JP2021141882A - Oligonucleotide for detecting target nucleic acid, and application of the same - Google Patents

Abstract

To provide means for specifically detecting target nucleic acid.SOLUTION: Provided is oligonucleotide for detecting target nucleic acid which has a base sequence complementary with an area including at least two different bases comparing to a corresponding sequence of non-target nucleic acid out of a base sequence of target nucleic acid, and has at least one modified base. The oligonucleotide for detecting target nucleic acid can be used as a primer for amplifying target nucleic acid for detecting a heat-resistant fungus such as genus Byssochlamys, genus Neosartorya and genus Eurotium, and prevention of food contamination by heat-resistant fungus after processing/distribution is expected by executing detection when producing long-term storage food in which at least any one of heat treatment, high-pressure treatment and vacuum packaging treatment is performed.SELECTED DRAWING: None

Description

The present invention relates to oligonucleotides for detecting target nucleic acids and their uses.

The causes of putrefaction and deterioration in long-term storage of food are microorganisms such as bacteria and fungi that survive in the food. Food processing technologies centered on heat treatment have been developed for the purpose of inactivating these microorganisms. Furthermore, in recent years, medium- and high-pressure processing technologies and vacuum packaging technologies have been developed, which has made it possible to significantly extend the food preservation period, while microbial contamination has also been reported in processed foods using these technologies. Therefore, microorganisms collectively called heat-resistant bacteria are considered to be the cause of contamination. Among the thermostable fungi, the genus Byssoclamys, the genus Neosartorya, and the genus Eurotiomycetes are a kind of fungi called thermostable fungi, and cases of contamination have been reported in Japan and overseas. There is.

As a method for detecting a thermostable fungus, a detection method using a primer specific to a target organism designed from the β-tubulin gene of each fungus and the ITS region has been proposed (for example, Patent Documents 1 to 6).

Japanese Unexamined Patent Publication No. 2010-4880 Japanese Unexamined Patent Publication No. 2010-4876 Japanese Unexamined Patent Publication No. 2013-34447 Japanese Unexamined Patent Publication No. 2010-4879 Japanese Unexamined Patent Publication No. 2009-284832 International Publication No. 2012/1690999

Conventional detection methods mainly utilize the β-tubulin gene and the coding region of the ITS region. Since the sequence information of the gene region is registered in many fungi, it is suitable for comprehensive detection of fungi. On the other hand, the gene is conserved in a wide range of species and has a highly conserved sequence. Therefore, strict primer design is required to specifically detect microorganisms classified in the same genus. In general, in the formation of complementary strands of DNA, a difference of about 1 base may be ignored. Therefore, when carrying out the PCR method, the amplification reaction may proceed in complement with a sequence similar to the base sequence of the primer set. .. In order to suppress such a non-specific amplification reaction, a region in which a base sequence specific to the organism to be detected is continuous is usually set as a primer. In this case, although the detection accuracy is improved, the coverage by the genus is lost, and the detection ability for unknown samples is reduced. In the prior art, a primer set prepared only from ordinary DNA is used, and it is difficult to design a primer because it has both specificity and completeness. Further, in the prior art, some thermostable fungi isolated in Japan may not be detected, and there is a possibility that the occurrence of contamination of the thermostable fungi cannot be sufficiently suppressed. As described above, at present, the establishment and widespread use of methods for detecting thermostable fungi in foods such as long-term preserved foods have not progressed, and ex post facto measures are taken against the occurrence of contamination with heat-resistant fungi. Therefore, in order to prevent food contamination of heat-resistant fungi after processing and distribution, it has been required to establish an inspection technique for detecting the causative bacteria in advance.

An object of the present invention is to provide a means for specifically detecting a target nucleic acid.

The present invention provides:
[1] The base sequence of the target nucleic acid has a base sequence complementary to a portion containing at least two different bases as compared with the corresponding sequence of the non-target nucleic acid.
Has at least one modified base,
Oligonucleotide for target nucleic acid detection.
[2] The oligonucleotide according to [1], wherein the distance between the modified base and the base complementary to the at least two different bases of the oligonucleotide is 0 to 15 bases.
[3] The oligonucleotide according to [1] or [2], wherein the distance between the base at the 3'end of the oligonucleotide and the modified base is 0 to 10 bases.
[4] The oligonucleotide according to any one of [1] to [3], wherein the modified base is LNA or BNA other than LNA.
[5] The oligonucleotide according to any one of [1] to [4], wherein the modified base is a modified base of adenine or guanine.
[6] The oligonucleotide according to any one of [1] to [5], wherein the target nucleic acid is a base sequence of at least a part of a gene of a fungal group belonging to a single genus of thermostable fungi.
[7] The item according to any one of [1] to [6], wherein the target nucleic acid is at least a part of the gene of at least one bacterium selected from Bisoclamis spp., Neosartria spp. And Eurotiomycetes spp. Oligonucleotide.
[8] A heat-resistant fungus in which the target nucleic acid corresponds to the portion of the nucleotide sequence of SEQ ID NO: 1 at base numbers 352-569 or 352-703, or the portion of the nucleotide sequence of SEQ ID NO: 26 at base numbers 52 to 545. The oligonucleotide according to any one of [1] to [7], which is a nucleic acid containing at least a part of the base sequence of a gene.
[9] The target nucleic acid is at least a part of the β-tubulin gene of a thermostable fungus.
When PCR is performed on a thermostable fungus using an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 as a primer, an amplification product of 100 to 600 bases is obtained.
The oligonucleotide according to any one of [1] to [8].
[10] The oligonucleotide according to any one of [1] to [9], wherein the oligonucleotide is any of the following.
(1) An oligonucleotide in which the base of base number 18 in the base sequence of SEQ ID NO: 2 is a modified base and contains at least the base portion of base numbers 6 to 18.
(2) An oligonucleotide in which the base of base number 25 in the base sequence of SEQ ID NO: 9 is a modified base and contains at least the base portion of base numbers 20 to 25.
(3) An oligonucleotide in which the base of base number 24 in the base sequence of SEQ ID NO: 14 is a modified base and contains at least the base portion of base numbers 20 to 24.
[11] The target nucleic acid is at least a part of the ITS region of a thermostable fungus.
When PCR is performed on a thermostable fungus using an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 as a primer, an amplification product of 100 to 600 bases is obtained.
The oligonucleotide according to any one of [1] to [8].
[12] The oligonucleotide is (4) an oligonucleotide in which the base of base number 16 is a modified base in the base sequence of SEQ ID NO: 27 and contains at least base numbers 13 to 19 [1] to [11]. The oligonucleotide according to any one of the above.
[13] The oligonucleotide according to any one of [1] to [12], which is a primer for amplifying a target nucleic acid.
[14] The oligonucleotide according to [13], which is an oligonucleotide (1) to (3) and is a reverse primer.
[15] The oligonucleotide according to [13], which is an oligonucleotide (4) and is a forward primer.
[16] A primer set for detecting a target nucleic acid, which comprises the oligonucleotide according to any one of [13] to [15].
[17] Containing the oligonucleotide according to [14] and the forward primer, the forward primer is the base portion 1 to 544 of the base sequence of SEQ ID NO: 1 or at least a part of a sequence having 90% or more identity with the base portion 1 to 544 thereof. The primer set according to [16], which is an oligonucleotide having.
[18] The primer set according to [17], wherein the forward primer is an oligonucleotide containing at least the nucleotide sequence of SEQ ID NO: 20.
[19] At least a sequence containing the oligonucleotide according to [15] and a reverse primer, wherein the reverse primer is a portion of the base sequence of SEQ ID NO: 26 with base numbers 73 to 1108 or 90% or more identity thereof. The primer set according to [16], which is an oligonucleotide having a sequence complementary to a part.
[20] The primer set according to [19], wherein the reverse primer is an oligonucleotide containing at least the nucleotide sequence of SEQ ID NO: 28.
[21] A target nucleic acid that can be contained in a sample using the oligonucleotide according to any one of [1] to [15] or the primer set according to any one of [16] to [19]. Detection method.
[22] The target nucleic acid in the sample is obtained by PCR using the oligonucleotide according to any one of [1] to [15] or the primer set according to any one of [16] to [19]. The detection method according to [21], which comprises a step of amplifying.
[23] Heat resistance that can be contained in a sample using the oligonucleotide according to any one of [1] to [15] or the primer set according to any one of [16] to [19]. How to detect fungi.
[24] The detection method according to [23], wherein the thermostable fungus is at least one fungus selected from Bisoclamis spp., Neosartria spp., And Eurotiomycetes spp.
[25] The detection method according to [23] or [24], wherein the sample is a long-term preserved food that undergoes at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment in the manufacturing process.
[26] The detection method according to any one of [23] to [25], wherein the sample is a canned, bottled or retort-packed food.
[27] The detection method according to any one of [23] to [26], wherein the detection is performed immediately after production.
[28] A process for producing a long-term preserved food, which is subjected to at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment, and
A method for producing a long-term preserved food, which comprises a detection step of detecting a thermostable fungus by the detection method according to any one of [23] to [27] after the completion of the production process and before shipment.

