JP2021095371A - Skin external preparation and internal preparation - Google Patents

Abstract

To provide a novel skin external preparation or internal preparation excellent in tenascin C expression promoting action, collagen production promoting action, MMP1 inhibitory action, and active oxygen scavenging action.SOLUTION: The extract of the buds of Liliaceae lilium subjected to dry heat treatment is more excellent in tenascin C expression promoting action, collagen production promoting action, MMP1 inhibitory action, and active oxygen scavenging action than the extract of Liliaceae lilium without being subjected to dry heat treatment, and also is excellent in safety and stability. Therefore, the extract of the buds of Liliaceae lilium subjected to dry heat treatment is used not only in the beauty field such as skin aging prevention but also in the medical field such as aging-caused functional deterioration suppression, cancer prevention and treatment, and is expected to be applied to foods, cosmetics, quasi-drugs, pharmaceuticals and the like.SELECTED DRAWING: None

Description

The present invention relates to a novel external preparation for skin having an excellent antiaging effect, a tenascin C expression promoter, a collagen production promoter, an MMP1 inhibitor, an active oxygen scavenger, a wrinkle improver and an internal preparation.

Tenascin C (TNC) is one of the extracellular matrix glycoproteins and is expressed during embryonic period and tissue remodeling. A molecule involved in fibronectin acting as an adhesion molecule in connective tissue and scars. TNC is rarely expressed in normal adults, but is re-expressed in the interstitial space under special conditions such as wound healing. It is one of the extracellular matrix having specificity. It is thought to play a role in morphogenesis and wound healing by suppressing cell adhesion and inducing cell migration, differentiation, division and apoptosis. In normal skin, expression is only on the basement membrane and between the epidermis-dermis junction, whereas in keloids, TNC expression is increased along the collagen fibers of the dermis reticular layer. It has been reported that the TNC mRNA expression level in keloid tissues is significantly higher than that in normal skin (Non-Patent Document 1).

Also, in articular cartilage, the expression of TNC increases in the growth process, decreases with the maturation of chondrocytes, and finally disappears in normal adult articular cartilage. However, in pathological articular cartilage and synovium such as osteoarthritis and rheumatoid arthritis, TNC is re-expressed, suggesting that TNC is useful for cartilage repair. Further, in an experiment in which TNC was administered to mice, the effect of suppressing cartilage degeneration by TNC has been reported (Non-Patent Document 2). From the above, administration of TNC and suppression of decreased expression of TNC are effective for wound healing and prevention and treatment of osteoarthritis of the cartilage and rheumatoid arthritis.

The skin is exposed daily to various physical and chemical stresses such as UV light, dryness, cold, heat and drugs. As a result, skin dysfunction is caused, and various skin aging phenomena become apparent. Wrinkles are one of the skin aging phenomena. It is known that there are two types of wrinkles, epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, which are temporary wrinkles caused by a decrease in the amount of water in the epidermal keratin due to dry skin. On the other hand, dermal wrinkles are wrinkles formed by ultraviolet rays contained in the sun's rays and aging. The formation mechanism includes a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays and aging, and an increase in matrix metalloproteinase (MMP) to promote collagen degradation.

Epidermal wrinkles caused by dryness and dermal wrinkles have different histological morphology, onset mechanism, and treatment method, and dermal wrinkles caused by ultraviolet rays and aging are improved by using cosmetics having a moisturizing effect. That is difficult.

So far, for the purpose of improving dermal wrinkles caused by ultraviolet rays, an agent for preventing / improving skin wrinkles containing hydrolyzed almond as an active ingredient (Patent Document 1), extracts of Jochokei, Tenxi and Kisenu. An agent for improving wrinkles caused by irradiation with ultraviolet rays containing the active ingredient (Patent Document 2) has been reported.

In addition, fibroblasts and collagen are present in the dermis, and type I collagen accounts for 80% of the total. In addition to type I collagen, the presence of type III, V, XII and XIV collagen is known. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, it is considered that promoting the production of type I collagen is effective in preventing and improving wrinkles and sagging. In addition, promotion of type I collagen production is also effective in improving skin wound healing.

