CN102732520B - The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special - Google Patents
The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special Download PDFInfo
- Publication number
- CN102732520B CN102732520B CN201210171919.8A CN201210171919A CN102732520B CN 102732520 B CN102732520 B CN 102732520B CN 201210171919 A CN201210171919 A CN 201210171919A CN 102732520 B CN102732520 B CN 102732520B
- Authority
- CN
- China
- Prior art keywords
- mirnas
- serum
- active tuberculosis
- mir
- hsa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the method preparing the sick special serum miRNAs of active tuberculosis, comprise the following steps: A1: the collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection; A2: the total serum IgE extracting serum sample; The high-flux sequence examination of A3: the serum miRNAs that active tuberculosis is sick special; A4: design miRNAs stem ring reverse transcription primer and upstream, downstream primer, does is stem ring reverse transcription primer SEQ ID NO:10-SEQ ID NO:18, does is general upstream primer SEQ ID NO:19, does is downstream primer SEQ ID NO:20-SEQ ID NO:28.The present invention prepares the sick special serum miRNAs of active tuberculosis, utilize the serum miRNAs of the preliminary examination differential expression of high-flux sequence, the specific reverse transcription primer of application stem ring method design, carry out the serum miRNAs that fluorescence quantifying PCR method checking obtains differential expression, control pulmonary tuberculosis to research to propagate, the incidence reducing pulmonary tuberculosis has great importance.
Description
Technical field
The present invention relates to technical field of molecular biology, in particular prepare the method for the serum miRNAs of active tuberculosis disease special (significant).
Background technology
The whole world has 2,000,000,000 people to infect mycobacterium tuberculosis, 2000 ten thousand people's hectics are sick, wherein sick 1,200 ten thousand examples of active tuberculosis, annual newly-increased pulmonary tuberculosis (pulmonarytuberculosis, TB) patient 850 ~ 9,200,000 example, mortality ratio reaches 120 ~ 1,500,000 examples, is the disease that Simple infection factor causes death toll maximum.In the world in 22 the most serious countries of pulmonary tuberculosis, the 2nd is ranked in China, and popular situation is very severe.China existing consumptive 4,510,000 people, wherein active tuberculosis patient about 1,300,000 people, in new cases 1,450,000 examples/year, mortality ratio reaches 130,000 examples/year, has exceeded the summation of animal infectious diease death toll.The Research Challenges of active tuberculosis disease lacks special mark.Research data shows, the miRNAs of existence and stability in serum and plasma, and the change of miRNAs express spectra has tissue and cell-specific, is suitable as candidate's biological marker of pulmonary tuberculosis.
But because miRNAs molecular weight is little, in serum, content is few, but enormous amount, traditional sequencing complicated operation, expense is expensive, and the order-checking degree of depth is limited, and efficiency is lower, is unsuitable for the detection of miRNAs.So the determination and analysis of miRNAs has just become key issue.Along with the development of high-flux sequence examination technology, the research of miRNAs is greatly improved.This sequencing technologies can detect any RNA in 17-35 Nucleotide, based on sequence label and the frequency of occurrences of surveyed target miRNAs, may be used for the minor alteration finding new miRNAs and detect known miRNAs length and sequence.And extraction scope can be adjusted according to demand, there is the advantages such as speed is fast, cost is low, coverage is dark, be applicable to very much the order-checking of the miRNAs of 21-25 Nucleotide composition, miRNAs known in database can be obtained, new miRNAs can also be found, accuracy and highly sensitive.Meanwhile, for excavating, identifying and the miRNAs collection of illustrative plates of quantitative all species full-length genome levels, it is the better method of deciphering miRNAs collection of illustrative plates.There is no the report of the serum miRNAs of application high-flux sequence examination pulmonary tuberculosis differential expression at present.Through the differential expression miRNAs of high-flux sequence examination, quantitative fluorescent PCR is also needed to verify.Because the miRNAs length of maturation is too short, do not detect by real-time fluorescence quantitative PCR, but pass through the reverse transcription primer of the loop-stem structure of particular design, coordinate real-time quantitative PCR primer and probe, accurately can detect miRNAs in micro-example and express.MiRNAs fluorescent quantitative PCR technique is a kind of new detection technique, can carry out quantitatively to ripe miRNAs, the homolgous molecule of effective differentiation ripe miRNAs molecule and precursor molecule and other ripe miRNAs, have fast, simple, save time, detection sensitivity is high, sample consumption few (only needing the total serum IgE of 1-10ng or the miRNAs of about 50pg), the linearity range of ultra-wide, can cross over 7 orders of magnitude, is the fit closely miRNAs preparing differential expression.
