JP2022086491A - Type iii collagen production promoter and antiaging cosmetic - Google Patents

Abstract

To provide a type III collagen production promoter that cause no skin irritation and is safe and can effectively promote the production of type III collagen, a component of collagen fibers, and to provide an anti-aging cosmetic that contains the type III collagen production promoter and shows a significant effect of improving wrinkles and sagging, the phenomena of skin aging.SOLUTION: A type III collagen production promoter comprises a composition containing isostearyl ascorbyl phosphate, represented by the formula shown below, or a metal salt thereof and a hydrolyzed eggshell membrane component as water-soluble components.SELECTED DRAWING: None

Description

The present invention relates to a type III collagen production promoter using a predetermined ascorbic acid derivative and eggshell membrane component, and an anti-aging cosmetic containing the same.

The skin is constantly exposed to the outside world, and aging phenomena such as wrinkles, tarmi, dullness, and pigmentation occur with aging. In particular, changes in skin morphology such as wrinkles and tarmi are thought to be largely affected by collagen, which accounts for 90% or more of the dermis matrix.

The amount of dermal collagen decreases with age, and the decrease in collagen results in incomplete formation of the dermal structure, resulting in skin deterioration. In addition, the amount of collagen in so-called "photoaging skin" is also significantly reduced as compared with normal skin, and is considered to be one of the major causes of wrinkles and tarmi.

Among collagens, type III collagen is said to have a function of imparting flexibility, and the abundance of type III collagen in the dermis tissue of infants is extremely higher than that of adults, and with aging. It is known that it tends to decrease rapidly.

In addition, in the clinical symptom type IV of Ehlers-Danlos syndrome caused by the abnormal collagen fibrosis mechanism caused by the deficiency of collagen synthesis of type III, including the case caused by aging, wrinkles are conspicuous on the skin. It is also known to be confirmed.

By the way, retinolu and retinoic acid derivatives are used as active ingredients of agents for preventing morphological changes due to aging of the skin or cosmetics for preventing wrinkles, and they are known to have an action of promoting collagen production.

However, conventional anti-wrinkle cosmetics containing such an active ingredient have the disadvantages that they are highly irritating to the skin and that the active ingredient is a very unstable substance.

In addition to the above active ingredients, ascorbic acid is known as an active ingredient having a collagen production promoting effect, but this has insufficient skin permeability and is extremely unstable to heat and oxidation. Since it is easily inactivated or decomposed before or during use, sufficient physiological action may not always be obtained.

In order to enhance the permeability of ascorbic acid to the skin, a collagen production promoter comprising an ascorbic acid derivative composed of L-ascorbic acid-2-phosphate ester having an alkyl group having a branched phosphate ester portion or a salt thereof is known. (Patent Document 1).

In addition, a glucosided derivative (Patent Document 2) is also known for improving the instability of ascorbic acid.

On the other hand, eggshell membranes are known as an effective material for collagen production or wrinkle improvement.
The eggshell membrane is the inner membrane of the eggshell of birds such as chicken eggs, and is composed of two inner and outer layers. Protects against infection by sex.

The eggshell membrane has a network structure composed of tough fibrous proteins mainly composed of collagen, glucosamine, desmosine and hyaluronic acid, and these proteins are relatively stable to acids, alkalis and proteases. Insoluble in water.

In addition, a collagen production promoter containing egg cornea and collagen (Patent Document 3), a wrinkle improving composition (Patent Document 4) characterized by promoting the production of type III collagen containing a hydrolyzed egg cornea component, and the like. A beauty essence (Patent Document 5) is known.

Japanese Unexamined Patent Publication No. 2008-94750 Japanese Unexamined Patent Publication No. 03-139288 Japanese Unexamined Patent Publication No. 2012-153614 Japanese Unexamined Patent Publication No. 2018-188405 Japanese Unexamined Patent Publication No. 2019-137634

However, the ascorbic acid derivative described in Patent Documents 1 and 2 and the eggshell membrane described in Patent Document 3-5 are used alone, and at best, accidentally with general-purpose vitamin C. There was only a combination.

Therefore, there is no known type III collagen production promoter and anti-aging cosmetics that are sufficiently effective against the aging phenomenon of skin tissue due to aging.

Therefore, the subject of the present invention is an excellent type III collagen production promoter that is not irritating to the skin, is safe, and can effectively promote the production of the amount of type III collagen, which is a component of collagen fibers. The purpose is to create an anti-aging cosmetic that is formulated with this type III collagen production promoter and has a remarkable improving effect on wrinkles and sagging, which are skin aging phenomena due to aging.

