JP2021159080A - Kits and methods for detecting mycoplasma pneumonia nucleic acid and presence or absence of mutation in drug resistance gene - Google Patents

Abstract

To provide kits and methods useful for detecting Mycoplasma pneumonia nucleic acid and the presence or absence of drug resistance gene mutation therein.SOLUTION: Disclosed is a reagent kit for determining Mycoplasma pneumonia nucleic acid and mutation in the drug resistance gene, which comprises KOD DNA polymerase, a primer pair of specific sequences and a target-specific fluorescent probe. Designing primers and probes of specific sequences allows for quick, simple and accurate detection of Mycoplasma pneumonia nucleic acid, Mycoplasma pneumonia nucleic acid 23S rRNA gene and mutation at locus 2063 or 2064 of the 23S rRNA.SELECTED DRAWING: None

Description

The present invention relates to the technical field of molecular biology, specifically to a kit and a method for detecting a pneumonia mycoplasma nucleic acid and a mutation in a drug resistance gene thereof, wherein the kit is contained in a sputum sample, a pharyngeal swab sample, or a nasal swab sample. It is used to qualitatively detect the Mycoplasma pneumoniae 23S rRNA gene and its mutations in vitro, and is applied to the auxiliary diagnosis of Mycoplasma pneumoniae infection.

Mycoplasma pneumoniae (also abbreviated as MPneumonia, MP or Mp) is the pathogen of human mycoplasma pneumoniae, which is transmitted primarily by droplets and has an incubation period of 2-3 weeks. Currently, mycoplasma pneumoniae is already one of the major pathogens of community-acquired pneumonia and is a common pathogen of respiratory tract infections in adolescents and the elderly. It can cause and can be fatal in severe cases. MP is sensitive to macrolide antibiotics that suppress the synthesis of microbial proteins, quinolone antibiotics that act on DNA topoisomerases, and tetracycline antibiotics. However, given the physiological characteristics of children and adverse drug reactions, tetracycline and quinolone antibiotics are limited in the treatment of childhood mycoplasma infections, and macrolide antibiotics are the first-line drugs for clinical MP infections. With the widespread clinical application of macrolide drugs, drug resistance phenomena due to gene mutations will continue to appear. In recent years, several domestic and foreign literatures have reported one after another that MP drug-resistant strains having drug resistance to macrolide antibiotics have been isolated clinically. Drug resistance of MP has been reported to be 3% in Germany, and Japanese studies have shown that drug resistance of MP increased from 5% to more than 30% between 2002 and 2006, and children in China. With MP drug resistance> 80%, treatment of childhood MP pneumonia and its extrapulmonary complications has become even more difficult. Therefore, clinical normal detection of drug resistance genes in MP-infected child patients leads to more effective treatment of mycoplasma-infected children, reduced incidence of extrapulmonary complications, and late-stage drug-resistant MP infection. All of them have a certain clinical significance for the treatment of infection, the study of drug resistance mechanism, and the control of drug resistance.

Currently, clinical detection of mycoplasma pneumoniae mainly includes isolation culture methods, antigen detection methods, PCR detection methods and serological detection methods.
In the case of the separation culture method, it takes a lot of cost and labor to separate and culture Mp from the clinical sample, and it is necessary to carry out a series of subcultures in a special medium, and the culture takes several weeks. Even if the separation efficiency of the medium is increased, the sensitivity of the diagnosis by such a method is less than 60% of that of the PCR method, but the specificity of the separation culture method can reach 100%.
Methods for direct rapid antigen detection against respiratory tract infection Mp by antigen detection techniques include direct immunofluorescence, counterimmunography, immunoblotting and antigen-capturing enzyme-binding immunotechnology. The concentration of Mp in the patient's sputum sample ^{is about 10 2} to 10 ⁶ cfu / ml, the concentration range detected by the antigen detection technique is 10 to 100 cfu / ml, and the sensitivity of antigen detection without Mp amplification culture is high. Since it is so finite, we do not recommend diagnosis by antigen detection when it can be diagnosed using nucleic acid amplification technology.

The application of PCR diagnostic technology has replaced the conventional isolation culture method, and in the late 1980s, simulated clinical specimens, animal models and clinical experiments proved the diagnostic ability of PCR technology for Mp infection. The conventional Mp PCR detection method currently recommended and used by the Centers for Disease Control and Prevention in the United States amplifies fragments of the MpATP enzyme gene sequence region based on the PCR detection method originally designed by Bernet et al.
Serological detection methods have traditionally been the main methods in Mp diagnosis and epidemiological studies. The most accurate diagnostic method for adult Mp infection is to detect IgM and IgG twice at the same time 2-3 weeks after infection. If the antibody titer differs by 4 times or more, it is Mp positive. IgG antibodies in patients with a history of Mp infection are continuously elevated and may be free of IgM reactions in adults over a long period of time, all of which are limited to simply detecting Mp infection by serological methods. Is.

With the increase in drug-resistant strains, it is necessary to detect whether or not they are drug-resistant bacteria before administering for treatment, and among various detection methods, only the PCR method can analyze the genes of drug-resistant bacteria. can. And so far, a method for rapidly detecting mycoplasma pneumoniae and / or performing a drug resistance test has been studied (Patent Documents 1 and 2, Non-Patent Document 1). However, there is a need for the development of more useful detection kits and detection methods.

Japanese Unexamined Patent Publication No. 2015-128400 Japanese Unexamined Patent Publication No. 2014-042459

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY Oct. 2008, p. 3542-3549

An object of the present invention is to provide a detection kit and a detection method for Mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation, in which the Mycoplasma pneumoniae nucleic acid, Mycoplasma pneumoniae 23S rRNA gene and 2063 or 2064 gene on 23S rRNA are used. Whether or not a mutation has occurred in the locus can be detected quickly and easily.

In order to achieve the above object, the technical solution according to the present invention is as follows. A kit for detecting Mycoplasma pneumoniae nucleic acid and drug resistance gene mutations thereof includes KOD DNA polymerase, primer MPN-F, primer MPN-R, and a specific target fluorescent probe;
The primer MPN-F is a forward consisting of a continuous 25-36 base sequence in the base sequence shown at positions 1910 to 2039 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The primer MPN-R is a reverse consisting of a base sequence having a length of 25 to 36 consecutive bases in the base sequence shown at positions 2091 to 2257 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The specific target fluorescent probe consists of the base sequence shown at positions 2040 to 2081 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence having a length of 16 to 23 consecutive bases in a base sequence complementary thereto. It is a probe designed as described above and characterized in that one of the terminal bases is labeled with a fluorescent dye.