Summary of the invention
The technical problem of all solutions of the present invention is to provide the method preparing the sick special serum miRNAs of active tuberculosis.
Technical scheme of the present invention is as follows:
The preparation method of the serum miRNAs that active tuberculosis is sick special, comprises the following steps: A1: the collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection; A2: the total serum IgE extracting serum sample; The high-flux sequence examination of A3: the serum miRNAs that active tuberculosis is sick special; A4: design miRNAs stem ring reverse transcription primer and upstream, downstream primer, stem ring reverse transcription primer is SEQIDNO:10-SEQIDNO:18, and general upstream primer is SEQIDNO:19, and downstream primer is SEQIDNO:20-SEQIDNO:28; A5: the serum miRNAs that quantitative fluorescent PCR checking active tuberculosis is sick special.
Described method, described A1 specifically performs following operation: collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons.All participator's blood samples are rise morning to extract on an empty stomach, and adopt disposal vacuum not anticoagulant blood-collecting pipe, gather peripheral blood 3.0mL, centrifugal within 4 hours (3000xg, 10min, 4 DEG C), suct and be distributed into each 200 μ L clearly afterwards, be stored in-80 DEG C of refrigerators.
Described method, described A2 specifically performs following operation: active tuberculosis patient and normal healthy controls person's serum are taken out in-80 DEG C, treats that 4 DEG C dissolve naturally; Draw 200 μ L with pipettor, join 1.5ml without in RNaseEP pipe, add 700 μ LQiagenLysissolution, be placed in the mixing of vortex instrument violent vortex to abundant cracking, until can't see white suspension thing; Room temperature leaves standstill 5min; Add 140 μ L chloroforms; Violent mixing 15s, stratification 3min; See 12000g, 15min when having demixing phenomenon, 4 DEG C; Get supernatant fluid (general 500 μ L) with pipettor to transfer in new 1.5mL collection tube, add the dehydrated alcohol of 1.5 times of supernatant volumes, mixing of turning upside down; Getting 700 μ L is added in pillar containing the lysate of ethanol, and the centrifugal 18s of 8000g, abandons lower floor, resets collection tube on post; Add 700 μ LRWTsolution, the centrifugal 18s of 8000g, abandons lower floor, is placed in by post on a new collection tube; Add 500 μ LRPE, the centrifugal 18s of 8000g, abandons lower floor, resets collection tube on post; Add 500 μ LRPE, the centrifugal 2min of 8000g, abandons collection tube.Pillar is put into new 2ml collection tube, at full speed centrifugal 1min; Pillar is put into 1.5mLElution pipe; Add 30 μ LRNase-FreeWater, leave standstill 1min, solution is fully combined with post, then the centrifugal 1min of 8000g.
Get active tuberculosis patient and normal healthy controls person's serum total serum IgE sample 1.0 μ L, detect OD value through nanodrop-2000, ultraviolet spectrophotometer measures A260/A280 numerical value, when its numerical value represents that between 1.8 ~ 2.0 the purity of total serum IgE is better; To be less than in 1.8 explanation solution albumen or time other organic pollutions obvious, be greater than 2.0 and then may degrade by total serum IgE; And A260/A230, then ratio should between 2 ~ 2.5, less than normal, illustrated that residual salt remains.
Described method, described A3 specifically performs following operation: by high-flux sequence examination technology, the serum miRNAs of differential expression between preliminary screening active tuberculosis patient and normal healthy controls person.20 routine consumptives and 20 routine normal healthy controls persons respectively provide the serum of 5mL; Serum requires: concentration >=5ng/ul, total amount >=100ng after AgilentBioanalyzer detects; The impurity such as albumen, salt ion is few, and PAGE glue electrophoretic separation compares compared with normal; According to result and bioinformatics software analysis, as normalization method and variance analysis method of calculation select differential expression miRNAs; Comprise hierarchical clustering by clustering method, Kmeans cluster and SOM etc. classify to different samples, and carry out similarity analysis to difference miRNAs, obtain the serum miRNAs of differential expression.
