JP2021193929A - Multilayered premixed reagent for nucleic acid amplification reaction, and ready-to-use nucleic acid amplification reaction kit - Google Patents

Abstract

To provide a premixed reagent for nucleic acid amplification reaction by which nucleic acid amplification reaction can be simply performed only by mixing a sample, and a ready-to-use nucleic acid amplification reaction kit including the reagent.SOLUTION: A kit for nucleic acid amplification reaction including a reaction vessel and a reagent for nucleic acid amplification reaction housed in the reaction vessel, in which the reagent is a multilayered reagent premix cryopreserved in a laminated state including: a first reagent layer including nucleic acid polymerase; a second reagent layer including primer oligonucleotide; and a membrane which partitions the first reagent layer and the second reagent layer, and consists of a substance that is in a solid state at the temperature lower than 0°C and dissolves into aqueous solution at 0 to 35°C.SELECTED DRAWING: Figure 1A

Description

The present invention relates to a multi-layered premix reagent for a nucleic acid amplification reaction and a Ready to use nucleic acid amplification reaction kit containing the same.

The test reaction solution for genetic tests such as PCR (polymerase chain reaction) and LAMP (Loop-Mediated Isothermal Amplification) method contains a nucleic acid polymerase in addition to a primer oligonucleotide, a nucleoside triphosphate, and a reaction buffer. Premix reagents and freeze-drying reagents that are premixed with multiple of these are also on the market for the sake of simplification of reaction operations. It is preferable to prepare the reagents separately from the above. When actually preparing the reaction solution, careful operation using a micropipette or the like that can accurately divide the volume is required. This is because the amount of polymerase (enzyme) greatly affects the efficiency of the detection reaction, sometimes resulting in false positives and false negatives.

Currently, the RT-PCR method is used to test for COVID-19 infection, which is causing a pandemic worldwide. Although it is relatively easy to prepare a reaction solution using a dedicated reagent kit, the above reasons Therefore, the current situation is that careful operation by a person who has received some training and physics and chemistry equipment such as micropipettes that are unfamiliar to the general public are required, which are the RT-LAMP method and the SATIC method (Patent Document 1 and non-patent documents). The same applies to other genetic testing methods such as 1).

WO 2016/152936

Anal. Chem., 2016, 88 (14), pp 7137-7144

The present invention provides a nucleic acid amplification reaction premix reagent having excellent storage stability and a ready-to-use nucleic acid amplification reaction kit containing the same, which can easily carry out a nucleic acid amplification reaction simply by mixing a sample. Make it an issue.

The present inventors have made diligent studies to solve the above problems. As a result, it separates the first reagent layer containing the nucleic acid polymerase, the second reagent layer containing the primer oligonucleotide set, and the first reagent layer and the second reagent layer. Succeeded in developing a multi-layer reagent premix that was cryopreserved in a laminated state containing a film composed of a substance that dissolves in an aqueous solution between them, and a nucleic acid amplification reaction in which this multi-layer reagent premix was housed in a container. We have found that by using the kit, it is possible to easily carry out a genetic test based on a nucleic acid amplification reaction while maintaining the performance of the reagent, and have completed the present invention.

The gist of the present invention is as follows.
[1] A nucleic acid amplification reaction kit containing a reaction vessel and a nucleic acid amplification reaction reagent contained in the reaction vessel.
The reagent is a first reagent layer containing a nucleic acid polymerase and
A second reagent layer containing a primer oligonucleotide and
A membrane that separates the first reagent layer and the second reagent layer and is composed of a substance that is solid below 0 ° C but dissolves in an aqueous solution between 0 and 35 ° C.
A kit for a nucleic acid amplification reaction, which is a multi-layer reagent premix that has been cryopreserved in a laminated state containing.
[2] The kit for nucleic acid amplification reaction according to [1], wherein the second reagent layer further contains a nucleic acid substrate and a reaction buffer.
[3] The kit for nucleic acid amplification reaction according to [1] or [2], wherein the nucleic acid amplification reaction is PCR (polymerase chain reaction).
[4] The kit for nucleic acid amplification reaction according to [1] or [2], wherein the nucleic acid amplification reaction is a LAMP (Loop-Mediated Isothermal Amplification) method.
[5] The nucleic acid amplification reaction is the SATIC method, the second reagent layer contains a first primer and a second primer, and further, a first single-stranded cyclic DNA and a second reagent layer are provided between the first reagent layer and the second reagent layer. 2 It contains an intermediate reagent layer containing single-stranded cyclic DNA, and the intermediate reagent layer is dissolved in each of the first reagent layer and the second reagent layer and in an aqueous solution between 0 and 35 ° C, although it is solid below 0 ° C. The kit for nucleic acid amplification reaction according to [1], which is isolated by a membrane composed of a reagent.
[6] The kit for nucleic acid amplification reaction according to [5], wherein the intermediate reagent layer further contains a nucleic acid substrate and a reaction buffer.
[7] The nucleic acid amplification reaction kit according to [5] or [6], wherein the first primer and the second primer are immobilized on a carrier.
[8] The substance which is solid below 0 ° C. but dissolves in an aqueous solution between 0 and 35 ° C. is polyethylene glycol, polyvinyl alcohol, a sugar chain compound, a polyamide chain compound, or a water-soluble heterocyclic compound having a self-assembling ability. The kit for a nucleic acid amplification reaction according to any one of [1] to [7], which is a cyclic compound.
[9] In the nucleic acid-containing sample, which comprises the step of arranging the nucleic acid amplification reaction kit according to any one of [1] to [8] in the temperature control device and the step of adding the nucleic acid-containing sample into the reaction vessel. Nucleic acid amplification method.
[10] A step of adding a liquid containing a nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer.
A step of laminating a film composed of a substance that is solid at less than 0 ° C. but dissolves in an aqueous solution between 0 and 35 ° C. on the first reagent layer, and a primer on the film at a temperature of less than 0 ° C. A method for producing a nucleic acid amplification reaction kit, which comprises a step of adding a liquid containing an oligonucleotide to form a second reagent layer, which comprises containing a multi-layer reagent premix in a reaction vessel.
[11] The method for producing a nucleic acid amplification reaction kit according to [10], wherein the nucleic acid amplification reaction is PCR or LAMP method.
[12] A step of adding a liquid containing a nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer.
A step of laminating a film composed of a substance that is solid at less than 0 ° C. but dissolves in an aqueous solution between 0 and 35 ° C. on the first reagent layer.
A step of adding a liquid containing a first single-stranded circular DNA and a second single-stranded circular DNA onto the membrane at a temperature of less than 0 ° C. to form an intermediate reagent layer.
A step of laminating a membrane composed of a substance that is solid at less than 0 ° C but soluble in an aqueous solution between 0 and 35 ° C on an intermediate reagent layer at a temperature of less than 0 ° C.
A multilayer reagent premix is housed in a reaction vessel, which comprises a step of adding a liquid containing a first primer and a second primer onto the membrane at a temperature of less than 0 ° C. to form a second reagent layer. , SATIC reaction kit manufacturing method.