The related contents in the above technical solution will be described as follows.
1. In the above-mentioned solution, the KOD DNA polymerase is obtained by extracting and purifying from the hyperthermococcus kodakaraensis KOD1 isolated from the sulfur pores of Kodakarajima, Kagoshima Prefecture, and is a strong 3'→ 5'nucleic acid. It has exonuclease activity (calibration activity) and is about 50 times more accurate than Taq DNA Polymerase. It has a DNA synthesis rate of 1 Kb / 30s or higher, which is twice that of the most common Taq polymerase. In addition, excellent continuous synthesis performance is one of the factors for the high elongation rate. By adopting KOD DNA polymerase, the time of one cycle can be shortened from the original minutes to several tens of seconds. For example, a KOD DNA polymerase commercially available from Toyobo Co., Ltd. can be preferably used.
2. In the above-mentioned solution, the fluorescent probe is preferably QProbe, and is a probe labeled with a fluorescent dye having a characteristic of fluorescence quenching by mixing a specific sequence. For the structure of QProbe, refer to Japanese Patent No. 3437816 and the like, but if this feature is utilized, it is not necessary to use a dye into which another double-stranded nucleic acid structure such as a DNA insertion agent is inserted, and the FRET phenomenon can be caused. It is not necessary to use two types of probes, and by using a probe labeled with one type of fluorescent substance, high-speed amplification is not inhibited and the target nucleic acid sequence can be specifically detected.

3. In the above solution, the kit may further include an internal control primer IC-F, an internal control primer IC-R, an internal control probe and an internal control template. In a preferred embodiment, the internal control primer IC-F is, for example, a forward primer with the sequence 5'-CCCGGTATTGTTAGAAATTTCCTTCTCCGTC-3'(SEQ ID NO: 34) designed for the matK gene of Lagarosiphon madagascariensis.
The internal control primer IC-R is, for example, a reverse primer having a sequence of 5'-CCCCATCCAGGATTGTAGATAGAATTGAATCAAG-3'(SEQ ID NO: 35) designed for the matK gene of Lagaroshiphon madagascariensis.
The internal control probe is, for example, a probe designed using the matK gene of Lagarosiphon madagascariensis as a template and having a sequence of 5'-GATCDATCATTCGABATTC-3'(SEQ ID NO: 36).
The internal control template is, for example, one fragment of matK gene Lagarosiphon madagascariensis, sequence is 5'-GCGGTTATTGTAGAAATTCCTTTCTCCCGTCCATTTTTTCTTGAAGAAAAAAAAGAAATACCAAAATATCAAAATTTACGATCTATTCATTCGATATTCCCTTTTTTAGAGGACAAATTTTTACATTTAAATTATGTGTCTGATATAGTAATACCTTATCCTATTCATCTCGAAATCTTGATTCAAATTCTACAATCCTGGAT-3 '(SEQ ID NO: 37).
The Lagarosiphon madagascariensis (Latin scientific name) is an aquatic plant, a grass with stems, and is mainly distributed in Madagascar.

4. In the above-mentioned solution, both the positive control reagent 1 and the positive control reagent 2 are samples whose concentration and base sequence are known in advance, and are detected together with other test samples, so that the detection result is accurate. Verify sex.
In order to achieve the above object, the method for detecting the presence or absence of mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation of the present invention is used.
Step 1 of preparing a test sample collected from sputum, pharyngeal swab, or nasal swab and pretreated as a detection target,
Step 2 in which the nucleic acid contained in the test sample is used as a template gene chain and a PCR amplification reaction is performed using the above kit,
The amplification product obtained in step 2 is detected by a melting curve analysis method, and the melting temperature of the amplification product having no drug resistance gene mutation and the probe and the melting temperature of the amplification product having the drug resistance gene mutation and the probe are determined. It includes step 3 of confirming the presence or absence of a drug resistance gene mutation in the amplification product by utilizing the difference.

1. In the above-mentioned solution, the PCR amplification reaction may include dNTP, and the dNTPs are deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP). , A mixture of deoxycytidine triphosphate (dTTP).
2. In the above solution, the reaction process of the PCR amplification reaction in step 2 is, for example,
(1) Pre-denaturation at 94.0 ° C. for 30.0 seconds to 2.0 minutes.
(2) Denatured at 97.0-98.0 ° C. for 1.0 to 10.0 seconds.
(3) Anneal at 58.0 to 60.0 ° C. for 3.0 to 30.0 seconds.
(4) Elongate at 63.0 to 68.0 ° C. for 5.0 to 30.0 seconds, and cycle (2) to (4) 50 to 70 times (preferably, for example, 60 times).
3. In the above-mentioned solution, the melting curve analysis may be an analysis based on a high-resolution melting curve (HRM) analysis technique. The high-resolution melting curve analysis is the latest genetic analysis method for mutation scanning and genotyping, which has become popular abroad in recent years, to form different forms of melting curves at different melting temperatures of mononucleotides. Gene analysis based on new technology, highly sensitive, capable of detecting single base differences, low cost, high flux, fast speed, accurate results, limited to genotypes to be detected Not done.