The present invention provides oligonucleotides capable of specifically detecting a target nucleic acid and uses thereof. The present invention can be widely used in food, pharmaceutical and research fields. Above all, by using the present invention, it is possible to easily and highly sensitively detect target nucleic acids, especially thermostable fungi. By carrying out the inspection based on the detection method of the present invention at the time of food production, it can be expected that food contamination of heat-resistant fungi after processing and distribution can be suppressed.

FIG. 1 is a diagram showing the difference between LNA and DNA. FIG. 2 shows the nucleotide sequence amplified by the oligonucleotide (1), Bisoclamis spp. It is a figure which shows the alignment of the corresponding part of the base sequence of β-tubulin gene of Bariotti. FIG. 3 shows the nucleotide sequence amplified by the oligonucleotide (2), Neosartria spp., And A. It is a figure which shows the alignment of the corresponding part of the base sequence of β-tubulin gene of Fumigatas. FIG. 4 shows the nucleotide sequence amplified by the oligonucleotide (3), Neosartria spp., And A. It is a figure which shows the alignment of the corresponding part of the base sequence of β-tubulin gene of Fumigatas. FIG. 5 is an electrophoretogram showing the results of Example 1. The upper, middle, and lower rows show the results of primer sets 1, 2, and 3, respectively. FIG. 6 is an electrophoretogram showing the results of Example 2 (2). The upper, middle, and lower rows of the left column show the results of primer sets 1, 2, and 3, and the upper and lower rows of the right column show the results of primer sets 4, 5. FIG. 7 is an electrophoretogram showing the results of Example 2 (3). The upper, middle, and lower rows show the results of primer sets 1, 4, and 5, respectively. FIG. 8 is an explanatory diagram showing the correspondence between the nucleotide sequence of SEQ ID NO: 1 and the preferred embodiment of the oligonucleotide of the present invention. The part surrounded by a square indicates the design position of the primers Bt2a (corresponding to the 352 to 375th positions of SEQ ID NO: 1) and Bt2b (corresponding to the 825 to 848th positions of SEQ ID NO: 1). The italicized part (corresponding to the 545-569th of SEQ ID NO: 1) and the shaded part (corresponding to the 681-703th of SEQ ID NO: 1) indicate the design positions of the oligonucleotides (for neosartria and bisoclamis), respectively. .. The double underline indicates the amino acid coding region (ORF). FIG. 9 is a diagram showing the alignment of the corresponding portions of the nucleotide sequences of the ITS region of the Eurotiomycetes bacterium of the oligonucleotide (4). FIG. 10 is an electrophoretogram showing the results of Example 3 (2). FIG. 11 is an electrophoretogram showing the results of Example 3 (3). The upper row is the result of using the Eur-F1 primer, and the lower row is the result of using the Eur-F1L primer. FIG. 12 is an explanatory diagram showing the correspondence between the nucleotide sequence of SEQ ID NO: 25 and the preferred embodiment of the oligonucleotide of the present invention. The part surrounded by a square is the part on which the design of the primer Euro-FIL (SEQ ID NO: 27) was based (2396 to 2417 of SEQ ID NO: 25). The underlined portion is the portion corresponding to the primer ITS4 (2517 to 2539th of SEQ ID NO: 25). FIG. 13 is an explanatory diagram showing the correspondence between the nucleotide sequence of SEQ ID NO: 26 and the preferred embodiment of the oligonucleotide of the present invention. The part surrounded by a square is the part on which the design of the primer Euro-FIL (SEQ ID NO: 27) was based (52nd to 72nd of SEQ ID NO: 26). The underlined portion is the portion corresponding to the primer ITS4 (corresponding to the complementary sequence at positions 526 to 545 of SEQ ID NO: 26).

[Oligonucleotide for target nucleic acid detection]
The target nucleic acid detection oligonucleotide is an oligonucleotide having a base sequence complementary to a part of the base sequence of the target nucleic acid and having at least one modified base.

