JP2021171052A - Microrna serum marker, primer set, kit, and their use to identify sex of sturgeon - Google Patents

Abstract

To provide a microRNA serum marker, primer set, kit. and their use to identify sex of sturgeon.SOLUTION: A serum miRNA marker, primer set, and kit are provided using high-throughput small RNA sequencing technology and microRNA chip technology to screen the types and levels of differentially expressed miRNAs in the third instar Acipenser schrenckii's gonad (testis and ovary) and identify the sex of Acipenser schrenckii obtained by screening 36 miRNAs among them.SELECTED DRAWING: Figure 1

Description

The present invention belongs to the field of biotechnology and specifically relates to microRNA serum markers, primer sets, kits and their use for identifying the sex of sturgeon.

Sturgeon is a very valuable fish, and caviar made from sturgeon roe contains a large amount of substances such as essential amino acids of the human body, many unsaturated fatty acids and vitamins, and has a very high nutritional value. In 2013, its international selling price reached $ 800-900 per kilogram, so female sturgeon has even higher economic value than male sturgeon. Currently, butterfly shark farming and caviar production are emerging industries, and development in China is very rapid. According to rudimentary statistics, the annual production of Chinese butterfly shark product fish farming has already exceeded 20,000 tons worldwide. It accounts for 66.17% of the total production of butterfly sharks and 72.46% of the total production of aquaculture, and has already become the largest producer of butterfly sharks and a major exporter of caviar, providing huge market potential. have. For example, the Amur sturgeon (Acipenser sturgeon) is a rare and valuable large economic fish peculiar to the Heilongjiang River system in China. Artificial breeding of sturgeon began in the 30s of the 19th century and has the advantages of fast growth, anti-disease and adaptability, and since the 90s of the last century, sturgeon hybrids and caviar have been used in the sturgeon farming industry. It is one of the important aquaculture varieties in the sturgeon aquaculture industry that it produces (Wei et al., 2011). In aquaculture, if the sex of Amur sturgeon can be screened at an early stage, directional selection and breeding can be performed on female and male colonies, and a higher economic effect can be obtained. However, there is no obvious secondary sexual characteristic between male and female sturgeon individuals in adolescence and even in adulthood, morphologically it is not possible to distinguish between male and female, and sexual maturation time is long. Since it is not possible to carry out intensive aquaculture or breeding at a certain gender ratio according to male and female gender, it causes a waste of resources to over-raise male individuals, increases the aquaculture cost, and hinders the rapid development of the sturgeon aquaculture industry. doing. Therefore, new technology for sex identification of sturgeon is currently a focus of attention for the sustainable development of the sturgeon aquaculture industry.

MicroRNAs (miRNAs) are highly conserved non-coding small RNAs with a length of around 22 bp and are predominantly complete or incomplete with the 3'end untranslated region (3'UTR) of the target gene. By pairing, it degrades target genes or suppresses their translation, thereby engaging in a wide range of vital processes, including growth, differentiation, development, tumorigenesis and spousal formation (Ambros, 2004; RNAsky). , 2014). MiRNAs are stable in serum for long periods of time, are not easily degraded by RNases, and extreme conditions such as boiling, repeated freeze-thaw, acid-alkali environment, and long-term storage do not cause loss of serum miRNAs. More importantly, recent studies have shown that changes in the miRNA expression spectrum in serum are closely associated with tumor tissue and can present tumor status, so miRNA can be used for early diagnosis of cancer. As a new technology of effective tumor markers used for malignant grading, personalized medical care and prognosis judgment, it is focused on, and by extension, miRNA can be targeted for tumor treatment and the use of clinical drugs can be instructed.

Recent studies have shown that miRNAs that target sex determination and differentiation genes exert accurate, effective, and important regulatory effects in the formation of sexual dimorphism in animals (Ryazansky et et al., Et al. 2014; Fernandez-Perez et al., 2018). For example, in mice, the Sox9 gene (SRY-box coding gene 9), in which miR-124 regulates testis differentiation, determines the fate of ovarian cells (Real et al., 2013); miR-202-5p / 3p It acts on testis differentiation by upstream regulation of the Sox9 gene (Wainwright et al., 2013); miR-19a / b target sex determinant Dmrt1 (dublessex and Mab-3 related transcription factor 1) acts on sex reversal (Li , 2015).

