JP2021093966A - Methods of gene introduction to filamentous fungi and uses thereof - Google Patents

Abstract

To provide methods of gene introduction into filamentous fungi for efficiently conducting a series of processes such as transformant screening and evaluation of obtained strains.MEANS FOR SOLVING THE PROBLEM: Disclosed is a method for introducing a gene into a filamentous fungus comprising a step of applying a DNA encoding a gene of interest to the filamentous fungus whose cell wall has been weakened; and a step of culturing the treated fungus in a liquid culture medium, where the liquid culture medium is a selection medium to selectively grow fungal cells that took in the DNA and has an osmosis that allow the growth of fungus having weakened cell wall, where the DNA has a sequence for homologous recombination into the filamentous fungal DNA and the filamentous fungus has been modified to reduce the rate of non-homologous recombination.SELECTED DRAWING: None

Description

The present invention relates to a method for introducing a gene into a filamentous fungus and its use.

Filamentous fungi have a high ability to secrete and produce proteolytic enzymes and saccharifying enzymes among eukaryotic microorganisms, as represented by Aspergillus oryzae, which is known as aspergillus oryzae used in sake and soy sauce. Some of them are known as antibiotic-producing bacteria, and have been used for the production of useful substances for a long time. In recent years, it has become easier to obtain whole-genome information, and by genetically modifying filamentous fungi, it has been developed to create more useful new strains, such as using it as a host for mass production of heterologous proteins. It is being advanced.

Regarding useful new strains of filamentous fungi, for example, the applicant applied for orotidine 5'-phosphate involved in uridine / uracil biosynthesis in the wild strain Aspergillus oryzae AOK27L strain (available from Akita Konno Shoten Co., Ltd.). Aspergillus oryzae HO1 strain (accession number: NITE BP-01749), which is a gene-disrupted strain of the gene encoding decarboxylase (pyrG gene), has been created and disclosed. The HO1 strain enables selective culture of transformants according to their auxotrophy when introducing a plasmid or linear DNA into which a pyrG gene expression cassette is inserted into the cells (see Patent Documents 1 and 2).

Furthermore, the applicant has submitted the Aspergillus oryzae HO2 strain (accession number: NITE BP-01750), which is a gene-disrupted strain of the gene encoding DNA ligase IV involved in DNA illegitimate recombination (ligD gene) in the HO1 strain. ) Has been created and disclosed. When introducing a plasmid or linear DNA having a sequence for homologous recombination into the genome, the HO2 strain suppresses the frequency of non-homologous recombination and enhances the efficiency of homologous recombination into the genome (Patent Document). See 1 and 2).

Furthermore, Applicants are the genes of the gene encoding PrtR (prtR gene), which is a transcription factor that positively regulates the gene expression of the main protease and peptidase enzyme groups secreted outside the cells in the HO2 strain. Aspergillus oryzae HO3 strain (accession number: NITE BP-01954), which is a destructive strain, has been created and disclosed. The HO3 strain suppresses the degradation / elimination of proteins expressed from the introduced gene and improves the production amount (see Patent Document 1).

Furthermore, in the HO2 strain, the applicant disrupts the gene encoding PrtR, which is the transcription factor (prtR gene), and also uses the gene encoding extracellular acidic protease (pepA gene) and extracellular carboxypeptidase. Aspergillus oryzae HO4 strain (accession number: NITE BP-01980), which is a multiple gene disruption strain of the encoding gene (cpI gene), has been created and disclosed. The HO4 strain suppresses the degradation / elimination of proteins expressed from the introduced gene and improves the production amount (see Patent Document 2).

Furthermore, the applicant has introduced an expression cassette of an artificial transcription factor into the cells of Aspergillus oryzae, and has provided a cis element for binding the gene encoding a foreign protein to the artificial transcription factor. By inserting it in tandem in the upstream region of the gene expression promoter and further introducing it, a technique for producing a heterologous saccharifying enzyme with high efficiency has been realized (see Patent Document 3).