(Target nucleic acid, thermostable fungus)
The target nucleic acid that the oligonucleotide can detect is not particularly limited, but the base sequence of the gene of the fungus group belonging to a single genus is preferable, and the fungus group belonging to a single genus selected from fungi, particularly heat-resistant fungi. The base sequence of the gene of is more preferable. This makes it possible to appropriately classify thermostable fungi, which have high homology between genera and are difficult to classify, for each genus. In the present specification, the thermostable fungus is a fungus that forms spores such as ascospores and has resistance to heat treatment and high-pressure treatment. Thermostable fungi, according to the general classification system, belong to a taxon called ascomycete, but are not limited to this. When it is confirmed that sexual spores called ascospores are produced, it is called a teleomorph, and thermostable fungi can be classified based on the presence or absence of a teleomorph and the difference in phenotype. However, this taxon is a system that was established before the development of gene analysis technology, and there are some taxa that do not have a relationship of complete generation (sexual generation): incomplete generation (asexual generation) = 1: 1. Although it is a guideline for the definition of heat-resistant fungi, it is not limited to this taxon.
Heat-resistant fungi include bacteria that cause contamination of long-term preserved foods that undergo at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment during the manufacturing process, and are generally different from ordinary fungi and are heat-treated (for example,). , 70 ° C., 10 minutes) to prevent inactivation (survive even after heat treatment). Examples of the long-term preserved foods mentioned above include canned foods, bottled foods, and retort foods. Heat-resistant fungi include, for example, Bisochlamys, Neosartorya, Aspergillus, Paecilomyces, Talaromyces, and Talaromyces. , Thermoascus spp., Eupenicillium spp., Eurotium spp. Bisoclamis spp. And Thermoscus spp. Are one of the teleomorphic groups of Paesiromyces spp. Some teleomorphs of Paesiromyces spp. Are also classified as Talaromyces spp. Neosartria is one of the teleomorphic groups of Aspergillus. Eurotiomycetes also exists as a complete generation of Aspergillus spp.

Examples of the bacterium belonging to the genus Bisoclamys include Bysocholamis fulva, Byssochlamys lagunculariae, Byssochlamys nivea, Byssochlamys zollerniae, Byssochlamys lasslasia, Can be mentioned. Examples of the genus Neosartria include Neosartorya fennelliae and Neosartorya fischeri var. Fischeri, Neosartoroya hiratsukae, Neosartoroya pseudofischeri, Neosartoroya udagawae, Neosartoroya primulina, Neosartoraya ci. Examples of Aspergillus spp. Examples include Aspergillus fumigatus. Examples of Paecilomyces genus bacteria include Paecilomyces variotii. Examples of the genus Talaromyces include Talalomyces cejpii, Talalomyces apiculatus, Talalomyces flavus, Talalomyces luteus, Talalomyces trachyspermus, Talaromyces. Examples of the genus Hamigera include Hamigera insecticola, Hamigera striatum, and Hamigera avellanea. Examples of the genus Thermoscus include Thermoascus thermophilus and Thermoascus aegyptiacus. Examples of the genus Penicillium include Penicillium brefeldianum and Penicillium cinnamopurureum. Examples of Eurotiomycetes include Eurotiomycetes, Eurotiomycetes, Eurotiomycetes, and Eurotiomycetes.

(Nucleotide sequence of target nucleic acid)
The oligonucleotide has a base sequence complementary to a portion of the base sequence of the target nucleic acid containing at least two different bases as compared with the corresponding sequence of the non-target nucleic acid. The base sequence of the target nucleic acid includes, for example, a gene of a group of bacteria belonging to a single genus of heat-resistant fungi (eg, β-tubulin gene, DNA encoding ribosomal RNA, and ITS (Internal) existing in the gap between them. At least a part of the Transcribed Spacer) region) can be mentioned, but is not particularly limited. As at least a part of the β-tubulin gene of the heat-resistant fungus, the base corresponding to the portion of the base sequence of SEQ ID NO: 1 at base number 352-569 or 352-703 in the β-tubulin gene of the heat-resistant fungus. The part is mentioned. SEQ ID NO: 1 can be confirmed in the base sequence (NC_026506.1: NCBI database) encoding the β-tubulin gene of Neurospora crassa, which is a type of fungus (https://www.ncbi.nlm.nih. It is a partial sequence from the 202nd base A to the 2213th base A, which is the translation start point of the gene coding region, in gov / nuccore / 759001909)). The correspondence between the β-tubulin gene of a thermostable fungus and SEQ ID NO: 1 can be confirmed by aligning the two (Glass and Donaldson (1995) Applied and Environmental Microbial ecology, p. 1323-1330). .. As at least a part of the ITS region of the thermostable fungus, for example, in the ITS region of the thermostable fungus, a base portion corresponding to the base numbers 52 to 545 of the base sequence of SEQ ID NO: 26 can be mentioned.

In the present specification, the identity of the base sequence is, for example, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more. be. Identity can be determined by setting search conditions as appropriate using algorithms such as BLAST and FASTA.

The base length of the portion of the base sequence of the target nucleic acid containing at least two different bases as compared with the corresponding sequence of the non-target nucleic acid is not particularly limited, but for example, 5 bases or more, 6 bases or more, 7 bases or more, Examples thereof include 8 bases or more, 9 bases or more, or 10 bases or more. The upper limit is 50 bases or less, 45 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, or 25 bases or less. The number of bases that differ from the corresponding sequence of the non-target nucleic acid may be at least two. The upper limit is not particularly limited, but is, for example, 5 or less, 4 or less, and 3 or less.

The portion containing at least two different bases as compared with the corresponding sequence of the non-target nucleic acid can be appropriately selected from the base sequence of the target nucleic acid, but the base numbers 545-569 and 681-702 of the base sequence of SEQ ID NO: 1 can be appropriately selected. It is preferable to contain a base sequence corresponding to at least a part thereof, and a portion containing base numbers 545 and 546 (for example, base numbers 545-546) and a portion containing base numbers 545 and 550 (for example, base numbers 545-550). ) Or a base sequence corresponding to a portion containing base numbers 683 and 686 (for example, base numbers 683 to 686) is preferable. The base numbers 545th, 546th and 550th of SEQ ID NO: 1 are different between the corresponding sequences of Neosartria spp. (SEQ ID NOs: 10-12 and 15-19) and Aspergillus fumigatus (SEQ ID NO: 13) (SEQ ID NO: 13). Figures 3 and 4). Base numbers 683, 686 and 698 of SEQ ID NO: 1 are different between Bisoclamis spp. (SEQ ID NOs: 3-6) and Paesiromyces variotti (SEQ ID NOs: 7-8) (FIG. 2). Further, it is preferable to include a base sequence corresponding to at least a part (preferably base number 27) of base numbers 52 to 72 of the base sequence of SEQ ID NO: 26. This base sequence portion (particularly, the base portion of SEQ ID NO: 26) is common to Eurotiomycetes and is different from the primer portion described in Patent Document 6 (FIGS. 9 and 13). The primer used in Patent Document 6 corresponds to the 2517 to 2539th portion of the rDNA base sequence (SEQ ID NO: 25) of the rDNA (ACCESION No. AP007173) of Aspergillus oryzae RIB40 shown in FIG. 12, and is the portion of SEQ ID NO: 27. The base sequence of is corresponding to positions 2396 to 2417 (Fig. 12).