Collagen is a major structural protein that occupies about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, and skin. When one site is cleaved by collagenase (MMP1) belonging to MMP, stable collagen molecules in normal tissues are denatured into single-stranded gelatin, which is decomposed by various other proteases. As a result, the structural integrity of the matrix structure is lost.

As a material having an inhibitory activity on collagenase, for example, cacao husk extract (Patent Document 3), Rosaceae onistrawberry extract (Patent Document 4), lactoferrin (Patent Document 5), which is cacao bean bark, and the like have been proposed. Under the increasing interest in skin aging and oral hygiene, it is required to find a material having no side effects, high safety, and excellent collagenase activity inhibitory action.

In addition, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermis connective tissue and maintain the firmness of the skin. It is believed that this connective tissue loses its contractile force and further loses its elasticity, resulting in wrinkles and sagging of the skin.

The skin is located in the outermost layer of the living body, and is an organ that easily generates active oxygen due to the influence of ultraviolet rays and the like, and is constantly exposed to the oxygen stress. On the other hand, active oxygen scavenging enzyme exists in the skin cell and protects the skin cell from the damage of the active oxygen unless the active oxygen exceeding its capacity is generated. However, it is known that the activity of active oxygen scavenging enzyme in skin cells decreases with aging, and when the damage caused by active oxygen exceeds the defense reaction, the skin is oxidized, the cell function deteriorates and aging. Is thought to progress. In addition, it is considered that when an organ other than the skin is exposed to active oxygen exceeding its active oxygen scavenging ability, functional deterioration occurs and aging occurs, and various lifestyle-related diseases such as cancer and myocardial infarction develop.

In recent years, the production of active oxygen in the living body and various effects caused by it have been reported. Generally, the active oxygen is called ^{_{Activated oxygens, O 2 -, H}} 2 O 2, is divided into four · ^OH, 1 _{O 2,} both have a strong bactericidal action, the biofeedback It is regarded as an important substance involved in defense. For example, when an antigen such as a bacterium, a virus, or a foreign substance invades a living body, neutrophils, monocytes, and macrophages, which are phagocytic cells in the blood, first start phagocytic action, and then phagocyte vesicles. Reactive oxygen species are produced to dissolve the foreign substances that have been phagocytosed inside. The produced active oxygen not only dissolves greedy foods, but also directly exerts a bactericidal action on foreign enemies such as bacteria, viruses and foreign substances, and plays a role of protecting against foreign enemies.

However, if the active oxygen for self-defense is also excessively produced, even normal cells will be stimulated, resulting in various injury reactions. Recently, many diseases induced by active oxygen have been reported. Therefore, active oxygen scavengers and antioxidants have been studied for the purpose of protection from damage caused by active oxygen, and contain active oxygen scavengers such as SOD and catalase, and active oxygen scavengers and antioxidants such as SOD-like active substances. Foods, cosmetics, non-pharmaceutical products, pharmaceuticals, etc. have been developed (Patent Documents 6 and 7).

Dry heat treatment refers to a method of applying heat to a material without using water. Generally, it is said that a dry heat treatment causes a change in a chemical component such as a protein, and it is possible to change the color, taste, aroma, and the like. The change in chemical composition also differs depending on the heating temperature and time.

Conventionally, extracts of flowers and leaves of plants belonging to the genus Lily of the Liliaceae family have the effects of moisturizing and improving rough skin, and are contained in cosmetics as an anti-aging active ingredient (Patent Documents 8 and 9), and lilies. The extract of the flower part of the plant of the genus Liliaceae has the effect of suppressing melanin production and is contained in cosmetics as a whitening active ingredient (Patent Document 10), and the extract of the bud part of the genus Lily of the family Liliaceae is active oxygen. It is known to have an erasing action (Patent Document 11). However, by applying the dry heat treatment to the buds of the genus Lily of the Liliaceae family, the buds of the genus Lily of the Liliaceae family, which are not subjected to the dry heat treatment, have a remarkable TNC expression promoting action, collagen production promoting action, and MMP1 inhibition. It was not known to have an action and an active oxygen scavenging action.

