JP2021514655A - Monoclonal antibody that specifically binds to human plasma membrane vesicle-related protein PV-1, and its production method and use - Google Patents

Abstract

The present invention is a monoclonal antibody or a derivative thereof that specifically binds to a human progenitor plasma membrane vesicle-related protein (Plasmalemma vector-associated protein, PLVAP, PV-1), and is an antibody light chain variable region and antibody heavy chain variable. The antigen complementarity determining regions CDR1, CDR2, and CDR3 of the antibody light chain variable region are amino acid sequences represented by SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19, respectively, and are antigen complementarity of the antibody heavy chain variable region. The sex determining regions CDR1, CDR2 and CDR3 expose antibodies or derivatives thereof, which are the amino acid sequences set forth in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, respectively. The present invention also discloses the process of producing a human-mouse chimeric antibody of the antibody and the amino acid sequences of the heavy chain variable region and the light chain variable region of the human-mouse chimeric antibody. The antibody or derivative thereof can be used as a component of a drug composition or prepared into an appropriate drug preparation, and may be administered alone, or with other drugs, for example, therapeutic means such as an anti-VEGF monoclonal antibody. It may be used in combination and is useful for the treatment of diseases associated with angiogenesis / permeation such as choroidal neovascularization fundus disease.

Description

The present invention belongs to the field of monoclonal antibodies in biotechnology. The present invention relates to a monoclonal antibody that specifically binds to a human plasma membrane vesicle-related protein (Plasmalemma vector-associated protein, that is, PLVAP, also abbreviated as PV-1), a coding sequence thereof, and a production method and use thereof.

In the body, the vascular system consisting of endothelial cells (EC) in the innermost layer of blood vessels inside each organ / tissue, pericytes surrounding the surroundings, and a substrate is mainly composed of the following two complementary substances. Acts.

1) It acts as a physical barrier by separating the blood circulating in the blood vessel wall from the tissue outside the blood vessel wall.

2) Permeability by mediating the exchange of oxygen, carbon dioxide, water and electrolytes with perivascular tissues, the transport of hormones / proteins or other nutrients and metabolites, the migration of inflammatory and immune cells, etc. Acts.

In tissues / organs where blood-tissue exchange and metabolism are active, for example, in areas such as endocrine glands, hepatic sinusoids, glomerulomas, bone marrow, spleen, gastrointestinal epithelium, brain and retinal choroid plexus. , The vascular endothelium is not necessarily completely connected (continuous) and is not surrounded by pericutaneous cells, but is intermittent (discontinuus) or sinusoid (Sinusoid) (Crivellato E, Nico Band Ribatti D, See 2007 Connection of endothelial cells to organogenesis, a modern leather of an old Aristoterian concept. J Anat 211: 415-427). On the surface or wall of the vascular endothelium in these areas, there are also many openings or pores, typically 60-80 nm in diameter, or caveolae, plasma membrane vesicles. It is also called.) There is a structure like this. These fine openings or holes are usually tens or hundreds or more, regularly assembled and arranged at regular intervals, and have a sieve plate or honeycomb shape in an electron microscope. Inside some openings or holes, there is a branch-like diaphragm structure with a thickness of about 6 to 7 nm (Bearer EL and Orci L.1985 J Cell Biol. 100: 418- , 428; Peters KR, Carley WW, Palade GE.985 J Cell Biol. 101: 2233-8; Lomardi T et al., 1986 J Cell Biol. 102: 1965-, 1970).

Material exchange and cell migration between blood vessels and tissues are generally 1) para-cellular migration through between vascular endothelial cells, and 2) via openings or cabeola in the vascular endothelium / vessel wall. There are two pathways: trans-endothelial migration, which passes or reverses from one side of the vessel wall to the other side of the vessel wall. Factors such as the presence or absence of pericytes surrounding the endothelial blood vessels, the tightness of connections between the endothelial blood vessels and the size of the gap, the presence or absence of openings in the walls of the endothelial blood vessels, and the presence of branched diaphragms within the openings. Affects the barrier structure and permeability of blood vessels, thereby controlling the efficiency and extent of vascular-tissue material exchange and cell migration. Among them, endothelial blood vessels, which are surrounded by pericytes, closely connected, and have no opening in the blood vessel wall, have the lowest permeability, and the efficiency of substance exchange and the degree of cell migration are also appropriate. The lowest to. Endothelial vessels that are not surrounded by pericytes, are intermittent, and have openings in the vessel wall (eg, the liver sinusoid region) are the most permeable, and the efficiency of substance exchange and the degree of cell migration are commensurate. highest. Also, perforated endothelial blood vessels that include a branched septum in the opening are generally less permeable than perforated endothelial blood vessels that do not contain a branched diaphragm in the opening.

Currently known, the only known substance that constitutes the diaphragm at the opening of the endothelial blood vessel or the caveolae diaphragm of the plasma membrane is the plasmalemma vesicle-associated protein. Is. PLVAP, also abbreviated as PV-1, is a glycoprotein specifically expressed in endothelial blood vessels, and its cDNA and the amino acid sequence of the protein encoded by it are obtained by cloning from rat lung tissue for the first time by Tan RV et al. And reported (Stan RV, Hitescu L, Jacobson BS, Parade GE: 1999 J Cell Biol. 145: 1189-9; Tan RV, Kubitza M, Parade GE. 1999 Proc Natl Acc 13 ). Subsequently, the human and mouse PLVAP / PV1 genes and their cDNA and coding amino acid sequences were also reported by Tan RV (Stan RV, Arden KC, Palade GE 2001 Genomics 72: 304-, 313; Santa RV. 2007 Endothelial stomatal. See fenestral diaphragms in normal vessels and angiogenesis. J Cell Mol Med. 621-, 643).

PV-1 is a single-transmembrane type II transmembrane protein (type-II transmembrane protein) having a molecular weight of about 55-60 kD. Rat and mouse PV-1 proteins have a total length of 438 amino acids (human PV-1 proteins have 442 amino acids), have a relatively short intracellular region (including 27 amino acids), and are N-terminal. The extracellular space located at the C-terminus is relatively long (containing 358 amino acids) and is exposed to the vascular cavity.

Under normal physiological conditions, the PV-1 gene is relatively highly expressed in some endocrine glands, such as the pituitary gland, adrenal gland, brain or retinal choroid plexus, and lung tissue. , The expression level is relatively low in any of the other tissues in the body (generally maintained only in the background expression) or not expressed (Hnasco R et al., 2002 J Endocrinel 1.75: 649-61). However, pathological changes associated with angiogenesis, such as tumors, oxygen deficiency / trauma and inflammation, significantly upregulate the expression of the PV-1 gene in these tissues (Madden SL et al., 2004 Am J. Pathol. 165: 601-, 608; Carson-Walter EB et al., 2005 Clin Cancer Res. 11: 7643-50; Liu Y et al., 2010 J Neuroncol. 99: 13-, 24; Moser AB et al., 2010 Curr Neurovasc Res. 7: 238-50).

Vascular Endothelial Growth Factor (VEGF) (Leung DW et al., 1989 Science 246: 1306-09) is a vascular permeability factor (vascular permeability factor, VPF) (VPF) (Keck 2 Also called 12), it is the most potent and most important substance that stimulates angiogenesis and permeability currently known (Carmeliet P et al., 1996 Nature 380: 435-438; Ferrara N et al., 1996 Nature 380: 439-412). .. VEGF / VPF is also the most important factor that induces the formation of the currently known plasma membrane pore structure of the vascular endothelium and upregulates the expression of the PV-1 gene (Roberts WG and Parade GE. 1995). J Cell Sci. 108: 2369-, 2379; Roberts WG and Parade GE. 1997 Cancer Res. 57: 765-772; Roberts WG et al. 1998 Am J Pathol. 153: 1239-48; Esser S et al., 1998 : 947-, 959; Stickland LA et al., 2005 J Pathol. 206: 466-, 475; Ionnido S et al. 2006 Proc Natl Acad Sci 103: 16770-16775).

Some other factors, such as tumor necrosis factor-α (TNF-α), interleukin-6 (Interleukin-6, IL-6), tumor-promoting factor holbol millistate acetate (Forbol myristate actate, PMA) and the like can also induce the formation of pores in the progenitor membrane of the endothelial and upregulate the expression of the PV-1 gene (Lombardi T et al. 1986 JCB 102: 1965-1970; Stan RV et al. 2004 Mol Biol Cell 15: 3615-, 3630; Strickland LA et al., 2005 J Pathol. 206: 466-, 475).

The first report of a study on the physiological function of PV-1 was published in Blood magazine in 2009 by Keuschnig J et al. (Keuschnig J et al., 2009 Blood. 114: 478-84. The prototype endotherial marker PAL. -E is a leukocyte tracing blood). PAL-E is actually an abbreviation for a single mouse-derived monoclonal antibody, the full name of which is Pathologyche Anatomie Endothelium (Schlingemann RO et al., 1985 Lab Invest. 52: 71-6), and the antigen recognized by it is It is mainly expressed specifically in blood vessels. Niemera H et al. Reported that the antigen recognized by the PAL-E monoclonal antibody was a human plasma membrane vesicle-related protein (PV-1) (Niemera H et al., 2005 Blood .; 106: 3405-3409). ). In human umbilical vein endothelial cells (HUVEC) activated with TNF-α by Keuschnig J et al., The PAL-E / PV-1 protein is significantly aggregated around the endothelial cell membrane, and the umbilical vein. Surrounding lymphocytes passing through venous endothelial cells, inclusion of PAL-E / PV-1 antibody can suppress paracellular migration of lymphocytes, umbilical vein in mouse models of acute peritonitis and pouchitis It was found that the number of mononuclear cells or lymphocytes in the peritoneum of mice was reduced by 85% after injection of an antibody with code number MECA-32 (Keuschnig J et al., 2009 Blood. 114: 478-84). ).

The importance of PLVAP / PV-1 in the formation of branch septa and vascular barrier / permeability in the pores of endothelial vessels has recently been clearly demonstrated in gene knockout mice. For example, by Stan RV et al. In 2012, Dev Cell. The journal reported that PV-1 gene knockout mice were unable to survive under C57BL / 6N background and a small number of embryos were able to survive to birth in a mixed genetic background. In PV-1 gene knockout mice, the pore membrane of the progenitor membrane of the vascular endothelium or the caveolae diaphragm cannot be formed, and the deletion of the diaphragm increases the permeability of endothelial cells, resulting in a large amount of protein extravascularly. Leakage leads to tissue edema, and the born animal dies of early-onset and severe non-inflammatory protein-losing enteritis (Stan RV et al., 2012 Dev Cell. 23: 1203-18).