(Modified base)
The modified base contained in the oligonucleotide may be a modified base capable of stabilizing the binding of nucleic acids. For example, LNA (locked nucleic acid: FIG. 1), BNA (crosslinked nucleic acid) other than LNA, 2'-O-methoxyethyl Nucleic acids, 2'-O-methyl nucleic acids, 2'-fluoronucleic acids can be mentioned. The modified base may further have one or more substituents (for example, a methyl group) as long as it does not interfere with the stabilization of nucleic acid binding. The number of modified bases may be at least one, and the upper limit is not particularly limited, and is usually 5 or less, 4 or less, 3 or less, or 2 or less. When it has two or more modified bases, different modified bases may be used.

The modified base is preferably the same as the base before modification. For example, when the base before modification is adenine, the modified base is preferably a modified base of adenine (for example, LNA of adenine). The modified base is preferably a modified base of adenine or guanine.

The position of the modified base in the oligonucleotide is not particularly limited, but the distance between the modified base and the base complementary to the different base as compared with the corresponding sequence of the non-target nucleic acid is, for example, 0 to 15 bases, 0 to 14 bases. 0 to 13 bases and 0 to 12 bases are preferable. The distance of 0 bases means that a base complementary to a base different from that of the corresponding sequence of the non-target nucleic acid is a modified base. Further, it is preferable that the distance between the base at the 3'end of the oligonucleotide and the modified base is shorter than the distance between the base at the 5'end and the modified base. This makes it possible to cause a structural change in the base sequence on the 3'side, which has a great influence on the amplification reaction. The distance between the base at the 3'end of the oligonucleotide and the modified base is preferably, for example, 0 to 10 bases, 0 to 9 bases, 0 to 8 bases, 0 to 7 bases, or 0 to 6 bases. The distance of 0 bases means that the base at the 3'end of the oligonucleotide is a modified base.

(Example of oligonucleotide)
The length of the oligonucleotide is not particularly limited, but is usually 15 or more or 20 or more, preferably 21 or more, 22 or more, or 23 or more. The upper limit is not particularly limited, but is usually 50 or less or 45 or less, preferably 40 or less, 35 or less or 30 or less.

As the target nucleic acid detection oligonucleotide, an oligonucleotide that can be used as a primer capable of amplifying a heat-resistant fungal gene together with an oligonucleotide containing a part of the nucleotide sequence of SEQ ID NO: 1 or 26 is preferable. Among them, the size of the amplification product to be amplified is, for example, 100 bases or more, 120 bases or more, 140 bases or more or 150 bases or more, and the upper limit is, for example, 600 bases or less, 500 bases or less, 450 bases or less, 400 bases or less, or 350 bases. The following is preferable.

Oligonucleotides for target nucleic acid detection include, for example:
(1) An oligonucleotide in which the base of base number 18 in the base sequence of SEQ ID NO: 2 is a modified base and contains at least the base portion of base numbers 6 to 18;
(2) Of the base sequence of SEQ ID NO: 9, the base of base number 25 is a modified base, and an oligonucleotide containing at least the base portion of base numbers 20 to 25; and (3) of the base sequence of SEQ ID NO: 14. An oligonucleotide in which the base of base number 24 is a modified base and contains at least the base portion of base numbers 20 to 24.

SEQ ID NO: 2 is complementary to the base sequence of the β-tubulin gene of a thermostable fungus, which corresponds to the base numbers 681 to 702 of SEQ ID NO: 1. SEQ ID NOs: 9 and 14 are complementary to the nucleotide sequence of the β-tubulin gene of a thermostable fungus, which corresponds to the nucleotide number 545-569 portion of SEQ ID NO: 1 (FIG. 8).

Examples of the oligonucleotide for detecting the target nucleic acid include (4) an oligonucleotide in which the base of base number 16 in the base sequence of SEQ ID NO: 27 is a modified base and contains at least the base portion of base numbers 13 to 19.
The oligonucleotides (1) to (4) preferably include the full length of the base sequences of SEQ ID NOs: 2, 9, 14, and 27, respectively, and more preferably consist of the full length.

FIG. 2 shows an example of the nucleotide sequence amplified by the oligonucleotide (1) (complementary sequence of the oligonucleotide (1): SEQ ID NO: 2), Bisoclamis spp. (SEQ ID NOs: 3 to 6), and P.I. The alignment of the corresponding part of the base sequence of the β-tubulin gene of Variotti (SEQ ID NOs: 7 to 8) is shown. The bases corresponding to thymine (T) having base number 3 and cytosine (C) having base number 6 and thymine (T) having base number 18 in the base sequence amplified by the oligonucleotide (1) are P.I. In Bariotti, there are cytosine (C), thymine (T), and cytosine (C), which are different in three places. On the other hand, in Bisoclamis spp., These bases are thymine (T), thymine (T), cytosine (C), and thymine (T), and only the base of base number 6 may differ.

FIG. 3 shows an example of a nucleotide sequence amplified by oligonucleotide (2) (complementary sequence of oligonucleotide (2): SEQ ID NO: 9) and Neosartria spp. (N. primulina, N. quadricincta, N. stramenia: SEQ ID NOs: 10-12) and A., respectively. The alignment of the corresponding part of the base sequence of the β-tubulin gene of Fumigatas (SEQ ID NO: 13) is shown. The base corresponding to thymine (T) having base number 1 and cytosine (C) having base number 6 in the base sequence amplified by oligonucleotide (2) (the base numbers of SEQ ID NO: 1 are adenin in A. fumigatas, respectively). (A) and thymine (T) are different in two places. On the other hand, in Neosartria spp., These bases are thymine (T) and cytosine (C), which are the same.

FIG. 4 shows an example of the nucleotide sequence amplified by the oligonucleotide (3) (complementary sequence of the oligonucleotide (3): SEQ ID NO: 14) and Neosartria spp. N. pseudofischeri, N. udagawae: SEQ ID NOs: 15-19) and A. et al. The alignment of the corresponding part of the base sequence of the β-tubulin gene of Fumigatas (SEQ ID NO: 13) is shown. The bases corresponding to guanine (G) having base number 1 and thymine (T) having base number 2 in the base sequence amplified by oligonucleotide (3) are A.I. In Fumigatas, they are adenine (A) and adenine (A), respectively, and they differ in two places. On the other hand, in the five species of Neosartria spp., These bases are guanine (G), adenine (A) or thymine (T), and only the base of base number 2 may differ.