Described method, described A3 specifically performs following operation: the PRELIMINARY RESULTS obtained according to high-flux sequence examination technology, and the miRNAs chosen meets three conditions: in active tuberculosis patient or normal healthy controls person, 1. detect miRNAs expression amount at least reach 20copies; 2. differential expression is more than 2 times; 3. there were significant differences (P < 0.01) for P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
Described method, described A4 specifically performs following operation: the mature sequence finding corresponding miRNAs in miRBase database, with general stem ring method design.Add 6 bases of holding reverse complemental to match with ripe miRNAs3 ' at 3 ' end of general stem ring, be stem ring primer, reverse transcription can be carried out to miRNAs, finally use general downstream primer and the special upstream primer of miRNAs to increase.The each reverse transcription of stem ring primer can only hold for a kind of miRNAs or 3 ' miRNAs that 6 bases are identical.And fluorescent quantitation upstream and downstream design of primers, downstream primer is the part on stem ring, and upstream primer can be designed by primer5.0, upstream and downstream primer length about 20bp, annealing temperature Tm value is at about 60 DEG C, and GC content is about 40%-60%, and amplified production is about 60bp.After design of primers completes, by lesegene7.0, primer is evaluated.Increase in active tuberculosis patient serum sample for internal reference miR-16, observe amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has obvious logarithmic phase, and blank generates without continuous curve, illustrate that amplification is all right.Solubility curve is done to the miR-16 product of amplification, have and only have one obvious unimodal, and to occur without obvious crest without Template Controls, illustrate through amplification after product be special miR-16.Namely this is quantitatively pollution-free, accurately, reliably.
Described method, described A5 specifically performs following operation: carry out reverse transcription with Fermentas Reverse Transcription box.Reverse transcription reaction system: total serum IgE 2.5 μ L, RNase inhibitor RRI0.25 μ L, dNTP (10mMeach) 0.5 μ L, 5 × M-MuLVbuffer1.0 μ L, stem ring primer SLP (2 μMs) 0.5 μ L, M-MuLV ThermoScript II 0.25 μ L, cumulative volume 5 μ L.Method is carried out in two steps, the first step: 65 DEG C, 5min; On ice, 10min.Second step: 42 DEG C, 60min; 70 DEG C, 15min; After completion of the reaction ,-80 DEG C of refrigerators are stored in.
Described method, described A5 specifically performs following operation: the serum miRNAs carrying out quantitative fluorescent PCR checking differential expression by SYBR method.Quantitative fluorescent PCR system: ddH2O7 μ L, SYBRsystemMix10 μ L, 50*ROXrefenencedye0.4 μ L, FP (10 μMs)/RP (10 μMs) 0.8 μ L, Template (cDNA) 1 μ L, cumulative volume 20 μ L.Slightly centrifugal after mixing, in ABI7500, carry out quantitative fluorescent PCR reaction, reaction parameter is set to: 95 DEG C of 30s, then 95 DEG C of 5s, 60 DEG C of 31s, totally 40 circulations.
Described method, described A5 specifically performs following operation: the data analysis of miRNAs fluorescent quantitation is reference gene with miR-16, is normalized target gene, has guaranteed the amount of comparison object gene in the sample of equal amount.The change formula that miRNA expresses multiple is RQ=2
-Δ Δ CT, wherein Δ Δ CT=(CTmiRNA-CTmiR-16) OC-(CTmiRNA-CTmiR-16) MeanON.RQ represents relative expression's variable quantity, CTmiRNA and CTmiR-16 represents the Ct value with target miRNA and reference gene miR-16 in a sample respectively, OC deputy activity consumptive, ON represents normal healthy controls person, and MeanON represents the mean value in all Normal groups.Experiment is set up negative control and is repeated experiment, and negative control is do not add cDNA template in reaction system, with ddH
2o replaces, and all quantitative fluorescent PCRs all do 3 repetitions.
Described method, described A5 specifically performs following operation: miRNA relative expression component analysis adopts GraphPadPrism5 software, adopts single sample T inspection and independent sample T in software to check.During P < 0.05, think that result has significant difference statistically, during P < 0.01, think that result has pole significant difference statistically.The miRNA data processed result of differential expression represents with mean+/-standard error, draws the scatter diagram containing error line.