Similarly, by Herrnberger L et al., In 2012, in Histochem Cell Biol, a homozygous (Plvap ^{− / −} ) embryo of a Plavap (PV-1) gene knockout mouse was found in the C57BL / 6N genetic background before birth. He died and was reported to have abnormalities such as subcutaneous edema, bleeding and vascular wall defects in the subcutaneous capillaries. It also appeared in ^{the heart of the Plavap − / −} embryo as a ventricular septal defect and a thinner ventricular wall. In a C57BL / 6N / FVB-N mixed genetic background, Plavap ^{− / −} embryos were able to develop to birth, but the mice born were only able to survive for at most 4 weeks (Herrnberger L et al., 2012 Histochem Cell Biol. 138). : 709-24).

Under normal conditions, there is a region within the body protected by a vascular-tissue barrier, such as the blood-brain barrier in the central nervous system, the blood-retinal barrier in the eye, and the endothelium. The blood vessel wall generally has no pores of the progenitor membrane and does not express the PV-1 / PAL-E antigen. However, some pathological conditions, such as ischemic stroke, spinal cord injury, experimental allergic cephalomyelitis (EAE) / multiple sclerosis (MS), In cases of primary or metastatic tumors of the brain, such as diabetic retinopathy, the vascular-tissue barrier structures in these areas are often disrupted, pores appear in the vascular wall of the endothelial, and Upregulation of PV-1 / PAL-E antigen expression is involved (Carson-Walter EB et al., 2005, Clin Cancer Res. 11: 7643-50; Shue EH et al., 2008 BMC Neurosci 9:29; Moser AB et al., 2010 Curr Neurovasc Res. 7: 238-508). For example, Shue EH et al. In a mouse model of acute cerebral ischemia due to cerebral artery embolization, PV-1 / PAL-E antigen is expressed in a small number of cerebrovascular vessels in the embolic region 48 hours after acute cerebral ischemia. It was found that the expression of PV-1 / PAL-E antigen in the cerebral blood vessels in the embolic region reached a peak value about 7 days after the onset of the disease (Shue EH et al. 2008 BMC Neurosci 9:29).

Similarly, Schlingemann RO et al. Eupregulated the expression of PV-1 / PAL-E antigens in the vascular wall of the retinal endothelium in diabetic retinopathy patients and diabetic mice Akimba with disrupted blood-retinal barrier structures, and It was found that the elevated expression level was positively correlated with the degree of disruption and permeability of the structure of the blood-retinal barrier (Schlingemann RO et al., 1999, Diabetic retinopathy. 42: 596-602; Wisniewska-Kruk J. Et al., 2014, Exp Eye Res. 122: 123-31). Inhibition of PV-1 gene expression in endothelial cells by lentivirus interfering RNA (siRNA) technology disrupts VEGF-induced plasma membrane pore / caveolae formation and blood-retinal barrier structure Can be prevented or alleviated (Wisniewska-Kruk J et al. 2016 Am J Pathol. 186: 1044-54).

Therefore, PLVAP (PV-1) is a major component of the pores of the protoplasmic membrane of the endothelium (fenestal diphragem) and the caveolae diphragm, and is the pores or caveolae of the protoplasmic membrane of the endothelial blood vessels. It is directly involved in the regulation of angiogenesis and permeation.
Outline of the invention

The first technical problem to be solved by the present invention is a monoclonal antibody or a derivative thereof, for example, an antibody Fab, which specifically recognizes and binds to the human progenitor membrane vesicle-related protein PLVAP (or PV-1) antigen. Fragments, Fv fragments, single-stranded antibodies, bi-specific antibodies, antibody-drug conjugates (ADCs), chimeric antigen receptor T-Cell, CAR-T) and the like.

The monoclonal antibody or its derivative alone is prepared as a main active ingredient in an appropriate drug preparation, and by interfering with angiogenesis / permeation by PLVAP (PV-1), the related disease is treated or its development / onset. Can have the effect of delaying. Diseases closely related to angiogenesis / permeation suitable for treatment with the antibody include various malignant tumors, age-related macular degeneration (AMD), diabetic retinopathy, for example, diabetic macular edema. Includes macular edema (DME) and the like.

The anti-PLVAP (PV-1) antibody can be used sequentially or in combination with other drugs currently on the market or studied for the treatment of the above diseases.

The second technical problem to be solved by the present invention is to provide a DNA molecule or gene encoding the above antibody.

A third technical problem to be solved by the present invention is to provide a drug or drug composition containing the above antibody.

A fourth technical challenge to be solved by the present invention provides the use of a drug or drug composition containing the above antibody in the treatment of diseases associated with angiogenesis / permeation, particularly choroidal neovascularization of the fundus of the eye. That is.

The sixth technical problem to be solved by the present invention is to detect and analyze PLVAP (PV-1) protein, or to track histiocytes labeled with positive PLVAP (PV-1) expression inside and outside the body. It is to provide a reagent or a kit containing the above-mentioned antibody.

The seventh technical problem to be solved by the present invention is to provide a method for producing the above antibody.

PLVAP (PV-1) antigen is generally expressed in the pores of the vascular wall of the endothelium of the lesion area only in pathological conditions such as inflammation, tumor, and diabetic retinopathy, and thus PLVAP (PV-1) in the body. -1) When an antibody that specifically recognizes a protein is administered, the antibody couples or binds to the diaphragm in the pores of the blood vessel wall and physically closes the pores of the blood vessel wall to prevent blood vessel permeation / leakage. Can be prevented or reduced. Diseases closely related to angiogenesis / permeation by producing appropriate drug preparations using an antibody or a derivative thereof that specifically recognizes and binds to PLVAP (PV-1) protein in the blood vessel wall of the endothelium as an active ingredient. Can be used to treat or interfere with. Because these monoclonal antibodies or derivatives thereof assemble and bind to the canal walls of neovascular or endothelial blood vessels, they can be linked or conjugated to other drugs as target vectors, such as antitumor chemical drugs, radiopharmaceuticals or toxins, and antibodies-. It forms a drug conjugate (ADC), which is transported to the lumen of a new blood vessel in the tumor area and aggregates, and has the dual action of blocking the blood vessel in the tumor area and killing the tumor cell by the drug. Can be effective. Also, antibodies or derivatives thereof that specifically bind to the PLVAP (PV-1) antigen, such as antibody-drug conjugates (ADCs), are sequential with other drugs already on the market or under study. It can also be used in or in combination for the treatment of diseases associated with angiogenesis / permeation.
In order to solve the above technical problems, the technical solution of the present invention uses the following.

A first aspect of the present invention provides a completely novel monoclonal antibody or derivative thereof that specifically binds to the extracellular region of the human plasma membrane vesicle-related protein PV-1. The monoclonal antibody or derivative thereof comprises a first variable region and a second variable region, wherein the first variable region is an antibody light chain variable region, the antigen complementarity determining regions CDR1, CDR2 and the like. CDR3 is an amino acid sequence shown by SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, respectively, the second variable region is an antibody heavy chain variable region, and the antigen complementarity determining regions CDR1, CDR2 and CDR3 are respectively. It is an amino acid sequence shown by SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.

The antibody includes a mouse-derived antibody, a human-mouse chimeric antibody, a humanized antibody, and the like, and the derivative is an antibody Fab fragment, an Fv fragment, a single-chain antibody, and a bispecific antibody (bi). -Special antibody), antibody-drug complex (antibody-drug-conjuged, ADC), chimeric antibody receptor T-Cell, CAR-T and the like.

As a preferred technical solution of the present invention, the first variable region is an antibody light chain variable region, the amino acid sequence shown by SEQ ID NO: 16, and the second variable region is an antibody heavy chain variable region. Yes, it is the amino acid sequence shown in SEQ ID NO: 21.

As a preferred technical solution of the present invention, the antibody light chain variable region and the human antibody light chain constant region are included, and the hinge region, CH1 region, and CH2 region of the antibody heavy chain variable region and the human antibody heavy chain constant region are included. And includes the CH3 region.

As a preferred technical solution of the present invention, the human antibody light chain constant region is derived from human antibody κ chain or human antibody λ chain, and the human antibody heavy chain constant region is human IgG1, IgG2, IgG3, IgG4, etc. Of the subtypes, IgA or IgM, of which the IgG1 or IgG4 subtypes are preferred.

In the second aspect of the present invention, the DNA molecule or gene nucleotide sequence encoding the antibody or derivative thereof, the gene nucleotide sequence of the antibody light chain variable region thereof is shown by SEQ ID NO: 15, and the antibody heavy chain variable thereof. The gene nucleotide sequence of the region provides that shown by SEQ ID NO: 20.

A third aspect of the present invention provides an expression vector containing a DNA molecule / gene nucleode sequence encoding the antibody or derivative thereof and an expression regulatory sequence operably linked to the sequence.

A fourth aspect of the present invention provides recombinant host cells transformed from the expression vector. The recombinant host cell or progeny cell expresses the antibody or derivative thereof. The antibody includes a mouse-derived antibody, a human-mouse chimeric antibody, a humanized antibody, and the like, and the derivative is an antibody Fab fragment, Fv fragment, single-stranded antibody, bi-specific antibody, antibody-. Includes antibody complex (antibody-drug-conjuged, ADC), chimeric antibody receptor T-Cell, CAR-T and the like.

A fifth aspect of the present invention provides a drug or drug composition comprising a pharmaceutically effective amount of the antibody or derivative thereof and a pharmaceutically acceptable carrier or adjunct.

A sixth aspect of the present invention provides the use of a drug or drug composition of said antibody in the manufacture of a drug for treating a disease associated with angiogenesis or permeation. Diseases closely related to angiogenesis / permeation include various malignant tumors and choroidal neovascular fundus diseases such as age-related macular degeneration (AMD) and diabetic retinopathy, such as diabetic retinopathy. Includes macular edema (DME), retinal vein occlusion, and the like.

As a preferred technical solution of the invention, the drug composition further antagonizes a pharmaceutically effective amount of vascular endothelial growth factor (VEGF) or its receptor (VEGF-R). Contains a blocking active ingredient and a pharmaceutically acceptable carrier. The PLVAP (PV-1) antibody of the present invention is further VEGF / when used as a component of a drug formulation for the treatment of diseases closely associated with angiogenesis / permeation, such as malignant tumors or choroidal neovascular fundus disease. Alternatively, it can be used sequentially or in combination with drugs that target the VEGF receptor (VEGF-R). Suitable VEGF / or VEGF receptor (VEGF-R) targeting drugs are high molecular weight biodrugs, such as anti-VEGF monoclonal antibody drug Bevacizumab (trade name Avastin), anti-VEGF monoclonal antibody Fab. Fragment Ranibizumab (trade name Lucentis), anti-VEGFR2 monoclonal antibody Ramucirumab (trade name Gyramza) and anti-human VEGF monoclonal antibody with code number hPV19 (Stainwei's Chinese patent). Reference: Patent Registration No .: 201210540692X, Patent Name: Monochromic antibody that antagonizes / inhibits the binding of vascular endothelial growth factor and its receptor, its coding sequence and use, and the US patent document of authorization patent number US9580498B2. ), Or VEGF receptor-Fc fusion protein drugs, such as Affilicept, trade name: Eylea, conversept, and the like. Suitable VEGF / or VEGF receptor-targeted low-molecular-weight chemical agents include sunitinib, sorafenib, apatinib, pazopanib, and the like.