FIG. 9 shows an example of the nucleotide sequence amplified by the oligonucleotide (4) (sequence of oligonucleotide (4): SEQ ID NO: 27) and E. echinulatum, E. rubrum, E. rubrum, E. rubrum, E. Chevalieri: The alignment of the corresponding part of the base sequence of the ITS region of SEQ ID NOs: 29 to 38) is shown. The base moiety amplified by the oligonucleotide (4) is common to each bacterium, unlike the base moiety amplified by the primer shown in Patent Document 6.

The upper part of FIG. 9 shows the alignment of the corresponding portion of the ITS region of Eurotiomycetes (E. echinulatum, E. rubrum, E. chevalieri: SEQ ID NOs: 29 to 33) amplified by the oligonucleotide (4). Further, the lower part of FIG. 9 shows the alignment of the corresponding portions (SEQ ID NOs: 34 to 38) of each bacterium in the upper part, which are amplified by the primers described in Patent Document 6. The region where the oligonucleotide (4) is amplified is common to the 27 strains of Eurotiomycetes including each bacterium. On the other hand, the region amplified by the primer described in Patent Document 6 is E.I. Since the chevalieri (E in the figure) differs by one base, it is considered that the detection accuracy is lower than that of the present invention.

The oligonucleotides (1) to (4) have 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, or 98% or more identity as long as the effects of the present invention are not impaired. The base sequence may be modified as long as it has, and it may have a modified base other than the specified location.

(Detection of target nucleic acid)
Oligonucleotides are used for the detection of target nucleic acids, preferably for the detection of target nucleic acids by PCR. Oligonucleotides are more preferably used as PCR primers for the detection of target nucleic acids, and even more preferably as reverse primers. When the target nucleic acid is a gene of a group of fungi belonging to a single genus of thermostable fungi or a part thereof, it is used for detection of thermostable fungi. As used herein, the detection of a target nucleic acid includes the meaning of confirmation of the target nucleic acid and identification of the target nucleic acid.

[Primer set]
The above-mentioned oligonucleotide can be used as a primer for detecting a target nucleic acid, together with an oligonucleotide as a predetermined primer, as a primer set for detecting a target nucleic acid. Among them, the oligonucleotides (1) to (3) are preferably used together with a predetermined forward primer, and the oligonucleotide (4) is preferably used together with a predetermined reverse primer.

(Forward primer to be combined with oligonucleotides (1) to (3))
The oligonucleotide as a forward primer is at least a part of the target nucleic acid (for example, 100 bases or more, 120 bases or more, 140 bases or more or 150 bases or more, and the upper limit is, for example, 600 bases or less, 500 bases or less, 450 bases or less, 400. It may be designed so that it can amplify (less than or equal to bases, or less than 350 bases). The length of the oligonucleotide as a forward primer is not particularly limited, but is usually 15 or more or 20 or more, preferably 21 or more, 22 or more, or 23 or more. The upper limit is not particularly limited, but is usually 50 or less or 45 or less, preferably 40 or less, 35 or less or 30 or less. Examples of the oligonucleotide as a forward primer include oligonucleotides having a base portion 1 to 544 of the base sequence of SEQ ID NO: 1 or at least a part of a sequence having 90% or more identity with the base portion 1-544 thereof, and an oligonucleotide having at least a part of a sequence having 90% or more identity thereof is preferable. It is an oligonucleotide having a base sequence represented by 20.

(Reverse primer combined with oligonucleotide (4))
The oligonucleotide as a reverse primer is at least a part of the target nucleic acid (for example, 100 bases or more, 120 bases or more, 140 bases or more or 150 bases or more, and the upper limit is, for example, 600 bases or less, 500 bases or less, 450 bases or less, 400. It may be designed so that it can amplify (less than or equal to bases, or less than 350 bases). The length of the oligonucleotide as a reverse primer is not particularly limited, but is usually 15 or more or 17 or more, preferably 20 or more. The upper limit is not particularly limited, but is usually 50 or less or 45 or less, preferably 40 or less, 35 or less or 30 or less. Examples of the oligonucleotide as a reverse primer include oligonucleotides having a sequence complementary to the base portion 73 to 1108 of the base sequence of SEQ ID NO: 26 or at least a part of a sequence having 90% or more identity with the base portion 73 to 1108. Preferably, it is an oligonucleotide having the base sequence represented by SEQ ID NO: 28 (base numbers 526 to 545 of the base sequence of SEQ ID NO: 26: FIG. 13).

[Target nucleic acid detection kit]
The oligonucleotide or primer set can be used as an element of a kit for detecting a target nucleic acid. The target nucleic acid detection kit may contain at least one of the above oligonucleotides or primer sets, and may contain a plurality of the above-mentioned oligonucleotides or primer sets. In addition to the primer set, the target nucleic acid detection kit may further include reagents and materials used for carrying out PCR. Examples of such reagents and materials include PCR enzymes (for example, DNA polymerase), pH buffers, fluorescent dyes, dNTPs, MgCl ₂ , positive control DNA, and sterile water. Further, if necessary, a measuring container may be included.

[Method for detecting target nucleic acid]
The oligonucleotide or primer set can be used to detect a target nucleic acid that may be contained in a sample.

(sample)
The sample is not particularly limited as long as it may contain the target nucleic acid. When the target nucleic acid is a group of fungi belonging to a single genus of thermostable fungi, for example, foods and related devices, biological samples can be mentioned. Among them, long-term preserved foods (eg, canned foods, bottled foods, retort-packed foods) that undergo at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment in the manufacturing process, manufacturing equipment, containers, and cleaning liquids used in the manufacturing process are preferable.

(Step of amplifying target nucleic acid)
The detection method is not particularly limited as long as it uses an oligonucleotide and a primer set to detect the target nucleic acid, but is a method including a step of amplifying the target nucleic acid in the sample by PCR using the oligonucleotide and the primer set. It is preferable to have. PCR may be carried out by appropriately selecting the execution conditions by a conventional method, but it is preferable to adopt a touchdown protocol. The touchdown protocol is a protocol that raises the annealing temperature in the first cycle of the PCR thermal cycle, gradually lowers the temperature in each subsequent cycle, and maintains the annealing temperature until the last cycle after reaching the optimum temperature. be. As a result, the specific amplification product can be preferentially amplified by annealing at a high temperature in the first cycle, and the decrease in amplification efficiency can be covered by gradually lowering the temperature thereafter. Amplification reactions with high specificity are likely to occur, including cycles. In touchdown PCR, the adjustment of the annealing temperature in the thermal cycle is higher than the melting temperature of the primers used, the recommended annealing temperature in the standard protocol of the PCR kit used (eg, within 12 ° C, within 11 ° C, 10). High temperature within the range of ° C or within 9 ° C) may be set.