The present invention prepares the sick special serum miRNAs of active tuberculosis, utilize the serum miRNAs of the preliminary examination differential expression of high-flux sequence, the specific reverse transcription primer of application stem ring method design, carry out the serum miRNAs that fluorescence quantifying PCR method checking obtains differential expression, control pulmonary tuberculosis to research to propagate, the incidence reducing pulmonary tuberculosis has great importance.
Accompanying drawing explanation
Fig. 1 detects by the method for quantitative fluorescent PCR the hsa-miR-378 (P < 0.05) that expression amount raises in active tuberculosis patient serum;
Fig. 2 detects by the method for quantitative fluorescent PCR the hsa-miR-483-5p (P < 0.01) that expression amount raises in active tuberculosis patient serum.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.
Material: total RNA extraction reagent box is purchased from Qiagen company; Quantitative fluorescent PCR Reverse Transcription box is purchased from Fermentas company; SYBRsystemMix is purchased from precious biotechnology (Dalian) company limited of TaKaRa; 96 orifice plates and film are purchased from Axygen company.
Embodiment 1
The collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection:
Collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons.All participator's blood samples are rise morning to extract on an empty stomach, adopt disposal vacuum not anticoagulant blood-collecting pipe, gather peripheral blood 3.0mL, centrifugal within 4 hours (3000xg, 10min, 4 DEG C), suct and be distributed into each 200 μ L serum samples clearly afterwards, be stored in-80 DEG C of refrigerators.
Embodiment 2
Extract the total serum IgE in all serum samples:
Active tuberculosis patient and normal healthy controls person's serum are taken out in-80 DEG C, treats that 4 DEG C dissolve naturally; Draw 200 μ L with pipettor, join 1.5mL without in RNaseEP pipe, add 700 μ LQiagenLysissolution, be placed in the mixing of vortex instrument violent vortex to abundant cracking, until can't see white suspension thing; Room temperature leaves standstill 5min; Add 140 μ L chloroforms; Violent mixing 15s, stratification 3min; See 12000g, 15min when having demixing phenomenon, 4 DEG C; Get supernatant fluid (general 500 μ L) with pipettor to transfer in new 1.5mL collection tube, add the dehydrated alcohol of 1.5 times of supernatant volumes, mixing of turning upside down; Getting 700 μ L is added in pillar containing the lysate of ethanol, and the centrifugal 18s of 8000g, abandons lower floor, resets collection tube and (repeats 2 times) on post; Add 700 μ LRWTsolution, the centrifugal 18s of 8000g, abandons lower floor, is placed in by post on a new collection tube; Add 500 μ LRPE, the centrifugal 18s of 8000g, abandons lower floor, resets collection tube on post; Add 500 μ LRPE, the centrifugal 2min of 8000g, abandons collection tube.Pillar is put into new 2mL collection tube, at full speed centrifugal 1min; Pillar is put into 1.5mLElution pipe; Add 30 μ LRNase-FreeWater, leave standstill 1min, solution is fully combined with post, then the centrifugal 1min of 8000g.
Get active tuberculosis patient and normal healthy controls person's serum total serum IgE sample 1.0 μ L, OD value is detected through nanodrop-2000, ultraviolet spectrophotometer measures A260/A280 numerical value, and measurement result total rna concentration is between 5 ~ 10ng/ μ L, and A260/A280 numerical value is between 1.2 ~ 1.9.
Embodiment 3: by high-flux sequence examination technology, the miRNAs of the serum differential expression of preliminary screening active tuberculosis patient and normal healthy controls person.
20 routine consumptives and 20 routine normal healthy controls persons respectively provide the serum of 20mL; Serum requires: concentration >=5ng/ul, total amount >=100ng after AgilentBioanalyzer detects; The impurity such as albumen, salt ion is few, and PAGE glue electrophoretic separation compares compared with normal; According to result and bioinformatics software analysis, as normalization method and variance analysis method of calculation select differential expression miRNAs; Comprise hierarchical clustering by clustering method, Kmeans cluster and SOM etc. classify to different samples, and carry out similarity analysis to difference miRNAs, obtain the serum miRNAs of differential expression.