As a preferred technical solution of the present invention, the PLVAP (PV-1) antibody of the present invention mainly binds specifically to the diaphragm of pores in the blood vessel wall when treating fundus disease by topical administration. However, as a drug component, the antibody is wild-type or genetically modified in production to prevent or reduce permeation of the blood vessel by physically closing the hole in the blood vessel wall with what is formed. Antibody-dependent cellular cytotoxicity by using constant regions of antibodies of IgG4, IgG2 subtype, or by making antibody Fab fragments, Fv fragments, single-stranded antibodies, etc. without constant regions of antibodies. , ADCC) or antibody-dependent cellular cytotoxicity (CDC) can be reduced or eliminated and direct killing of blood vessels or tissues in the therapeutic area can be reduced. Wild-type or genetically modified human IgG4, IgG2 subtype antibody constant regions, and antibody Fab fragments, Fv fragments, single-chain antibodies, etc. without constant regions of the antibody are genetic engineering known to those skilled in the art. It can be obtained by cloning by technology or synthesized in vitro.

As another preferred technical solution of the invention, the PLVAP (PV-1) antibody of the invention provides constant regions of wild or genetically modified human IgG1, IgM subtype antibodies when treating tumors. By use, ADCC or CDC of the antibody can be maintained or improved to achieve a more potent tumor tissue and cell killing effect. Constant regions of wild-type or genetically modified human IgG1 and IgM subtype antibodies can be obtained by cloning by genetic engineering techniques known to those of skill in the art or synthesized in vitro.

Since the PLVAP (PV-1) antibody or derivative thereof of the present invention has the characteristic of specifically binding to the neovascular endothelial of the tumor region or the tube wall of the blood vessel, it is linked to other antitumor agents or toxins as a target vector. Alternatively, they conjugate to form antibody-drug conjugates (ADCs), both of which are transported and aggregated into the neovascular cavities of the tumor area to achieve a better tumor-killing effect. be able to. The method of linking or conjugating the antibody with the drug or toxicity can use conventional techniques known to those of skill in the art. Such antibody-drug conjugates are particularly suitable for the treatment of primary brain tumors, such as tumors in areas where conventional drugs are difficult to reach, such as tumors in the brain, including glioblastoma and metastatic brain tumors. .. When treating tumors of the brain, such as glioblastoma, the PLVAP (PV-1) antibody or antibody-drug conjugate of the present invention is used in combination with an orally administered small molecule drug, such as temozolomide. be able to. In addition, the PLVAP (PV-1) antibody or antibody-drug conjugate of the present invention particularly comprises some malignant tumors in which the expression of the PLVAP / PV1 gene is relatively high, such as primary liver cancer or metastatic liver cancer. Such antibody drugs provide more accurate targeted treatment by local administration by injection into intrahepatic vessels, and can also reduce the side effects of the drug on other parts of the body. it can.

As another preferred technical solution of the invention, will the PLVAP (PV-1) antibody of the invention be used sequentially with monoclonal antibody drugs targeting immunosuppressive checkpoint molecules? When used in combination, it can also be used to treat many malignancies such as primary (eg, glioblastoma) or metastatic brain tumors, lung cancer, gastric / esophageal cancer, liver cancer, kidney cancer, and cervical cancer. it can. Monoclonal antibody drugs that target immunosuppressive checkpoint molecules that are used sequentially or in combination with PLVAP (PV-1) antibodies are preferably anti-CTLA4 (Cytotoxic T-lymphocyte Atezolizumab-4), cytotoxic T. Lymphocytic antigen 4) Monoclonal antibody ipilimumab (trade name Yervoy), anti-PD-1 (programmed death protein 1, programmed cell death 1) monoclonal antibody nivolumab (trade name Opdivo), pembrolizumab Monoclonal antibody with trade name Keytruda) and code number hAB21 (Anti-PD-1 monoclonal antibody under study by Steinwei, PCT patent application documents: PCT / CN2017 / 089282, antagonizing the binding of human PD-1 antigen and its ligand. Inhibiting monoclonal antibodies and methods and uses thereof), the anti-PD-L1 monoclonal antibody drug atezolizumab (trade name Tecentriq), avelumab (trade name Bavencio), durvaluumab (trade name Imim). ) Etc. are included.

As another preferred technical solution of the present invention, the PLVAP (PV-1) antibody of the present invention is first made into chimeric antigen receptor T-Cell (CAR-T) and then in vitro tumor patients. After being introduced into immune cells isolated from the peripheral blood of the tumor, for example, T cells, further cultured and amplified in vitro, lymphocytes recognizing these PLVAP (PV-1) antigens are injected into the body again. Furthermore, by targeting vascular endothelial cells and new blood vessels in the tumor region in the body, the effect of treating the tumor can be achieved. Compared to conventional CAR-Ts that directly target tumor antigens such as CD19, CD20, the CAR-Ts of the invention specifically target vascular endothelial cells and neovascularization in the tumor area. Its action is independent of the expression of tumor antigens and can be used in the treatment of many solid tumors. The production of the PLVAP (PV-1) antibody of the present invention into a chimeric antigen receptor T cell (CAR-T) can use conventional techniques known to those skilled in the art.

In a specific example of the present invention, a human-mouse chimeric PLVAP (PV-1) antibody is used as a single component or in combination with an anti-VEGF antibody to treat choroidal neovascular fundus disease in the body of a crab monkey. Use is described.

In the seventh aspect of the present invention, a monoclonal antibody or a derivative thereof capable of binding to either the plasma membrane vesicle-related protein PV-1 of humans and monkeys, wherein the antibody is shown by SEQ ID NO: 8 or SEQ ID NO: 25. Provided are those that bind to an antigen having such an amino acid sequence and that bind to PV-1 in competition with the above antibody or derivative thereof.

The eighth aspect of the present invention is a method for antagonizing / blocking angiogenesis or permeation in the body by the plasma membrane vesicle-related protein PV-1 in which an appropriate dose of the antibody or derivative thereof is administered. Provide a method that includes that.

A ninth aspect of the present invention is a detection reagent or detection kit containing the antibody or derivative thereof for detecting and analyzing the plasma membrane vesicle-related protein PLVAP (PV-1) in a tissue or cell sample. Provided are detection reagents or detection kits used for tracking PLVAP (PV-1) expression-positive labeled tissue cells, either in the body or in the body.

A tenth aspect of the present invention is a method for producing the above antibody or a derivative thereof.
a) A step of providing an expression vector containing the above DNA sequence encoding the antibody or derivative and an expression regulatory sequence functionally linked to the sequence.
b) The step of transforming a host cell, for example, a CHO cell, with the expression vector according to step a).
c) Includes a step of culturing the host cell obtained in step b) under conditions suitable for the expression of the antibody, and d) a step of separating and purifying the antibody from the culture solution of the host cell by affinity chromatography. Provide a method.

As used herein, the term "monoclonal antibody" is an immunoglobulin obtained from a single pure cell, having similar structural and chemical characteristics and being specific for a single antigenic determinant. It has. Monoclonal antibodies are different from conventional polyclonal antibody preparations (usually different antibodies against different antigenic determinants), and each monoclonal antibody is against a single antigenic determinant in an antigen. Other than their specificity, the advantages of monoclonal antibodies are obtained by culturing hybridomas or recombinant engineering cells without the inclusion of other immunoglobulins. The modifier "monoclonal" describes the properties of an antibody and should not be understood that the antibody needs to be produced in some special way by being obtained from a homogeneous antibody colony.

As used herein, the term "humanized monoclonal antibody" refers to other sequences (in the variable region) of the amino acid sequence of a mouse-derived monoclonal antibody, except that it leaves complementarity-determining regions (CDRs). By converting all or most of the (including the sequences of the framework regions) to the amino acid sequences of human immunoglobulins, the immunogenicity of the mouse-derived monoclonal antibody was maximized by means of genetic engineering.

As used herein, the terms "antibody" and "immunoglobulin" are glycoproteins of approximately 150,000 daltons of heterotetramers with the same structural characteristics, two identical light chains ((light chain)) and two identical. It consists of a heavy chain. Each light chain is attached to the heavy chain by one covalent disulfide bond, although the number of disulfide bonds between the heavy chains is due to the immunoglobulin isotype. Each heavy chain and light chain also has intrachain disulfide bonds at regular intervals. Each heavy chain has a variable region ( _VH ) at one end and a number of constant regions beyond it. Each light chain has a variable region ( _VL ) at one end and a stationary region at the other end. The constant region of the light chain faces the first constant region of the heavy chain, and the variable region of the light chain faces the variable region of the heavy chain. Special amino acid residues form an interface between the variable regions of the light and heavy chains.

As used herein, the term "variable" refers to an antibody in which some part of the variable region differs in sequence, which constitutes the binding and specificity of each particular antibody to that particular antigen. .. However, variability is not uniformly distributed throughout the variable region of the antibody. It is concentrated in three fragments called complementarity determining regions (CDRs) or hypervariable regions in the variable regions of the light and heavy chains. The relatively conservative portion of the variable region is called the framework region (FR). The variable regions of the heavy chain and light chain of the antibody each basically have a β-sheet structure, and are linked by three CDRs forming a connecting loop, and in some cases, four FR regions having a partial β-sheet structure are formed. included. The CDRs in each strand are close together in the FR region and together with the CDRs of the other strand at the antigen binding site of the antibody (Kabat et al., NIH Publ. No. 91-3242, Vol. 1, 647-669 (1991)). See) forming. The constant region does not directly participate in antibody-antigen binding, but exhibits different effector functions, eg, as involved in antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cellular cytotoxicity (CDC).

The antibody of the present invention can generally be produced by the following method.

First, the gene encoding the antibody of the present invention is inserted into an expression vector containing an appropriate expression regulatory sequence.