The inventors of the present application have verified the synergistic effect of a component known to have a type III collagen production promoting effect, and as a result, a mixed composition containing isostearyl ascorvir phosphate or a metal salt thereof and a hydrolyzed eggshell membrane component. It was found that the product exerts an excellent synergistic effect of promoting the production of type III collagen, and the encapsulated preparation containing the mixed composition as a capsule shell constituent component and containing an oil-soluble component is more than the above-mentioned mixed composition. It was also found that it exerts an excellent effect. Furthermore, the present invention has been completed by finding an improvement effect on the aging phenomenon due to aging such as excellent wrinkles and sagging in the anti-aging cosmetic containing the mixed composition or the encapsulated preparation of the present invention.

That is, in order to solve the above-mentioned problems, the present invention comprises water-soluble isostearyl ascorvir phosphate or a metal salt thereof (isostearyl ascorvir phosphate metal salt) represented by the following formula (1) and a hydrolyzed eggshell membrane component. It was a type III collagen production promoter consisting of a composition contained as a sex component.

The type III collagen production promoter comprising the above composition has, as a water-soluble component, an isostearyl ascorvir phosphate ester represented by the formula of Chemical formula 1 or a metal salt thereof (isostearyl ascorvir phosphate ester metal salt) and a hydrolyzed eggshell. By blending the membrane components together, there is a synergistic effect that is more than the total when each component is blended alone, and there is a remarkable improvement in wrinkles and sagging, which is a skin aging phenomenon due to aging. It works.

The ratio of (isostearyl ascorbyl phosphate ester or a metal salt thereof) / hydrolyzed eggshell membrane component in the above composition is 1/1 to 1/1 by mass ratio so that such an expected synergistic effect is exhibited. It is preferably 8.

Further, since it has been found that the effect of the type III collagen production promoter is more excellent by adopting the dosage form of the nanometer-sized fine particle capsule formulation, the above composition is used as a constituent component of the fine particle capsule. A type III collagen production-promoting agent comprising a fine particle-encapsulated preparation in which an oil-soluble component is encapsulated in the fine particle capsule is preferable.

Further, by using the anti-aging cosmetic containing the type III collagen production promoter thus obtained as an active ingredient, the practicality of anti-aging property is enhanced, and the effect of improving wrinkles and sagging can be sufficiently obtained. ..

Since the type III collagen production promoter of the present invention comprises a composition containing isostearyl ascorbyl phosphate ester represented by the above formula 1 or a metal salt thereof and a hydrolyzed eggshell membrane component as a water-soluble component, the skin. It is an excellent type III collagen production promoter that is not irritating to collagen, is safe, and can effectively promote the production of the amount of type III collagen, which is a component of collagen fibers. The anti-aging cosmetic containing this type III collagen production promoter has an advantage that it exerts a remarkable improving effect on wrinkles and sagging, which is a skin aging phenomenon due to aging.

Chart showing the relative ratio of Example 1 and Comparative Examples 1 and 2 to the control of the type III collagen production promoting effect. Chart showing the relative ratio of Example 2-5 to the control of type III collagen production promoting effect

The embodiment of the type III collagen production promoter of the present invention has a composition in which an isostearyl ascorbyl phosphate ester represented by the above formula 1 or a metal salt thereof and a hydrolyzed eggshell membrane component are mixed as a water-soluble component. It consists of things.

Further, a fine particle encapsulation preparation containing this mixed composition as a capsule shell constituent component and containing an oil-soluble component is another embodiment, and an anti-anti-aging agent containing these type III collagen production promoters as an active ingredient. Aging cosmetics will also be described later as another embodiment.

The isostearyl ascorvir phosphate or a metal salt thereof (isostearyl ascorvir phosphate dimetal salt) used in the present invention is an L-ascorbic acid-2-phosphate ester having an alkyl group having a branched phosphoric acid ester moiety. It has moderate lipophilicity and is easily taken up into cells. At that time, it is rapidly decomposed into L-ascorbic acid and phospholipids by phosphatase, which is widely distributed in the body, and is excellent type III collagen in skin fibroblasts. Has a production promoting effect.

Specific examples of the isostearyl ascorbyl phosphate metal salt include isostearyl ascorvir phosphate disodium salt represented by the following formula (2), and other alkali metal salts may be potassium salts and the like. ..