A first object of the present invention is to provide a microRNA serum marker for identifying the sex of a butterfly shark, which markers are asc-miR-133-3p, asc-miR-133a-3p, asc-miR-. It is a combination of 130a-3p and dre-miR-34c, and the base sequence of each microRNA is as follows:
asc-miR-133-3p: UGGUCCCCUCACACCAGC (SEQ ID NO: 2).
asc-miR-133a-3p: UUUGGUCCCCUCAUCAACCAGCUG (SEQ ID NO: 3).
asc-miR-130a-3p: CAGUGCAUAUUAAAAGGGCAU (SEQ ID NO: 8).
dre-miR-34c: AGGCAGUGCAGUAUGUUGAUAC (SEQ ID NO: 11).

A second object of the present invention is the sex of a sturgeon containing a detection primer for detecting the asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c. Is to provide a set of detection primers to identify.
Preferably, the detection primers for asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c are as follows.
The forward primer for asc-miR-133-3p is shown in SEQ ID NO: 16.
The forward primer for asc-miR-133a-3p is shown in SEQ ID NO: 17.
The forward primer for asc-miR-130a-3p is shown in SEQ ID NO: 18.
The forward primer for dre-miR-34c is shown in SEQ ID NO: 19.
The reverse primer is a universal reverse primer, and the base sequence is shown in SEQ ID NO: 20.

A third object of the present invention is to provide the use of the microRNA serum marker as a detection target in the preparation of a kit for identifying the sex of sturgeon.

A fourth object of the present invention is to provide the use of the detection primer set in the preparation of a kit for identifying the sex of sturgeon.

A fifth object of the present invention is to provide a kit for identifying the sex of a sturgeon, which comprises a reagent for detecting the content of a microRNA serum marker for identifying the sex of the sturgeon.

The kit contains detection primers for asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c, specifically:
The forward primer for asc-miR-133-3p is shown in SEQ ID NO: 16.
The forward primer for asc-miR-133a-3p is shown in SEQ ID NO: 17.
The forward primer for asc-miR-130a-3p is shown in SEQ ID NO: 18.
The forward primer for dre-miR-34c is shown in SEQ ID NO: 19.
The reverse primer is a universal reverse primer and the SEQ ID NO: 20 is shown in SEQ ID NO: 20.

Preferably, it further comprises a reverse transcription stem-loop primer, specifically:
The reverse transcription stem-loop primer for asc-miR-133-3p is shown in SEQ ID NO: 12.
The reverse transcription stem-loop primer for asc-miR-133a-3p is shown in SEQ ID NO: 13.
The reverse transcription stem-loop primer for asc-miR-130a-3p is shown in SEQ ID NO: 14.
The reverse transcription stem-loop primer for dre-miR-34c is shown in SEQ ID NO: 15.

The kit further contains reagents commonly used in PCR techniques.

Compared with the prior art, the advantages of the present invention are as follows.
The present invention provides a novel detection method for identifying the sex of sturgeon. The present invention detects sex-related stable microRNAs in plasma / serum as compared to prior art, and for quantitative detection, miRNAs have very high quantification sensitivity and specificity, real-time quantitative PCR. By adopting the technique, it is possible to effectively distinguish the sex of the butterfly shark. Detection by the chip method of the real-time quantitative PCR miRNA detection kit for identifying the sex of the sturgeon of the present invention has a detection rate of up to 80% and can effectively distinguish between males and females of unknown young sturgeon samples. The type of sturgeon is not limited to Amur sturgeon, and there is a high detection rate for other types of sturgeon such as Siberian hybrid sturgeon. Further, the sex identification of the sturgeon according to the present invention does not require cutting the organ of the sturgeon to obtain DNA, and the damage to the sturgeon is extremely low. The method of the present invention is easy to operate, highly reproducible, is a new breakthrough in the technical field for efficient and early identification of sturgeon sex, suitable for dissemination and use, and high production cost in the sturgeon farming industry. Fundamentally solve the problems that severely restrict industrial development, such as low efficiency.