As used herein, the term "expression regulatory sequence" usually refers to a sequence involved in the regulation of gene expression. The expression regulatory sequence contains a promoter and termination signal that are functionally linked to the gene of interest. The gene (DNA) sequence encoding the antibody of the present invention can be obtained by ordinary means well known to those skilled in the art, for example, by artificially synthesizing from the protein sequence disclosed in the present invention or by amplifying by the PCR method. Be done. The DNA fragment obtained by synthesis or PCR amplification by various methods well known in the art is then inserted into a suitable expression vector. The expression vector used in the present invention may be a commercially available expression vector known to those skilled in the art, for example, a pCDNA 3.1 expression vector manufactured by Invitrogen.

Suitable host cells that undergo transformation of the expression vector generally include prokaryotic and eukaryotic cells. Examples of commonly used prokaryotic host cells include Escherichia coli, Bacillus subtilis and the like. Commonly used eukaryotic host cells include yeast cells, insect cells, mammalian cells and the like. In the present invention, suitable host cells are mammalian cells, particularly Chinese hamster ovary (CHO) cells.

After culturing the host cells transformed with the expression vector under appropriate conditions (for example, adherent culture or suspension culture in a cell culture bottle or a serum-free medium in a bioreactor), the culture supernatant is collected, and further. Purification by conventional separation steps or means well known to those skilled in the art, including protein A affinity chromatography, ion exchange chromatography, filtration sterilization, etc., gives the antibody of the invention.

The purified antibody of the present invention may be dissolved in a suitable solvent, for example, sterile saline, and the dissolution concentration may be between 0.01 and 100 mg / ml, but the ideal final dissolution concentration is It may be between 1 and 40 mg / ml.

In order to obtain a mouse-derived monoclonal antibody that specifically binds to the PLVAP (PV-1) protein and a hybridoma cell line that secretes it, the present invention presents a recombinant human PV-1 protein expressed by mammalian cells (CHO cells). By repeating low-dose mouse subcutaneous immunization several times using the extracellular region of the cell membrane as an immune antigen, a mouse secreting a polyclonal antibody of the anti-human PV-1 protein was obtained, and a high-potency antibody was further contained therein. Multiple strains that stably secrete anti-human PV-1 protein antibodies by selecting mice to be used, taking their spleen cells, fusing them with mouse myeloma cells in vitro, and performing steps such as drug screening and subcloning. Hybridoma monoclonal cells were constructed. Among them, the mouse hybridoma cell line having the code number STW-139-15 was verified by multiple detection methods such as ELISA, immunohistochemistry, and flow cytometer, and the monoclonal antibody secreted by the detection method was found in normal human tissues. It has been demonstrated that it can specifically bind not only to PV-1 proteins in cell and tumor tissues, but also to PV-1 proteins in monkey tissues.

The present invention was cloned from the mouse hybridoma cell line STW-139-15 by means such as genetic engineering to obtain a gene sequence encoding a protein in the heavy chain variable region and the light chain variable region of the mouse-derived antibody, and based on this. Humanization was performed on the antibody to obtain a human-mouse chimeric antibody STW-139-15-C and an expression vector thereof. The expression vector entered Chinese hamster ovary (CHO) cells by transfection to obtain genetically modified cells that stably and efficiently secrete the human-mouse chimeric antibody. After culturing the genetically modified cells on a large scale, a supernatant of the culture solution was obtained. The supernatant was centrifuged and filtered through a 0.45 μm filter, and then separated and purified by a protein A-containing affinity chromatography column to obtain a purified human-mouse chimeric antibody STW-139-15-C protein.

The separated and purified STW-139-15-C antibody protein can be sterilized by filtration, redissolved in an appropriate solvent, made into a drug preparation, and used for measuring its biological or pharmacological activity inside and outside the body. it can.

One of the methods for measuring the pharmacological activity of the human-mouse chimeric antibody in the body is to use a choroidal neovascular disease model of a cynomolgus monkey induced by laser irradiation, and by local administration by injection into the vitreous body. The inhibitory effect of STW-139-15-C antibody alone or in combination with an anti-VEGF antibody drug on choroidal neovascularization growth and permeation was discussed and compared to the inhibitory effect of anti-VEGF antibody drug alone. From the measurement results, the single administration of the STW-139-15C monoclonal antibody that specifically binds to PLVAP / PV-1 or the combined use with the anti-VEGF monoclonal antibody is both laser-induced permeation of choroidal neovascularization in the cynomolgus monkey body. It has been shown that it has a clear inhibitory effect and can be used for the treatment of diseases related to angiogenesis / permeation.

It is a schematic diagram of the alignment analysis of the amino acid sequences of the human PV-1 protein and the mouse PV-1 protein in Example 1 of the present invention. It is a pattern of SDS-PAGE electrophoresis analysis of the recombinant human PV-1-His protein in Example 1 of the present invention, where band 1 is a DTT-reduced sample and the marker is a standard product of the molecular weight of the protein (kd). ) Is shown. CHO cells (CHO / PV-) in which a sample of a supernatant of immune mouse serum and hybridoma cells and a human PV-1 gene were transiently transfected by the immunohistochemistry (IHC) method in Example 1 of the present invention. It is a schematic diagram of the typical result of detecting the specific binding of 1). Here, FIG. 3A is a sample (negative control) of the culture supernatant of unfused SP2 / 0 myeloma cells, and FIG. 3B is a serum sample of a mouse immunized with human PV-1 protein (at 1:200). (Diluted), and FIG. 3C is a sample of the culture supernatant of mouse hybridoma cells STW-139-15. Schematic diagram of the result of detecting the binding of a sample of a culture supernatant of mouse hybridoma cells STW-139-15 and a recombinant human PV-1 cell epimembrane protein coated on a 96-well plate by the ELISA method in Example 2 of the present invention. Is. Here, mAb113 is a sample of one unrelated mouse monoclonal antibody (anti-SOST monoclonal antibody), and the negative control sample is a sample of the culture supernatant of unfused SP2 / 0 myeloma cells. The binding of the mouse-derived monoclonal antibody STW-139-15 to the recombinant human PV-1-Fc fusion protein and the recombinant protein or Fc fusion protein of some other unrelated genes was detected by the ELISA method in Example 3 of the present invention. It is a schematic diagram of the result of comparison and analysis. The flow cytometer in Example 4 of the present invention was used to detect the binding between a sample of the mouse-derived monoclonal antibody STW-139-15 and CHO cells (CHO / PV-1) stably transfected with the human PV-1 gene. It is a schematic diagram of the analysis result. Here, FIG. 6A is a sample (negative control) of the culture supernatant of unfused SP2 / 0 myeloma cells, and FIG. 6B is a sample of an unrelated mouse monoclonal antibody mAb21 (anti-PD-1 monoclonal antibody). FIG. 6C is a serum sample of a mouse immunized with human PV-1 protein (diluted at 1: 200 and is a positive control), and FIG. 6D is a culture supernatant of mouse hybridoma cell STW-139-15. This is a sample of. A sample of a mouse-derived monoclonal antibody STW-139-15 gradient-diluted by a flow cytometer in Example 4 of the present invention and CHO cells (CHO / PV-1) stably transfected with the human PV-1 gene. FIG. 3 is a dose-response curve of antibody solubility in which binding was detected-mean fluororesense. Results of detection and analysis of binding between a sample of mouse-derived monoclonal antibody STW-139-15 and a mixed sample of CHO and CHO / PV-1 cells (mixed at 9: 1) using a flow cytometer in Example 4 of the present invention. It is a schematic diagram. Here, FIG. 8A is a sample (negative control) of the culture supernatant of unfused SP2 / 0 myeloma cells, and FIG. 8B is a sample of the unrelated mouse monoclonal antibody mAb21 (anti-PD-1). FIG. 8C is a sample of mouse-derived monoclonal antibody STW-139-15. FIG. 5 is a schematic diagram of typical results of detection and analysis of binding between a sample of mouse-derived monoclonal antibody STW-139-15 and human HUVEC cells by a flow cytometer in Example 5 of the present invention, where A01NC is unfused. It is a sample (negative control) of the culture supernatant of SP2 / 0 myeloma cells. It is a schematic diagram of the representative result of detecting the binding of the mouse-derived monoclonal antibody STW-139-15 sample and the tissue section of human normal tissue by the immunohistochemistry (IHC) method in Example 6 of the present invention. Here, FIG. 10A shows a tissue section having a lung Lung, FIG. 10B shows a tissue section having a liver Liver, FIG. 10C shows a tissue section having a brain Brian, and FIG. 10D shows a tissue section having a pancreatic pancreasic. FIG. 10E shows a tissue section, FIG. 10E shows a tissue section of a heart heart, and FIG. 10F shows a tissue section of a pancreatic lung. It is a schematic diagram of the representative result of detecting the binding of the mouse-derived monoclonal antibody STW-139-15 sample and the tissue section of human tumor tissue by the immunohistochemistry (IHC) method in Example 7 of the present invention. Here, FIG. 11A shows a tissue section of human tumor tissue having a lung cancer lung cancer, FIG. 11B shows a tissue section of human tumor tissue having a liver cancer liver canceler, and FIG. 11C shows a tissue section of human tumor tissue having a human tumor tissue. A brain tumor brain tumor is shown in FIG. 11D, a tissue section of human tumor tissue is a pancreatic cancer pancreatic cancer, FIG. 11E is a tissue section of human tumor tissue is an ovarian cancer cancer, and FIG. 11F is a human. Represents a tissue section of tumor tissue that is lymphoma lymphoma. It is a schematic diagram of the alignment analysis of the amino acid sequences of the human PV-1 protein and the monkey PV-1 protein in Example 8 of the present invention. The binding between a sample of mouse-derived monoclonal antibody STW-139-15 and CHO cells (CHO / monkey PV-1) transfected with the monkey PV-1 gene was detected and analyzed by the flow cytometer in Example 8 of the present invention. It is a schematic diagram of the result. Here, FIG. 13A is a sample (negative control) of the culture supernatant of unfused SP2 / 0 myeloma cells, and FIG. 13B is a sample of the unrelated mouse monoclonal antibody mAB7 (anti-PD-1). FIG. 13C is a sample of mouse-derived monoclonal antibody STW-139-15. In the schematic of the result of detecting the binding of the human-mouse chimeric antibody STW-139-15-C sample and the recombinant human PV-1 cell membrane protein coated on the 96-well plate by the ELISA method in Example 10 of the present invention. is there. It is a fundus fluorescence imaging image at each time point of the observation period after administration by intravitreal injection of an animal 3 weeks after the cynomolgus monkey in Example 11 of the present invention was photocoagulated by a laser. Here, FIG. 15A is an imaging image of a negative control (0.9% NaCl injection) treatment group, FIG. 15B is an imaging image of an STW-139-15C monoclonal antibody test sample administration group, and FIG. 15C is a positive control. It is an imaging image of a drug hPV19 monoclonal antibody (anti-VEGF monoclonal antibody) administration group, and FIG. 15D is an imaging image of a combined administration group of a test sample TW-139-15C monoclonal antibody and a positive control drug hPV19 monoclonal antibody.