The hydrolyzed eggshell membrane component used in the present invention is a hydrolyzed eggshell membrane or eggshell membrane-containing powder, which is converted into a peptide, oligopeptide, and optionally an amino acid by a solution containing an acid, an alkali, an alkaline organic solvent, and a proteolytic enzyme. It can be prepared by a known hydrolysis method that hydrolyzes, and because it is soluble in the aqueous and oil phases, it has a high affinity for the skin, has good adhesion to skin cells, and can be used alone to some extent. It shows the effect of promoting the production of type III collagen.

The hydrolyzed eggshell membrane component used in the present invention can be any hydrolyzed eggshell membrane component produced by any of the above methods. Further, the extract extracted from the hydrolyzed eggshell membrane with alcohol, an aqueous solvent or the like is often used as a powder form obtained by a drying means such as freeze-drying because of its usability and stability. For use, it can also be used as a liquid substance dissolved in a solvent such as water or butylene glycol. Further, commercially available hydrolyzed eggshell membrane components as described in Patent Documents 4 and 5 are well known.

Examples of the composition of the type III collagen production promoter of the present invention include 1 to 10% by mass of isostearyl ascorvir phosphate or a metal salt thereof (isostearyl ascorvir phosphate disodium salt) and hydrolyzed eggshell membrane components 1 to 10. A mixed composition can be prepared by mixing and stirring the mass% with an aqueous solvent such as an aqueous solution of glycerin, adding an oily component of 1 to 30% by weight as necessary, and dispersing and emulsifying with a homogenizer. ..

Furthermore, the obtained mixed composition is atomized using a general atomizing device such as a thin film swirling high-speed mixer or a high-pressure emulsifier to produce a nano-sized fine particle-encapsulated formulation having excellent skin permeability. can do.

In addition, the type III collagen production promoter of the present invention has a type III collagen production promoting function and is useful as a type III collagen production promoting agent, as demonstrated in the evaluation test of Examples described later.

The type III collagen production promoter according to the present invention is contained and used as an active ingredient in cosmetics, and is also used in cosmetics and other external preparations for skin to promote type III collagen production in skin fibroblasts. It has functions such as anti-aging effects such as the effect of improving wrinkles and sagging, which is a skin aging phenomenon due to aging caused by the type III collagen production promoting effect. Can be prepared.

When the type III collagen production promoter according to the present invention is blended in a required ratio to make an anti-aging cosmetic, one or more of the type III collagen production promoter may be blended, and the blending amount thereof is It is effective to make 0.05% by mass or more, for example, 0.05 to 80% by mass, preferably 0.5 to 50% by mass in the total amount of the anti-aging cosmetics, and the compounding efficiency is also good.

Incidentally, the constituents whose safety is well known have no problem in safety even if they are excessively blended, and can be blended as a cosmetic in a concentration that is irritating to the skin and does not lose its practicality.

In addition to the above essential ingredients, the anti-aging cosmetics of the present invention include various ingredients used in ordinary cosmetics, non-pharmaceutical products, pharmaceuticals, etc., such as oily ingredients, emulsifiers, moisturizers, thickeners, and medicinal ingredients. , Preservatives, pigments, powders, pH adjusters, ultraviolet absorbers, antioxidants, fragrances and the like can be appropriately blended.

Specific examples of the above-mentioned oily components include higher alcohols such as liquid paraffin, vaseline, microcrystalline wax, squalane, jojoba oil, beeswax, carnauba wax, lanolin, olive oil, palm oil, higher alcohols, fatty acids, and isostearyl alcohols. Examples thereof include esters and silicone oils.

Examples of the above emulsifier include nonionic surfactants such as polyoxyethylene alkyl ether, polyoxyethylene fatty acid ester, polyoxyethylene sorbitan fatty acid ester, sorbitan fatty acid ester, glycerin fatty acid ester, polyglycerin fatty acid ester, and polyoxyethylene hydrogenated castor oil. Examples thereof include an activator, an anionic surfactant such as stearoyl sodium lactate, an amphoteric surfactant such as soybean phospholipid, and a cationic surfactant such as alkyltrimethylammonium chloride.

Examples of the moisturizer include glycerin, sorbitol, xylitol, maltitol, propylene glycol, polyethylene glycol, 1,3-butylene glycol, 1,2-pentanediol and the like.

Examples of the thickener include carboxyvinyl polymers, (acrylitz / alkyl acrylate) crosspolymers, xanthan gum, methylcellulose, polyvinylpyrrolidone, gelatin, bentonite and other clay minerals.