Japanese Unexamined Patent Publication No. 2000-119125 Japanese Unexamined Patent Publication No. 2006-199611 Japanese Unexamined Patent Publication No. 3-44331 Japanese Unexamined Patent Publication No. 2003-137801 Japanese Unexamined Patent Publication No. 5-186368 Japanese Unexamined Patent Publication No. 9-118630 Japanese Unexamined Patent Publication No. 9-208484 Japanese Unexamined Patent Publication No. 2003-012489 JP-A-2010-018594 Japanese Unexamined Patent Publication No. 2003-238343 Japanese Unexamined Patent Publication No. 2011-225564

Noriko Aramaki et al., Wound, 5 (2), pp51, 2014 Hiroshi Unno et al., Niseki Disease Journal, 35 (2), pp131, 2016

Materials that are safe, have excellent stability, and have excellent tenascin C expression-promoting action, collagen production-promoting action, MMP1 inhibitory action, and active oxygen scavenging action have been desired, but materials that are sufficiently satisfactory have not yet been provided. The current situation.

Under these circumstances, as a result of diligent studies by the present inventors, the extract of the buds of the genus Lily of the Liliaceae family, which has undergone dry heat treatment, has an excellent tenascin C expression promoting action, collagen production promoting action, MMP1 inhibitory action, and It was found that it has an active oxygen scavenging effect and is excellent in stability and efficiency. Furthermore, the external or internal preparation containing the extract is safe and stable, and is excellent in tenascin C expression promoting action, collagen production promoting action, MMP1 inhibitory action and active oxygen scavenging action, and is multifunctional beauty. -We have found that it can be used as a material for health and a pharmaceutical product, and have completed the present invention.

The extract of the bud part of the genus Lily of the Liliaceae family subjected to the dry heat treatment of the present invention has an excellent tenascin C expression promoting action, collagen production promoting action, MMP1 inhibitory action and active oxygen scavenging action, and is a pharmaceutical product. It can contribute to the fields of quasi-drugs, cosmetics, foods, etc.

It is a photograph of the buds of the genus Lily of the Liliaceae family that have undergone dry heat treatment (major axis 3 cm to 4 cm, stamens and pistils are invisible raw ones).

The species of plants of the Lilyaceae lily genus used in the present invention are not particularly limited, and are, for example, lily lily lily lily lily lily lily lily lily lily brown lily (lilyium brownii). Lilyum plumilum, lily lily speciosum, lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily lily Lilyum formomam, Lilyum concolor, Madonna lily, Lilyum candium, Lilyum nobilissimum, or varieties / hybrids of these lily genus plants can also be used. Many cultivars are known for these lily plants, such as Asiantic hybrid, Longiflorum hybrid, Martagon hybrid, Trumpet hybrid, Oriental hybrid, etc., and the lilies of these cultivars are used. You may. In the present invention, it is preferable to use Casablanca, which is known as an oriental hybrid, because of its good effect.

The buds of the genus Lily of the Liliaceae family have a major axis of 1 cm to 10 cm, and can be used at any time from immature to near flowering, but stamens and pistils are complete. It is preferable to use the one that is wrapped in and cannot be seen from the outside. In addition, it is particularly preferable to use one having a major axis in the range of 2 cm to 4 cm. Further, the buds to be used may be raw, or dried products such as naturally dried products and sun-dried products may be used.

The temperature of the dry heat treatment of the buds of the genus Lily of the Liliaceae family is preferably 100 ° C. or higher, more preferably 120 ° C. to 280 ° C. Further, the temperature around 150 ° C. to 250 ° C. is particularly preferable. At 280 ° C. or higher, carbonization of plants tends to proceed, which is unsuitable for extraction. The time of the dry heat treatment varies depending on the temperature, but is preferably 10 minutes or more, more preferably 15 to 60 minutes. Further, 20 to 40 minutes is particularly preferable. When heated for 60 minutes or more, carbonization of plants tends to proceed, which is unsuitable for extraction. Further, the time for these treatments may be divided into 2 to 5 times and the like. The total time at that time is preferably the above-mentioned time.