On the other hand, regarding homologous recombination of foreign DNA to the genome, Aspergillus oryzae increases the rate of homologous recombination to the genome due to gene disruption of ku70 and ku80 involved in illegitimate recombination of DNA. ), And other filamentous fungi such as Aspergillus sojae and Neurospora crassa (see Patent Document 4 and Non-Patent Document 1).

From the above examples, it can be seen that genetic engineering modification methods are useful for creating useful new strains of filamentous fungi, but in general, for incorporating foreign DNA into the bacterial cells of filamentous fungi, It is necessary to weaken the cell wall by enzymatic decomposition treatment and let the foreign DNA act on it. In this case, do not destroy the cells for a certain period of time on a solid medium such as a soft agar plate whose osmotic pressure has been adjusted. It was necessary to maintain and restore the weakened cell wall (see Non-Patent Document 2).

Japanese Patent No. 6360787 Japanese Patent No. 6473339 JP-A-2017-23139 Japanese Unexamined Patent Publication No. 2005-237316

Takahashi T, Masuda T, Koyama Y. "Enhanced gene targeting frequency in ku70 and ku80 disruption mutants of Aspergillus sojae and Aspergillus oryzae" Mol Genet Genomics (2006) May; 275 (5) pp460-70. Katsuya Gomi, Yuzuru Iimura, Shodo Hara "Integrative Transformation of Aspergillus oryzae with a plasmid Containing the Aspergillus nidulans argB Gene" Agricultural and Biological Chemistry (1987) 51 (9) pp2549-2555.

However, in the culture of filamentous fungi, which are aerobic microorganisms, the period required for bacterial growth is longer in solid culture on an agar plate or the like than in liquid culture, considering the entire process up to screening. There is a problem that it takes a certain amount of time for the bacteria to grow after the cell wall is restored. On the other hand, in liquid culture, the killing of bacteria was promoted by mechanical destruction by stirring the fluid, and the bacteria could not be grown stably.

Therefore, an object of the present invention is to enable the recovery of the cell wall weakened in order to allow the cells of filamentous fungi to take up foreign DNA by liquid culture, shorten the recovery period, and thus to the transformant. It is an object of the present invention to provide a method for introducing a gene into a filamentous fungus, which enables an efficient series of processes such as screening and evaluation of the obtained strain.

In order to achieve the above object, the present invention, in the first aspect thereof,
The process of causing the DNA encoding the gene of interest to act on the filamentous fungus that has weakened the cell wall,
The step of culturing the filamentous fungus on which the DNA was allowed to act in a liquid medium and
It is a method of gene transfer into filamentous fungi equipped with
The liquid medium is a selective medium for selectively growing bacterial cells incorporating the DNA, and has an osmotic pressure for culturing the cell wall of the fragile filamentous fungus. Yes,
The DNA has a sequence for homologous recombination into the filamentous fungus genome.
The filamentous fungus provides a method for introducing a gene into a filamentous fungus, which is a filamentous fungus modified so as to reduce the frequency of illegitimate recombination.

According to the above-mentioned gene transfer method into filamentous fungi, appropriate penetration of selection of cells of Aspergillus oryzae into which the target gene has been introduced and recovery / proliferation from fragility such as protoplastization for incorporating foreign DNA can be performed appropriately. By liquid culturing in a selective medium having pressure, it can be carried out by one operation, and the recovery period by solid culturing, which has been conventionally required, can be shortened. And since filamentous fungi modified to reduce the frequency of illegitimate recombination are used, even if the colony separation work of the transformant by the selective medium on the agar plate is omitted, the foreign gene is almost uniformly used. Is obtained as a bacterial cell population introduced into the genome. Therefore, when the cells are subsequently isolated and the functionality is evaluated, there is little influence on the variation in the expression of functionality and the variation in the properties of the isolated cells themselves.

In order to achieve the above object, in the second aspect of the present invention, in the method for introducing a gene into a filamentous fungus, the osmotic pressure of the liquid medium is 0.6Osm / L or more and 1.6Osm / L or less. It provides a method for introducing a gene into a filamentous fungus, which is characterized by the above.

In order to achieve the above object, in the third aspect of the present invention, in the method for introducing a gene into a filamentous fungus, the filamentous fungus is a aspergillus. Is to provide.