Other medicinal ingredients include, for example, various vitamins and their derivatives, allantin, glycyrrhizic acid and its derivatives, antiseptic agents such as various animal and plant extracts, moisturizers, hair growth agents, hair growth agents, transdermal absorption promoters, and ultraviolet absorption. Examples thereof include agents, cell activators, anti-inflammatory agents, whitening agents, and antiseptic and antifungal agents.

The anti-aging cosmetic containing the type III collagen production-promoting agent of the present invention is particularly limited in terms of production, in addition to blending the above-mentioned mixed composition or encapsulated preparation as an active ingredient for promoting III collagen production. It can be prepared by a well-known cosmetic manufacturing method.

Further, the use of the type III collagen production promoter of the present invention is not limited by domestic and foreign laws and social circumstances, and can be applied to non-pharmaceutical products, external medicines, etc., and the dosage form of cosmetics depends on the purpose. For example, cream-like, milky-liquid, liquid, gel-like, ointment-like, pack-like, stick-like, powder-like and the like can be adopted.

[Example 1]
Isostearyl ascorbyl phosphate disodium salt (expressed by the formula of Chemical formula 2 above, the same applies hereinafter) 0.25% by mass, commercially available hydrolyzed eggshell membrane component (hydrolyzed eggshell membrane protein with alkali) 0. A type III collagen production promoter of Example 1 was obtained, which consisted of a composition obtained by mixing and stirring 1% by mass and 99.65% by mass of a mixed solution containing 20/1 (mass ratio) of glycerin / water.

[Comparative Examples 1 and 2]
Comparative Example 1 was obtained by mixing and stirring 0.25% by mass of isostearyl ascorbyl phosphate disodium salt and 99.75% by mass of a mixed solution of 20/1 (mass ratio) of glycerin / water.

In addition, 0.1% by mass of a commercially available hydrolyzed eggshell membrane component (protein of eggshell membrane hydrolyzed with alkali) and 99.9% by mass of a mixed solution containing 20/1 (mass ratio) of glycerin / water are mixed and stirred. Comparative Example 2 consisting of the above composition was obtained.

The following tests were conducted on Example 1 and Comparative Example 1-2 obtained as described above in order to examine the type III collagen-producing ability, and the results are shown in FIG.

<Evaluation test of synergistic effect of type III collagen production ability by fibroblasts of Example 1 and Comparative Example 1-2>
Fibroblasts were replaced with 0.5% FBS-containing DMEM by 96-well microplates using 5% fetal bovine serum (FBS) -containing DMEM. After culturing in a sample-containing medium for 72 hours, after culturing for 24 hours, total RNA was extracted using Nucleospin RNA Plus (Machery-Nagel GmbH & Co. KG).

Reverse transcription was performed on this total RNA using the Prime Script RT RCR Kit (manufactured by Takara Bio Inc.), and cDNA was synthesized. Using the obtained cDNA as a template, the expression levels of tropoelastin and GAPDH were measured by real-time PCR (7500 real-time PCR system, manufactured by Applied Biosystems) using the following primers and enzymes.

As a primer, Col3a1 (forward primer: TCCCCTGAGAATCTGTGTGAATC, reverse primer: TGAGTCGAATTTGGGQATGT) was used. SYBR Select Master Mix (manufactured by Applied Biosystems) was used for the PCR reaction, and the gene expression was analyzed by the comparative Ct method.

<Test results>
As is clear from the results shown in FIG. 1, Example 1, Comparative Examples 1 and 2 are compared with the case where the mixture of isostearyl ascorbyl phosphate disodium salt and the hydrolyzed eggshell membrane component is not added (control). Showed a clearly high type III collagen production promoting effect.

Further, the type III collagen production promoting effect of Example 1 is based on the sum of the promoting effects of Comparative Example 1 containing only isostearyl ascorbyl phosphate disodium salt and Comparative Example 2 containing only the hydrolyzed eggshell membrane component. Also showed a high effect.

From the above, it was clear that Example 1 in which the disodium isostearyl ascorbyl phosphate and the hydrolyzed eggshell membrane component were combined had a synergistic effect in the effect of promoting the production of type III collagen.

[Examples 2 and 3]
Isostearyl ascorbyl phosphate disodium salt 1.0% by mass, commercially available hydrolyzed eggshell membrane component (hydrolyzed eggshell membrane protein with alkali) 4.0% by mass, and glycerin / water 20/1 ( Mixing with 70.0% by mass of the mixed solution of (mass ratio), 25.0% by mass of isostearyl alcohol is added thereto, and the mixture is dispersed and emulsified by a homogenizer to form Type III of Example 2 consisting of the mixed composition A. A collagen production promoter was obtained.