Hereinafter, the present invention will be further described based on examples, but these examples are for illustration purposes only and do not limit the present invention.

Example 1: Construction, selection and identification of a mouse hybridoma cell line secreting an anti-human PV-1 antibody 1.1 Alignment analysis of the amino acid sequence of human PV-1 protein and the amino acid sequence of mouse PD-1 protein Human PV-1 Alignment analysis of the amino acid sequence of the protein (NCBI Reference Sequence: NP_112600.1) (SEQ ID NO: 1) and the amino acid sequence of the mouse PV-1 protein (NCBI Reference Sequence: NP_115774.2) (SEQ ID NO: 2) is shown in FIG. It's a street. Here, more than 20 amino acids at the N-terminal are located in the cell membrane (the sequence is shown in oblique), and the amino acid sequence shown in the frame and bold is the transmembrane region of the PV-1 protein. The C-terminal amino acid sequences (human: AA53-442, mouse: AA53-438) are all located outside the cell membrane, and have four N-glycosylation sites (indicated by a frame) and nine cysteine Cysteine (indicated by a frame). Underlined) is included. In terms of amino acid sequence, human PV-1 protein and mouse PV-1 protein have an overall homology of only 62%, of which, in the epicellular region, the amino acids of human PV-1 protein and mouse PV-1 protein are different. The number of parts is more than 100. Therefore, it is presumed that a mouse antibody against the antigen region outside the human PV-1 cell membrane can be produced by using the conventional technique of immunizing a mouse with an antigen protein and producing a hybridoma.

1.2 Expression and Production of Recombinant Human PV-1 Protein (Immune Antigen) In the examples of the present invention, first, total RNA was extracted from human umbilical venendothelial cells (HUVEC), and reverse transcription PCR was performed. (Reverse Transscription-Polymerase Chain Reaction, RT-PCR) was used to obtain cDNA. Furthermore, using the cDNA as a template, cloning was performed by PCR technology to obtain a gene fragment encoding a human PV-1 protein. After being confirmed to be correct by DNA sequencing and treated with a DNA restriction enzyme, it was cloned into a DNA plasmid capable of efficiently expressing the exogenous gene in CHO cells to obtain the corresponding recombinant expression plasmid.

1.2.1 Acquisition of a gene clone encoding a human PV-1 full-length protein and construction of its expression plasmid The construction process of the expression plasmid is as follows.

First, using the above cDNA as a template and using a pair of primers as shown below, amplification by PCR was successful in obtaining a target gene fragment (length: about 1345 bp) encoding a human PV-1 full-length protein.

Forward Primer hPV-1-His-F-HindIII: AACTAAGCTTGCCACCACTGGGTCTGGCCATGGGAGCCGGA (SEQ ID NO: 3)
Reverse primer hPV-1-His-R-XhoI:
ACCACTCGAGTCAGTGATGGTGATGGTGATGCCACTGGGATGGGGTACAGGGAT (SEQ ID NO: 4)

The DNA obtained by PCR amplification was recovered and treated with a DNA restriction enzyme, and then cloned into a pCDNA3.1 expression plasmid (Inivtrogen) to obtain a recombinant plasmid. It was confirmed that the recombinant plasmid was successfully obtained by cleavage with a restriction enzyme and DNA sequencing to obtain a recombinant plasmid (plasmid name: pQY-PV-1) capable of expressing the exogenous human PV-1 gene on the CHO cell membrane. ..

1.2.2 Construction of expression plasmid for human PV-1 cell extramembrane recombinant protein with His-6 tag at C-terminal Using the PCR recovery product in the previous section (1.2.1) as a template, a pair of the following Using a primer, we succeeded in obtaining a gene fragment (PV-1-His) encoding a human PV-1 extracellular protein with a 6-histidine tag sequence at the C-terminus by amplification by PCR.

Forward Primer hPV-1-Fc-F-BglII: GTGGAGATACTCACGTGAGCACAGAGTCCAACCTG (SEQ ID NO: 5);
Reverse primer hPV-1-His-R-XhoI:
ACCACTCGAGTCAGTGATGGTGATGGTGATGCCACTGGGATGGGGTACAGGGAT (SEQ ID NO: 4)

The DNA obtained by PCR amplification was recovered and treated with a DNA restriction enzyme, and then introduced into an expression plasmid pCDNA3.1-DHFR having a signal peptide to obtain a recombinant plasmid. The recombinant plasmid was successfully obtained as an expression plasmid (plasmid name: pQY-DHFR-PV1-His) that expresses and secretes the hPV-1-His recombinant gene in CHO cells by cleavage with a restriction enzyme and DNA sequencing. confirmed.

1.2.3 Construction of expression plasmid for recombinant human PV-1-Fc fusion protein The construction process of the expression plasmid is as follows.

Using the PCR recovery product in the previous section (1.2.1) as a template, and using a pair of primers as shown below, amplifying by PCR to obtain a gene fragment (length: about 1176 bp) of the extracellular region of hPV-1. succeeded in.

Forward Primer hPV-1-Fc-F-BglII: GTGGAGATACTCACGTGAGCACAGAGTCCAACCTG (SEQ ID NO: 5)

Reverse Primer hPV-1-Fc-R-BamHI: GTGGGGCATGTGTGTGAGTGGATCCGCCCACTGGATGGGGCTACAG (SEQ ID NO: 6)

Then, using the PCR recovery product as a template, a pair of primers as shown below was used, and the gene was amplified by PCR to fuse the gene in the extracellular region of hPV-1 with the gene encoding the human IgG1-Fc fragment. We succeeded in acquiring the gene (length: about 1859 bp).

Forward Primer hPV-1-Fc-F-BglII: GTGGAGATACTCACGTGAGCACAGAGTCCAACCTG (SEQ ID NO: 5)

Reverse Primer PV1-DHFR-XbaI-R: TAACTCTAGACATCATTACCCCGGGGACAGGG (SEQ ID NO: 7)

The DNA of the recombinant gene obtained by the PCR amplification was recovered and cleaved with a DNA restriction enzyme, and then cloned into the expression plasmid pCDNA3.1-DHFR to obtain a recombinant plasmid. The recombinant plasmid was successfully obtained as an expression plasmid (plasmid name: pQY-DHFR-PV1-Fc) that expresses and secretes the human PV-1-Fc fusion protein in CHO cells by restriction enzyme cleavage and DNA sequencing. Was confirmed.

1.3 Expression and production of human PV-1-His recombinant protein and PV-1-Fc fusion protein (immune antigen) DNAs of the above expression plasmids (pQY-DHFR-PV1-His, pQY-DHFR-PV1-Fc) after mixing with Fugen-6 liposome (Roche), respectively, DHFR gene-deficient CHO cells ^- were transfected into (CHO-dhfr). After transfection, screening was performed with a drug (methotrexate, MTX) to obtain cell lines capable of efficiently expressing and secreting human PV-1-His recombinant protein and human PV-1-Fc fusion protein, respectively. The expressed cell lines obtained by screening were amplified and cultured in a serum-free medium, separated and purified from the cell supernatant by a Ni affinity chromatography column or a Protein-A affinity chromatography column, respectively, and human PV-with a purity of 90% or more. A 1-His recombinant protein and a human PV-1-Fc fusion protein were obtained.

FIG. 2 shows a pattern of SDS-PAGE electrophoresis analysis of human PV-1-His recombinant protein (DTT reduction) obtained by separation and purification. From the results, a sample of human PV-1-His protein with DTT reduction was obtained. The major band is shown to be on the order of 55 kd, which is consistent with the theoretically expected molecular weight of the protein.

1.4 Animal immunity with recombinant human PV-1 protein First, human PV-1-His recombinant protein was mixed with a complete Freund's adjuvant (manufactured by Sigma, USA) and then injected subcutaneously into several Balb / c mice. (100 μl / mouse, 10 μg PV-1-His protein / dose). 2-3 weeks after the initial immunization, a mixture containing human PV-1-Fc protein and incomplete Freund's adjuvant (manufactured by US Sigma) was injected into several places under the skin of the mouse, and 3-4 times of enhanced immunization was performed. Then, a small amount of mouse serum was taken and anti-PV-1 in mouse serum by enzyme-linked immunosorbent assay (ELISA) on a 96-well plate coated with human PD-1-Fc fusion protein. The titer of the antibody was detected, and high-titer mouse spleen cells were taken and used for cell fusion in the next step.

1.5 Cell Fusion 3-4 days after final immunization, sterile mouse spleen cell suspension was prepared with mouse SP2 / 0 myeloma cells (purchased from the Cell Depository Center, Shanghai Life Science Institute, Chinese Academy of Sciences), 5: 1. Alternatively, they were fused under the action of 50% PEG-1000 (manufactured by Sigma, USA) at a ratio of 10: 1. The fusion was carried out according to the usual method (Kohler G. and Milstein C: Nature 1975; 256: 495-497), the amount of PEG used was 1 ml, and the addition was completed slowly within 60 seconds. After reacting for 90 seconds, the reaction was stopped in serum-free RPMI-1640 medium, centrifuged at 1000 rpm for 10 minutes, the supernatant was removed, and the cells precipitated by centrifugation were 10% HAT (H: hypoxanthin, A). 96-well flat-bottomed cell culture plate (200 μl / well) adjusted to a ^{cell concentration of 1 × 10 6} / ml in RPMI 1640-10% FCS medium containing: aminopterin, T: thymidine, manufactured by Sigma, USA. ), And the _{cells were cultured in a 5% CO 2} incubator (manufactured by Thermo, USA) at 37 ° C. for 2-3 weeks.

1.6 Screening of PV-1 antibody secretion-positive mouse hybridoma cells by immunohistochemistry (IHC) In the examples of the present invention, PV-1 antibody secretion-positive cell lines are screened from mouse hybridomas by immunohistochemistry. did.

The outline of the method is as follows.

1) CHO cells transfected with the human PV-1 gene (CHO / PV1) and untransfected CHO cells were mixed at a ratio of 1: 6 and spread on a 96-well cell culture plate at 37 ° C. and 5% CO. ₂ Incubator left overnight.

2) After taking out the cell culture plate and sucking up the culture solution, it was fixed with 2% paraformaldehyde-containing phosphate buffered saline (PBS) (2% paraformaldehyde PBS solution) and permeated with 90% methanol. It became.