According to the present invention, since the nucleic acid amplification reaction can be easily performed by simply adding the sample to the premix, it does not require multiple operations with a micropipette or the like and can be handled by ordinary people without special skills. At the same time, the throughput of genetic tests such as PCR tests can be significantly improved. Since the operation can be greatly simplified, false positives due to contamination and false negatives due to forgetting to insert the reagent can be significantly reduced. Further, since the nucleic acid polymerase and the primer oligonucleotide are not mixed until immediately before the reaction, there is no problem of reagent deterioration and the like, and the storage stability is excellent.

The schematic diagram of the first aspect of the multilayer reagent premix. The schematic diagram of the second aspect (when the intermediate layer is included) of the multilayer reagent premix. Schematic diagram of the SATIC method. The figure which shows the result of Example 1 (the drawing substitute photograph). The figure which shows the result of Example 2 (the drawing substitute photograph). The figure which shows the result of Example 3 (the drawing substitute photograph).

<Nucleic acid amplification reaction kit>
The nucleic acid amplification reaction kit of the present invention is
A nucleic acid amplification reaction kit containing a reaction vessel and a nucleic acid amplification reaction reagent contained in the reaction vessel.
The reagent is a first reagent layer containing a nucleic acid polymerase and
A second reagent layer containing a primer oligonucleotide and
A membrane that separates the first reagent layer and the second reagent layer and is composed of a substance that is solid below 0 ° C but dissolves in an aqueous solution between 0 and 35 ° C.
It is characterized by being a multi-layer reagent premix stored frozen (less than 0 ° C., for example, −10 ° C. to −30 ° C.) in a laminated state containing.

The nucleic acid amplification reaction may be a reaction in which a primer is hybridized to a target nucleic acid and a polynucleotide chain is extended from the primer by a nucleic acid polymerase, and examples thereof include PCR, LAMP method, SATIC method, and SmartAmp method. Without limitation, the kit of the present invention can be widely used for nucleic acid amplification reaction.

In the nucleic acid amplification reaction kit of the present invention, in the nucleic acid amplification reaction reagent housed in the reaction vessel, the first reagent layer containing the nucleic acid polymerase and the second reagent layer containing the primer oligonucleotide are "at least below 0 ° C." It is separated via a "film" that is a solid but is composed of a substance that dissolves in an aqueous solution between 0 and 35 ° C. (FIG. 1A).

By using the above substance for this membrane, the nucleic acid polymerase and primer oligonucleotide are separated during cryopreservation, and the reagent is thawed at the time of use, and the temperature is between 0 ° C and 35 ° C while the temperature is being raised. When the membrane is dissolved in the aqueous solutions of the first reagent layer and the second reagent layer and mixed (FIG. 1A), the reaction solution is automatically prepared, and the sample (nucleic acid-containing sample) is added thereto. Then, the nucleic acid amplification reaction can be promoted only by setting the reaction vessel to the reaction temperature.

The substance may be a substance that is solid at least below 0 ° C. but dissolves in an aqueous solution at 0 to 35 ° C. (preferably 10 to 30 ° C.), but a substance that does not interfere with the polymerase reaction is preferable. Specifically, polyethylene glycol having a molecular weight in a predetermined range (600 to 8000, preferably 1000 to 6000) (for example, PEG1000 or an alternative thereof (PEG having a different molecular weight, branched PEG and a mixture thereof), polyvinyl alcohol, starch / cellulose). • Branched sugar chain compounds such as agarose, dextran, dextrin, oligosaccharides and mixtures thereof, branched polyamide chain compounds such as poly (oligo) lysine, poly (oligo) glutamate, collagen and Examples thereof include a mixture thereof, a water-soluble heterocyclic compound having a self-assembling ability such as melamine and guanine, and the like.

The first reagent layer is an aqueous solution containing a nucleic acid polymerase. The nucleic acid polymerase may be a DNA polymerase or an RNA polymerase. The DNA polymerase can be arbitrarily selected depending on the desired reaction, and examples thereof include heat-resistant DNA polymerases (Taq, Pfu, etc.), strand-substituted DNA polymerases, reverse transcriptases, and the like. Strand-substituted DNA polymerases include phi29 polymerase, Klenow DNA Polymerase (5'-3', 3'-5' exo minus), Aac DNA Polymerase, Sequence® Version 2.0 T7 DNA Polymerase (USB), Bsu. Medium-temperature strand-replacement DNA polymerases such as DNA Polymerase, Large Fragment (NEB), Bst DNA Polymerase (Large Fragment), Bsm DNA Polymerase, Large Fragment (Fermentas), BcaBEST DNA polymerase (TakaraBio), Vent DNA Examples thereof include heat-resistant strand-replacement DNA polymerases such as polymerase (NEB), Deep Vent DNA polymerase (NEB), and DisplaceAce (registered trademark) DNA Polymerase (Epicentre).

For example, a thermostable DNA polymerase can be used for PCR, and a strand replacement DNA polymerase can be used for the LAMP method and the SATIC method.
The content of the nucleic acid polymerase is not particularly limited as long as it is an amount required for the nucleic acid amplification reaction, and the required amount may be contained according to the specific activity of the enzyme or the like. Two or more kinds of nucleic acid polymerases may be combined.
The first reagent layer may contain a stabilizer such as glycerol to stabilize the nucleic acid polymerase.