The design principle of the present invention is as follows. In the kit of the present invention, the PCR melting curve method is used to detect whether or not a mutation has occurred in the 23SrRNA gene of mycoplasma pneumoniae nucleic acid and its 2063 or 2064 locus. The verification principle is divided into two parts, one of which is denatured by using real-time fluorescence quantitative PCR technology and adding a pneumonia mycoplasma-specific amplification primer using the 23S rRNA gene region of pneumonia mycoplasma as a target template gene strand. , Annealing and catalyzing each primer with a fast-amplifying KOD DNA polymerase to extend the gene strand. In this case, the enzymatic activity of the dNTP substrate and magnesium ion acts on the annealed primer to extend and repeat the process to amplify the target gene strand. After that, the amplified target gene strand hybridizes with a specifically paired Mycoplasma pneumoniae fluorescent probe (the probe can be detected quickly and easily) and causes a fluorescence change to determine whether or not Mycoplasma pneumoniae is present. Is detected. The other part utilizes the difference in melting temperature between the wild-type pneumonia mycoplasma nucleic acid and the case where the gene at the 2063 or 2064 locus is mutated, and draws the melting curve by detecting the fluorescence change. It is to determine whether or not a mutation has occurred at the 2063 or 2064 locus of the pneumonia mycoplasma 23S rRNA gene. In addition, an internal control sample is also added to the above reaction system, and it is possible to grasp the effect of the interfering substances in the clinical sample on the PCR reaction and prevent false negatives of mycoplasma pneumoniae detection.

In a specific embodiment, PCR amplification and hybridization with a specific fluorescent probe of Mycoplasma pneumoniae are performed using a fully automatic nucleic acid purification / fluorescence PCR analyzer, and then the fluorescence change is detected. The software system of the device automatically monitors the fluorescence intensity in real time, draws a melting curve by calculating the amount of change in fluorescence in real time, obtains the fluorescence differential value and melting temperature of the unknown sample, and detects the unknown sample. Realize.
The pneumonia mycoplasma nucleic acid and its drug resistance gene mutation detection kit (PCR melting curve method) of the present invention can detect pneumonia mycoplasma 23S rRNA gene and its drug resistance mutation in a sputum, pharyngeal swab or nasal swab sample in vitro by PCR amplification method. It is used for qualitative detection and is applied to the auxiliary diagnosis of mycoplasma pneumoniae infection. Detection of mutations in the 23S rRNA gene of mycoplasma pneumoniae and its 2063 or 2064 locus by a fully automated nucleic acid purification and fluorescence PCR analyzer (preferably GENECUBE®) is optimal for clinicians to treat mycoplasma pneumoniae. It can assist in deciding on a treatment strategy, which allows the clinician to determine the appropriate drug, dosage and economic treatment strategy for the patient, and clinically rational dosing, personalized dosing and treatment. Provides a powerful means to.

The beneficial effects of the present invention are as follows.
(1) According to the present invention, by using a combination of KOD DNA polymerase, primer MPN-F, primer MPN-R, and a specific labeled fluorescent probe, pneumonia mycoplasma nucleic acid 23S rRNA can be efficiently amplified, and its wild type and mutation can be obtained. It is possible to detect with high sensitivity while distinguishing types.
(2) The conventional PCR reaction system generally requires an amount of 40 μL, and the amount of the fluorescence quantitative PCR amplification reaction system of the present invention is at least 13.2 μL.
(3) The fluorescence quantitative PCR amplification reaction time of the present invention is significantly shortened, and 60 cycles of denaturation, annealing and extension can be completed in a minimum of 40 minutes.
(4) The conventional kit for detecting a drug resistance gene mutation in Mycoplasma pneumoniae nucleic acid needs to be stored under the condition of −20 ° C., and the kit of the present invention can be stored under the condition of 2 to 8 ° C.
(5) The present invention employs completely sealed PCR amplification and can prevent false positive results due to carryover or the like.
(6) The positive control sample of the present invention is a sample that has been substantially pre-designed and whose concentration and base sequence are known, and other subjects using the related pneumonia mycoplasma nucleic acid and its drug resistance gene mutation detection kit. The accuracy of the detection result of the test sample is verified by detecting with the test sample (for example, the pharyngeal swab sample). That is, when a test sample is detected using a pneumonia mycoplasma nucleic acid and a drug resistance gene mutation detection kit thereof, the positive control sample of the present invention corresponds to a positive sample having a known concentration, and the pneumonia mycoplasma nucleic acid and its drug resistance. It is used to verify whether the detection results of the gene mutation detection kit are true and valid, and solve the problem of detection quality of Mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation.

In short, the kit of the present invention and its detection method are on pneumonia mycoplasma nucleic acid, pneumonia mycoplasma nucleic acid 23SrRNA gene and 23SrRNA by designing a specific sequence of primers MPN-F, primer MPN-R, and a specific target fluorescent probe. Achieve the purpose of detecting mutations at locus 2063 or 2064 quickly, easily and accurately.

It is a fluorescence quantitative PCR amplification melting curve diagram in the case of pneumonia mycoplasma nucleic acid positive and no mutation at the 2063 or 2064 locus of the 23SrRNA gene, the horizontal axis is the temperature, and the vertical axis is the fluorescence differential value. It is a fluorescence quantitative PCR amplification melting curve diagram in the case of pneumonia mycoplasma nucleic acid positive and a mutation at the 2063 locus of the 23SrRNA gene, the horizontal axis is the temperature, and the vertical axis is the fluorescence differential value. It is a fluorescence quantitative PCR amplification melting curve diagram in the case of pneumonia mycoplasma nucleic acid positive and a mutation at the 2064 locus of the 23SrRNA gene, the horizontal axis is the temperature, and the vertical axis is the fluorescence differential value. It is a fluorescence quantitative PCR amplification melting curve diagram in the case of mycoplasma pneumoniae nucleic acid negative, the horizontal axis is temperature, and the vertical axis is a fluorescence differential value. It is a fluorescence quantitative PCR amplification melting curve diagram of an internal control sample, the horizontal axis is temperature, and the vertical axis is a fluorescence differential value. It is a PCR amplification melting curve diagram which shows the result of the evaluation test 2 of a primer and a probe. The upper graph is the result of using the specific labeled fluorescent probe QP-1, and the lower graph is the result of using the specific labeled fluorescent probe QP-2. Each line shows the case where the Mycoplasma pneumoniae genome template was used at various dilution ratios and the case where purified water was used as a comparative example (the template was not included). It is a PCR amplification melting curve diagram which shows the result of the evaluation test 3 of a primer and a probe. It is a PCR amplification melting curve diagram which shows the result of the evaluation test 4 of a primer and a probe. It is a PCR amplification melting curve diagram which shows the result of the evaluation test 5 of a primer and a probe.