3) After washing with PBS solution, the primary antibody, mouse hybridoma supernatant or PV-1 immune mouse serum (diluted at 1: 200) was added to prepare a positive control sample, which was incubated at 37 ° C. for 1 hour.

4) After washing with PBS solution, the secondary antibody HRP-goat anti-mouse IgG was added (1: 400) and incubated at 37 ° C. for 1 hour.

5) After washing with PBS solution, a substrate (DAB, 0.1% H ₂ O ₂ ) was added and the color was developed.

FIG. 3 shows typical results of the immunohistochemistry (IHC) screening.

As shown in FIG. 3, the mouse hybridoma cell culture supernatant having the code number STW-139-15 (FIG. 3C) clearly specifically binds to and presents CHO / PV-1 and CHO mixed culture cells. The ratio of color intensity to color-positive cells was similar to that of the positive control sample (PV-1 antigen-immunized mouse serum sample, FIG. 3B), and the SP2 / 0 myeloma cell supernatant sample was colored. The result was negative (Fig. 3A), which was also in agreement with the expected result.

Example 2 Detection of binding of recombinant human PV-1-Fc fusion protein to a supernatant sample of mouse hybridoma cell STW-139-15 by the ELISA method RPMI-1640-10 was obtained from the positive hybridoma cells obtained in the above preliminary screening. The cells were diluted to 1-10 cells / well in% FCS medium, spread on 96-well cell culture plates, and cultured in a 5% CO ₂ incubator at 37 ° C. for 2-3 weeks. When the clone grew, the supernatant was taken and ELISA was used to detect and identify the anti-PV-1 antibody again.

The ELISA detection method is as follows.

1) A 96-well microplate is coated with recombinant human PV-1-Fc fusion protein (2 μg / ml, pH 9.6, 0.1 M NaHCO ₃ solution), coated at 37 ° C. for 2 hours, and then further 2% bovine serum. Albumin (BSA) was added and blocked overnight at 4 ° C.

2) The next day, after washing the coating plate with PBS-0.1% Tween 20 solution, test hybridoma cell culture supernatant (unfused SP2 / 0 myeloma cell culture supernatant is a negative control) at 37 ° C. Incubated for 2 hours.

3) After washing with PBS-0.1% Tween 20 solution, goat anti-mouse IgG (manufactured by Sigma, USA) labeled with horseradish peroxidase HRP was added and incubated at 37 ° C. for 1 hour.

4) After further washing with PBS-0.1% Tween20 solution, substrate solution (o-phenylenediamine OPD, was 10-15min colored put _0.1% H _{2 O} 2).

5) After stopping the reaction by adding 0.1 M HCl, the OD value at 492 nm was read by a Multiskan-FC microplate reader (manufactured by Thermo Scientific, USA).

FIG. 4 is a schematic diagram of typical results of the ELISA.

As shown in FIG. 4, the supernatant sample of mouse hybridoma cell STW-139-15 contained an antibody that could specifically bind to a high titer of human PV-1-Fc fusion protein. Both the sample of the unrelated monoclonal antibody mAb113 (anti-SOST monoclonal antibody, SOST is an abbreviation for Sclerostin) and the supernatant sample of SP2 / 0 myeloma cells were negative.

Example 3 Detection of binding of mouse-derived STW-139-15 monoclonal antibody to human PV-1-Fc fusion protein and other unrelated proteins by ELISA In this example, mouse-derived STW-139-15 monoclonal antibody by ELISA And human PV-1-Fc fusion protein and other unrelated proteins were detected.

Therefore, human PV-1-Fc fusion proteins and other unrelated proteins (CD3, TIGIT-His, SIRPa-His) or Fc-fusion proteins (PD1-Fc, PDL1-Fc, PDL2-Fc, mPDL1-Fc, CTLA4). -Fc, CD28-Fc, B7-Fc and BTLA-Fc) were coated on a 96-well ELISA plate at a concentration of 1 μg / ml, and a mouse-derived monoclonal antibody STW-139-15 sample was used as the primary antibody, and horseradish peroxidase (HRP) was used as the primary antibody. ) Labeled goat anti-mouse IgG (manufactured by Jackson) as a secondary antibody, further _{colored with a substrate solution (o-phenylenediamine OPD, 0.1% H 2} O ₂ ), and stopped the reaction with 1M HCl. I let you. The OD value at 492 nm was read by a Multiskan MC microplate reader (manufactured by Thermo Scientific, USA).

FIG. 5 shows the detection result by the ELISA method. From the results, the mouse-derived monoclonal antibody STW-139-15 sample specifically bound only to the human PV-1-Fc fusion protein (OD value> 1.0), CD3 and other unrelated recombinant proteins (His tag). It was shown that none of the attached or IgG-Fc fusion proteins had a clear binding (OD values were 0.1 or less). From this result, it was shown that the STW-139-15 monoclonal antibody has a high degree of specificity in antigen recognition and binding, and binds only to the PV-1 protein.

Example 4 Detection of binding between mouse-derived STW-139-15 monoclonal antibody and CHO cells (CHO / PV-1) expressed by transfecting the human PV-1 gene with a flow cytometer In this example, mouse-derived monoclonal antibody A sample of antibody STW-139-15 is used as the primary antibody, FITC fluorescently labeled rabbit anti-mouse IgG is used as the secondary antibody, and a sample of STW-139-15 monoclonal antibody and CHO expressing the human PV-1 gene are expressed by a flow cytometer. Cell (CHO / PV-1) binding was detected and analyzed.

To this end, CHO / PV-1 cells that stably transfect and express the human full-length PV-1 recombinant protein gene are expressed in mouse hybridoma STW-139-15 supernatant sample and unrelated mouse hybridoma mAb21 sample (anti-PD), respectively. Incubate with -1 monoclonal antibody), PV-1 antigen-immunized mouse serum (positive control sample, diluted 1: 200) and mouse SP2 / 0 cell supernatant (negative control sample) for 1 hour at 4 ° C. After washing with PBS-0.1% FCS solution, FITC-labeled rabbit anti-mouse IgG (diluted at 1: 200, manufactured by Southhern Biotech) was added. The cells were incubated at 4 ° C. for 1 hour, washed with PBS-0.1% FCS solution, and then set on a BD Accuri C6Plus Flow Cytometer flow cytometer (manufactured by BD Biosciences, USA) for detection.

FIG. 6 is a schematic diagram of typical results detected by the flow cytometer. As shown in FIG. 6, similar to the positive control sample (FIG. 6C, serum of mice immunized with PV-1 protein), the mouse hybridoma STW-139-15 supernatant sample was clearly with CHO / PV-1 cells. Although specific binding was possible (Fig. 6D), both the unrelated hybridoma sample (Fig. 6B) and the mouse SP2 / 0 cell supernatant (Fig. 6A) of the negative control sample specifically bound to CHO / PV-1 cells. I didn't.

FIG. 7 detected the binding of a sample of mouse-derived monoclonal antibody STW-139-15 gradient-diluted by a flow cytometer to CHO cells (CHO / PV-1) stably transfected with the human PV-1 gene. It is an antibody solubility-mean fluorescence curve, and the results clearly show the binding between the STW-139-15 monoclonal antibody sample and CHO / PV-1 cells within the solubility range of 0.1-10 μg / ml. It was found to show a dose-response curve (dose-respone).

FIG. 8 is a schematic diagram of the results of detecting and analyzing the binding between a sample of mouse-derived monoclonal antibody STW-139-15 and a mixed sample of CHO and CHO / PV-1 cells (mixed at 9: 1) by a flow cytometer. .. As shown in FIG. 8, the mouse hybridoma STW-139-15 supernatant sample is apparent when compared to the negative control sample of mouse SP2 / 0 cell supernatant (FIG. 8A) and the unrelated hybridoma supernatant sample (FIG. 8B). The ratio of positive cells that specifically bound to some cells in the hybridoma (Fig. 8C) was 9.67%, which is the ratio of CHO / PV-1 cells placed in the hybridoma. Consistent with (10%). From this result, it was further proved that STW-139-15 specifically recognizes and binds only the PV-1 antigen and does not bind to other proteins or antigenic substances in CHO.

Example 5 Detection of binding between mouse-derived STW-139-15 monoclonal antibody and human HUVEC cells by flow cytometer In this example, a sample of mouse-derived monoclonal antibody STW-139-15 was used as the primary antibody, and a goat labeled with FITC fluorescence. Using anti-mouse IgG as a secondary antibody, the binding between STW-139-15 monoclonal antibody and human HUVEC cells was further detected and analyzed by a flow cytometer.

To this end, first, HUVEC cells were fixed with 0.1% Triton X-100 and permeabilized. Mouse hybridoma STW-139-15 supernatant sample or negative control sample was used and mouse SP2 / 0 cell supernatant was added. After incubating at 4 ° C. for 1 hour and washing with PBS-0.1% FCS solution, FITC-labeled goat anti-mouse IgG (FITC-goat anti-mouse IgG (H + L), manufactured by Sigma) was further added. The cells were incubated at 4 ° C. for 1 hour, washed with PBS-0.1% FCS solution, and then set on a BD Accuri C6Plus Flow Cytometer flow cytometer (manufactured by BD Biosciences, USA) for detection.

FIG. 9 is a schematic diagram of typical results detected by the flow cytometer. As shown in FIG. 9, the mouse hybridoma STW-139-15 supernatant sample clearly bound to human HUVEC cells as compared to the negative control sample (A01 NC) of the mouse SP2 / 0 cell supernatant.

Example 6 Detection of binding between mouse-derived STW-139-15 monoclonal antibody and tissue section of normal human tissue by immunohistochemistry (IHC) method In this example, mouse-derived monoclonal antibody by immunohistochemistry (IHC) method. The binding between the STW-139-15 sample and a section of a part of normal tissue derived from human was detected and analyzed, and the detection step is as follows.

After rehydration and antigen recovery treatment of paraffin sections of normal human tissue, mouse-derived monoclonal antibody STW-139-15 sample was added as a primary antibody, incubated at room temperature for 1 hour, washed, and then further diluted. HRP-labeled goat anti-mouse IgG (secondary antibody) was added, incubated at room temperature for 1 hour, washed, and then DAB, which is a substrate, was added to colorize, secondarily stained with hematoxylin, sealed, and photographed. ..

FIG. 10 is one of the representative results of the immunohistochemistry. As shown in FIG. 10, in immunohistochemical stained sections of normal tissues such as lung, liver, brain, heart, pancreas, spleen, STW-139-15 monoclonal antibody samples specifically bound only to lung tissue. The result of coloring with other tissue sections was not clear. The positive immunohistochemical detection of the STW-139-15 monoclonal antibody in lung tissue was also consistent with the results reported in the literature that the PV-1 gene was expressed in lung tissue, encoding the PV-1 antigen. The cDNA to be used was cloned separately from rat lung tissue at that time (Stan RV et al., 1999 J Cell Biol. 145: 1189-98).