The second reagent layer is an aqueous solution containing a primer oligonucleotide. As the primer oligonucleotide, the required number of primer oligonucleotides can be used depending on the type of nucleic acid amplification reaction. For example, for PCR, a set of a forward primer and a reverse primer for amplifying the target site of the target nucleic acid may be used, but in nested PCR and the like, three or more kinds of primer oligonucleotides can be contained.
In addition, in the LAMP method (reference: principles and applications of the LAMP method, Modern Media Vol. 60, No. 7, 2014, p211-213), four types of FIP, BIP, F3 primer, and B3 primer may be used, or FIP and BIP. , Loop primer B and Loop primer F may be used, or 6 types of FIP, BIP, F3 primer, B3 primer, Loop primer B and Loop primer F may be used.
Further, in the SmartAmp method (reference: PLoS ONE, 2012, doi: 10.1371 / journal.pone.0030236), four types of TP, FP, OP, and BP may be used.
Further, in the SATIC method, two types of primers, a first primer and a second primer, as described later may be used.
In the case of RNA polymerase reaction or reverse transcription reaction, one kind of primer may be used.

The second reagent layer may further contain a nucleic acid substrate (such as deoxynucleoside triphosphate) and a reaction buffer. The reaction buffer can be appropriately selected depending on the enzyme.
Further, the second reagent layer may further contain a salt, a surfactant, a detection reagent such as a color-developing reagent or a luminescent reagent, and the like.
The concentrations of the primer, nucleic acid substrate, etc. may be appropriately adjusted in consideration of the volume of the final reaction solution.
In the SATIC method premix, when an intermediate reagent layer is provided as described later, a nucleic acid substrate (deoxynucleoside triphosphate, etc.), a reaction buffer, a salt, a surfactant, and color development are provided in the intermediate reagent layer. It may contain a detection reagent such as a reagent or a luminescent reagent.

Either the first reagent layer or the second reagent layer may be the upper layer, but it is preferable that the first reagent layer is the lower layer.

Hereinafter, the SATIC method will be described.
The SATIC method uses a single-stranded circular DNA and a primer disclosed in Patent Document 1 to form a tripartite complex of a target (template) nucleic acid, a single-stranded circular DNA and a primer, and at an isothermal temperature (37 ° C). It is a method for amplifying nucleic acid, and preferably means a method using the first and second single-stranded circular DNAs and the first and second primers described below.

In the preferred SATIC mode,
(I) A sequence of 10 to 30 bases complementary to the first site of the target nucleic acid,
The 7-8 base first primer binding sequence adjacent to the 5'side of the sequence and
The second single-stranded circular DNA binding sequence and
First single-stranded circular DNA containing
(Ii) A sequence of 8 to 15 bases complementary to the second site adjacent to the 3'side of the first site of the target nucleic acid,
A sequence of 7 to 8 bases adjacent to the 3'side of the sequence and complementary to the first primer binding site of the first single-stranded circular DNA.
A first oligonucleotide primer containing
(Iii) The same sequence as the second single-stranded circular DNA binding sequence of the first single-stranded circular DNA,
The second primer binding sequence adjacent to the 5'side of the sequence and
2nd single-stranded circular DNA, including
(Iv) With the same sequence as the site adjacent to the 5'side of the 2nd single-stranded circular DNA binding sequence of the 1st single-stranded circular DNA.
A sequence complementary to the second primer binding sequence of the second single-stranded circular DNA adjacent to the 3'side of the sequence,
With a second oligonucleotide primer, including
Is used,
More preferably
The first oligonucleotide primer is bound to the carrier via its 5'end.
The second oligonucleotide primer is bound to the carrier to which the first oligonucleotide primer is bound via its 5'end.

<1st single-stranded circular DNA>
The first single-stranded circular DNA contains a sequence of 10 to 30 bases complementary to the first site of the target nucleic acid.
A primer binding sequence of 7 to 8 bases adjacent to the 5'side of the sequence and a primer binding sequence of 7 to 8 bases.
The second single-stranded circular DNA binding sequence and
including.

The SATIC method will be described with reference to FIG. However, in the case of single-stranded circular DNA, it is 5'→ 3'clockwise. Further, in FIG. 2, the carrier is not shown for convenience.
The first single-stranded circular DNA 20 contains a sequence 201 complementary to the first site 211 of the target nucleic acid 21, a primer-binding sequence 202 linked to the 5'side thereof, and a second single-stranded circular DNA-binding sequence 203. ..
The length of sequence 201 is usually 10 to 30 bases, preferably 15 to 25 bases, and the GC content is preferably 30 to 70%. The length of the sequence 202 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The total length of the first single-stranded circular DNA 20 is preferably 35 to 100 bases.

The first single-stranded circular DNA 20 can be obtained by circularizing the single-stranded DNA (ssDNA). Circulation of single-stranded DNA can be performed by any means, for example, CircLigase®, CircLigase II®, ssDNA Ligase (Epicentre), ThermoPhage ligase® single-stranded. It can be performed using DNA (Prokzyme).

<First oligonucleotide primer>
The first oligonucleotide primer 22 is linked to the sequence 221 of 8 to 15 bases complementary to the second site 212 adjacent to the 3'side of the first site 211 and the 3'side thereof of the target nucleic acid 21. It also contains a 7-8 base sequence 222 complementary to the primer binding site 202 of the first single-stranded circular DNA 20.

The first oligonucleotide primer 22 is attached to the carrier via its 5'end.
Examples of the 5'end of the first oligonucleotide primer 22 include those modified with a biotin, an amino group, an aldehyde group, or an SH group. Examples of the carrier include a carrier capable of binding to each of these, and examples thereof include a carrier on which avidin (including a derivative thereof, that is, for example, streptavidin, neutravidin, etc.) is immobilized, and an amino group and an aldehyde group. , A carrier surface-treated with a silane coupling agent having an epoxy group or the like. Immobilization may follow a conventional method.