In order to achieve the above object, the present invention is characterized in that, in the fourth aspect thereof, in the method for introducing a gene into the filamentous fungus in the third aspect, the aspergillus is a ligD gene-deficient strain. It provides a method for introducing a gene into a filamentous fungus.

In order to achieve the above object, in the fifth aspect of the present invention, in the method for introducing a gene into the filamentous fungus, the filamentous fungus is Aspergillus oryzae HO1 strain (accession number: NITE BP-01749). It is characterized by being Aspergillus oryzae HO2 strain (trust number: NITE BP-01750), Aspergillus oryzae HO3 strain (trust number: NITE BP-01954), or Aspergillus oryzae HO4 strain (trust number: NITE BP-01980). It provides a method for introducing a gene into Aspergillus oryzae.

On the other hand, in the sixth aspect of the present invention, a foreign gene is introduced into a filamentous fungus by the above-mentioned method for introducing a gene into a filamentous fungus, and the introduced foreign gene is introduced using the filamentous fungus into which the foreign gene has been introduced. It provides a gene evaluation method characterized by evaluating functionality.

According to the above gene evaluation method, since the above-mentioned gene transfer method for filamentous fungi is used, the work of individual gene transfer is expedited, and screening and new strains based on a predetermined functional evaluation of a foreign gene of unknown function are performed. Can be searched more efficiently.

According to the present invention, the recovery period can be shortened because the recovery of the cell wall weakened in order to incorporate foreign DNA into the cells of the filamentous fungus can be performed by liquid culture. Therefore, a series of processes such as screening of transformants and evaluation of the obtained strain can be efficiently performed.

It is explanatory drawing which shows typically the CBH1 expression mechanism of the CBH1 producing bacterium prepared in Test Example 1. FIG. It is an electrophoresis gel staining image which shows the result of having confirmed the expression of CBH1 in Test Example 1. It is a chart which shows the result of having investigated the influence of osmotic pressure in the recovery phase from the weakening of a cell wall in Test Example 2.

The present invention comprises a step of allowing a DNA encoding a target gene to act on a filamentous bacterium having a weakened cell wall, and a step of culturing the filamentous bacterium on which the DNA is acted in a liquid medium. It provides a method for introducing a gene into a cell.

The present invention is applicable to various filamentous fungi, but typically, for example, Aspergillus spp., Neurospora spp., Penicillium spp., Cephalosporium spp. ), Acremonium, etc. Among them, Aspergillus oryzae, Aspergillus sojae, Aspergillus awamori, Aspergillus kawachii, Aspergillus kawachii, Aspergillus aspergillus aspergillus nidulans Filamentous fungi belonging to the genus Aspergillus such as Aspergillus are known as Aspergillus (Aspergillus) and are derived from foods such as sake, shochu, awamori, soy sauce, miso, and sardine, and therefore can be suitably used.

However, the filamentous fungus to which the present invention is applied needs to be a filamentous fungus modified so that the frequency of illegitimate recombination is reduced. This prevents the foreign DNA taken up by the cells from being introduced into the genome asymmetrically, and simply cultures in liquid culture on a selective medium (without the work of colony isolation on an agar medium plate). Even), a bacterial cell population in which the foreign gene is introduced into the genome is obtained almost uniformly.