[Manufacturing method of long-term preserved foods]
The oligonucleotide or primer set can be used to detect true heat resistance in the production of long-term preserved foods. That is, after the manufacturing step of the long-term preserved food which performs at least one of heat treatment, high pressure treatment and vacuum packaging treatment, the detection step of detecting the heat-resistant fungus by the above-mentioned detection method after the completion of the manufacturing step and before shipping is included. As a result, it is possible to suppress spoilage and deterioration due to the generation of heat-resistant fungi during long-term storage, and to produce safe foods. The timing of the detection step includes, for example, an appropriate timing immediately after the production of the long-term preserved food or during the storage period, and is preferably immediately after the production, but is not particularly limited.

Example 1 (Detection of Bisoclamis spp.)
(1) Primer design In selecting a primer pair for detecting Bisoclamis spp., Known universal primers Bt2a (GGTAACCAAATCGGTGCTGCTTC: Corresponding to the portion of SEQ ID NO: 20, base number 352 to 375 of SEQ ID NO: 1) and Bt2b (ACCCTCAGTGTAGTGTACCTTGGC, sequence) PCR for Bisoclamis spp. The sequence information of the amplification product of the β-tubulin gene of Bisoclamis spp. Was obtained. Based on the obtained sequence information, a reverse primer was designed in which an amplification product of about 350 bp is expected when the β-tubulin gene of the genus Bisoclamis is amplified by PCR using Bt2a as a forward primer. As a result, Bys-R1 (GGAACATACTTCTTCGCCGGCAGC) having a base sequence complementary to the sequence part of the β-tubulin gene of the genus Bisoclamis corresponding to the part of base number 681 to 703 of SEQ ID NO: 1 (NC_026506.1): SEQ ID NO: 2), Bys-R1L, Bys-R1L-2 and Bys-R1L3 having the same base sequence as Bys-R1 but having one or two bases substituted with LNA were designed (Table 1).

(Footnotes in Table 1)
Underlined bases: LNA

(2) Detection test for Bysocholamis spp. And other thermostable fungi The thermostable fungus shown in Table 2 was detected using the reverse primer designed in (1). The following were used as the primer set:
Primer set 1: Existing primer sets B1F-B1R (ttgggaccacaacacadacaa (SEQ ID NO: 21) and tgtggacttacacaccaca (SEQ ID NO: 22); Nakayama, Soft Drink Technical Data 2012 No. 1)
Primer set 2: Bt2a-Bys-R1
Primer set 3: Bt2a-Bys-R1L
Primer set 4: Bt2a-Bys-R1L-2
Primer set 5: Bt2a-Bys-R1L-3
Primer set 6: Bt2a-Bys-R1L-4.

As a reaction reagent for PCR, KAPA2G® (registered trademark) Roche HotStart ReadyMix with dye (Roche), which shows high detectability even in a crude sample, was used. As a template DNA sample solution, a reaction solution of 1 μL, Primer (Forward, Revase) 10 μM; 1 μL each, distilled water; 7 μL, PCR Mix; 10 μL: a total of 20 μL was prepared. For the reaction cycle, the following was applied instead of the reagent kit standard reaction cycle for the purpose of improving the specificity of the amplification reaction.

[Touch-down cycle]
95 ° C, 2 min;
(95 ° C: 15 sec → 68 to 61 ° C ^* : 15 sec → 72 ° C: 25 sec) × 8 cycles;
(95 ° C: 15 sec → 60 ° C: 15 sec → 72 ° C: 25 sec) × 27 cycles;
72 ° C: 10 min
10 ° C:
^{* The} annealing temperature was lowered by 1 ° C. from 68 ° C. to 61 ° C. for each cycle.

A 5 μL PCR reaction solution was applied to a 2% agarose / TAE (Tris-acetylate EDTA Buffer) gel to which Midori Green Advance (Nippon Genetics) was added for DNA staining, and electrophoresis was performed. The gel after electrophoresis was irradiated with a blue LED to detect the band pattern of the amplification product (Table 2, FIG. 5).

(Footnotes in Table 2)
+: Assumed length single amplification product, + ^* : Assumed length amplification product and non-specific amplification product, ^* : Non-specific amplification product

Comparing the discriminating ability of each thermostable fungus by each primer set, when the primer set 1 was used, B. No detection of lagunculariae (strains 2 and 5) was confirmed (upper part of FIG. 5). In addition, when the primer set 2 was used, non-specific amplification products were detected in Byssochlamys spp., And non-specific amplification occurred in many strains of other thermostable fungi (middle of FIG. 5). On the other hand, by using the primer sets 3 to 6, the bacteria of the genus Byssochlamys (B. fulva, 1, B. nivea, 3.6, B. lagunculariae, 2.5, B. zollerniae, 4) were used at the time of primer design. A single amplification product with an assumed chain length (350 bp) was confirmed (Table 2, lanes 1-6 in the lower part of FIG. 5). Among them, when the primer set 3 was used, a single amplification product was not formed in Paecilomyces variotii, which is reported to have a complete generation of the genus Byssochlamys. Above all, B. It was found that lagunculariae (2, 5) can be discriminated together with other Byssochlamys spp. By using primer sets 3 to 6, while it is necessary to detect using individual specific primers in the existing technology. rice field.

Example 2 (Detection of Neosartria spp.)
(1) Primer design In selecting a primer pair for detecting Neosartria spp., PCR was performed on Neosartria spp. Using the same Bt2a and Bt2b primer sets as in Example 1, and β-tubulin of Neosartria spp. The sequence information of the amplification product of the gene was acquired. Based on the obtained sequence information, we designed a reverse primer that is expected to have an amplification product of about 220 bp when the β-tubulin gene of the genus Bisoclamis is amplified by PCR using Bt2a as a forward primer. bottom. Neo PCR performed for Sarutoria spp, Ne-R1 with partially complementary to the nucleotide sequence of nucleotide numbers 545 to 569 of Neosartorya spp β- tubulin gene (CGGAGGAGCCATTGTAGCTGTTATA: SEQ ID NO: 9) and Ne-R2 ( We designed Ne-R1L and Ne-R2L having a base sequence in which one base is substituted with LNA for each of CGGAGGAGCCATTGTAGCTATAAC: SEQ ID NO: 14), Ne-R1 and Ne-R2 (Table 3).