The method for extracting the buds of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment, is not particularly limited, and may be, for example, heat-extracted or room-temperature extracted. Further, for the extraction, the buds that have been subjected to the dry heat treatment may be used as they are, or may be subjected to treatments such as drying, crushing, and shredding.

The extraction method is not particularly limited, but can be carried out by a method of stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, etc.). , Glycerin, etc.), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferred, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferred. These solvents may be used alone or in admixture of two or more. Particularly preferable extraction solvents include water and water-ethanol mixed polar solvents. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, that of the buds (dry weight) of the genus Lily of the Liliaceae family that have been subjected to dry heat treatment, but after extraction. It is preferably 100 times or less for convenience of operation when concentrating or isolating. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure at the time of extraction, and the like.

The above extract may be used as it is in the extracted solution, but if necessary, concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc. is performed within the range in which the effect of the present invention is exhibited. , Deodorization, ethanol precipitation, etc. may be performed before use. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze drying and the like, and used as a dried product.

In the present invention, the above-mentioned extract may be used as it is, and oils and fats, waxes, and carbonized components used in cosmetics, non-pharmaceutical products, pharmaceuticals, foods, etc., as long as the effects of the extracts are not impaired. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH regulators, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , Chelating agents, excipients, filming agents, sweeteners, acidity agents and the like may be contained.

The present invention can be used for any of cosmetics, non-pharmaceutical products, pharmaceuticals, and foods, and the dosage forms thereof include, for example, cosmetics, creams, emulsions, gels, aerosols, essences, packs, and cleaning agents. , Baths, foundations, dusting, lipsticks, ointments, poultices, tablets, capsules, chocolates, gums, candy, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions Examples include agents, solutions, emulsions, suppositories, solutions for injection and the like.

In the case of external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001% by weight to 10% by weight in terms of solid matter. Further, 0.01% by weight to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, the enhancement of the effect is hardly recognized and it is uneconomical.

For internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Usually, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Further, 20 mg to 2 g is most preferable.

Next, in order to explain the present invention in detail, examples of production, experiment, and formulation of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. The% shown in the production example means% by weight, and the content part shown in the formulation example means a weight part.

An extract of the buds of Casablanca that had been subjected to a dry heat treatment was produced as described in Production Examples 1 to 3 below. In Comparative Production Examples 1 to 3, the buds of Casablanca that had not been subjected to the dry heat treatment were used as the extraction material.

(Manufacturing Example 1) Preparation of hot water extract of buds of Casablanca subjected to dry heat treatment Stainless steel buds of Casablanca (raw stamens and pistils with a major axis of 2 cm to 4 cm and no visible stamens or pistils from the outside (Fig. 1)) They were evenly arranged on a stainless steel tray and subjected to a dry heat treatment at a temperature of 200 ° C. for 30 minutes under ventilation. The buds of Casablanca subjected to the dry heat treatment were pulverized, 200 mL of water was added to 10 g of the pulverized product, and the mixture was extracted at 95 ° C to 100 ° C for 2 hours. The obtained extract was filtered, the filtrate was concentrated, freeze-dried, and subjected to dry heat treatment to obtain 2.8 g of a hot water extract of the buds of Casablanca.

(Comparative Production Example 1) Preparation of hot water extract of buds of Casablanca not subjected to dry heat treatment In Production Example 1, the buds of Casablanca subjected to dry heat treatment were prepared from Casablanca not subjected to dry heat treatment. Replacing with the buds, 2.6 g of hot water extract was obtained.

(Production Example 2) Preparation of 50% ethanol extract of buds of Casablanca subjected to dry heat treatment The buds of Casablanca subjected to dry heat treatment were crushed in the same manner as in Production Example 1, and 200 mL of 50 was added to 10 g of the pulverized product. % Ethanol was added, and the mixture was extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain 1.7 g of 50% ethanol extract of the buds of Casablanca subjected to dry heat treatment.