Such variants of filamentous fungi can be obtained for any filamentous fungus, such as by obtaining a disrupted strain of a gene involved in illegitimate recombination. Examples of genes involved in illegitimate recombination include genes encoding DNA ligase IV (ligD gene), genes encoding DNA repair proteins ku70 and ku80, and the like. Gene disruption can be done by conventional genetic engineering techniques. Alternatively, even for an existing condominium strain or a strain isolated from a natural product, if the frequency of illegitimate recombination is low, the present invention is modified so that the frequency of illegitimate recombination is low. It is included in "It was done" and there is no problem in using it. As a guideline for reducing the rate, when a linear DNA fragment having an arbitrarily unbiased sequence for homologous recombination is incorporated into a filamentous fungus cell, the frequency of recombination into the filamentous fungus genome is generally single. It suffices if the frequency of non-homologous recombination is reduced to the extent that a copy is introduced. To confirm whether or not a single copy has been introduced, genomic DNA is extracted from the cells, the amount is quantified, and the amount is divided by the amount of DNA of a known genome size to obtain the genome extraction coefficient. It can be calculated by quantifying the copy number of the introduced DNA contained in the DNA by real-time PCR or the like and dividing it by the genome extraction coefficient. The value is, for example, preferably 0.5 to 1.5, and more preferably 0.8 to 1.2. However, the gene transfer method according to the present invention is not limited to the purpose of introducing a single copy, and in some cases, it may be used with the intention of introducing a multicopy of 2 or more copies per genome. In addition, as a result, it does not exclude the introduction by multi-copy of 2 or more copies per genome.

As described above, the applicant has adopted Aspergillus oryzae HO1 strain (accession number: NITE BP-01749), Aspergillus oryzae HO2 strain (accession number: NITE BP-01750), as host aspergillus for heterologous enzyme expression. Aspergillus oryzae HO3 strain (trust number: NITE BP-01954) and Aspergillus orize HO4 strain (trust number: NITE BP-01980) were created, and the National Institute of Technology and Evaluation Patent Microorganisms Depositary Center (Kisarazu City, Chiba Prefecture) It has been deposited at Kazusa Kamashita Room 2-5-8 122). Therefore, these can also be preferably used.

The gene to be introduced into the filamentous fungus may be a desired gene and is arbitrary. It can also be a gene of unknown function. Moreover, a single type may be introduced, or a plurality of types may be introduced collectively.

However, the DNA encoding the gene of interest must have a sequence for homologous recombination into the filamentous fungal genome. That is, it is necessary to introduce it into the filamentous fungus genome by the mechanism of homologous recombination inherent in the organism. The shape of the DNA may be a terminal, that is, a linear DNA fragment, or a terminal, that is, a circular plasmid, but from the viewpoint of controlling the number of copies to be introduced, the linear DNA fragment. Is preferable. The DNA size is preferably about 6 kbp to 15 kbp as a whole, and it is preferable to have a homologous sequence portion of about 0.5 kbp to 2.0 kbp on each of the 5'sides and 3'sides. If the homologous sequence portion is smaller than 0.5 kbp, the efficiency of homologous recombination is significantly reduced. On the other hand, since the efficiency is constant at 2.0 kbp, the efficiency does not increase even if the base length is further increased. A gene expression cassette consisting of a promoter region, an enhancer region, a terminator region, a coding region (which may include an exon / intron structure), a 5'side or 3'side non-coding region, etc. is sandwiched between the homologous sequences. It is preferable to do so. In addition, the gene does not have to be a gene expression scheduled, and a gene expression-related sequence such as a gene expression activation sequence or a silencer sequence, a gene having other functionality, or a partial sequence, junk DNA, etc. It may be.

The weakening of the cell wall of filamentous fungi can usually be carried out by a method well known in the art as a necessary treatment for incorporating foreign DNA. For example, a protoplast method, an electroporation method, a PEG-calcium method, a calcium phosphate method, a method using a cationic lipid, and the like can be mentioned. Of these, the protoplast method is preferable because it is simple and versatile regardless of the bacterial species.

In the present invention, a filamentous fungus having a weakened cell wall is allowed to act on a DNA encoding a gene of interest, and then liquid-cultured in a liquid medium. At this time, the liquid medium is a selective medium for selectively growing the cells that have taken up the DNA, and has an osmotic pressure for culturing the cell wall of the fragile filamentous fungus.

As such a liquid medium, as the selective medium, although it depends on the type of filamentous fungus to which the present invention is applied, those well known in the art can be used, and a typical example is uridine. Requirement, arginine requirement, nitrate assimilation, sulfate assimilation, bleomycin resistance, pyrithiamine resistance and the like can be mentioned. Specifically, for example, the following aspects can be mentioned.