Hereinafter, the present invention will be further described with reference to the drawings and examples.
Example, Kit and detection method for detecting the presence or absence of mutations in pneumonia mycoplasma nucleic acid and its drug resistance gene It is a base sequence shown in 33.
The pneumonia mycoplasma nucleic acid and drug resistance gene mutation detection kit comprises a KOD DNA polymerase, primer MPN-F, primer MPN-R, and a specific target fluorescent probe.
The primer MPN-F is a forward consisting of a continuous 25-36 base sequence in the base sequence shown at positions 1910 to 2039 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer and
The primer MPN-R is a reverse consisting of a base sequence having a length of 25 to 36 consecutive bases in the base sequence shown at positions 2091 to 2257 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer and
The specific target fluorescent probe consists of the base sequence shown at positions 2040 to 2081 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence having a length of 16 to 23 consecutive bases in a base sequence complementary thereto. It is characterized in that it is designed as described above and the fluorescent dye is labeled on any of the terminal bases.

The primer MPN-R, the primer MPN-F, and the specific target fluorescent probe are not particularly limited as long as they have the above-mentioned base sequence, but enable more sensitive detection of the mycoplasma pneumoniae nucleic acid 23S rRNA gene. From the point of view of getting
The primer MPN-F is a forward consisting of a continuous 25-36 base sequence in the base sequence shown at positions 1988 to 2030 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. Preferably a primer;
The primer MPN-R is a reverse consisting of a base sequence having a length of 25 to 36 consecutive bases in the base sequence shown at positions 2101 to 2140 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. Preferably a primer;
The specific target fluorescent probe is designed to consist of a continuous 16 to 22 base long base sequence at positions 2050 to 2071 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33), and is one of the terminal bases. It is preferably labeled with a fluorescent dye.

In certain preferred embodiments,
The primer MPN-F is a forward primer consisting of the base sequence shown in any of SEQ ID NOs: 1 to 10 or a base sequence complementary thereto;
The primer MPN-R is a reverse primer consisting of the base sequence shown in any of SEQ ID NOs: 11 to 20 or a base sequence complementary thereto;
The specific target fluorescent probe is designed to consist of the base sequence shown in any of SEQ ID NOs: 21 to 30 or a base sequence complementary thereto, and one of the terminal bases is labeled with a fluorescent dye. By using the above, it is possible to more reliably detect the pneumonia mycoplasma nucleic acid 23S rRNA gene with high sensitivity.
Here, the primer MPN-F consisting of the nucleotide sequence shown in any of SEQ ID NOs: 1 to 10 is continuous 25 in the nucleotide sequence shown at positions 1910 to 2039 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33). Corresponds to the base sequence of ~ 36 base length.

The primer MPN-R consisting of the nucleotide sequence shown in any of SEQ ID NOs: 11 to 20 has a nucleotide sequence complementary to the nucleotide sequence shown at positions 2091 to 2257 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33). It corresponds to a continuous base sequence of 25 to 36 base lengths.
The specific target fluorescent probe consisting of the nucleotide sequence shown in any of SEQ ID NOs: 21 to 30 is continuous 16 in the nucleotide sequence shown in positions 2040 to 2081 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33). Corresponds to the base sequence of ~ 23 base length.

In one embodiment, the kit of the present invention may further include two types of positive control reagents (positive control reagent 1 and positive control reagent 2). By including such a positive control reagent, it becomes easy to verify whether or not the detection result of whether the 23S rRNA gene of Mycoplasma pneumoniae nucleic acid is contained in the test sample is accurate. It can solve the problem of quality test of 23S rRNA gene test of Mycoplasma pneumoniae nucleic acid.

In certain embodiments, for example, the positive control reagent 1 is a DNA sequence designed to wild-type M. pneumoniae nucleic 23S rRNA gene as a template, the sequence 5'-CCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGAAAGACCCCGTGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACT-3 '(SEQ ID NO: 38) Can be.

In certain embodiments, for example, the positive control reagent 2 is a DNA sequence designed to M. pneumoniae nucleic 23S rRNA gene mutation in 2063 locus as a template, the sequence 5'-CCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGGAAGACCCCGTGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACT-3 ' (SEQ ID NO: 39).

The kit may further include an internal control primer IC-F, an internal control primer IC-R, an internal control probe and an internal control template.
In certain embodiments, the internal control primer IC-F is, for example, a forward primer with the sequence 5'-CCCGGTATTTGTAGAAATTCCTTTCTCCGTC-3'(SEQ ID NO: 34) designed for the matK gene of Lagarosiphon madagascariensis.
The internal control primer IC-R is, for example, a reverse primer having a sequence of 5'-CCCCATCCAGGATTGTAGATAGAATTGAATCAAG-3'(SEQ ID NO: 35) designed for the matK gene of Lagaroshiphon madagascariensis.
The internal control probe is, for example, a probe designed using the matK gene of Lagarosiphon madagascariensis as a template and having a sequence of 5'-GATCDATCATTCGABATTC-3'(SEQ ID NO: 36).
The internal control template is, for example, one fragment of matK gene Lagarosiphon madagascariensis, sequences may be 5'-GCGGTTATTGTAGAAATTCCTTTCTCCCGTCCATTTTTTCTTGAAGAAAAAAAAGAAATACCAAAATATCAAAATTTACGATCTATTCATTCGATATTCCCTTTTTTAGAGGACAAATTTTTACATTTAAATTATGTGTCTGATATAGTAATACCTTATCCTATTCATCTCGAAATCTTGATTCAAATTCTACAATCCTGGAT-3 '(SEQ ID NO: 37).

As shown in FIG. 5, the internal control primer IC-F, the internal control primer IC-R, the internal control probe and the internal control template are true and effective in detecting mutations in the drug resistance gene of Mycoplasma pneumoniae nucleic acid by the kit. It is used to verify whether or not it is.