Described method, the PRELIMINARY RESULTS that high-flux sequence examination technology obtains, detects 236 miRNAs in active tuberculosis patient serum, 254 miRNAs detected in normal healthy controls person; Active tuberculosis patient and normal healthy controls person have the serum miRNAs of 91 differential expressions, have 44 miRNAs expression amounts to raise in consumptive, and 47 miRNAs expression amounts are lowered.The miRNAs chosen meets three conditions: in active tuberculosis patient or normal healthy controls person, 1. detect miRNAs expression amount at least reach 20copies; 2. differential expression is more than 2 times; 3. there were significant differences (P < 0.01) for P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
Embodiment 4: design miRNAs stem ring reverse transcription primer and upstream, downstream primer.
The mature sequence of corresponding miRNAs is found in miRBase database, hsa-let-7i (MIMAT0000415UGAGGUAGUAGUUUGUGCUGUU), hsa-miR-122 (MIMAT0000421UGGAGUGUGACAAUGGUGUUUG), hsa-miR-146a (MIMAT0000449UGAGAACUGAAUUCCAUGGGUU), hsa-miR-146b-5p (MIMAT0002809UGAGAACUGAAUUCCAUAGGCU), hsa-miR-181a-2* (MIMAT0004558ACCACUGACCGUUGACUGUACC), hsa-miR-320c (MIMAT0005793AAAAGCUGGGUUGAGAGGGU), hsa-miR-378 (MIMAT0000732ACUGGACUUGGAGUCAGAAGG), hsa-miR-483-5p (MIMAT0004761AAGACGGGAGGAAAGAAGGGAG), hsa-miR-93 (MIMAT0000093CAAAGUGCUGUUCGUGCAGGUAG).
With general stem ring method design.Add 6 bases of holding reverse complemental to match with ripe miRNAs3 ' at 3 ' end of general stem ring, be stem ring primer, that is:
hsa-let-7i：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGC，
hsa-miR-122：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAACA，
hsa-miR-146a：
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACCCA，
hsa-miR-146b-5p：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCTA，
hsa-miR-181a-2*：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGTACA，
hsa-miR-320c：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCTC，
hsa-miR-378：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTTCT，
hsa-miR-483-5p：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCCCT，
hsa-miR-93：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT；
Reverse transcription can be carried out to miRNAs.
The each reverse transcription of stem ring primer can only hold for a kind of miRNAs or 3 ' miRNAs that 6 bases are identical.And fluorescent quantitation upstream and downstream design of primers, downstream primer is the part on stem ring, and upstream primer can pass through primer5.0 software design, upstream and downstream primer length about 20bp, annealing temperature Tm value is at about 60 DEG C, and GC content is about 40%-60%, and amplified production is about 60bp.After design of primers completes, by lesegene7.0, primer is evaluated.General downstream primer and the special upstream primer of miRNAs is used to increase.
General downstream primer is: 5 '-AGTGCAGGGTCCGAGGTATT-3 ',
Upstream primer: hsa-let-7i (5 '-CTCGGCCTGAGGTAGTAGTTTG-3 '),
hsa-miR-122(5’-CGCGGTGGAGTGTGACAATG-3’)，
hsa-miR-146a(5’-GGGTGAGAACTGAATTCCA-3’)，
hsa-miR-146b-5p(5’-ATGGCCTGAGAACTGAATTCC-3’)，
hsa-miR-181a-2*(5’-ATCTGTCACCACTGACCGTTG-3’)，
hsa-miR-320c(5’-ATGCCAAAAGCTGGGTTGA-3’)，
hsa-miR-378(5’-GATAATACTGGACTTGGAGTC-3’)，
hsa-miR-483-5p(5’-TCTCGGAAGACGGGAGGA-3’)，
hsa-miR-93(5’-CGCGGCAAAGTGCTGTTC-3’)，
Increase in active tuberculosis patient serum sample for internal reference miR-16, observe amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has obvious logarithmic phase, and blank generates without continuous curve, illustrate that amplification is all right.To amplification miR-16 product do solubility curve, have and only have one obvious unimodal, and without template (NTC) contrast occur without obvious crest, illustrate through amplification after product be special miR-16.Namely this is quantitatively pollution-free, accurately, reliably.
Embodiment 5
The serum miRNAs that quantitative fluorescent PCR checking active tuberculosis disease is relevant.