Expression of 36 miRNAs in female and male Amur sturgeon sera is detected by fluorescence real-time PCR. It is a ROC curve of 11 kinds of miRNA. Arrangement of detection primers on a 96-well PCR plate (ie, a fluorescent quantitative miRNA PCR detection chip for sex identification of sturgeon). The abbreviations are Am133 (asc-miR-133-3p), Am133a (asc-miR-133a-3p), Am130 (asc-miR-130a-3p), Am34c (dre-miR-34c), U6 (see inside). Represents a gene of gene U6), 5S (5S rRNA).

The following examples are further descriptions of the present invention and are not intended to limit the present invention.
The present invention utilizes high-throughput small RNA sequencing technology and microRNA chip technology to screen for the type and level of differentially expressed miRNA in 3rd instar Amur butterfly shark glands (testis and ovaries). 36 miRNAs from the above are screened and used as serum miRNA markers to identify the sex of Amur butterfly sharks. By establishing new methods of miRNA markers and verifying them in younger butterfly sharks, the difficulty of gender identification in the butterfly shark farming industry can be resolved to some extent, and the sustainability of the butterfly shark farming industry and green and healthy Can promote and support rapid development.

(Example 1)
1. 1. Screening of Amur gonad differential expression miRNA | Log2 (FC) | , Removes 100% family-similar miRNAs and retains 36 miRNAs. A list of miRNA gene information is shown in Table 1.

2. Serum collection One lot of 3rd instar sturgeon was taken, its weight, body length and total length were measured, and paraffin slices of gonadal tissue were prepared. Tissue observation was performed by hematoxylin eosin staining method, and sex was accurately determined. Blood was collected from the tail vein, placed in a 1.5 mL sterile EP tube, allowed to stand at room temperature for 30 minutes, and centrifuged at 3500 rpm for 15 minutes in a low temperature centrifuge. The separated sera are collected, stored in a refrigerator at -80 ° C, and finally the sera of 30 gender-determined sturgeon (15 female and 15 male) are selected and used in the next step. ..

3. 3. Serum miRNA Extraction and Reverse Transcription Extraction Kit: TIANGEN's miRcute Serum / Plasma miRNA Extraction Separation Kit (DP503) was operated according to the reagent instructions to determine the sex of 30 sharks (15 females and 15 males). The miRNA of the serum of 15 fish) was extracted, and the concentration and purity of the miRNA were detected using an ultraviolet spectrophotometer.

Reverse Transcription: According to the unified amount, the miRNA extracted in the above step was reverse transcribed using the miRcute-enhanced miRNA cDNA First Strand Synthesis Kit (KR211) manufactured by TIANGEN to obtain a reverse transcriptase. In this step, by integrating the A-tailing reaction and the reverse transcription reaction, all A-tailing products of miRNA can undergo further reverse transcription reaction, which can greatly improve the detection rate of low-abundance miRNA. can.

4. Fluorescent real-time PCR
Using the reverse transcriptase obtained in the above step as a template, relative quantitative PCR was performed on each of the 36 Amur butterfly shark gland differential expression miRNAs and the internal reference gene U6, respectively, and a miRcute-enhanced miRNA fluorescence quantitative detection kit (TIANGEN) was used. Operate according to SYBR Green) (FP411). The miRNA primer sequences are shown in Table 2.

Fluorescence quantitative PCR reaction conditions are as follows: 95 ° C. for 15 minutes; 95 ° C. for 15 minutes, 60 ° C. for 30 seconds, 72 ° C. for 34 seconds, 5 cycles; 94 ° C. for 20 seconds, 60 ° C. for 34 seconds, 45 cycles; dissolution curve analysis.

5. The results analysis U6 as a detection internal reference, real-time quantitative PCR results were analyzed by ^{2 -DerutaderutaCT} method, SPSS17.0 is analyzed using independent sample T test between the two groups (independent sample T-test), the difference Statistics of sexual prominence (P <0.05). As a result, as shown in FIG. 1, asc-miR-107, asc-miR-133-3p, asc-miR-133a-3p, asc-miR-140-3p, asc-let-7g, asc-miR Eleven miRNAs such as -10-5p, asc-miR-10b-5p, asc-miR-130a-3p, asc-miR-16-5p, asc-miR-223-3p and dre-miR-34c It was shown to be consistently and significantly elevated in the serum of male Amur sturgeon.