In actual production, the kit for detecting the Mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation can be produced in a kit containing the following components. However, the names, liquid volumes, and numbers of each reagent / sample listed below are examples, and it does not prevent the kit from being composed of reagents or sample names, liquid volumes, and numbers other than those listed below.
(1) Polymerase Reagent [KOD Mix]: Consists of KOD DNA polymerase and dNTP, and the standard is 140 μL × 1, 140 μL × 2, 140 μL × 3, or 140 μL × 6.
(2) Primer probe reagent [MPN Mix]: That is, it is a mixed reagent consisting of primer MPN-F, primer MPN-R and a specific target fluorescent probe, and the specifications are 140 μL × 1, 140 μL × 2, 140 μL × 3. Or 140 μL × 6.
(3) Positive control sample 1 [MPN PC1]: That is, it is a positive control reagent 1, and the standard is 300 μL × 1.
(4) Positive control sample 2 [MPN PC2]: That is, it is a positive control reagent 2, and the standard is 300 μL × 1.
(5) Negative control sample [MPN NC]: That is, it is a Tris-Hcl buffer solution containing no DNA, and the standard is 300 μL × 1.
Both the positive control reagent 1 and the positive control reagent 2 are constructed and stored in a vector plasmid, and the original plasmid is purchased from Biotechnology Biotechnology (Shanghai) Co., Ltd. The process of constructing the plasmid is as follows.
Primer design-PCR amplification-DNA fragment recovery from gel-vector construction-transformation culture-positive clone identification-shaking culture at 37 ° C-plasmid extraction-base sequence confirmation by sequencing.

The extracted plasmid is further prepared into the positive control reagent 1 by the following method.
(1) Preparation of diluted solution: Add 50% purified water → Add Tris-HCl buffer (pH 7.6) → Add the remaining purified water (swirl vibration in 5 seconds x 3 times) → 0 Obtain a .002 mol / L Tris-HCl (pH 7.6) diluent.
(2) Pre-dilution of wild-type pneumonia mycoplasma vector plasmid: Add 50% of the diluted solution → Add wild-type pneumonia mycoplasma vector plasmid solution → Add the remaining diluted solution (swirl vibration in 5 seconds x 3 times) → Obtain an X copy / microliter of wild-type pneumonia mycoplasma vector plasmid solution (X represents a specific value of plasmid concentration).
(3) Acquisition of positive control reagent 1: Add 50% diluted solution → Add X copy / microliter wild-type pneumonia mycoplasma vector plasmid solution → Add the remaining diluted solution (swirl in 5 seconds x 3 times) Vibrate) → Obtain positive control reagent 1.

The extracted plasmid is further prepared into the positive control reagent 2 by the following method.
(1) Preparation of diluted solution: Add 50% purified water → Add Tris-HCl buffer (pH 7.6) → Add the remaining purified water (swirl vibration in 5 seconds x 3 times) → 0 Obtain a .002 mol / L Tris-HCl (pH 7.6) diluent.
(2) Predilution of the pneumonia mycoplasma vector plasmid (there is a mutation at the 2063 locus of the 23S rRNA gene): Add a 50% diluted solution → The pneumonia mycoplasma vector plasmid (there is a mutation at the 2063 locus of the 23S rRNA gene) ) Add the solution → Add the remaining diluent (swirl vibration in 5 seconds x 3 times) → Obtain an X copy / microliter pneumonia mycoplasma vector plasmid (with a mutation at the 2063 locus of the 23S rRNA gene) solution. ..
(3) Obtain positive control reagent 2: Add 50% diluted solution → Add X copy / microliter pneumonia mycoplasma vector plasmid (mutation at 2063 locus of 23S rRNA gene) solution → Remaining Add the diluent (swirl vibration in 5 seconds x 3 times) → Obtain the positive control reagent 2.
Negative control reagents and positive control reagents are injected together with the test sample for detection, used to evaluate the effectiveness of the detection process, and also used to monitor the environment.

The detection method includes the following steps.
In step 1, a target sample collected by sputum, pharyngeal swab or nasal swab and pretreated test sample is prepared as a detection target.
The requirements for sampling are as follows.
Spontaneous sputum method: Preferably morning sputum, sputum in the deep airways is exhaled, sputum is exhaled as it is into a sputum storage case, and a sample volume of 1 ml or more is collected.
Sputum collection with a pharyngeal swab: A specialist doctor presses the back of the tongue with a curved tongue, puts the swab into the pharynx, rotates the swab to remove mucus, and puts it in a sterile glass tube. Seal and supply for detection.
Nasal swab collection: A specialist inserts a curved swab into the nasal cavity and rotates the swab to remove mucus, place it in sterile glass, seal it and feed it for detection.
Regarding the effects of human gene contamination, it was confirmed that 100,000 copies / test of human gene contamination did not affect the detection of this kit.

Sample storage period: At 2-8 ° C, it can be stored within 24 hours, at -20 ° C or lower, it can be stored within 3 months, and at -70 ° C or lower, it can be stored for a long time. When using cryopreserved samples, repeated freeze-thaw should be avoided and the samples should be warmed to room temperature before use. For transportation, it is transported in an ice pack box containing ice or a foam box containing ice.
In step 2, the target is used as a template gene chain, and the above kit is used to carry out a fluorescence PCR amplification reaction in the following reaction system as a preferred example.
Primer MPN-F 50-550 μmol / L, 0.01-0.2 μL;
Primer MPN-R 300-1200 μmol / L, 0.01-0.2 μL;
Specific Targeted Fluorescent Probe 50-550 μmol / L, 0.01-0.1 μL;
Internal control primer IC-F 50 to 550 μmol / L, 0.01 to 0.2 μL;
Internal control primer IC-R 300-1200 μmol / L, 0.01-0.2 μL;
Internal control probe 50-550 μmol / L, 0.01-0.2 μL;
Internal control template 200,000 to 4000000 copies / μL, 0.001 to 0.1 μL;
_{4 10} to 50 mM, 1 to 5 μL;
dNTP 0.5-5 mM, 1-3 μL;
KOD DNA polymerase 0.3-3U / μL, 0.05-2μL;
KOD buffer 1-5 μL;
Mold 3-12 μL.
In the reaction system of the fluorescent PCR amplification reaction, the amount of each component used may be twice or less of the above value, assuming that the concentration of each component used does not change, that is, the volume used of the primer MPN-F is 0.03. ~ 0.3 μL, the amount of primer MPN-R used is 0.03 to 0.3 μL, the amount of specific target fluorescent probe used is 0.03 to 0.3 μL, and the amount of internal control primer IC-F used is 0. 01 to 0.2 μL, internal control primer IC-R usage is 0.01 to 0.2 μL, internal control probe usage is 0.01 to 0.2 μL, internal control template usage is 0.005 to 0.05 μL, 1 to ₄ μL of sulfonyl 4, 1 to 3 μL of dNTPs, 0.1 to 1 μL of KOD DNA polymerase, 1 to 5 μL of KOD buffer, template The amount is 3-10 μL.