Example 7 Detection of binding of mouse-derived STW-139-15 monoclonal antibody to tissue section of human tumor tissue by immunohistochemistry (IHC) method In this example, mouse-derived STW- The binding between the 139-15 monoclonal antibody sample and a section of a part of human-derived tumor tissue was detected and analyzed, and the detection step is as follows.

After rehydration and antigen recovery treatment of human tumor tissue, mouse-derived STW-139-15 monoclonal antibody sample was added as a primary antibody, incubated at room temperature for 1 hour, washed, and then further diluted HRP label. After adding goat anti-mouse IgG (secondary antibody) and incubating at room temperature for 1 hour to wash, DAB as a substrate was added to colorize, secondary staining with hematoxylin, sealing, and photographing.

FIG. 11 is one of the representative results of the immunohistochemistry. As shown in FIG. 11, the STW-139-15 monoclonal antibody sample was able to specifically bind to vascular-like structures in regions of many tumor tissues (lung cancer, liver cancer, brain tumor, pancreatic cancer, ovarian cancer, etc.). The results of coloration with sections of lymphoma tissue were unclear.

Since the STW-139-15 monoclonal antibody binds to many malignant tumor tissues but not to most normal tissues (see the results of Example 6), the monoclonal antibody specificizes the blood vessels in the tumor region. An ideal substance or vector for the manufacture of a targeted drug or formulation.

Example 8 Detection of binding between mouse-derived STW-139-15 monoclonal antibody and kanikuisaru PV-1 protein by flow cytometry method 1) Alignment analysis of amino acid sequence in epicellular region of human and monkey PV-1 protein Human PV- The result of the alignment analysis of the extracellular amino acid sequence (SEQ ID NO: 8) of one protein and the amino acid sequence (SEQ ID NO: 25) of the extracellular region of the kanikuisaru (Macaca fascicularis) PV-1 protein (NCBI: GenBank: AKG9247.1) is shown in the figure. It is shown in 12. As shown in FIG. 12, in the protein sequence, the homology of the extracellular region of the monkey PV-1 protein and the human PV-1 protein is 95%, and the sequences of 17 amino acid sites are different.

2) Construction of CHO cell line expressing the monkey PV-1 gene Corresponds to Sushu Kin Yuichi Biotechnology Co., Ltd. according to the amino acid sequence (NCBI: GenBank: AKG9247.1) of the full-length protein of crab quill PV-1 published in Genbank. The monkey PV-1 cDNA fragment was requested to be artificially synthesized, treated with a DNA limiting enzyme, and then cloned into a pCDNA3.1-DHFR expression plasmid to obtain a recombinant plasmid. The recombinant plasmid was successfully obtained as a recombinant plasmid (plasmid name: pCDNA3.1-DHFR-mkPV1) capable of expressing the kanikuisaru PV-1 full-length protein on the CHO-dhfr-cell membrane by restriction enzyme cleavage and DNA sequencing. Was confirmed.

The DNA of the above expression plasmid was mixed with Fugen-6 liposome (Roche) and then transfected into DHFR gene-deficient CHO cells (CHO-dhfr-). After transfection, screening was performed on a normal IMDM medium containing 8% FBS to obtain a cell line expressing the cynomolgus monkey PV-1 full-length protein.

3) Analysis of binding between mouse-derived monoclonal antibody STW-139-15 and CHO- / monkey PV-1 cells by flow cytometer A sample of mouse-derived monoclonal antibody STW-139-15 by the flow cytometry method described in Example 4. And the binding of CHO cells (CHO / monoclonal PV-1) expressing the above-mentioned kanikuisaru PV-1 full-length protein was detected and analyzed. Typical detection results of the flow cytometer are a negative control sample (SP2 / 0 myeloma cell culture supernatant, FIG. 13A) and an unrelated mouse monoclonal antibody sample mAB7 (anti-PD-1), as shown in FIG. Compared with the monoclonal antibody, FIG. 13B), the mouse-derived monoclonal antibody STW-139-15 was clearly able to bind to CHO / monkeyPV-1 cells (FIG. 13C). From this result, it was previously shown that different sites of the amino acid sequence of the cynomolgus monkey PV-1 protein and the amino acid sequence of the human PV-1 protein do not affect the binding to the STW-139-15 monoclonal antibody. The results that the STW-139-15 monoclonal antibody can specifically bind to the cynomolgus monkey PV-1 protein also suggested that the cynomolgus monkey is an ideal relevant animal for the study of the STW-139-15 monoclonal antibody in the body.

Example 9. Cloning, amplification and analysis of the gene encoding the variable region of mouse-derived STW-139-15 monoclonal antibody In this example, first, total RNA was extracted from mouse hybridoma cell STW-139-15, and the RNA was used as a template. degenerate primers using (degenerate primer), reverse transcription polymerase chain reaction (reverse transcription-polymerase chain reaction, RT-PCR) method (Wang Y, et al: degenerated primer design to amplify the heavy chain variable region from immunoglobulin cDNA.BMC Bioinformatics .2006; 7 Suppl (4): S9) was used for cloning and amplification, respectively, to obtain cDNA gene fragments of the heavy chain variable region and the light chain variable region of the STW-139-15 antibody. Here, the cloning step of the cDNA gene is as follows.

Process 1. Total RNA was extracted from mouse hybridoma cells STW-139-15 with an RNA extraction reagent (RNAiso Plus, manufactured by Takara).

Process 2. A cDNA template was obtained in an Eppendorf tube by reverse transcription PCR (RT-PCR).

Here, the PCR primer (STW-139-15-L) sequence used for the reverse transcription of the light chain variable region of the STW-139-15 antibody is TGT CGT TCA CTG CCA TCA AT (SEQ ID NO: 9).

The PCR primer (STW-139-15-H) sequence used for reverse transcription of the heavy chain variable region of the STW-139-15 antibody is GCA AGG CTT ACA ACC ACA ATC (SEQ ID NO: 10).

After reacting at a temperature of 42 ° C. for 1 hour, the temperature was raised to 75 ° C., and the cDNA obtained by inactivating for 15 minutes was placed at −20 ° C. and stored for use.

Process 3. Cloning and amplification of light chain variable region and heavy chain variable region genes of STW-139-15 antibody by PCR Cloning of light chain variable region gene of STW-139-15 antibody by degenerate primer and PCR method -The pair of primers used for amplification is as follows.
Forward primer: GAC ATT GTG ATG WCM CA (SEQ ID NO: 11)
Reverse primer: CTG AGG CAC CTC CAG ATG TT (SEQ ID NO: 12)
Here, W = A or T and M = A or C.

The pair of primers used for cloning and amplification of the gene in the heavy chain variable region of the STW-139-15 antibody by the degenerate primer and the PCR method is as follows.
Forward primer: CAR CTG CAR CAR YCT G (SEQ ID NO: 13)
Here, R = A or G and Y = C or T.

Reverse primer: GTG CTG GAG GGG ACA GTC ACT (SEQ ID NO: 14)
The DNA product obtained by PCR amplification was subjected to electrophoretic analysis on a 1% agarose gel. After the completion of electrophoresis, the separated DNA bands were excised and sequenced respectively to obtain the nucleotide sequences of the DNA in the variable regions of the light and heavy chains of the antibody. The nucleotide sequence of the measured DNA of the light chain variable region of the antibody is shown in SEQ ID NO: 15, and the amino acid sequence of the light chain variable region of the antibody inferred from the nucleotide sequence of the DNA is shown in SEQ ID NO: 16. The amino acid sequences of CDR1, CDR2 and CDR3 of the complementarity-determining regions of the light chain are shown in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, respectively.

The nucleotide sequence of the measured heavy chain variable region DNA of the antibody is shown in SEQ ID NO: 20, and the amino acid sequence of the antibody heavy chain variable region inferred from the nucleotide sequence of the DNA is shown in SEQ ID NO: 21. The amino acid sequences of CDR1, CDR2 and CDR3 of the antigen complementarity determining regions of the heavy chain are shown in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, respectively.

Example 10 Construction of human-mouse chimeric antibody STW-139-15-C The light chain variable region gene and heavy chain variable region gene of the mouse-derived STW-139-15 antibody cloned and amplified in Example 9 were obtained, respectively. Human-mouse chimeric light chain gene (STW-139-15-L) and human-mouse chimeric heavy chain fused with gene fragments of human κ light chain constant region (C-domine) and human IgG1-heavy chain constant region. Gene (STW-139-15-H) was obtained. The light chain chimeric gene and the heavy chain chimeric gene are cloned into pcDNA3.1 expression plasmids (Invitrogen), respectively, introduced into Escherichia coli, amplified, separated, and separated into human-mouse chimeric antibody light chain gene and human-mouse chimeric antibody heavy chain. An expression plasmid containing the gene was obtained.

Then, some samples of the expression plasmid containing the human-mouse chimeric antibody light chain gene (recombinant plasmid numbers L17, L18, L19) and some samples of the expression plasmid containing the human-mouse chimeric antibody heavy chain gene (recombinant plasmid numbers L17, L18, L19). Recombinant plasmid numbers H12, H13, and H15) were combined in pairs, mixed with Fugen-6 liposomes (manufactured by Roche), and then co-transfected into CHO cells. 2-3 days after cell transfection, the culture supernatant was taken and a 96-well plate coated with human PV-1-Fc protein, secondary to HRP enzyme-labeled goat anti-human IgG (Fab Specific). As an antibody (purchased from Shanghai Xingtan Biological Co., Ltd.), in order to detect the secondary antibody, the numerical value was read at 492 nm by a microplate reader, and the binding between the chimeric antibody and the human PV-1 protein in the supernatant was detected.

Representative detection results (reading value at 492 nm) of the ELISA are shown in Table 1 and FIG. 14 below.

From the results in Table 1 and FIG. 14, a plasmid that accurately expresses the human-mouse chimeric antibody STW-139-15 heavy chain gene and a plasmid that accurately expresses the human-mouse chimeric antibody STW-139-15 light chain gene are found. It was shown that the cultured supernatant (H15 + L19) sample of the transfected CHO cells can specifically bind to the human PV-1-Fc protein.

The supernatant of the transfected cells is centrifuged, filtered through a 0.45 μm filter, set on a protein A affinity chromatography column (protein A-Sepharose Fast Flow, manufactured by GE, USA), separated, purified, and purified. Obtained 95% or more of human-mouse chimeric antibody (STW-139-15-C) protein.