(Comparative Production Example 2) Preparation of 50% ethanol extract of buds of Casablanca not subjected to dry heat treatment In Production Example 2, the buds of Casablanca subjected to dry heat treatment were subjected to Casablanca not subjected to dry heat treatment. In place of the buds, 1.6 g of 50% ethanol extract was obtained.

(Production Example 3) Preparation of ethanol extract of buds of Casablanca subjected to dry heat treatment The buds of Casablanca subjected to dry heat treatment were crushed in the same manner as in Production Example 1, and 200 mL of ethanol was added to 10 g of the pulverized product. After extraction at room temperature for 7 days, the mixture was filtered, and the filtrate was concentrated to dryness to obtain 0.5 g of an ethanol extract of the buds of Casablanca subjected to dry heat treatment.

(Comparative Production Example 3) Preparation of ethanol extract of buds of Casablanca not subjected to dry heat treatment In Production Example 3, the buds of Casablanca subjected to dry heat treatment are buds of Casablanca not subjected to dry heat treatment. Substituted for parts, 0.4 g of ethanol extract was obtained.

(Prescription example 1) Toner prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 2.0
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water to make the total amount 100, and both are mixed and filtered to obtain a product.

Comparative Formulation Example 1 Conventional Toner In Formulation Example 1, the hot water extract (Production Example 1) of the buds of Casablanca that had been subjected to dry heat treatment was replaced with purified water to obtain the conventional lotion.

(Prescription example 2) Cream prescription content (part)
1. 1. The buds of Casablanca that have undergone dry heat treatment
50% ethanol extract (Production Example 2) 1.0
2. Squalene 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-butylene glycol 8.5
13. [Manufacturing method] Ingredients 2 to 9 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated and dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 10 is added at 45 ° C., and the mixture is further cooled to 30 ° C. to obtain a product.

(Prescription example 3) Emulsion prescription content (part)
1. 1. The buds of Casablanca that have undergone dry heat treatment
Ethanol extract (Production Example 3) 0.01
2. Squalene 5.0
3. 3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glycerin monostearate 2.0
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Polyoxyethylene sorbitan monooleate (20EO) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Ingredients 1 to 8 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 10 to 13 are heated and dissolved, mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 9 is added at 45 ° C., and the mixture is further cooled to 30 ° C. to obtain a product.

(Prescription example 4) Gel preparation Prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 1.0
2. Ethanol 5.0
3. 3. Methyl paraoxybenzoate 0.1
4. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
5. Appropriate amount of fragrance 6.1,3-butylene glycol 5.0
7. Glycerin 5.0
8. Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11. [Manufacturing method] Ingredients 2 to 5 and components 1 and 6 to 11 having a total amount of 100 in purified water are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 5) Pack prescription content (part)
1. 1. The buds of Casablanca that have undergone dry heat treatment
50% ethanol extract (Production Example 2) 2.0
2. Polyvinyl alcohol 12.0
3. 3. Ethanol 5.0
4.1,3-butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
7. Citric acid 0.1
8. Sodium citrate 0.3
9. Appropriate amount of fragrance 10. [Manufacturing method] Ingredients 1 to 10 having a total amount of 100 are uniformly dissolved in purified water to prepare a product.

(Prescription example 6) Foundation prescription content (part)
1. 1. The buds of Casablanca that have undergone dry heat treatment
Ethanol extract (Production Example 3) 1.0
2. Stearic acid 2.4
3. 3. Polyoxyethylene sorbitan monostearate (20EO) 1.0
4. Polyoxyethylene cetyl ether (20EO) 2.0
5. Cetanol 1.0
6. Liquid lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Sodium Carboxymethyl Cellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Appropriate amount of fragrance 19. [Manufacturing method] Ingredients 1 to 8 having a total amount of 100 in purified water are melted by heating and kept at 80 ° C. to prepare an oil phase. Ingredient 9 is well swollen with ingredient 19, followed by addition of ingredients 10-13 and mixed uniformly. Ingredients 14 to 17 pulverized and mixed by a pulverizer are added thereto, and the mixture is stirred with a homomixer and kept at 75 ° C. to prepare an aqueous phase. Add the aqueous phase to the oil phase while stirring to emulsify. Then, the mixture is cooled, component 18 is added at 45 ° C., and the product is cooled to 30 ° C. with stirring to obtain a product.