The carrier preferably has a carrier capable of fixing the first oligonucleotide primer 22 and the second oligonucleotide primer 25, which will be described later, in the vicinity thereof. The presence of both in the vicinity allows the first oligonucleotide primer 22 to amplify the first amplification product 23 and the second oligonucleotide primer 25 to amplify the second amplification product 26 in the solution. This is because it is performed more efficiently than the case where two kinds of primers in a free state are used, and as a result, a significant improvement in detection sensitivity can be achieved.

Preferred carriers include, for example, beads and flat carriers such as substrates used in sensors and the like. The beads are particulate insoluble carriers having an average particle size of, for example, 10 nm to 100 μm, preferably 30 nm to 10 μm, more preferably 30 nm to 1 μm, and further preferably 30 nm to 500 nm. The material of the beads is not particularly limited. Examples thereof include magnetic materials (magnetic materials such as iron oxide such as ferrite and magnetite, chromium oxide and cobalt), silica, agarose and sepharose. Magnetic beads are sometimes referred to as "magnetic beads". Further, metal colloid particles such as gold colloid can also be used.

<Second single-stranded circular DNA>
The second single-stranded circular DNA 24 has the same sequence 241 as the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20.
The second primer binding sequence 242 adjacent to the 5'side of the sequence and
including.
The length of sequence 203 is usually 10 to 30 bases, preferably 15 to 25 bases, and the GC content is preferably 30 to 70%. The length of the sequence 242 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The length of the sequence 242 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The total length of the second single-stranded circular DNA 24 is preferably 35 to 100 bases. The second single-stranded circular DNA 24 can be obtained by circularizing the single-stranded DNA (ssDNA) by the method described above.

The second single-stranded circular DNA 24 preferably contains a sequence complementary to the detection reagent binding sequence. Examples of the detection reagent binding sequence include a guanine quadruple chain forming sequence.
Examples of the guanine quadruple chain forming sequence include sequences as described in Nat Rev Drug Discov. 2011 Apr; 10 (4): 261-275., G ₃ N _1-10 G ₃ N _1-10 G. _{It is represented by 3} N _1-10 G ₃ , and specifically, the sequence described in Patent Document 1 and the like are exemplified. Therefore, as the sequence 243 complementary to the guanine quadruple chain forming sequence, C ₃ N _1-10 C ₃ N _1-10 C ₃ N _1-10 C ₃ is exemplified. That is, it is a sequence in which three consecutive Cs are repeated four times with a sequence consisting of 1 to 10 (preferably 1 to 5) arbitrary bases (N = A, T, G or C) as a spacer. ..

In addition, in FIG. 2, the case where the second single-stranded circular DNA 24 contains a sequence 243 complementary to the guanine quadruplex forming sequence has been described, but the second single-stranded circular DNA 24 may be detected, for example, in addition to this. The aptamer-binding sequence is an aptamer sequence or a molecular beacon (a hairpin-like oligonucleotide having a fluorescent group (donor) and a quenching group (acceptor) that causes FRET), and an aptamer-binding color-developing molecule or molecular beacon is used as a detection reagent. It can also be detected using (ChemBioChem 2007, 8, 1795-1803; J. Am. Chem. Soc. 2013, 135, 7430-7433).

<Second oligonucleotide primer>
The second oligonucleotide primer 25 has the same sequence 251 as the site 204 adjacent to the 5'side of the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20 (preferably a sequence of 8 to 15 bases). When,
A sequence 252 (preferably a sequence of 7 to 8 bases) complementary to the second primer binding sequence 242 of the second single-stranded circular DNA 24 adjacent to the 3'side of the sequence.
including.

The second oligonucleotide primer 25 is bound to the carrier to which the first oligonucleotide primer 22 is bound via its 5'end.
That is, the 5'end of the first oligonucleotide primer 22 is modified with biotin, and the second oligonucleotide primer 25 is bound to a carrier on which avidin is immobilized via the biotin. , The 5'end thereof is modified with biotin, and it is preferable that the 5'end is bound to the carrier to which the first oligonucleotide primer 22 is bound via the biotin.

The quantitative ratio of the first oligonucleotide primer 22 and the second oligonucleotide primer 25 immobilized on the carrier is a molar ratio, preferably 1:10 to 1: 100, and more preferably 1:10 to 1: 1. It is 30, more preferably 1:10 to 1:25.

The concentration of the first oligonucleotide primer 22 during the amplification reaction (during use) is preferably 0.0025 pmol / μL or more, more preferably 0.005 pmol / μL or more, and preferably 0.04 pmol / μL or more in terms of molar ratio. Below, it is more preferably 0.02 pmol / μL or less.
The concentration of the second oligonucleotide primer 25 during the amplification reaction (during use) is preferably 0.0125 pmol / μL or more, more preferably 0.025 pmol / μL or more in terms of molar ratio, while 0.8 pmol / μL. Below, it is more preferably 0.4 pmol / μL or less.

The amount ratio of the first single-stranded circular DNA 20 to the second single-stranded circular DNA 24 during the amplification reaction (during use) is a molar ratio, preferably 1: 2 to 1: 1000, more preferably 1: 3 to 1. : 500, more preferably 1: 4 to 1: 400.
The lower limit of the concentration of the first single-stranded circular DNA 20 during the amplification reaction (during use) is, for example, 0.1 nM or more, 1 nM or more, 10 nM or more, 50 nM or more, while the upper limit is, for example, 500 nM or less, 200 nM or less. Is.
The lower limit of the concentration of the second single-stranded circular DNA 24 during the amplification reaction (during use) is, for example, 20 nM or more, 40 nM or more, 100 nM or more, 200 nM or more, while the upper limit is, for example, 1000 nM or less, 500 nM or less. be.

<Amplification method>
As shown in FIG. 2, first, the target nucleic acid 21 is hybridized with the first single-stranded circular DNA 20 and the primer 22 to form a complex of the three, and then the target nucleic acid is subjected to the rolling circle amplification (RCA) method. A nucleic acid amplification reaction based on 21 is performed.

Those skilled in the art can examine the combination of the single-stranded circular DNA 20, the target nucleic acid 21, and the primer and appropriately set the hybridization conditions.