(Footnotes in Table 3)
Underlined bases: LNA

(2) Bysochlamys spp. Detection test for fumigatus Using the reverse primer designed in (1), the detection test for thermostable fungi shown in Table 4 was performed. The same procedure as in Example 1 (1) was carried out except that the following was used as the primer set.
Primer set 1: Existing primer sets N2F-N2R (ggctctggcccagtaggttcg (SEQ ID NO: 23) and ttgtcccgttggcctagta (SEQ ID NO: 24); Japanese Patent No. 5548385).
Primer set 2: Bt2a-Ne-R1
Primer set 3: Bt2a-Ne-R2
Primer set 4: Bt2a-Ne-R1L
Primer set 5: Bt2a-Ne-R2L

(Footnotes in Table 4)
+: Single amplification product of expected length

Neosartorya spp. And A. Comparing the discriminative ability of fumigatus, when the primer set 1 was used, A. False positive detection results derived from fumigats are obtained (upper left side of FIG. 2). In the PCR reaction using primer sets 2 to 5, A. No false positive results derived from fumigats were detected (second and third rows on the left side of FIG. 5). Furthermore, in the PCR reaction using the primer sets 4 and 5, it was possible to discriminate the Neosartorya spp. For each primer (first and second rows on the right side of FIG. 6). Above all, N. Fennelliae (A) is a domestically-derived bacterium and its detection is important, but it cannot be detected well by existing technology. However, from this example, it was found that it can be discriminated by using the primer set 5. In this example, in the test conducted without adopting the touchdown protocol, false positives were confirmed in the results of bacteria other than Neosartheluus in primer sets 2 and 3, whereas primer set 4 When and 5 were used, the same results as in Table 4 were obtained.

(3) Detection test for Bysocholamis spp. And other thermostable fungi The thermostable fungus shown in Table 5 was detected using the reverse primer designed in (1). The same procedure as in Example 1 (2) was carried out except that the primer sets 1, 4 and 5 shown in (2) were used as the primer set.

As a result of comparing the detection specificity of each primer set for thermostable fungi, the primer sets 4 and 5 were found in A.I. Not only fumigatus (5, 6) but also Eurotium spp. (7, 8) having Aspergillus as an incomplete generation like Neosartorya spp. Were not misdetected, and no misdetection was found for other thermostable fungi. From this, it was found that highly specific detection is possible (Fig. 7).

Example 3 (Detection of Eurotiomycetes)
(1) Primer design With reference to the partial sequence (SEQ ID NO: 26, FIG. 13) of the ribosome RNA coding region of Eurotium spp. A forward primer was designed in which an amplification product of about 500 bp is expected when at least a part of the partial sequence is amplified by PCR using (corresponding to the 545th base portion) as a reverse primer. As a result, Eur-F1 (CATCCGTGTCTATTCTGTACCC: SEQ ID NO: 27) having a base sequence complementary to the parts 52 to 72 of SEQ ID NO: 26 (FIG. 13) and Eur-F1 having the same base sequence but in one place. We designed Eur-F1L in which the base is substituted with LNA (Table 6).

(Footnotes in Table 6)
Underlined bases: LNA

(2) Detection test for Eurotium spp. The forward primer Eur-F1L designed in (1) was used together with the reverse primer ITS4 to perform a detection test for thermostable fungi shown in Table 7. The procedure was the same except that Eur-F1L / ITS4 was used as the primer set.

In the PCR reaction using Eur-F1L / ITS4, all the strains of the genus Eurotium tested could be detected (Fig. 10).

(3) Detection test for Aspergillus spp. And other thermostable fungi The thermostable fungus shown in Table 5 was detected using the reverse primer designed in (1). The procedure was the same as in (2) except that the following primer set 1 or 2 was used as the primer set.
Primer set 1: Euro-F1 / ITS4
Primer set 2: Euro-F1L / ITS4

As a result of comparing the detection specificity for heat-resistant fungi by each primer set, erroneous detection of Neosartoraya primulina (5), Neosartorya pseudofischeri, (6), and Aspergillus fumigatus (17, 18) was observed in primer set 1. On the other hand, Primer Set 2 did not show false detection of not only Aspergillus spp. (17 to 20) but also heat-resistant fungi (5 to 16) other than Eurotium spp. Therefore, highly specific detection is possible. It turned out (Fig. 11).

SEQ ID NO: 1: Nucleotide sequence encoding the β-tubulin gene of Neurospora crassa SEQ ID NO: 2: Nucleotide sequence of oligonucleotide for detecting target nucleic acid (Bys-R1) SEQ ID NO: 3: B.I. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of fulva IFM62195 SEQ ID NO: 4: B.I. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of lagunculariae IFM58746 SEQ ID NO: 5: B. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of nivea IFM59486 SEQ ID NO: 6: B. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of zollerniae IFM61583 SEQ ID NO: 7: P.I. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of variotii NBRC31685 SEQ ID NO: 8: P.I. Partial base sequence corresponding to Bys-R1 in the β-tubulin gene of variotii NBRC109023 SEQ ID NO: 9: Base sequence of oligonucleotide for detecting target nucleic acid (Ne-R1L) SEQ ID NO: 10: N.I. Partial base sequence corresponding to Ne-R1L in the β-tubulin gene of primulina NBRC33243 SEQ ID NO: 11: N.I. Partial base sequence corresponding to Ne-R1L in the β-tubulin gene of quadricincta NBRC9842 SEQ ID NO: 12: N.I. Partial base sequence corresponding to Ne-R1L in the β-tubulin gene of stramenia NBRC31358 SEQ ID NO: 13: A.I. Partial nucleotide sequence corresponding to Ne-R1L in the β-tubulin gene of fumigatus IFM62629 SEQ ID NO: 14: Nucleotide sequence of oligonucleotide for detecting target nucleic acid (Ne-R2L) SEQ ID NO: 15: N.I. Partial base sequence corresponding to Ne-R2L in the β-tubulin gene of fennelliae NBRC32080 SEQ ID NO: 16: N.I. Partial base sequence corresponding to Ne-R2L in the β-tubulin gene of fisheri NBRC31354 SEQ ID NO: 17: N.I. Partial base sequence corresponding to Ne-R2L in the β-tubulin gene of hiratsukae NBRC33242 SEQ ID NO: 18: N.I. Partial base sequence corresponding to Ne-R2L in the β-tubulin gene of pseudophischeri NBRC33244 SEQ ID NO: 19: N.I. Partial base sequence corresponding to Ne-R2L in the β-tubulin gene of udagawae NBRC101678 SEQ ID NO: 20: Base sequence of primer Bt2a SEQ ID NO: 21: Base sequence of primer B1F SEQ ID NO: 22: Base sequence of primer B1R SEQ ID NO: 23: Nucleotide sequence of primer N2F SEQ ID NO: 24: Nucleotide sequence of primer N2R SEQ ID NO: 25: A. Nucleotide sequence of ITS region of oryzae RIB40 SEQ ID NO: 26: E.I. Nucleotide sequence of ITS region of echinulatum NBRC5862 SEQ ID NO: 27: Nucleotide sequence of oligonucleotide for detecting target nucleic acid (Eur-F1) SEQ ID NO: 28: Nucleotide sequence of primer ITS4 SEQ ID NO: 29: E.I. Partial base sequence corresponding to Euro-F1 in the ITS region of echinulatum NBRC5862 SEQ ID NO: 30: E.I. Partial base sequence corresponding to Euro-F1 in the ITS region of rubrum NBRC4089 SEQ ID NO: 31: E.I. Partial base sequence corresponding to Euro-F1 in the ITS region of rubrum NBRC7712 SEQ ID NO: 32: E.I. Partial base sequence corresponding to Euro-F1 in the ITS region of chevalieri NBRC4086 SEQ ID NO: 33: E.I. Partial base sequence corresponding to Euro-F1 in the ITS region of chevalieri NBRC100022 SEQ ID NO: 34: E.I. Partial base sequence corresponding to the primer described in Patent Document 6 in the ITS region of echinulatum NBRC5862 SEQ ID NO: 35: E.I. Partial base sequence corresponding to the primer described in Patent Document 6 in the ITS region of rubrum NBRC4089 SEQ ID NO: 36: E.I. Partial base sequence corresponding to the primer described in Patent Document 6 in the ITS region of rubrum NBRC7712 SEQ ID NO: 37: E.I. Partial base sequence corresponding to the primer described in Patent Document 6 in the ITS region of chevalieri NBRC4086 SEQ ID NO: 38: E.I. Partial base sequence corresponding to the primer described in Patent Document 6 in the ITS region of chevalieri NBRC100022 SEQ ID NO: 39: Base sequence of primer Bt2b