The reaction process of the fluorescent PCR amplification reaction is, as a preferred example,
(1) Pre-denaturation at 94.0 ° C. for 30.0 seconds to 2.0 minutes.
(2) Denatured at 97.0-98.0 ° C. for 1.0 to 10.0 seconds.
(3) Anneal at 58.0 to 60.0 ° C. for 3.0 to 30.0 seconds.
(4) Elongate at 63.0 to 68.0 ° C. for 5.0 to 30.0 seconds, and cycle (2) to (4) 50 to 70 times (preferably, for example, 60 times).
In step 3, as a preferred example
(1) 94.0 ° C., 30.0 seconds,
(2) 39.0 ° C, 30.0 seconds,
(3) Detect by the high-resolution dissolution curve method under the detection conditions of 40.0 to 75.0 ° C. and 0.09 ° C./sec.

The entire fluorescence quantitative PCR amplification reaction is directly performed by a fully automatic nucleic acid purification / fluorescence PCR analyzer (GENECUBE (registered trademark), manufactured by Toyobo Co., Ltd.). The reagents, samples, control samples and corresponding consumables required for the test are set in the fully automatic nucleic acid purification / fluorescence PCR analyzer, and the specifics are as follows.
(1) The polymerase reagent and the primer / probe reagent are mixed by spiral vibration for 5 to 6 seconds, centrifuged at 8000 rpm for several seconds, and set at a specific position of the instrument.
(2) Add 10 μl of the treated sample, positive control reagent, and negative control reagent to several 0.5 mL centrifuge tubes, mix for 5 to 6 seconds by spiral vibration, and centrifuge at 8000 rpm for several seconds. Set to a specific position.
(3) Set a tip with a filter, a plastic capillary cup and a tube (for example, 8-tube or 12-tube) corresponding to the quantity of the test reagent at a specific position of the device.
(4) Perform a PCR reaction by operating a fully automatic nucleic acid purification / fluorescence PCR analyzer. The fully automatic nucleic acid purification / fluorescence PCR analyzer automatically displays the detection result on the display screen after the reaction is completed.

In step 4, the detection result is determined based on the positive determination value, and the basis for determining the three types of positive determination values is as follows.
(1) As shown in FIG. 1, when the fluorescence differential value is ≥7.5 and the melting temperature at which the peak value of the melting curve is located is between 56.1 ° C and 64.1 ° C, pneumonia mycoplasma positive and It is determined that there are no mutations in the 23SrRNA genes 2063 and 2064 loci.
(2) As shown in FIGS. 2 and 3, when the fluorescence differential value is ≥7.5 and the melting temperature at which the peak value of the melting curve is located is between 46.8 ° C and 54.8 ° C. It is determined that Mycoplasma pneumoniae is positive and that there is a mutation in the 23SrRNA gene 2063 or 2064 locus.
(3) As shown in FIG. 4, the fluorescence differential value <7.5, the internal control fluorescence differential value ≥ 1.5, and the melting temperature at which the peak value of the melting curve is located is 52.0 ° C. to If it is between 62.0 ° C., it is judged to be mycoplasma pneumoniae negative.
The fluorescence differential value is a fluorescence differential value obtained by differentiating a value of the detected fluorescence intensity of the target that changes with temperature.
In the melting curve of FIG. 5, the entire detection system is normal and effective only when the internal control fluorescence differential value ≥ 1.0 and the melting temperature where the peak value of the melting curve is located is 42 ° C to 68 ° C. This is especially important when the determination result is negative.

(Primer and probe evaluation test 1)
Furthermore, the following tests were carried out to evaluate the primers and probes of the specific sequence of the present invention.
First, the primers MPN-F and MPN-R shown in Table 1 below were synthesized by a conventional method.

It was confirmed whether the genome of Mycoplasma pneumoniae could be amplified using each of the above primers. The PCR conditions were as follows.
<PCR Mix composition (volume per sample)>
10 × Buffet for KOD-Plus-ver. 2 5.0 μl
25 mM _{sulfonyl 4} 3.0 μl
10 μM Each primer MPN-F 1.5 μl
10 μM Each primer MPN-R 1.5 μl
2 mM dNTPs 5.0 μl
KOD-Plus- (KOD DNA polymerase) 1.0 μl
Template (genome sequence of Mycoplasma pneumoniae ¹ ) 1.0 μl
Distilled sterile water 32.0 μl
(1: Use boiled inactivated bacteria of M. pneumoniae)
<PCR cycle conditions>
94 ° C for 2 minutes,
98 ° C 10 seconds-60 ° C 30 seconds-68 ° C 30 seconds (30 cycles)
4 ° C (reaction stop)
The product obtained by the above PCR reaction was subjected to agarose gel electrophoresis, and the amount of amplified product was evaluated by the shade of the band. The evaluation criteria were as follows: 〇: Dark band is visible, Δ: Light band is visible, ×: Band is not visible. The results are shown in Table 2 below.

As shown in the above results, it was confirmed that the genome sequence of Mycoplasma pneumoniae can be amplified by the combination of all the primers MPN-F and the primer MPN-R. Among them, under the conditions of this test, it tends to be easy to obtain a high amplification amount by using the primer MPN-F3 as the primer MPN-F and the primer MPN-R1 as the primer MPN-R, and the type of primer used. It was found that the amount of amplification could vary depending on the amount.

(Primer and probe evaluation test 2)
Next, using a combination of primers (combination of MPN-F3 and MPN-R1, combination of MPN-F3 and MPN-R2), which was confirmed to be able to efficiently amplify the pneumoniae mycoplasma nucleic acid 23S rRNA gene from the above test results, The detection by the Q-Probe method was evaluated. The following were used as specific labeled fluorescent probes used in the Q-Probe method.