The RCA method is described in Lizardi et al., Nature Genet. 19: 225-232 (1998); US Pat. Nos. 5,854,033 and 6,143,495; PCT application WO 97/19193, etc. .. The RCA method can be carried out by using, for example, a strand-substituted DNA polymerase such as phi29 DNA polymerase as described above.

The DNA elongation reaction by RCA is carried out, for example, at a constant temperature in the range of 25 ° C to 65 ° C. The reaction temperature is appropriately set by a usual procedure based on the optimum temperature of the enzyme and the denaturation temperature based on the primer chain length (the temperature range in which the primer binds (anneals) / dissociates to DNA). Furthermore, it is also carried out at a constant relatively low temperature. For example, when phi29 DNA polymerase is used as a strand-substituted DNA synthase, the reaction is preferably at 25 ° C to 42 ° C, more preferably at about 30 to 37 ° C.

RCA amplifies the first amplification product 23 from primer 22 along the first single-stranded circular DNA 20 in a manner dependent on the target nucleic acid 21.

Since the amplification product 23 contains the sequence 233 complementary to the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20, the second single-stranded circular DNA 24 containing the same sequence 241 as this sequence 203. Hybridizes to sequence 233 of the first amplification product 23 via sequence 241.
The second oligonucleotide primer 25 hybridizes to the complex of the first amplification product 23 and the second single-stranded circular DNA 24 thus formed to form a tripartite complex.

That is, since the second oligonucleotide primer 25 has the same sequence 251 as the site 204 adjacent to the 5'side of the second single-stranded circular DNA-binding sequence 203 of the first single-stranded circular DNA 20, the first amplification product. It hybridizes to region 234 complementary to site 204 of the first single-stranded circular DNA 20 of 23 via sequence 251.

Further, since the second oligonucleotide primer 25 has a sequence 252 complementary to the second primer binding sequence 242 of the second single-stranded circular DNA 24 on the 3'side of the sequence 251, the second single-stranded circular DNA 24 has a sequence 252. Also hybridizes via sequence 252.

The second amplification product 26 is amplified by RCA from the tripartite complex of the first amplification product 23, the second single-stranded circular DNA 24, and the second oligonucleotide primer 25. The second amplification product 26 contains, for example, sequence 261 containing a guanine quadruple chain and is detected by the guanine quadruple chain detection reagent 262. The second single-stranded circular DNA 24 hybridizes to each of the regions 231 contained in the first amplification product 23, and an RCA reaction occurs.

By immobilizing the first oligonucleotide primer 22 and the second oligonucleotide primer 25 on the same carrier, the first oligonucleotide primer 22 amplifies the first amplification product 23, and the second oligonucleotide primer 25. Since the step of amplifying the second amplification product 26 is performed in the vicinity, a significant improvement in detection sensitivity can be achieved.

Since the second single-stranded circular DNA 24 contains a sequence complementary to the detection reagent binding sequence, the second amplification product 26 obtained by RCA contains the detection reagent binding sequence. When the detection reagent binding sequence is a guanine quadruple chain forming sequence or the like, the amplification product obtained by RCA can be detected using a guanine quadruple chain binding reagent. Examples of the guanine quadruplex binding reagent include thioflavin T (ThT) disclosed in Patent Document 1 or a derivative thereof.

Further, a ThT derivative (ThT-PEG) containing the following PEG chain can also be used.
Here, R ⁵ is an amino group, a hydroxyl group, an alkyl group, or a carboxyl group, and n is an integer of 4 to 50, preferably an integer of 5 to 20, and more preferably an integer of 8 to 15. , Particularly preferably 11. As ThT-PEG, a compound having an amino group of ^{R 5 is more preferable.}

A ThT derivative (ThT-PEG-ThT) in which the following ThTs are linked by a PEG chain can also be used.
Here, n is an integer of 4 to 50, preferably an integer of 5 to 20, more preferably an integer of 8 to 15, and particularly preferably 11. Further, the PEG chain of ThT-PEG-ThT may be replaced with a spermine linker.

For detection, for example, a ThT derivative is brought into contact with a sample containing an RCA product, and the ThT derivative bound to the guanine quadruplex structure is detected based on the fluorescence emitted by the ThT derivative. The heavy chain structure can be detected. The ThT derivative is preferably added to the reaction solution in advance.

When ThT-PEG or ThT-PEG-ThT is used as the guanine quadruplex binding reagent, specific aggregation occurs when ThT-PEG or ThT-PEG-ThT binds to the RCA product. By visually observing, the presence or absence of RCA amplification can be easily confirmed without using a fluorescence detection device. In addition, ThT-PEG and ThT-PEG-ThT may be used at the same time. The concentration of ThT-PEG or ThT-PEG-ThT is, for example, 5 to 50 μM, preferably 5 to 20 μM.

In the reagent premix for the SATIC method, the first reagent layer contains a nucleic acid polymerase such as phi29 DNA polymerase, and the second reagent layer contains other reagents, that is, the first and second primers, the first and the second. Circular DNA Further may contain dNTPs, buffers and detection reagents (such as ThT-PEG), but when the second reagent layer contains the first and second primers, the first and second circular DNAs. Furthermore, an intermediate reagent layer containing dNTP, a buffer, and a detection reagent (ThT-PEG, etc.) is placed between the first reagent layer and the second reagent layer, and each of them is solid at least below 0 ° C. such as PEG. It may be provided separated by a membrane composed of a substance that dissolves in an aqueous solution at 35 ° C. (FIG. 1B). Then, the first primer and the second primer contained in the second reagent layer may be immobilized on the same carrier.

<Nucleic acid amplification method>
In order to carry out a nucleic acid amplification reaction using the nucleic acid amplification reaction kit of the present invention, a step of arranging the nucleic acid amplification reaction kit in a temperature control device and a step of adding a nucleic acid-containing sample into a reaction vessel may be performed. ..
Either the step of arranging the sample in the temperature control device or the step of adding the nucleic acid-containing sample into the reaction vessel may be performed first.
Examples of the temperature control device include a thermal cycler in the case of PCR, and a constant temperature device (tank) in the case of an isothermal amplification method such as the LAMP method and the SATIC method.