6. Using statistical methods, we evaluated the ability of the above 11 miRNAs to be used alone as a standard for sex identification of Amur sturgeon, and the sensitivity, specificity, and correspondence of individual miRNAs as serum markers to identify the sex of Amur sturgeon. The ROC curve to be detected is detected and shown in FIG. 2 and Table 3.

As can be seen from FIG. 2 and Table 3, the area under the diagnostic ability ROC curve of each miRNA is 0.74 or more, and the above 11 types of miRNA can be used for sex identification of Amur sturgeon, and has a certain identification significance. There is.

7. Further statistical analysis is performed in three cases: (1) 11 miRNAs are combined; (2) 6 miRNAs with specificity index> 0.7 (asc-miR-133-3p, asc-miR) -133a-3p, asc-let-7g, asc-miR-130a-3p, asc-miR-16-5p and dre-miR-34c) are combined and analyzed; (3) Specificity index> 0. 9 4 miRNAs (including asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p sum dre-miR-34c) are combined and analyzed, and the diagnostic ability of the comprehensive index. Was evaluated. As shown in Table 4, the area under the ROC curve for sex identification of Amur sturgeon by the combination index, and its accuracy and specificity are detected.

As can be seen from Table 4, combination detection of four miRNAs (including asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c) among them. Has the highest discriminating effect, and its diagnostic ability was that the correct answer rate (area below the line) was 82.6%, and its discriminating sensitivity and specificity were 80.4% and 95.5%, respectively.

8. Preparation of real-time quantitative miRNA PCR detection kit for sex identification of butterfly sharks Four miRNAs (asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c) Special and specialized reverse transcription stem-loop primers used in (including) are:
asc-miR-133-3p-F: 5'-ACACTCCAGCTGGGTGGTTCCCCTTCAACCAGC-3';
asc-miR-133a-3p-F: 5'-ACACTCCAGCTGGGTTTGGTGTCCCTTCAACCAGC-3';
asc-miR-130a-3p-F: 5'-ACACTCCAGCTGGGCAGTGCAATATTATAAAAGGGC-3';
dre-miR-34c-F: 5'-ACACTCCAGCTGGGAGGCAGGTGCAGTTAGTTGAT-3';

The primer pairs of the real-time quantitative miRNA PCR detection kit for identifying the sex of sturgeon are stored in 96-well PCR plates, respectively, and the sequence of the primer pairs is as follows.
asc-miR-133-3p-F: 5'-ACACTCCAGCTGGGTGGTTCCCCTTCAACCAGC-3';
asc-miR-133a-3p-F: 5'-ACACTCCAGCTGGGTTTGGTGTCCCTTCAACCAGC-3';
asc-miR-130a-3p-F: 5'-ACACTCCAGCTGGGCAGTGCAATATTATAAAAGGGC-3';
dre-miR-34c-F: 5'-ACACTCCAGCTGGGAGGCAGGTGCAGTTAGTTGAT-3';
Universal reverse primer: 5'-CTCACAGTACGTTGGTATCCTTGG-3'.

The sequence scheme in which each of the above preferred primer pairs was stored in a 96-well PCR plate was such that the four miRNA genes were asc-miR-133-3p (Am133), asc-miR-133a-, as shown in FIG. It is abbreviated as 3p (Am133a), asc-miR-130a-3p (Am130) and dre-miR-34c (Am34c). When detecting samples using this 96-well PCR plate (ie, a fluorescent quantitative miRNA PCR detection chip for identifying the sex of butterfly sharks), we set the control and maleity of the female serum (Gray zone A1-A6). Based on the control amplification status of the serum (Gray zone A-A12), the miRNA expression status of the test serum sample can be obtained very accurately at the same time, thereby accurately predicting the sex of the test serum sample. can do. This 96-well PCR plate contains 14 sturgeon individuals, or 7 sturgeon individuals (1 individual is detected twice at the same time) or at least 4 sturgeon individuals (1 individual is detected 3 times at the same time). Used at once for simultaneous detection of sturgeon.