Reverse transcription is carried out with Fermentas Reverse Transcription box.Reverse transcription reaction system: total serum IgE 2.5 μ L, RNase inhibitor RRI0.25 μ L, dNTP (10mMeach) 0.5 μ L, 5 × M-MuLVbuffer1.0 μ L, stem ring primer SLP (2 μMs) 0.5 μ L, M-MuLV ThermoScript II 0.25 μ L, cumulative volume 5 μ L.Method is carried out in two steps, the first step: 65 DEG C, 5min; On ice, 10min.Second step: 42 DEG C, 60min; 70 DEG C, 15min; After completion of the reaction ,-80 DEG C of refrigerators are stored in.
Quantitative fluorescent PCR system: ddH
2o7 μ L, SYBRsystemMix10 μ L, 50*ROXrefenencedye0.4 μ L, FP (10 μMs)/RP (10 μMs) 0.8 μ L, Template (cDNA) 1 μ L, cumulative volume 20 μ L.Slightly centrifugal after mixing, in ABI7500, carry out quantitative fluorescent PCR reaction, reaction parameter is set to: 95 DEG C of 30s, then 95 DEG C of 5s, 60 DEG C of 31s, totally 40 circulations.
The data analysis of miRNAs fluorescent quantitation is reference gene with miR-16, is normalized target gene, has guaranteed the amount of comparison object gene in the sample of equal amount.The change formula that miRNA expresses multiple is RQ=2
-Δ Δ CT, wherein Δ Δ CT=(CTmiRNA-CTmiR-16) OC-(CTmiRNA-CTmiR-16) MeanON.RQ represents relative expression's variable quantity, CTmiRNA and CTmiR-16 represents the Ct value with target miRNA and reference gene miR-16 in a sample respectively, OC deputy activity consumptive, ON represents normal healthy controls person, and MeanON represents the mean value in all Normal groups.Experiment is set up negative control and is repeated experiment, and negative control is do not add cDNA template in reaction system, with ddH
2o replaces, and all quantitative fluorescent PCRs all do 3 repetitions.
MiRNA relative expression component analysis adopts GraphPadPrism5 software, adopts single sample T inspection and independent sample T in software to check.During P < 0.05, think that result has significant difference statistically, during P < 0.01, think that result has pole significant difference statistically.The miRNA data processed result of differential expression represents with mean+/-standard error, draws the scatter diagram containing error line.
Qualification result:
The collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection
Collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons altogether.Tuberculosis sufferer blood sample is rise morning to extract on an empty stomach, adopts disposal vacuum not anticoagulant blood-collecting pipe, gathers peripheral blood 3.0mL, centrifugal.Suct and be distributed into each 200 μ L serum samples clearly afterwards, be stored in-80 DEG C of refrigerators.Final selected sample ensures that men and women's sex ratio, age, active tuberculosis cause of disease expose history, vaccine inoculation and skin PPD and test similar in normal healthy controls person with active tuberculosis sufferer.Case essential information is in table 1.
ap value represents does T inspection between the two groups,
bp value represents is χ between the two groups
2inspection.
The ill example of table 1 active tuberculosis and normal healthy controls clinical pathology information
Extract the total serum IgE of serum sample
Because in serum sample, total serum IgE enrichment is lower, the serum being extracted 200 μ L by Qiagen test kit can be obtained between concentration 5 ~ 10ng/ μ L of total serum IgE, and A260/A280 numerical value is between 1.2 ~ 1.9.Because content is lower, therefore we generally do not carry out detected through gel electrophoresis, and mainly become cDNA to be used for quantitative fluorescent PCR total serum IgE reverse transcription.Total serum IgE in serum sample has exceptional stability, can tolerate multigelation, acid-alkali treatment, DNase process etc.In serum sample, the NanoDrop-2000 measurement result of total serum IgE is in table 2.
The NanoDrop-2000 measurement result of total serum IgE in table 2 serum sample
The high-flux sequence examination of the serum miRNAs that active tuberculosis is sick special
20 routine consumptives and 20 routine normal healthy controls person's serum miRNAs by high-flux sequence examination technical Analysis.The PRELIMINARY RESULTS that high-flux sequence examination technology obtains, detects 236 miRNAs in active tuberculosis patient serum, 254 miRNAs detected in normal healthy controls person; The kind of active tuberculosis patient and the medium and small RNAs of normal healthy controls person's serum is in table 3; In active tuberculosis patient and normal healthy controls person's serum, the quantity of miRNAs is in table 4.Active tuberculosis patient and normal healthy controls person have the serum miRNAs of 91 differential expressions, have 44 miRNAs expression amounts to raise in table 5 in consumptive, and 47 miRNAs expression amounts are lowered in table 6.