<Manufacturing method of nucleic acid amplification reaction kit>
The kit for nucleic acid amplification reaction of the present invention is a step of adding a liquid (aqueous solution) containing nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer.
A step of laminating a film composed of a substance that is solid at less than 0 ° C. and dissolves in an aqueous solution at 0 to 35 ° C. on the first reagent layer.
It is produced by a step of adding a liquid (aqueous solution) containing a primer oligonucleotide or the like onto the membrane of the substance to form a second reagent layer at a temperature of less than 0 ° C., that is, in a state where the membrane is not dissolved. be able to.
When the first reagent layer is arranged on the upper layer, the second reagent layer may be formed first, and a film may be laminated on the second reagent layer to further form the second reagent layer.

The reaction vessel may be a reaction tube (microtube) such as an Eppendorf tube, or a vessel such as a multi-well plate.

To laminate a film composed of a substance that is solid at less than 0 ° C and dissolves in an aqueous solution at 0 to 35 ° C on the first reagent layer, dissolve the substance in an appropriate solvent and add the solution to the first reagent layer. (1) A method of laminating on a reagent layer and volatilizing the solvent by vacuum drying or the like can be mentioned. The solvent can be appropriately selected depending on the type of the substance, but an organic solvent is preferable. The laminating method is not particularly limited, but the spray method is preferable for forming a thin film. The concentration of the substance is preferably 3 to 20 w / v% as the final concentration of the nucleic acid amplification reaction system when the membrane is dissolved, and more preferably 5 to 12 w / v%.

Then, the reaction vessel is placed at a temperature at which the membrane does not dissolve in water, preferably less than 0 ° C. (for example, on ice), and an aqueous solution containing a primer oligonucleotide or the like is added onto the membrane to form a second reagent layer. be able to.

Then, the nucleic acid amplification reaction kit containing the obtained multi-layered premix reagent is stored in a frozen state at a low temperature such that the membrane does not dissolve, preferably less than 0 ° C (for example, -10 to -30 ° C) until use. be able to.

For the SATIC method, the first reagent layer containing the nucleic acid polymerase, the second reagent layer containing the first and second primers, and the first reagent layer and the second reagent layer located between them, respectively. In the case of producing a multi-layered premix reagent containing an intermediate reagent layer containing a polynucleotide primer or the like, which is arranged via a membrane of the above substance, it can be produced by performing the following steps.

A step of adding a liquid containing a nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer. A substance that is solid at less than 0 ° C but dissolves in an aqueous solution at 0 to 35 ° C on the first reagent layer. The process of laminating the constituent films,
A step of adding a liquid containing a first single-stranded circular DNA and a second single-stranded circular DNA onto the membrane at a temperature of less than 0 ° C. to form an intermediate reagent layer.
A step of laminating a film composed of a substance that is solid at less than 0 ° C but soluble in an aqueous solution between 0 and 35 ° C on an intermediate reagent layer at a temperature of less than 0 ° C, and at a temperature of less than 0 ° C. A step of adding a liquid containing the first primer and the second primer onto the film to form a second reagent layer.

The step of laminating each film can be the same as described above.
Further, the method of laminating the intermediate reagent layer and the second reagent layer can be the same as described above. When the first primer and the second primer are immobilized on the carrier, the suspension containing the carrier may be laminated.

Hereinafter, the present invention will be specifically described with reference to examples, but the present invention is not limited to the following embodiments.

Example 1. Preparation and verification of multi-layered premix (SATIC method)
1-1) Preparation of primer-immobilized nanoparticles
a) (corresponding to P ₁ -1 (target area 1) Preparation of biotinylated primers biotinylated primer) with biotinylated primer (P ₂₎ was dissolved in 1 × φ29 DNA polymerase reaction buffer, P 1 (1μM), P ₂ (20 μM) P ₁ and P ₂ mixed solution was prepared.
b) Preparation and cleaning of nanoparticles before use
FG beads streptavidin were well vortexed, stirred until uniform particles, scooped 40 μL and placed in a 1.5 mL Eppendorf tube.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, and 40 μL of 1 × φ29 DNA polymerase reaction buffer was added for pipetting.
The above operation was performed twice more.
c) Primer was immobilized on nanoparticles and washed. The tube was set in a magnetic rack (tube with magnet), and the magnetic beads and supernatant were separated (5 minutes). The supernatant was removed.
_{4 μL of the above P 1} and P ₂ mixed solution was added to the washed FG beads.
Incubated at 25 ° C for 30 minutes. At that time, vortex was performed every 5 minutes.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, and 40 μL of 1 × φ29 DNA polymerase reaction buffer was added for pipetting.
The above operation was performed twice more.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, 40 μL of water was added, and pipetting was performed.
The above operation was performed twice more. Refrigerated until used.
At the time of preparation of the premix, the tube was set on a magnetic rack (tube with a magnet), and the magnetic beads and the supernatant were separated (5 minutes). The supernatant was extracted. Then, 20 μL of heat-dissolved PEG1000 and 20 μL of 10 μg / μL BSA were added (Liquid 2).

1-2) Preparation of multi-layered premix
i. 1 μL of 10 U / μL of φ29 DNA polymerase was placed at the bottom of the tube.
ii. A 0.5 g / mL PEG 1000 dichloromethane solution was sprayed from above the tube. (Coating PEG1000 on top of the polymerase to form a layer)
iii. The tube was vacuum dried (0 ° C) while cooling (5 minutes).
iv. The tube was cooled to -21 ° C. The cooled liquid 1 was added onto ii while cooling the tube on ice. 43 μL was added.
v. The tube was cooled to -21 ° C (freezes liquid 1).
vi. While cooling the tube (0 ° C), a 0.5 g / mL PEG 1000 dichloromethane solution was sprayed from above the tube. (Coating PEG1000 on the frozen liquid 1 to form a layer)
vii. Liquid 2 was carefully added in an amount of 1 μL onto the layer of PEG1000.
viii. This was used as a SATIC premix reagent and stored frozen.