The purified STW-139-15-C antibody protein is sterilized by filtration and then redissolved in sterile PBS solution to prepare a liquid preparation having a final solubility of about 10 mg / ml. It can be stored for a long time at low temperature, avoiding light.

Example 11 Measurement of biotherapeutic effect or activity of human-mouse chimeric antibody STW-139-15-C in cynomolgus monkey Since STW-139-15 does not recognize mouse PV-1, its biological therapeutic effect in mouse body. Alternatively, the activity can be measured. Therefore, in this example, a cynomolgus monkey was used as a test animal, and a test study was conducted on the suppression of the human-mouse chimeric antibody STW-139-15-C in the body by laser on the choroidal neovascularization of the cynomolgus monkey. The study was commissioned to Chengdu Hua Xinghai Pharmaceutical Technology Co., Ltd. (WestChina-Frontier PharmaTech Co., WCFP), that is, the National Chengdu Center for Safety Education of Drugs.

Objectives To study the effect of laser administration of a human-mouse chimeric antibody (STW-139-15C, sample number STW007) by intravitreal injection on the permeation and growth of choroidal neovascularization of crab monkeys, and to further study the drug in animal studies. Provide the basis for.

The study of the animal test is divided into two stages, and the description of the test model, administration group and test results of the first stage is as follows.
Animal test model and administration group 11.1 Construction of model 11.1.1 Anesthesia To anesthetize cynomolgus monkeys with sodium pentobarbitalton (25 mg / kg, intravenous injection) to maintain corneal moisturization irregularly during anesthesia A small amount of selvisc was added dropwise.

11.1.2 Pupil enlargement Midorin (composite tropicamide ophthalmic solution) was added dropwise to both eyes to enlarge the pupil.

11.1.3 Laser photocoagulation The head of a cynomolgus monkey was fixed in front of an ophthalmic laser photocoagulator and the macula region was photocoagulated by a total retinal image detector. Photocoagulation surrounds the fovea centralis of the macula, but the fovea centralis is not damaged and irradiation is applied to 8 to 9 spots in each eye. Laser parameters: spot diameter 50 μm, energy 0.6-0.7 W, exposure time 0.05 s. Judgment of successful photocoagulation: Foam formation is seen, suggesting the destruction of the Bruch film.

Fluorosein angiography was performed 2-3 weeks after laser photocoagulation, which was used as the basis for determining the success of model construction.

A successful model construction is determined if each monkey has at least one grade 4 spot on each eye.

11.2 Dosage Design Animals in each group started dosing 3 weeks after laser photocoagulation. The dosage design is shown in Table 2.

Here, the positive drug hPV19 monoclonal antibody is a humanized antibody that specifically recognizes and binds to human and monkey VEGF antigens (Chinese patent document: Granted patent number: 201210540692X, Patent name: Vascular Endothelial Growth Factor and its receptor). Monoclonal antibodies that antagonize and inhibit the binding of, and their coding sequences and uses, as well as US Patent Documents: Granted Patent Number: US9580498B2).

11.3 Administration Route of administration: Intravitreal injection of both eyes Reason for selection of route of administration: Consistent with clinical route of administration Administration frequency: Single dose Administration method: Crab quizzes in each group were anesthetized with pentobarbitalton sodium (approx. 25 mg / kg, intravenous injection. The appropriate dose of anesthesia can be adjusted according to the anesthesia situation of the monkey.) After that, the eyes to be injected are disinfected with povidone iodine solution and treated by intravitreal injection of both eyes shown in Table 2. STW007, positive drug and STW007 + positive drug were administered at the same concentration, and in the model control group, an equal volume of 0.9% NaCl injection solution was administered. If necessary, 1 to 2 drops of oxybuprocaine hydrochloride ophthalmic solution was added dropwise to the eye to be injected for surface anesthesia, and then the injection operation was performed.

After intravitreal injection, 1-2 drops of ofloxacin eye ointment were added dropwise to prevent infection and moisturize the cornea.
The day of administration is defined as the first day of the study.

Second stage: Animal test results:
Table 3 shows the reduction and improvement of fluorosane leakage area in cynomolgus monkeys injected with STW-139-15C monoclonal antibody (STW007) and positive control drug hPV19 (anti-VEGF monoclonal antibody) into the vitreous 3 weeks after photocoagulation. Effect on rate (data statistics are up to 49 days post-dose).

15A-15D are fundus fluorescence imaging images at days 7, 14 and 21 after administration by injection into the vitreous of each group of animals, respectively.

Note: At the time of measurement from the 7th day after the administration to the 36th day after the administration, the sample size was 1 because there was no data on the fluorosane leakage area in the right eye in the sample 1 + 2 group 4M001.

As shown in Table 3 and FIG. 15A, in the model control group (0.9% NaCl injection), there was no improvement in fundus fluorosane leakage after administration as compared with before treatment, but rather severe. It became severe (the average improvement rate of the fluorosane leakage area during the observation period was -11.12% to -54.73%. A series of photographs of fundus fluorescence imaging on day 7-21 is shown in FIG. 15A. See). On the other hand, in the STW-139-15C monoclonal antibody sample (0.5 mg / eye), the fundus fluorosane leakage area was clearly improved from the 7th day after administration (the improvement rate of the fluorosane leakage area during the observation period was 33). It was .27% to 64.10%. See FIG. 15B for a series of photographs of fundus fluorescence imaging on day 7-21). The degree of reduction in fluorosane leakage was close to the result of the positive control drug hPV19 (anti-VEGF monoclonal antibody) group at the same dose (0.5 mg / eye) (the range of improvement rate of fluorosane leakage area during the observation period was It was 45.75% to 71.12%. See FIG. 15C for a series of photographs of fundus fluorescence imaging on day 7-21).

After the combined use of the STW-139-15C monoclonal antibody sample (0.25 mg / eye) and the positive control drug hPV19 monoclonal antibody (0.25 mg / eye), the improvement rate of the fluorosane leakage area during the observation period was 80.28% or more. The therapeutic effect was maintained between 95.20% (see Figure 15D for a series of photographs of the fundus fluorescence imaging on days 7-21), with the therapeutic effect being halved in each injection dose of the single drug. It is superior to the double injection dose of the positive control drug hPV19 monoclonal antibody (0.5 mg / eye). From this result, the STW-139-15C monoclonal antibody that specifically binds to PLVAP / PV-1 has a clear inhibitory effect on the permeation of laser-induced choroidal neovascularization in the cynomolgus monkey body, and STW-139-15C. It can be seen that the combined use of the monoclonal antibody and the VEGF monoclonal antibody drug has a superior therapeutic effect as compared with the case of treating each alone.

Claims (18)

A monoclonal antibody or derivative thereof that specifically binds to the human antigenic membrane vesicle-related protein PV-1, and comprises a first variable region and a second variable region, wherein the first variable region is It is an antibody light chain variable region, and its antigen complementarity determining regions CDR1, CDR2 and CDR3 are amino acid sequences represented by SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, respectively, and the second variable region is an antibody heavy chain. An antibody or a derivative thereof, which is a variable region, wherein the antigen complementarity determining regions CDR1, CDR2 and CDR3 are amino acid sequences represented by SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, respectively. The first variable region is the antibody light chain variable region and is the amino acid sequence shown by SEQ ID NO: 16, and the second variable region is the antibody heavy chain variable region and is the amino acid sequence shown by SEQ ID NO: 21. The antibody or derivative thereof according to claim 1, wherein the antibody or derivative thereof is present. A claim comprising the antibody light chain variable region and the human antibody light chain constant region, and including the hinge region, CH1, CH2 region, and CH3 region of the antibody heavy chain variable region and the human antibody heavy chain constant region. Item 1 or 2, the antibody or derivative thereof. The human antibody light chain constant region is derived from a human antibody κ chain or antibody λ chain, and the human antibody heavy chain constant region is derived from a subtype of human IgG1, IgG2, IgG3 or IgG4, IgA or IgM. The antibody or derivative thereof according to claim 3. The derivative may be an antibody Fab fragment, an Fv fragment, a single-stranded antibody, a bispecific antibody, an antibody-drug conjugate (ADC), or a chimeric antigen receptor T-. The antibody or derivative thereof according to claim 1 or 2, which is Cell, CAR-T). The DNA molecule or gene encoding the antibody or derivative thereof according to claim 2, wherein the antibody light chain variable region is the nucleotide sequence represented by SEQ ID NO: 15, and the antibody heavy chain variable region is SEQ ID NO: 20. A DNA molecule or gene characterized by being the nucleotide sequence shown. An expression vector comprising the DNA molecular sequence according to claim 6 and an expression regulatory sequence functionally linked to the sequence. A recombinant host cell characterized by being transformed with the expression vector according to claim 7. The recombinant host cell or progeny cell according to claim 8, wherein the recombinant host cell or progeny cell expresses the antibody or derivative thereof according to claim 1 or 2. A drug or drug composition comprising a pharmaceutically effective amount of the antibody or derivative thereof according to claim 1 or 2, and a pharmaceutically acceptable carrier. The drug composition according to claim 10, which comprises a pharmaceutically effective amount of an active ingredient that antagonizes or blocks vascular endothelial growth factor VEGF or its receptor VEGF-R, and a pharmaceutically acceptable carrier. Stuff. Use of the drug or drug composition according to claim 10 or 11 in the manufacture of a drug for treating a disease associated with angiogenesis or permeation. The use according to claim 12, wherein the disease is a choroidal neovascular fundus disease. The use according to claim 13, wherein the choroidal neovascular fundus disease is diabetic retinopathy and age-related macular degeneration. A monoclonal antibody or a derivative thereof that can bind to both the human and monkey plasma membrane vesicle-related protein PV-1, and the antibody is an antigen having an amino acid sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 25. An antibody or derivative thereof that binds and binds to PV-1 in competition with the antibody or derivative thereof according to claim 1 or 2. A method for antagonizing or blocking angiogenesis or permeation in the body by the plasma membrane vesicle-related protein PV-1, and administering an appropriate dose of the antibody or derivative thereof according to claim 1, 2 or 15. How to include. A reagent or kit for detecting the plasma membrane vesicle-related protein PV-1 in a tissue or cell sample, which comprises the monoclonal antibody or derivative thereof according to claim 1, 2 or 15. A method for producing an antibody or a derivative thereof according to claim 1, 2 or 15.
a) A step of providing an expression vector containing the DNA molecular sequence according to claim 6 and an expression regulatory sequence functionally linked to the sequence.
b) A step of transforming a host cell with the expression vector according to step a).
c) Include a step of culturing the host cell obtained in step b) under conditions suitable for the expression of the antibody, and d) a step of separating and purifying the antibody from the culture solution of the host cell by affinity chromatography. A method characterized by.

Images