(Prescription example 7) Prescription content for bath (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 1.0
2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 (1) Appropriate amount 4. Appropriate amount of fragrance 5. [Manufacturing method] Ingredients 1 to 5 having a total amount of 100 with sodium sulfate are uniformly mixed to prepare a product.

(Prescription example 8) Ointment prescription content (part)
1. 1. The buds of Casablanca that have undergone dry heat treatment
50% ethanol extract (Production Example 2) 6.0
2. Polyoxyethylene cetyl ether (30EO) 2.0
3. 3. Glycerin monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. [Manufacturing method] Ingredients 1 to 5 having a total amount of 100 in purified water are melted by heating and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 6 to 8 are heated and dissolved, mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring.

(Prescription example 9) Powder formulation Prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 1.0
2. Dried cornstarch 39.0
3. 3. Microcrystalline Cellulose 60.0
[Manufacturing method] Ingredients 1 to 3 are mixed to prepare a powder.

(Prescription example 10) Tablet prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 5.0
2. Dried cornstarch 25.0
3. 3. Carboxymethyl Cellulose Calcium 20.0
4. Microcrystalline Cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Ingredients 1 to 4 are mixed, and then an aqueous solution of ingredient 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and the mixture is locked. One tablet weighs 0.52 g.

(Prescription example 11) Tablet confectionery prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 2.0
2. Dried cornstarch 49.8
3. 3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Fragrance 0.1
7. Set the total amount to 100 with purified water
[Manufacturing method] Ingredients 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and the mixture is locked. One grain is 1.0 g.

(Prescription example 12) Beverage prescription content (part)
1. 1. Hot water extract of buds of Casablanca subjected to dry heat treatment (Production Example 1) 0.05
2. Stevia 0.05
3. 3. Malic acid 5.0
4. Fragrance 0.1
5. [Manufacturing method] Ingredients 1 to 3 with a total amount of 100 in purified water are dissolved in a small amount of water. Then, components 4 and 5 are added and mixed.

Next, in order to explain the effect of the present invention in detail, an experimental example will be given.

Experimental Example 1 Effect of dry heat-treated Casablanca bud extract on the production of tenascin C, type I collagen and matrix-degrading enzyme in human skin fibroblasts Tenascin C (TNC), type I collagen (COL1A1) and The expression level of matrix degrading enzyme (MMP1) mRNA was measured. ^{Human skin fibroblasts (NB1RGB) were seeded in 1 × 10 5} cells on a 60 mm dish and cultured in DMEM culture medium containing 10% FBS _{under 37 ° C. and 5% CO 2} conditions. When the condition became confluent, UVA 10 J / cm ² was irradiated for 3 consecutive days in the presence of PBS (-). After irradiation, the medium was replaced with DMEM (+) medium, and each sample was added to a final concentration of 10 μg / mL and 100 μg / mL. After culturing for 24 hours after the final irradiation, total RNA was extracted using RNAiso plus (Takara Bio). The total amount of RNA was determined by the absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to- cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 60 seconds, 40 cycles) was performed. For other operations, the expression levels of TNC, COL1A1 and MMP1 mRNA were determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The expression rates of TNC, COL1A1 and MMP1 were calculated as the ratio of the expression levels of TNC, COL1A1 and MMP1 mRNA in the sample addition group to the expression levels of TNC, COL1A1 and MMP1 mRNA in the control group. The primers used to measure the expression level of each gene are as follows.