1-3) Reaction using primer-immobilized nanoparticles
Further, 5 μL of target DNA (purified 1 kbp DNA fragment (10 pM) or cell disruption solution) was added to the SATIC premix reagent.
The reaction was carried out at 37 ° C and 1500 rpm for 20 minutes.

1-4) Visual observation The changes in nanoparticles were visually observed.

result
When the premix reagent frozen and frozen in the SATIC reaction was used, the target DNA was specifically detected (Fig. 3).

Example 2. Preparation and verification of multi-layered premix (for PCR)
2-1) Preparation of multi-layered premix
i. Place 1 μL of 5 U / μL of Taq DNA polymerase at the bottom of the tube.
ii. A 0.5 g / mL PEG 1000 dichloromethane solution was sprayed from above the tube. (Coating PEG1000 on top of the polymerase to form a layer)
iii. The tube was vacuum dried (0 ° C) while cooling (5 minutes).
iv. The tube was cooled to -21 ° C. The cooled liquid 3 was added onto ii while cooling the tube on ice. 44 μL was added. The tube was cooled to -21 ° C (freezes liquid 3).
v. This was used as a PCR premix reagent and stored frozen.

2-2) PCR reaction
5 μL of target DNA (purified 1 kbp DNA fragment (10 pM) or cell disruption solution) was added to the PCR premix reagent (5 μL of water was added to the negative control).
PCR cycle was performed
1. 95 ℃ 5min
2. 95 ℃ 0.5min
3. 62 ℃ 0.5min
4. 72 ℃ 2min
28 cycles of 2 → 4
5. 72 ℃ 5min

2-3) Agarose gel electrophoresis The PCR products were observed by agarose gel electrophoresis.

result:
A 1 kbp PCR product was obtained using the frozen premix reagent (Fig. 4).

Example 3. Preparation and verification of multi-layered premix (LAMP method)
3-1) Preparation of multi-layered premix
i. Place 1 μL of 1.6 U / μL of Bst 3.0 DNA polymerase at the bottom of the tube.
ii. A 0.5 g / mL PEG 1000 dichloromethane solution was sprayed from above the tube. (Coating PEG1000 on top of the polymerase to form a layer)
iii. The tube was vacuum dried (0 ° C) while cooling (5 minutes).
iv. The tube was cooled to -21 ° C. The cooled liquid 4 was added onto ii while cooling the tube on ice. 44 μL was added. The tube was cooled to -21 ° C (freezes liquid 4).
v. This was used as a LAMP premix reagent and stored frozen.

3-2) LAMP reaction
To the LAMP premix reagent, 5 μL of target DNA (purified 1 kbp DNA fragment (10 pM) or cell disruption solution) was added.
The reaction was carried out at 60 ° C for 30 minutes.

3-3) Visual observation
The color change of HNB was visually observed.

result:
When the premix reagent frozen and frozen in the LAMP reaction was used, the target DNA was specifically detected (Fig. 5).

Sequence-purified 1 kbp DNA fragments such as template DNA and primers used:
(SEQ ID NO: 1) Length: 1001bp
cT ₁ (CYP2C19 * 3): CAA AAA ACA GGG GGT GCT TAC AAT CCT AGG ATT GTA TAG AAG CTG TTG TAT TGT TGT CGA AGA AGA AAA GTC C (SEQ ID NO: 2) Length: 73base
cT2 CCC AAC CCT ACC CAC CCT CAA GAA AAA AAA GTG ATA ATT GTT GTC GAA GAA GAA AAA AAA TT (SEQ ID NO: 3) Length: 62base
P ₁ (CYP2C19 * 3): TTA CCT GGA TCT TTT TTG (SEQ ID NO: 4) Length: 18base
P ₂ GAA GCT GTT GTT ATC ACT (SEQ ID NO: 5) Length: 18base
PCR-FP (CYP2C19 * 3): TTGTCTACAGACTTTGCAGACTGATGTGAT (SEQ ID NO: 6) Length: 30base
PCR-RP (CYP2C19 * 3): GAGACATCAAACACCTCTGCCCTATTCAGT (SEQ ID NO: 7) Length: 30base
FIP (CYP2C19 * 3): TCCAGGGGTCTTAACTTGATGGAAAAAT (SEQ ID NO: 8) Length: 28base
BIP (CYP2C19 * 3): GGATCCAGGCCCAGAAAAAAAGACTGT (SEQ ID NO: 9) Length: 28base
F3 (CYP2C19 * 3): TCCAGAAACGTTTCG (SEQ ID NO: 10) Length: 15base
B3 (CYP2C19 * 3): AGGGCTTGGTCAATAT (SEQ ID NO: 11) Length: 16base
LoopF (CYP2C19 * 3): GCTTACAATCCTGATGTT (SEQ ID NO: 12) Length: 18base
LoopB (CYP2C19 * 3): GTAAGGCCAAGTTTTTTG (SEQ ID NO: 13) Length: 18base

[Composite example]
Synthesis of ThT derivatives ThT-PEG-ThT was synthesized according to the following scheme. References (Kataoka, Y .; Fujita, H .; Afanaseva, A .; Nagao, C .; Mizuguchi, K .; Kasahara, Y .; Obika, S .; Kuwahara, M) for the synthesis method of ThT-AE. .Biochemistry, 2019, 58, 493.).

[Synthesis of compound T1]
_{Add dry Dichloromethane (CH 2} Cl ₂ ) (0.30 mL) to ThT-AE (32 mg, 0.10 mmol), stir, add Triethylamine (TEA) (85 μL, 0.61 mmol), and then Succinic anhydride (11). mg, 0.11 mmol) was added, and the mixture was stirred at room temperature for 30 minutes. After distilling off the reaction mixture under reduced pressure, the residue was suspended in water and washed with _{CH 2} Cl _2. Compound T1 was quantitatively obtained by distilling off the aqueous layer under reduced pressure. ESI-MS (positive ion mode) m / z, found = 412.15, calculated for [M ⁺ ] = 412.17.