The total amount of primer pairs in the holes of each 96-well PCR plate is preferably 1-20 × ^10-12 mol, with the same amount of upstream and downstream primer pairs. It is preferably stored in a refrigerator at 2-8 ° C.
Other contents of the kit are 2 x SYBR Premix Ex Taq ^TM , sterile deionized water.
A fluorescence quantitative miRNA PCR detection chip for sex identification of sturgeon and other reagents are enclosed and put into a kit together with an instruction manual to form a detection kit.

9. Kit detection and verification application Amur sturgeon and Siberian hybrid sturgeon of about 1 instar each lot are selected, and the biological serum collection method reduces the stress response of the sturgeon and separates the sturgeon from water in order to match the biological blood sampling. After that, immediately transfer to the prepared ice and let stand for 3 to 5 minutes, using a 5 mL disposable sterile syringe (using a 0.6 x 25 TWLB needle), about 0.5 from the tail of the sturgeon, that is, the hole in the drainage cavity. Insert the needle at a 30-45 angle from -1.0 cm, collect 1 mL of blood in the tail vein, place in a 1.5 mL sterile centrifuge tube, leave at room temperature for 30-60 minutes, and use a low temperature centrifuge at 3500 rpm for 15 Centrifuge for minutes, collect the supernatant, place in a 2 mL freezer tube and store in a refrigerator at -80 ° C. At the same time, the sex of the butterfly shark was detected by the method of step 2 above, and a butterfly shark sample (including 10 male and female Amur butterfly sharks and 10 male and female Siberian hybrid butterfly sharks) with complete gender differentiation was screened. Next, miRNA was extracted by the method of step 3 above, and four specific reverse transcription stem-loop primers (asc-miR-133-3p-) were followed according to the operation method described in the reverse transcription kit (Takara, product number 6210A). Using RT, asc-miR-133a-3p-F, asc-miR-130a-3p-F, dre-miR-34c-F), 4 microRNA serum markers asc-miR-133-3p, respectively, Obtain the cDNAs for asc-miR-133a-3p, asc-miR-130a-3p, and dre-miR-34c, and the PCR meter reaction process was incubated at 42 ° C. for 60 minutes, held at 72 ° C. for 15 minutes, and further. The temperature should be lowered to 4 ° C and transferred to a refrigerator at -20 ° C for storage. Next, according to the real-time quantitative miRNA PCR detection kit method for sex identification of butterfly sharks, a 20 μL reaction system consists of 1.0 μL of cDNA, 0.5 μL of miRNA-specific primers and 0.5 μL of universal reverse primers, and 10 μL of 2 × SYBR Premix Ex Taq ^TM is included, and the rest is supplemented with distilled water. The PCR reaction program is a 40-cycle system (95 ° C. for 15 seconds, 60 ° C. for 30 seconds and 72 ° C. for 30 seconds) for 2 minutes at 95 ° C. Detect by gender double-blind method. The sex of an unknown sturgeon sample is determined based on the relative up-down regulation of the above four miRNA markers of the present invention and the expression status of male and female serum controls. The criterion is that if the unknown sturgeon serum sample is relatively significantly upregulated compared to the four miRNA markers in the female control serum and the relative expression multiple is at least 2-fold, then the test sturgeon sample Is determined to be a potential male, otherwise the test sturgeon sample is determined to be a potential female, and the final statistical results indicate a real-time quantitative miRNA for sex identification of the sturgeon of the present invention. Detection by the chip method of the PCR detection kit shows that the detection rate for both young Amur sturgeon and Siberian hybrid sturgeon reaches 80%, and it is possible to effectively classify the sex of unknown young sturgeon samples. Shown.

The above is only a preferred embodiment of the present invention, and the above preferred embodiment should not be regarded as a limitation on the present invention, and the scope of protection of the present invention should be in accordance with the claims. For those skilled in the art, some modifications and decorations can be made without departing from the spirit and scope of the invention, and these modifications and decorations should also be considered the scope of protection of the invention.

(Additional note)
(Appendix 1)
MicroRNA serum markers for identifying the sex of sturgeon, said markers are asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c. ,
The nucleotide sequence of asc-miR-133-3p is shown in SEQ ID NO: 2.
The nucleotide sequence of asc-miR-133a-3p is shown in SEQ ID NO: 3.
The nucleotide sequence of asc-miR-130a-3p is shown in SEQ ID NO: 8.
The nucleotide sequence of dre-miR-34c is shown in SEQ ID NO: 11.
A microRNA serum marker for identifying the sex of sturgeon characterized by this.