Further, by atomizing Example 2 into fine particles with a thin film swirl type high-speed mixer, a type III collagen production promoter of Example 3 composed of the fine particle encapsulated preparation A was obtained.

As a result of measuring the particle size of the obtained Examples 2 and 3 using a laser diffraction / scattering type particle size distribution measuring device (manufactured by HORIBA: LA-950), the average particle size of Example 2 was 14.87 μm. The average particle size of Example 3 of the fine particle encapsulating preparation A was 228 nm.

[Examples 4 and 5]
Isostearyl ascorbyl phosphate disodium salt 1.0% by mass, commercially available hydrolyzed eggshell membrane component (hydrolyzed eggshell membrane protein with alkali) 8.0% by mass, and glycerin / water 10/1 ( A mixed solution of (mass ratio) (70.0% by mass) is mixed with 70.0% by mass, 22.0% by mass of isostearyl alcohol is added thereto, and the mixture is dispersed and emulsified by a homogenizer to form a mixed composition B, type III of Example 4. A collagen production promoter was obtained.

Further, Example 4 was atomized by a high-pressure emulsifier to obtain a type III collagen production promoter of Example 5 composed of the fine particle-encapsulated preparation B.

As a result of measuring the particle size of the obtained Examples 4 and 5 using a laser diffraction / scattering type particle size distribution measuring device (manufactured by HORIBA: LA-950), the average particle size of Example 4 was 8.77 μm. The average particle size of Example 5, which is the fine particle encapsulating preparation B, was 128 nm.

Examples 2-5 obtained as described above were tested as follows in order to examine the type III collagen-producing ability, and the results are shown in FIG.

<Evaluation of type III collagen production ability by fibroblasts of type III collagen production promoter (Example 2-5)>
The same test as in the type III collagen production ability synergistic effect evaluation test with respect to Example 1 and Comparative Example 1-2 was carried out, and the type III collagen production promoting effect was measured for Example 2-5.

<Test results>
As is clear from the results shown in FIG. 2, Example 2 (mixture composition A), Example 3 (fine particle encapsulated formulation A), Example 4 (mixture composition B), and Example 5 (fine particles). Example 2-5 showed a clearly higher type III collagen production promoting effect as compared with the case where the mixture of the encapsulated preparation B) was not added (control).

Further, the effect of promoting the production of type III collagen is higher in Example 3 (fine particle encapsulated preparation A) than in Example 2 (mixed composition A), and in the fine particle encapsulated preparation B than in the mixed composition B. From the high value, it was clarified that the encapsulation of fine particles improved the skin permeability and the effect of promoting the production of III collagen.

[Example 6-17, Comparative Example 3-5]
Cosmetic compositions (toners) (Examples 6 to 17) containing a type III collagen production promoter in the blending ratios (total 100% by weight) shown in Table 1 below, and isostearyl ascorbyl as a type III collagen production promoting component. Comparative Example 3 in which only the sodium phosphate 2 was blended, Comparative Example 4 in which only the hydrolyzed eggshell membrane component was blended, or Comparative Example 5 in which none of them was blended was prepared.

The following tests were performed on these Examples 6-17 and Comparative Example 3-5 to evaluate the anti-aging effect by humans.
<Evaluation test of anti-aging effect by humans>
A group of 20 subjects suffering from skin aging due to aging, and the cosmetics of Example 6-17 and Comparative Example 3-5 were applied daily for 3 months in the morning and at night, and the cumulative application effect was applied after 3 months. Was self-judged according to the following criteria, and the determination results were evaluated according to the following criteria, and the results are also shown in Table 1.

[evaluation]
⊚: Among the subjects, the ratio (effective rate) showing significant effect and effectiveness is 80% or more.
◯: The percentage (effective rate) of the subjects that showed significant efficacy and efficacy was 60% or more and less than 80%.
Δ: The percentage of subjects showing significant efficacy and efficacy (effective rate) is 40% or more and less than 60%.
×: The percentage of subjects showing significant efficacy and efficacy (effective rate) is less than 40%.
However, the criteria for determining effectiveness are as follows.
Significant effect: Wrinkles and tarmi have become almost inconspicuous.
Effective: Wrinkles and tarmi have become a little less noticeable.
Slightly effective: Wrinkles and tarmi have become slightly less noticeable.
Invalid: No change.

As is clear from the results shown in Table 1, the cosmetic (external skin preparation) containing the type III collagen production promoter of Example 6-17 as an active ingredient is useful, and is useful for skin fibroblasts III. It has an anti-aging effect due to the effect of promoting the production of type collagen and the effect of improving wrinkles and tarmi by enriching the amount of type III collagen, and it can be seen that it is useful as an anti-aging cosmetic.

Below, a typical prescription example of a cosmetic is shown as an example containing a predetermined type III collagen production promoter as an active ingredient. The numerical value at the right end of each line is the blending ratio (% by weight). The cosmetic according to the obtained prescription example is an anti-aging cosmetic that contains an active ingredient amount of a type III collagen production promoter and has an effect of improving wrinkles and tarmi.

[Prescription Example 1] (Gel cream)
Mixed Composition A 5.0
Glycerin 5.0
Ethanol 5.0
Sodium hydroxide 0.5
Carboxyvinyl polymer 0.8
Fragrance Appropriate amount Preservative Appropriate amount Purified water Residual

[Prescription example 2] (milky lotion)
Fine particle encapsulation formulation A 10.0
1,3-butylene glycol 10.0
Carboxyvinyl polymer 0.3
Squalene 5.0
Cetanol 0.6
L-Arginine 0.3
Fragrance Appropriate amount Preservative Appropriate amount Purified water Residual

[Prescription Example 3] (Cream)
Fine particle encapsulation product B 20.0
1,3-butylene glycol 10.0
Carboxyvinyl polymer 0.4
Squalene 5.0
Cetanol 3.0
Beeswax 3.0
L-Arginine 0.3
Fragrance Appropriate amount Preservative Appropriate amount Purified water Residual

[ Reference Example 1]
Isostearyl ascorbyl phosphate disodium salt (expressed by the formula of Chemical formula 2 above, the same applies hereinafter) 0.25% by mass, commercially available hydrolyzed eggshell membrane component (hydrolyzed eggshell membrane protein with alkali) 0. A type III collagen production promoter of Reference Example 1 was obtained, which consisted of a composition obtained by mixing and stirring 1% by mass and 99.65% by mass of a mixed solution containing 20/1 (mass ratio) of glycerin / water.

In order to investigate the type III collagen-producing ability of Reference Example 1 and Comparative Example 1-2 obtained as described above, the following tests were conducted, and the results are shown in FIG.

<Evaluation test of synergistic effect of type III collagen production ability by fibroblasts of Reference Example 1 and Comparative Example 1-2>
Fibroblasts were replaced with 0.5% FBS-containing DMEM by 96-well microplates using 5% fetal bovine serum (FBS) -containing DMEM. After culturing in a sample-containing medium for 72 hours, after culturing for 24 hours, total RNA was extracted using Nucleospin RNA Plus (Machery-Nagel GmbH & Co. KG).

<Test results>
As is clear from the results shown in FIG. 1, Reference Example 1, Comparative Examples 1 and 2 are compared with the case where the mixture of isostearyl ascorbyl phosphate disodium salt and the hydrolyzed eggshell membrane component is not added (control). Showed a clearly high type III collagen production promoting effect.

Further, the type III collagen production promoting effect of Reference Example 1 is based on the sum of the promoting effects of Comparative Example 1 containing only isostearyl ascorbyl phosphate disodium salt and Comparative Example 2 containing only the hydrolyzed eggshell membrane component. Also showed a high effect.

<Evaluation of type III collagen production ability by fibroblasts of type III collagen production promoter (Example 2-5)>
The same test as in the type III collagen production ability synergistic effect evaluation test with respect to Reference Example 1 and Comparative Example 1-2 was carried out, and the type III collagen production promoting effect was measured for Example 2-5.

Claims (4)

A type III collagen production promoter comprising a composition containing isostearyl ascorbyl phosphate ester represented by the following formula (1) or a metal salt thereof and a hydrolyzed eggshell membrane component as a water-soluble component.

The type III collagen production promoter according to claim 1, wherein the ratio of (isostearyl ascorbyl phosphate ester or a metal salt thereof) / hydrolyzed eggshell membrane component in the above composition is 1/1 to 1/8 by mass ratio. .. The type III collagen production-promoting agent according to claim 1 or 2, wherein the composition is a constituent component of a fine particle capsule, and the fine particle capsule contains an oil-soluble component. An anti-aging cosmetic containing the type III collagen production promoter according to any one of claims 1 to 3 as an active ingredient.

Images