Claims (28)

It has a base sequence complementary to a portion of the base sequence of the target nucleic acid containing at least two different bases as compared with the corresponding sequence of the non-target nucleic acid.
Has at least one modified base,
Oligonucleotide for target nucleic acid detection. The oligonucleotide according to claim 1, wherein the distance between the modified base and the base complementary to the at least two different bases of the oligonucleotide is 0 to 15 bases. The oligonucleotide according to claim 1 or 2, wherein the distance between the base at the 3'end of the oligonucleotide and the modified base is 0 to 10 bases. The oligonucleotide according to any one of claims 1 to 3, wherein the modified base is LNA or BNA other than LNA. The oligonucleotide according to any one of claims 1 to 4, wherein the modifying base is a modified base of adenine or guanine. The oligonucleotide according to any one of claims 1 to 5, wherein the target nucleic acid is a base sequence of at least a part of a gene of a group of fungi belonging to a single genus of thermostable fungi. The oligonucleotide according to any one of claims 1 to 6, wherein the target nucleic acid is at least a part of a gene of at least one bacterium selected from Bisoclamis spp., Neosartria spp. And Eurotiomycetes spp. At least the heat-resistant fungal gene in which the target nucleic acid corresponds to the portion of the nucleotide sequence of SEQ ID NO: 1 at base numbers 352-569 or 352-703, or the portion of the nucleotide sequence of SEQ ID NO: 26 at base numbers 52 to 545. The oligonucleotide according to any one of claims 1 to 7, which is a nucleic acid containing a part of the base sequence. The target nucleic acid is at least part of the thermostable fungal β-tubulin gene,
When PCR is performed on a thermostable fungus using an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 20 as a primer, an amplification product of 100 to 600 bases is obtained.
The oligonucleotide according to any one of claims 1 to 8. The oligonucleotide according to any one of claims 1 to 9, wherein the oligonucleotide is any of the following.
(1) An oligonucleotide in which the base of base number 18 in the base sequence of SEQ ID NO: 2 is a modified base and contains at least the base portion of base numbers 6 to 18.
(2) An oligonucleotide in which the base of base number 25 in the base sequence of SEQ ID NO: 9 is a modified base and contains at least the base portion of base numbers 20 to 25.
(3) An oligonucleotide in which the base of base number 24 in the base sequence of SEQ ID NO: 14 is a modified base and contains at least the base portion of base numbers 20 to 24. The target nucleic acid is at least part of the ITS region of the thermostable fungus,
When PCR is performed on a thermostable fungus using an oligonucleotide containing the nucleotide sequence of SEQ ID NO: 28 as a primer, an amplification product of 100 to 600 bases is obtained.
The oligonucleotide according to any one of claims 1 to 8. One of claims 1 to 11, wherein the oligonucleotide is (4) an oligonucleotide in which the base of base number 16 in the base sequence of SEQ ID NO: 27 is a modified base and contains at least base numbers 13 to 19. The oligonucleotide according to. The oligonucleotide according to any one of claims 1 to 12, which is a primer for amplifying a target nucleic acid. The oligonucleotide according to claim 13, wherein the oligonucleotides (1) to (3) are reverse primers. The oligonucleotide according to claim 13, which is an oligonucleotide (4) and is a forward primer. A primer set for detecting a target nucleic acid, which comprises the oligonucleotide according to any one of claims 13 to 15 and a forward primer. An oligonucleotide containing the oligonucleotide according to claim 14 and a forward primer, wherein the forward primer has at least a part of the nucleotide portion 1 to 544 of the nucleotide sequence of SEQ ID NO: 1 or a sequence having 90% or more identity thereof. The primer set according to claim 15, which is a nucleotide. The primer set according to claim 17, wherein the forward primer is an oligonucleotide containing at least the nucleotide sequence of SEQ ID NO: 20. The oligonucleotide and the reverse primer according to claim 15, and the reverse primer is a part of the base sequence of SEQ ID NO: 26 with base numbers 73 to 1108 or at least a part of a sequence having 90% or more identity with the same. The primer set according to claim 16, which is an oligonucleotide having a complementary sequence. The primer set according to claim 19, wherein the reverse primer is an oligonucleotide containing at least the nucleotide sequence of SEQ ID NO: 28. A method for detecting a target nucleic acid that can be contained in a sample, using the oligonucleotide according to any one of claims 1 to 15 or the primer set according to any one of claims 16 to 19. A claim comprising the step of amplifying a target nucleic acid in a sample by PCR using the oligonucleotide according to any one of claims 1 to 15 or the primer set according to any one of claims 16 to 19. Item 21. The detection method. A method for detecting a thermostable fungus that can be contained in a sample, using the oligonucleotide according to any one of claims 1 to 15 or the primer set according to any one of claims 16 to 19. 23. The detection method according to claim 23, wherein the thermostable fungus is at least one fungus selected from Bisoclamis spp., Neosartria spp., And Eurotiomycetes spp. The detection method according to claim 23 or 24, wherein the sample is a long-term preserved food that undergoes at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment in the manufacturing process. The detection method according to any one of claims 23 to 25, wherein the sample is a canned, bottled or retort-packed food. The detection method according to any one of claims 23 to 26, wherein the detection is performed immediately after production. A manufacturing process for long-term preserved foods that undergoes at least one of heat treatment, high-pressure treatment, and vacuum packaging treatment, and
A method for producing a long-term preserved food, which comprises a detection step of detecting a thermostable fungus by the detection method according to any one of claims 23 to 27 after the completion of the production process and before shipment.

Images