Primer set for TNC CTCCAGAGCCAAAGAACC (SEQ ID NO: 1)
CAAGTCTCCAGCAACCT (SEQ ID NO: 2)
Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 3)
TTGCAGTGGTAGGTGATGTTTCTG (SEQ ID NO: 4)
Primer set for MMP1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 5)
TGAGCATCCCCCTCCAAATACC (SEQ ID NO: 6)
Primer set for β-actin CACTCTTCCAGCCTTCCTCC (SEQ ID NO: 7)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 8)

The results are shown in Tables 1 to 3. In the table, "control" means a group in which UVA is not irradiated and no sample is added, and "UVA" means a group in which no sample is added after UVA irradiation. Continuous irradiation with UVA reduced the expression levels of TNC and COL1A1 mRNA, but the extract of the buds of Casablanca suppressed the decrease. The effect was significantly higher in the Casablanca extract subjected to the dry heat treatment than in the Casablanca extract not subjected to the dry heat treatment. In addition, continuous irradiation with UVA increased the expression level of MMP1 mRNA, but the extract of the buds of Casablanca suppressed the increase. The effect was significantly higher in the Casablanca extract subjected to the dry heat treatment than in the Casablanca extract not subjected to the dry heat treatment.

Experimental Example 2 Active oxygen scavenging action of hot water extract of buds of Casablanca subjected to dry heat treatment Superoxide dismutase (Superoxide dismutase) of the extract of buds of Casablanca subjected to dry heat treatment obtained in the above example. SOD) -like activity was measured on a 96-well plate using SOD Assay Kit-WST (Dojin Chemical Laboratory). The reagent used was that included in the kit. After adding 20 μL of the sample solution to each well, 200 μL of WST working solution was added, and the mixture was well stirred with a plate mixer. 20 μL of Dilution buffer was added to the blank wells. 20 μL of Enzyme working solution was added to each of the well to which the sample solution was added and the well to which the sample solution was added. Then, the mixture was incubated at 37 ° C. for 20 minutes, and the absorbance at 450 nm was measured with a plate reader. The concentration (μg / mL) of each extract at an active oxygen scavenging rate of 50% was determined as an _{IC 50 value.}

From the test results of each sample, the concentration (IC ₅₀ ) required for the removal of 50% superoxide was calculated. Lower an IC ₅₀ value is meant more potent active oxygen scavenger. The results of these tests are shown in Table 4. The extract of the buds of Casablanca subjected to the dry heat treatment of the present invention showed stable and excellent SOD-like activity. Further, the extract of the buds of Casablanca subjected to the dry heat treatment has significantly superior SOD-like activity as compared with the extract of the buds of Casablanca not subjected to the dry heat treatment. Admitted. From the above, it was confirmed that the SOD-like activity of the extract of the buds of Casablanca was remarkably increased by the dry heat treatment.

Experimental Example 3 Use test Using the lotion of Prescription Example 1 and the conventional lotion of Comparative Prescription Example 1, a one-month use test was conducted on 5 people (26-64 years old) with wrinkles and sagging. .. After use, the degree of wrinkles and sagging was judged by a questionnaire.

As a result, wrinkles and sagging were alleviated by the external preparation for skin containing the extract of the present invention. During the test period, there were no skin problems and there was no problem in terms of safety. In addition, there was no problem with deterioration of the formulated ingredients.

From the above, the extract of the bud of the genus Lily of the Liliaceae family subjected to the dry heat treatment of the present invention has an excellent TNC expression promoting action, collagen production promoting action, MMP1 inhibitory action and active oxygen scavenging action. It was also excellent in stability. From this, the extract of the bud part of the genus Lily of the Liliaceae family, which has been subjected to the dry heat treatment of the present invention, is used not only in the cosmetic field such as skin aging, but also in medical treatment such as suppression of functional deterioration due to aging, prevention and treatment of cancer. It can also be used in the field, and is expected to be applied to foods, cosmetics, quasi-drugs, pharmaceuticals, etc.

Claims (8)

An external preparation for skin, which contains an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. A tenascin C expression promoter, which comprises an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. A collagen production promoter characterized by containing an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. An MMP1 inhibitor characterized by containing an extract of a bud of the genus Lily of the Liliaceae family that has been subjected to a dry heat treatment. An active oxygen scavenger characterized by containing an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. A wrinkle improving agent containing an extract of buds of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. A pharmaceutical product characterized by containing an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment. An internal preparation containing an extract of a bud of the genus Lily of the Liliaceae family, which has been subjected to a dry heat treatment.

Images