The kind of high-flux sequence examination technical Analysis active tuberculosis patient and the medium and small RNAs of normal healthy controls person's serum applied by table 3
The quantity of miRNAs in high-flux sequence examination technical Analysis active tuberculosis patient and normal healthy controls person's serum applied by table 4
Table 5 apply high-flux sequence examination technical Analysis in active tuberculosis patient serum expression amount raise
Table 6 apply high-flux sequence examination technical Analysis in active tuberculosis patient serum expression amount lower
The miRNAs chosen meets three conditions: in active tuberculosis patient or normal healthy controls person, 1. detect miRNAs expression amount at least reach 20copies; 2. differential expression is more than 2 times; 3. there were significant differences (P < 0.01) for P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
Design miRNAs stem ring reverse transcription primer and upstream, downstream primer:
In general stem is around-France, have 14 pairs of bases to form stem structure, 16 bases form ring structure, and this stem ring has very high stability.Add 6 bases of holding reverse complemental to match with ripe miRNAs3 ' at 3 ' end of general stem ring, be stem ring primer, reverse transcription can be carried out to miRNAs, finally use general downstream primer and the special upstream primer of miRNAs to increase.The each reverse transcription of stem ring primer can only hold for a kind of miRNAs or 3 ' miRNAs that 6 bases are identical.And fluorescent quantitation upstream and downstream design of primers, reverse primer is last point of stem ring, and upstream primer can be designed by primer5.0, upstream and downstream primer length about 20bp, annealing temperature Tm value is at about 60 DEG C, and GC content is about 40%-60%, and amplified production is about 60bp.After design of primers completes, can be evaluated primer by lesegene7.0.To the expression of results of 9 serum miRNAs after quantitative fluorescent PCR and analysis, increase in active tuberculosis patient serum sample for internal reference miR-16, observe amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has obvious logarithmic phase, and blank generates without continuous curve, illustrate that amplification is all right.To amplification miR-16 product do solubility curve, have and only have one obvious unimodal, and without template (NTC) contrast occur without obvious crest, illustrate through amplification after product be special miR-16.Namely this is quantitatively pollution-free, accurately, reliably.
The serum miRNAs that quantitative fluorescent PCR checking active tuberculosis is sick special
To the data analysis of quantitative fluorescent PCR gained, draw the serum miRNAs relative expression fold differences between active tuberculosis patient and normal healthy controls person, test by the Mann-Whitney method in GraphPadPrism5 statistical analysis software, whether the differential expression of serum analysis miRNAs in two groups of sample serum has significant difference (P < 0.05) statistically again.9 miRNAs in 60 routine active tuberculosis patients and 60 routine normal healthy controls group serum are verified, found that hsa-miR-378 and hsa-miR-483-5p has significant difference (being respectively P < 0.05 and P < 0.01) between pulmonary tuberculosis group and normal healthy controls group, difference is more than 2 times, Ct value < 35, verification and measurement ratio > 75% (Fig. 1 and Fig. 2).
The preparation method of the serum miRNAs that a kind of active tuberculosis of the present invention is sick special, for the serum miRNAs of differential expression between detected activity consumptive and normal healthy controls person, has higher specificity and accuracy.
Should be understood that, for those of ordinary skills, can be improved according to above explanation or convert, and all these improve and convert the protection domain that all should belong to claims of the present invention.