A reagent for detecting Mycoplasma pneumoniae 23S rRNA gene having the following composition was prepared, and detection by the Q-Probe method was attempted with GENECUBE (registered trademark). The PCR cycle conditions and melting curve analysis conditions are as follows.
<Composition of 23S rRNA gene detection reagent (volume per sample)>
KOD plus DNA Polymerase 0.2 μl
10 x Buffer for KOD-Plus-Ver. 2 1.0 μl
2 mM dNTP 1.0 μl
25 mM _{sulfonyl 4} 1.6 μl
10 μM Each primer MPN-F 0.25 μl
10 μM Each primer MPN-R 1.5 μl
10 μM Each Q-Probe 0.25 μl
Template (genome sequence of Mycoplasma pneumoniae ² ) 1 μl
Milli-Q water 3.2 μl
(2: A boiled version of M. pneumoniae inactivated bacteria was used. Dilution ratio was 10 times, 10 ² times, 10 ³ times, and 4 types of purified water were used as comparative examples.)
<PCR cycle conditions>
94 ° C 30 seconds 98 ° C 1 second-60 ° C 3 seconds-63 ° C 5 seconds (50 cycles)
<Melting curve analysis conditions>
94 ° C. 30 seconds 39 ° C. 30 seconds 40.0 to 75.0 ° C., 0.09 ° C./sec The results are shown in FIG. The upper graph of FIG. 6 shows the result of probe QP-1, and the lower graph of FIG. 6 shows the result of probe QP-2. As shown in this result, mycoplasma pneumoniae could be detected with any combination of probes. In particular, stronger fluorescence intensity was confirmed when a combination of MPN-F3 and MPN-R2 primers was used.

(Primer and probe evaluation test 3)
Using the combination of the primers of MPN-F3 and MPN-R2 whose strong fluorescence intensity was confirmed in Test Example 2, it was evaluated whether the wild type and the mutant type (A2063G) of the pneumonia mycoplasma nucleic acid 23S rRNA could be distinguished. In this test example, QP-1 used in Test Example 2 was used as the specific labeled fluorescent probe.
Specifically, a pneumonia mycoplasma 23S rRNA gene detection reagent having the following composition was prepared, and detection by the Q-Probe method was attempted with GENECUBE (registered trademark). The PCR cycle conditions and melting curve analysis conditions were the same as in Test Example 2.
<Composition of 23S rRNA gene detection reagent (volume per sample)>
KOD plus DNA Polymerase 0.2 μl
10 x Buffer for KOD-Plus-Ver. 2 1.0 μl
2 mM dNTP 1.0 μl
25 mM _{sulfonyl 4} 1.6 μl
10 μM Primer MPN-F3 0.25 μl
10 μM Primer MPN-R2 1.5 μl
10 μM probe QP-1 0.25 μl
Template (Mycoplasma pneumoniae sample ³ ) 1 μl
Sterilized purified water 3.2 μl
(3: Using a pneumonia mycoplasma sample or a wild-type pneumonia mycoplasma nucleic acid 23S rRNA sample in which the 2063 position of the 23S rRNA gene has been found to be mutated from A to G by another evaluation system)
The result is shown in FIG. As shown in this result, it was confirmed that by using the combination of the primer and the probe of the present invention, the wild-type and mutant mycoplasma pneumoniae nucleic acids can be detected separately from the difference in peak temperature. The mutant type (A2063G) used in this test is known to be a drug resistance gene mutation. Therefore, it can be seen that the present invention can distinguish between the wild type of Mycoplasma pneumoniae nucleic acid and the drug resistance mutant type.

(Primer and probe evaluation test 4)
For the purpose of more sensitive detection, new primers MPN-R5 and R6 were prepared, and in combination with primers MPN-F3 and F4, an attempt was made to detect the pneumoniae mycoplasma nucleic acid 23S rRNA gene by the Q-Probe method.

A reagent for detecting Mycoplasma pneumoniae 23S rRNA gene having the following composition was prepared, and detection by the Q-Probe method was attempted with GENECUBE (registered trademark). In this test example, the probe QP-1 used in Test Example 2 was used as the specific labeled fluorescent probe. The PCR cycle conditions were the same as in Test Example 1.
<Composition of 23S rRNA gene detection reagent (volume per sample)>
KOD plus DNA Polymerase 0.2 μl
10 x Buffer for KOD-Plus-Ver. 2 1.0 μl
2 mM dNTP 1.0 μl
25 mM _{sulfonyl 4} 1.6 μl
Each primer MPN-F 0.25 μl
Each primer MPN-R 1.5 μl
Probe QP-1 0.3 μl
DMSO 0.75 μl
Template (Mycoplasma pneumoniae sample ³ ) 1.0 μl
Sterilized purified water 2.4 μl
(3: Using a pneumonia mycoplasma sample or a wild-type pneumonia mycoplasma nucleic acid 23S rRNA sample in which the 2063 position of the 23S rRNA gene has been found to be mutated from A to G by another evaluation system)
<PCR cycle conditions>
94 ° C 30 seconds 97 ° C 1 second-60 ° C 3 seconds-63 ° C 5 seconds (50 cycles)
<Melting curve analysis conditions>
94 ° C. 30 seconds 39 ° C. 30 seconds 40.0 to 75.0 ° C., 0.09 ° C./sec As a typical example of the results of this test, the results when the primer MPN-F4 and the primer MPN-R6 are combined are shown in FIG. Shown in. As shown in this result, it was confirmed that wild-type and mutant mycoplasma pneumoniae nucleic acids can be detected separately by using the combination of the primer and the probe of the present invention. Similar results are observed when other primer combinations are used. Comparing the results of this test with the results of the above evaluation test 3, the fluorescence intensity was higher when the combination of primers of this evaluation test was used than when the combination of primers of evaluation test 3 was used. It was confirmed that the wild type and the mutant type of mycoplasma pneumoniae nucleic acid 23S rRNA can be detected with higher sensitivity.
Here, between the primer MPN-F3 and the primer MPN-F4, and between the primer MPN-R5 and the primer MPN-R6, there are 3 to 7 bases to be annealed to the base sequence of the pneumonia mycoplasma nucleic acid 23R rRNA. The degree is off. From this result, a few bases (for example, 2 to 8 bases, preferably 3 to 7 bases) from each primer MPN-F or primer MPN-R were added or deleted at the 5'end or 3'end side. It was found that the pneumonia mycoplasma nucleic acid 23S rRNA may be designed to be annealed.

(Primer and probe evaluation test 5)
Furthermore, primers MPN-F11 and F12 were newly prepared, and in combination with the primers MPN-R5 used in the above evaluation test 4, an attempt was made to detect the pneumonia mycoplasma nucleic acid 23S rRNA gene by the Q-Probe method.

A reagent for detecting Mycoplasma pneumoniae 23S rRNA gene having the following composition was prepared, and detection by the Q-Probe method was attempted with GENECUBE (registered trademark). In this test example, the probe QP-1 used in Test Example 2 was used as the specific labeled fluorescent probe. The PCR cycle conditions and melting curve analysis conditions were the same as in Test Example 2.
<Composition of 23S rRNA gene detection reagent (volume per sample)>
KOD plus DNA Polymerase 0.2 μl
10 x Buffer for KOD-Plus-Ver. 2 1.0 μl
2 mM dNTP 1.0 μl
25 mM _{sulfonyl 4} 1.6 μl
Each primer MPN-F 0.25 μl
Primer MPN-R5 1.5 μl
Probe QP-1 0.25 μl
Template (Mycoplasma pneumoniae sample ¹ ) 1.0 μl
Milli-Q water 2.2 μl
(1: Use boiled inactivated bacteria of M. pneumoniae)
The results of this evaluation are shown in FIG. Here, the result when the primer MPN-F11 and the primer MPN-R5 are combined is shown in the upper part of FIG. 9, and the result when the primer MPN-F12 primer MPN-R5 is combined is shown in the lower part of FIG. As shown in this result, it was found that when the primers MPN-F11 and F12 were used, the fluorescence intensity was low and the detection sensitivity was lowered even when combined with the primers MPN-R5. The primers MPN-F11 and MPN-F12 are designed to anneal to the pneumonia mycoplasma nucleic acid 23S rRNA at a position shifted to the 5'terminal side by about 25 residues from the primer MPN-F2 used in the above evaluation test 1. MPN-F. As shown in this result, it was found that the pneumonia mycoplasma nucleic acid 23S rRNA could not be detected with high sensitivity by the primer designed at a position outside the base sequence site of the corresponding pneumonia mycoplasma nucleic acid 23S rRNA.

Based on the results of the above evaluation results 1 to 5, the primers MPN-F and MPN-R of the present invention, which are preferable for distinguishing between the wild type and the drug resistance mutant of the pneumonia mycoplasma nucleic acid 23S rRNA, are specific. An example of the base sequence of the labeled fluorescent probe is shown in the table below.

Any combination of each of the above primers MPN-F, primer MPN-R, and specific target fluorescent probe can be used in the present invention. Further, a combination of a primer and a probe having a base sequence complementary to each base sequence shown in Tables 6 to 8 above may be used.

The above-mentioned examples merely explain the technical idea and features of the present invention, and are intended to enable those skilled in the art to understand and carry out the contents of the present invention, thereby limiting the scope of protection of the present invention. It is not something to do. Any equivalent changes or modifications made based on the gist of the invention should be within the scope of the invention.

Claims (5)

A kit for measuring mycoplasma pneumoniae nucleic acid and drug resistance gene mutations thereof, including KOD DNA polymerase, primer MPN-F, primer MPN-R, and a specific target fluorescent probe;
The primer MPN-F is a forward consisting of a continuous 25-36 base sequence in the base sequence shown at positions 1910 to 2039 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The primer MPN-R is a reverse consisting of a base sequence having a length of 25 to 36 consecutive bases in the base sequence shown at positions 2091 to 2257 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The specific target fluorescent probe comprises a base sequence shown at positions 2040 to 2081 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence having a length of 16 to 23 consecutive bases in a base sequence complementary thereto. A kit designed in such a manner and characterized in that one of the terminal bases is labeled with a fluorescent dye. The reagent kit for measuring mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation according to claim 1.
The primer MPN-F is a forward consisting of a continuous 25-36 base sequence in the base sequence shown at positions 1988 to 2030 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The primer MPN-R is a reverse consisting of a base sequence having a length of 25 to 36 consecutive bases in the base sequence shown at positions 2101 to 2140 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33) or a base sequence complementary thereto. It is a primer;
The specific target fluorescent probe is designed to consist of a continuous 16 to 22 base long base sequence at positions 2050 to 2071 of the pneumonia mycoplasma nucleic acid 23S rRNA gene (SEQ ID NO: 33), and is one of the terminal bases. A kit characterized by being labeled with a fluorescent dye. The reagent kit for measuring mycoplasma pneumoniae nucleic acid and drug resistance gene mutation thereof according to claim 1 or 2.
The primer MPN-F is a forward primer consisting of the base sequence shown in any of SEQ ID NOs: 1 to 10 or a base sequence complementary thereto;
The primer MPN-R is a reverse primer consisting of the base sequence shown in any of SEQ ID NOs: 11 to 20 or a base sequence complementary thereto;
The specific target fluorescent probe is designed to consist of the base sequence shown in any of SEQ ID NOs: 21 to 30 or a base sequence complementary thereto, and one of the terminal bases is labeled with a fluorescent dye. A kit featuring. The reagent kit for measuring pneumonia mycoplasma nucleic acid and its drug resistance gene mutation according to any one of claims 1 to 3, wherein the internal control primer IC-F, the internal control primer IC-R, the internal control probe, and the internal control template are used. A kit characterized by further inclusion. A method for detecting Mycoplasma pneumoniae nucleic acid and its drug resistance gene mutation.
Step 1: Prepare a pretreated test sample that was taken with either sputum, pharyngeal swab, or nasal swab;
Step 2: Using the nucleic acid contained in the test sample as a template gene chain, a PCR amplification reaction is carried out using the kit according to any one of claims 1 to 4; and Step 3: Amplification obtained in step 2 The product is detected by the melting curve analysis method, and amplification is performed by utilizing the difference between the melting temperature of the amplified product and the probe having no drug resistance gene mutation and the melting temperature of the amplified product and the probe having the drug resistance gene mutation. Steps to check for drug resistance gene mutations in a product,
Detection method including.

Images