[Synthesis of ThT-PEG-ThT]
Add dry DMF (0.3 mL) to ThT-PEG (10 mg, 10 μmol) and stir, and then HOBt · H ₂ O (4.
2 mg, 26 μmol) and PyBOP (14 mg, 26 μmol) were added, followed by DIPEA (14 μL, 80 μmol). Compound T1 (5.6 mg, 13 μmol) dissolved in dry DMF (0.2 mL) was added thereto, and the mixture was stirred at room temperature for 5 hours. After distilling off the reaction mixture under reduced pressure, the residue was _{dissolved in CH 2} Cl ₂ and washed with water. The organic layer was distilled off under reduced pressure, and the mixture was subjected to solid-liquid extraction with diethyl ether and then purified by HPLC to obtain ThT-PEG-ThT.
Yield: 0.82 mg Yield: 6.1%

¹ H NMR (500 MHz, Deuterium oxide) δ 8.01 (2H, d) 7.97 (2H, s) 7.75 (6H, t) 6.95
(4H, d) 5.12 (4H, t) 3.86 (4H, s) 3.68 (44H, q) 3.61 (4H, q) 3.42-3.35 (4H, m) 3.10 (12H, s) 2.65 (4H, t) 2.57 (3H, s) 2.54 (3H, t); ESI-MS (positive ion mode)
m / z, found = 1348.51, calculated for [H ⁺ ] = 1348.67.

20 ... Single-stranded circular DNA, 21 ... Target nucleic acid, 22 ... First oligonucleotide primer, 23 ... First amplification product, 24 ... Second single-stranded circular DNA, 25. Second oligonucleotide primer, 26 ... second amplification product, 201 ... sequence complementary to the first site, 202 ... first primer binding sequence, 203 ... second single strand Circular DNA binding sequence, site adjacent to the 5'side of 204 ... 203, 211 ... first site, 212 ... second site, 221 ... sequence complementary to the second site , 222 ... a sequence complementary to the first primer binding site, 231 ..., a complementary region of 203, 232 ... a region complementary to site 204, 233 ... a sequence complementary to sequence 203, 241 ... the same sequence as the second single-stranded circular DNA-binding sequence 203, 242 ... the second primer-binding sequence, 243 ... a sequence complementary to the guanine quadruplex forming sequence, 251 ... site. The same sequence as 204, 252 ... a sequence complementary to the second primer binding sequence 242 of the second single-stranded circular DNA, 261 ... a sequence containing a guanine quadruplex, 262 ... a guanine quadruplex. Detection reagent

Claims (12)

A nucleic acid amplification reaction kit containing a reaction vessel and a nucleic acid amplification reaction reagent contained in the reaction vessel.
The reagent is a first reagent layer containing a nucleic acid polymerase and
A second reagent layer containing a primer oligonucleotide and
A membrane that separates the first reagent layer and the second reagent layer and is composed of a substance that is solid below 0 ° C but dissolves in an aqueous solution between 0 and 35 ° C.
A kit for a nucleic acid amplification reaction, which is a multi-layer reagent premix that has been cryopreserved in a laminated state containing. The kit for a nucleic acid amplification reaction according to claim 1, wherein the second reagent layer further contains a nucleic acid substrate and a reaction buffer. The kit for a nucleic acid amplification reaction according to claim 1 or 2, wherein the nucleic acid amplification reaction is PCR (polymerase chain reaction). The kit for a nucleic acid amplification reaction according to claim 1 or 2, wherein the nucleic acid amplification reaction is a LAMP (Loop-Mediated Isothermal Amplification) method. The nucleic acid amplification reaction is the SATIC method, the second reagent layer contains a first primer and a second primer, and further, a first single-stranded cyclic DNA and a second single are provided between the first reagent layer and the second reagent layer. It contains an intermediate reagent layer containing cyclic DNA, and the intermediate reagent layer is a substance that dissolves in water between the first reagent layer and the second reagent layer, respectively, and a solid below 0 ° C, but between 0 and 35 ° C. The kit for nucleic acid amplification reaction according to claim 1, which is isolated by a constituent membrane. The kit for nucleic acid amplification reaction according to claim 5, wherein the intermediate reagent layer further contains a nucleic acid substrate and a reaction buffer. The kit for nucleic acid amplification reaction according to claim 5 or 6, wherein the first primer and the second primer are immobilized on a carrier. The substance that is solid below 0 ° C. but dissolves in an aqueous solution between 0 and 35 ° C. is polyethylene glycol, polyvinyl alcohol, a sugar chain compound, a polyamide chain compound, or a water-soluble heterocyclic compound having a self-assembling ability. The kit for a nucleic acid amplification reaction according to any one of claims 1 to 7. A nucleic acid in a nucleic acid-containing sample, comprising a step of arranging the nucleic acid amplification reaction kit according to any one of claims 1 to 8 in a temperature control device and a step of adding a nucleic acid-containing sample into a reaction vessel. Amplification method. A step of adding a liquid containing a nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer. A substance that is solid at less than 0 ° C but dissolves in an aqueous solution at 0 to 35 ° C on the first reagent layer. Multilayering in the reaction vessel, which comprises a step of laminating the constituent membranes and a step of adding a liquid containing a primer oligonucleotide on the membrane to form a second reagent layer at a temperature of less than 0 ° C. A method for producing a nucleic acid amplification reaction kit containing a reagent premix. The method for producing a nucleic acid amplification reaction kit according to claim 10, wherein the nucleic acid amplification reaction is PCR or LAMP method. A step of adding a liquid containing a nucleic acid polymerase to a nucleic acid amplification reaction vessel to form a first reagent layer. A substance that is solid at less than 0 ° C but dissolves in an aqueous solution at 0 to 35 ° C on the first reagent layer. The process of laminating the constituent films,
A step of adding a liquid containing a first single-stranded circular DNA and a second single-stranded circular DNA onto the membrane at a temperature of less than 0 ° C. to form an intermediate reagent layer.
A step of laminating a film composed of a substance that is solid at less than 0 ° C but soluble in an aqueous solution between 0 and 35 ° C on an intermediate reagent layer at a temperature of less than 0 ° C, and at a temperature of less than 0 ° C. A SATIC reaction kit comprising a step of adding a liquid containing a first primer and a second primer onto the membrane to form a second reagent layer, comprising a multi-layer reagent premix in a reaction vessel. Production method.

Images