(Appendix 2)
The asc-miR-133, which comprises a detection primer for detecting asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c according to Appendix 1. The detection primers for -3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c are:
The forward primer for asc-miR-133-3p is shown in SEQ ID NO: 16.
The forward primer for asc-miR-133a-3p is shown in SEQ ID NO: 17.
The forward primer for asc-miR-130a-3p is shown in SEQ ID NO: 18.
The forward primer for dre-miR-34c is shown in SEQ ID NO: 19.
The reverse primer is a universal reverse primer and the sequence is shown in SEQ ID NO: 20.
A set of detection primers for identifying the sex of sturgeon characterized by this.

(Appendix 3)
Use of the microRNA serum marker described in Appendix 1 as a detection target in the preparation of kits for identifying sturgeon sex.

(Appendix 4)
Use of the detection primer set described in Appendix 2 in the preparation of a kit for identifying the sex of sturgeon.

(Appendix 5)
A kit for identifying the sex of a sturgeon, which comprises a reagent for detecting the content of a microRNA serum marker for identifying the sex of the sturgeon according to Appendix 1.

(Appendix 6)
Including the detection primer set described in Appendix 2,
The kit according to Appendix 5, characterized in that.

(Appendix 7)
The reverse transcription stem-loop primer for asc-miR-133-3p is shown in SEQ ID NO: 12.
The reverse transcription stem-loop primer for asc-miR-133a-3p is shown in SEQ ID NO: 13.
The reverse transcription stem-loop primer for asc-miR-130a-3p is shown in SEQ ID NO: 14.
The reverse transcription stem-loop primer for dre-miR-34c is shown in SEQ ID NO: 15.
The kit according to Appendix 5 or 6, further comprising a reverse transfer stem-loop primer.

Claims (7)

MicroRNA serum markers for identifying the sex of sturgeon, said markers are asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c. ,
The nucleotide sequence of asc-miR-133-3p is shown in SEQ ID NO: 2.
The nucleotide sequence of asc-miR-133a-3p is shown in SEQ ID NO: 3.
The nucleotide sequence of asc-miR-130a-3p is shown in SEQ ID NO: 8.
The nucleotide sequence of dre-miR-34c is shown in SEQ ID NO: 11.
A microRNA serum marker for identifying the sex of sturgeon characterized by this. The asc-miR- comprising a detection primer for detecting asc-miR-133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c according to claim 1. The detection primers for 133-3p, asc-miR-133a-3p, asc-miR-130a-3p and dre-miR-34c are as follows:
The forward primer for asc-miR-133-3p is shown in SEQ ID NO: 16.
The forward primer for asc-miR-133a-3p is shown in SEQ ID NO: 17.
The forward primer for asc-miR-130a-3p is shown in SEQ ID NO: 18.
The forward primer for dre-miR-34c is shown in SEQ ID NO: 19.
The reverse primer is a universal reverse primer and the sequence is shown in SEQ ID NO: 20.
A set of detection primers for identifying the sex of sturgeon characterized by this. Use of the microRNA serum marker according to claim 1 as a detection target in the preparation of a kit for identifying the sex of sturgeon. Use of the detection primer set according to claim 2 in the preparation of a kit for identifying the sex of sturgeon. A kit for identifying the sex of a sturgeon, which comprises a reagent for detecting the content of a microRNA serum marker for identifying the sex of the sturgeon according to claim 1. 2. The detection primer set according to claim 2 is included.
The kit according to claim 5. The reverse transcription stem-loop primer for asc-miR-133-3p is shown in SEQ ID NO: 12.
The reverse transcription stem-loop primer for asc-miR-133a-3p is shown in SEQ ID NO: 13.
The reverse transcription stem-loop primer for asc-miR-130a-3p is shown in SEQ ID NO: 14.
The reverse transcription stem-loop primer for dre-miR-34c is shown in SEQ ID NO: 15.
The kit according to claim 5 or 6, further comprising a reverse transcription stem-loop primer.

Images