Claims (1)
1.hsa-miR-378 and hsa-miR-483-5p is preparing the application in the sick specific markers of active tuberculosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210171919.8A CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210171919.8A CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102732520A CN102732520A (en) | 2012-10-17 |
| CN102732520B true CN102732520B (en) | 2016-01-20 |
Family
ID=46988822
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210171919.8A Active CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102732520B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884052A (en) * | 2017-03-23 | 2017-06-23 | 李继承 | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571938B (en) * | 2013-02-25 | 2016-04-20 | 哈尔滨医科大学 | The reverse transcription PCR method of tubercle bacillus affection is detected from clinical samples |
| CN104017806B (en) * | 2014-05-08 | 2017-11-10 | 复旦大学 | MicroRNA and its application in active tuberculosis detection reagent is prepared |
| EP3026121A1 (en) * | 2014-11-27 | 2016-06-01 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Micro-RNA-based diagnosis of tuberculosis |
| CN109593845A (en) * | 2019-01-25 | 2019-04-09 | 河北仁博科技有限公司 | Purposes of the miRNA as the marker of diagnosis of endometriosis |
| CN109852686A (en) * | 2019-02-26 | 2019-06-07 | 浙江大学医学院附属妇产科医院 | The internal reference collection of excretion body miRNA a kind of and more internal reference combination with standard sizing techniques |
| CN110018302A (en) * | 2019-03-27 | 2019-07-16 | 南京大学 | It is a kind of new to cause pulmonary inflammatory diagnosing and treating reagent by liver diseases |
| CN114231612B (en) * | 2021-12-27 | 2022-05-06 | 深圳大学 | MiRNA marker related to active tuberculosis and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307361A (en) * | 2008-07-15 | 2008-11-19 | 南京大学 | Method for identifying miRNA in blood serum of patient with lung cancer by Solexa technology |
-
2012
- 2012-05-30 CN CN201210171919.8A patent/CN102732520B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
Non-Patent Citations (2)
| Title |
|---|
| Circulating MicroRNAs in Patients with Active Pulmonary Tuberculosis;Fu Y. 等;《JOURNAL OF CLINICAL MICROBIOLOGY》;20111231;第49卷(第12期);第729-733页 * |
| 肺结核患者外周血单核细胞中差异表达miRNA的筛选;张立群 等;《中国防痨杂志》;20111130;第33卷(第11期);第4246-4251页 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884052A (en) * | 2017-03-23 | 2017-06-23 | 李继承 | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102732520A (en) | 2012-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102732520B (en) | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special | |
| US9868988B2 (en) | Method to assess human allograft status from microrna expression levels | |
| CN102016037A (en) | Use of serum/plasma microRNA in early diagnosis of HBV infection and liver cancer | |
| US20170283883A1 (en) | Methods for lung cancer detection | |
| Tong et al. | Circulating microRNAs in young patients with acute coronary syndrome | |
| CN104152567B (en) | MiRNA-199a is preparing the purposes in diagnostic kit | |
| KR20130029079A (en) | Marker consisting of plasma microrna and a new method for diagnosis of hepatocellular carcinoma | |
| CN107653315A (en) | Applications of the lncRNAs active tuberculosis disease-specific mark | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN104450704A (en) | Schizophrenia peripheral blood marker miR-132 and application thereof | |
| CN104480106A (en) | Serum/plasma micro-RNA marker for detecting patients with mild cognitive impairment and application thereof | |
| CN112195244B (en) | Application of GMFB (GMFB) as hepatocyte liver cancer biomarker | |
| JP2021171052A (en) | Microrna serum marker, primer set, kit, and their use to identify sex of sturgeon | |
| CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| US20230167504A1 (en) | Method for aiding detection of pancreatic cancer | |
| Yu et al. | Identification of potential biomarkers and pathways for sepsis using RNA sequencing technology and bioinformatic analysis | |
| CN102140537A (en) | Polymerase chain reaction detection method of hepatitis B virus genotyping | |
| CN102021169A (en) | Serum/plasma miRNA composition and use thereof | |
| CN111808946A (en) | Myelodysplastic syndrome marker and kit thereof | |
| Li et al. | Screening and validating the immune-related gene expression signatures in peripheral blood mononuclear cells of nonischaemic cardiomyopathy | |
| CN112725484A (en) | Mycobacterium tuberculosis sRNA real-time fluorescence quantitative PCR standard substance and application thereof | |
| CN104152566B (en) | The purposes of miRNA-26a | |
| CN105483224B (en) | A kind of detection kit and its application for distinguishing active tuberculosis and latent tuberculosis infection | |
| CN110734971A (en) | group biomarker for diagnosing metabolic fatty liver mediated vascular diseases and application thereof | |
| CN104164500A (en) | Application of miRNA marker hsa-miR-486-5p |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |