distinction between frontal lobe executive dysfunction phenotypic dementia and AD dementia. This is particularly useful in patients with mild dementia (MMSE> 24). This assessment consists of six parts and addresses the areas of cognition, movement, and behavior. A total score of 18, or a higher score indicates better performance.

FDR: FDR is a simplified staging assessment for patients diagnosed with frontotemporal dementia (FTD) abtype (ie, either bvFTD or PPA subtype). FDR detects differences in FTD disease progression over time. This brief interview is conducted with the primary caregiver and consists of 30 items, classified as "not happening", "occasionally happening", or "always happening". The percentage score is then calculated and converted into a logit score and finally a severity score. Severity scores range from "very mild" to "most severe."

Columbia Suicide Severity Rating Scale (C-SSRS): The C-SSRS score is not an exploratory efficacy endpoint for FIH, but this assessment is carried out throughout the study. C-SSRS is a three-part scale that measures suicidal ideation, intensity of thought, and suicidal behavior. The result of this assessment consists of a suicidal ideation rate assessment, a suicidal ideation score, and a suicidal ideation intensity assessment obtained directly from the scale. A thought score above 0 may indicate the need for intervention, based on evaluation guidelines. The intensity rating ranges from 0 to 25, where 0 represents no support for suicidal ideation.

Patient survival is assessed as an additional exploratory endpoint. However, patients diagnosed with neurodegeneration due to GRN haploinsufficiency have a life expectancy of 7 to 11 years from the onset of symptoms. Therefore, study duration, sample size, and inclusion of subjects in the early stages of the disease may not be sufficient to demonstrate survival benefits.

rAAV1. Administration of hPGRN stabilizes atrophy (loss of nerve cells), primarily in the cortex of the frontal and temporal lobes, caused by GRN-related haploinsufficiency, and the overall brain volume over time. MRI can be used to track changes in thickness of the medial prefrontal cortex and parietal region.

Biochemical biomarkers are also evaluated. Levels of PGRN protein in CSF and plasma are measured as readouts of AAV transduction, rAAV1. Increased in patients after administration of hPGRN. CSF levels of nerve filament light chain (NFL), tau, phosphorylated tau, and other inflammatory markers are also tracked. The NFL is considered a general indicator of nerve cell loss or damage. Tau and phosphorylated tau are associated with the pathology found in AD, PD, and some forms of FTD.

Patient blood tests are screened through a complete blood count (CBC) panel, and patients are monitored for tumors at 5-year follow-up via MRI with gadolinium contrast in the brain and upper spine. ..

rAAV1. A single dose of hPGRN is safe and tolerable after administration. rAAV1. A single dose of hPGRN improves survival and / or reduces disease progression, as assessed by clinical symptoms and patient routine function. Treatment delays the loss of neurocognitive function.

(Arrangement table free text)
The following information is provided for arrays containing free text under the numeric identifier <223>.

All documents cited herein are incorporated herein by reference. US Provisional Patent Application No. 62 / 809,329 filed February 22, 2019, US Provisional Patent Application No. 62/923,812 filed October 21, 2019, and February 2, 2020. US Provisional Patent Application Nos. 62 / 969,108, filed on the same day, are incorporated by reference in their entirety, along with their sequence listings. Similarly, the sequence listings submitted with this specification under the name "18-8663PCT_ST25.txt", as well as the sequences and texts therein, are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such amendments are intended to be within the claims of the attachment.

Claims (36)

Recombinant AAV (rAAV)
(A) AAV capsid derived from adeno-associated virus 1 and
(B) A vector genome packaged in the AAV capsid comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin, and a regulatory sequence indicating the expression of the progranulin. With a vector genome, including rAAV. The rAAV of claim 1, wherein the coding sequence encodes the human progranulin protein of SEQ ID NO: 1. The rAAV according to claim 1 or 2, wherein the coding sequence of the progranulin is SEQ ID NO: 3, or at least 95% to 99.9% identical to the sequence. The rAAV according to any one of claims 1 to 3, wherein the vector genome contains a promoter, an enhancer, an intron, a coding sequence of human progranulin, and a polyadenylation signal. The rAAV according to any one of claims 1 to 4, wherein the intron comprises a chicken beta actin splice donor and a rabbit β splice acceptor element. The AAV inverted terminal repeats (ITRs) are AAV25'ITR and AAV2 3'ITR, which are adjacent to the coding and regulatory sequences of the progranulin, any one of claims 1-5. The rAAV described in. The vector genome comprises (a) the EF-1a promoter and the SV40 late poly A, (b) the UbC promoter, the intron, and the SV40 late poly A, or (c) the CB7 promoter, the chimeric intron, and the rabbit globin poly A. The rAAV according to any one of claims 1 to 6. The rAAV of claim 7, wherein the vector genome comprises the sequence of SEQ ID NO: 24. A pharmaceutical composition comprising an aqueous liquid suitable for intrathecal administration and recombinant AAV (rAAV) suitable for use in the treatment of neurodegenerative diseases caused by GRN-haploinsufficiency, wherein the rAAV comprises.
(A) AAV capsid derived from adeno-associated virus 1 and
(B) A vector genome packaged in the AAV capsid, comprising an AAV inverted terminal repeat (ITR), a coding sequence for human progranulin, and a regulatory sequence indicating the expression of the progranulin. A pharmaceutical composition comprising a vector genome. The composition according to claim 9, wherein the coding sequence encodes the human progranulin protein of SEQ ID NO: 1. The composition according to claim 9 or 10, wherein the coding sequence of the progranulin is a sequence that is at least 95% to 99.9% identical to at least amino acids 18 to 593 of SEQ ID NO: 3 or SEQ ID NO: 3. .. The composition according to any one of claims 9 to 11, wherein the vector genome comprises a promoter, an enhancer, an intron, the coding sequence of the human progranulin, and a polyadenylation signal. The composition according to any one of claims 9 to 12, wherein the intron comprises a chicken beta actin splice donor and a rabbit β splice acceptor element. AAV inverted terminal repeats (ITRs) are AAV25'ITR and AAV2 3'ITR, which are flanking the coding sequence of the progranulin and the regulatory sequence of the vector genome, claims 9-13. The composition according to any one. The vector genome comprises (a) the EF-1a promoter and the SV40 late poly A, (b) the UbC promoter, the intron, and the SV40 late poly A, or (c) the CB7 promoter, the chimeric intron, and the rabbit globin poly A. The composition according to any one of claims 9 to 14. 15. The rAAV of claim 15, wherein the vector genome comprises the sequence of SEQ ID NO: 24. The composition according to any one of claims 9 to 16, wherein the composition comprises an artificial cerebrospinal fluid containing a surfactant. 17. The composition of claim 17, wherein the surfactant is Pluronic F-68. The recombinant AAV (rAAV) according to any one of claims 1 to 8 or 9 to 18 for use in a method for treating a patient having adult-onset neurodegenerative disease caused by GRN-haploinsufficiency. The pharmaceutical composition according to any one of the above. The recombinant AAV (rAAV) or claims 9-18 of any one of claims 1-8 in the manufacture of a pharmaceutical product for treating a patient with adult-onset neurodegenerative disease caused by GRN-haploinsufficiency. Use of the pharmaceutical composition according to any one of the above. ^{19 .} use. The use according to claim 19 or 20, wherein the patient is a human adult and is administered a dose of 1.44 × 10 ¹³ to 4.33 × 10 ¹⁴ GC of the rAAV. The rAAV or composition evaluates the patient non-invasively for (a) reduction of retinal accumulation lesions as a predictor of reduction of brain lesions, and (b) evaluation of brain volume by magnetic resonance imaging. And / or (b) any one of claims 19-22, which can be administered in a regimen further comprising one or more of measuring the concentration of progranulin in the CSF. Use of. The use according to any one of claims 19 to 23, wherein the rAAV containing the coding sequence of the progranulin is delivered intrathecally via intraventricular delivery or via intraparenchymal delivery. .. 13. Use of. The use according to any one of claims 19-25, wherein the patient has progranulin-frontotemporal dementia. A method of treating human patients with adult-onset neurological degeneration caused by granulin (GRN) haplo deficiency, in which recombinant adeno-associated virus (rAAV) with an AAV capsid of adeno-associated virus 1 (AAV1) is used in the central nervous system. Containing delivery to the system (CNS), the rAAV further comprises a vector genome packaged in the AAV capsid, wherein the vector genome contains AAV inverted terminal repeats, coding sequences for human progranulin, and. A method comprising a regulatory sequence indicating the expression of the progranulin. A method of treating human patients with adult-onset neurological degeneration caused by granulin (GRN) haplo deficiency, a recombinant adeno-associated virus having an AAV capsid of adeno-associated virus 1 (AAV1) that targets coat cells (AAV1). rAAV) comprising administration to the central nervous system (CNS), wherein the rAAV further comprises a vector genome packaged in the AAV capsid, wherein the vector genome is an AAV inverted terminal repeat, human program. A method comprising a coding sequence of phosphorus and a regulatory sequence that directs expression of said progranulin in said coat cells. A method for treating human patients with brain lesions associated with adult-onset neurological degeneration caused by granular haplodeficiency, a recombinant adeno-associated virus (rAAV) with an AAV capsid of adeno-associated virus 1 (AAV1). ) To the central nervous system, wherein the rAAV further comprises a vector genome packaged in the AAV capsid, wherein the vector genome is an AAV inverted terminal repeat, coding sequence of human progranulin. , And a regulatory sequence that directs the expression of said progranulin. One of claims 27 to 29, wherein the patient is administered the rAAV according to any one of claims 1 to 8 or the pharmaceutical composition according to any one of claims 9 to 18. The method described in. One of claims 27-30, wherein the patient is administered a dose of 1 × 10 ¹⁰ GC / g brain mass to 3.33 × 10 ¹¹ GC / g brain mass of the rAAV intrathecally. The method described in. The method of any one of claims 27-30, wherein the patient is a human adult and is administered a dose of 1.44 × 10 ¹³ to 4.33 × 10 ¹⁴ GC of the rAAV. (A) Non-invasive evaluation of the patient for reduction of retinal accumulation lesions as predictors of reduction of brain lesions, (b) Evaluation of brain volume by magnetic resonance imaging, and / or ( c) The method of any one of claims 27-32, further comprising one or more of measuring the concentration of progranulin in the CSF. The method of any one of claims 27-33, wherein the rAAV comprising the coding sequence of the progranulin is delivered intrathecally via intraventricular delivery or via intraparenchymal delivery. .. 13. Method. The method of any one of claims 27-35, wherein said patient has progranulin-related frontotemporal dementia (FTD).

Images