(Autotrophic system)
-Uridine-requiring strain Indispensable component for growth: Uridine final concentration 15-20 mM
Medium used at the time of selection: CD medium ・ Arginine-requiring strain Essential component for growth: Arginine final concentration 0.1%
Medium used at the time of selection: CD medium-nitrate assimilation deficient strain Essential component for growth: Sodium glutamate as a nitrogen source other than _{nitrate (NaNO 3, etc.) Final concentration 10 mM}
Medium used for selection: CD medium-Sulfate assimilation Essential ingredient: Methionine Final concentration 0.15%
Medium used for selection: CD medium

(Growth inhibitor system)
-Bleomycin-resistant growth-inhibiting substance: medium used when selecting bleomycin: CD medium + 30 μg / mL bleomycin + 0.007% Triton X-100 + 0.1 mM chlorpromazine ・ Pyritiamine-resistant growth-inhibiting substance: pyritiamine final concentration 100 μg / mL
Medium used for selection: CD medium + pyrithiamine

In addition, the osmotic pressure of the liquid medium can be adjusted by the additional addition of a water-soluble component that is harmless to the growth of filamentous fungi. Examples of such an osmotic pressure adjusting agent include sugar alcohols such as sorbitol and mannitol, sugars such as glucose _{, and ionic salts such as KCl, sulfonyl 4} , NaCl, and ammonium sulfate. One type of osmotic pressure adjusting agent may be used alone, or two or more types may be used in combination. As a guideline for the osmotic pressure, it is 0.6Osm / L or more and 1.6Osm / L or less, and more preferably 0.8mOsm / L or more and 1.2Osm / L or less. If the osmotic pressure is smaller than the above range, the filamentous fungus cells that have weakened the cell wall are likely to rupture, which may make it difficult to grow. If it is larger than the above range, the filamentous fungus cells that have weakened the cell wall are likely to be crushed, which may also make it difficult to proliferate.

In the present invention, the cells after the action of the DNA encoding the gene of interest are inoculated into a liquid medium placed in a culture vessel and subjected to liquid culture. The liquid culture is preferably aerobically cultured at, for example, an initial mycelium concentration of 1 × 10 ⁴ to 1 × 10 ⁶ and a temperature condition of 30 to 37 ° C. From the viewpoint of supplying fresh air, it is preferable to carry out the culture while shaking or shaking the liquid medium contained in the container together with the container. The number of culture days can be appropriately set according to the purpose, but for example, it is preferably 5 to 14 days, and more preferably 7 to 12 days.

By such a liquid culture, only the cells that have taken up the DNA can be selectively grown, and the recovery / growth treatment of the filamentous fungi that have weakened the cell wall can be performed by one operation. Therefore, a series of processes that normally required a period of, for example, 21 to 28 days can be performed in a shorter time, for example, about 7 to 14 days, and labor saving and space saving are achieved. It also becomes easier.

Hereinafter, the present invention will be specifically described with reference to examples, but these examples do not limit the scope of the present invention.

<Test Example 1>
An attempt was made to create a CBH1-producing bacterium according to the method described in JP-A-2017-23139. At this time, the gene fragment for producing CBH1 was introduced by the method according to the present invention. Specifically, the test was conducted as follows.

[1. Overview of CBH1 producing bacteria]
FIG. 1 is an explanatory diagram schematically showing a CBH1 expression mechanism in a CBH1 producing bacterium. As shown in FIG. 1, a CBH1 expression gene fragment 1 and an artificial transcription factor expression gene fragment 9 have been introduced into the CBH1 producing bacterium.

The gene fragment 1 for CBH1 expression is a cbh1 gene 3 encoding cellobiohydrolase (CBH1) as a desired protein 2, a promoter 4 linked to the upstream side (5'side) of the cbh1 gene 3, and a promoter 4 of the promoter 4. It is provided with a cis element 5 connected to the upstream side (5'side).

The cis element 5 consists of a base sequence containing an enhancer DNA present in the promoter of the kojT gene. In this test example, the base sequence of the cis element 5 is gacggaaaagtcgggtagat (SEQ ID NO: 1), which is located upstream of the promoter 4. Eight cis elements 5 are connected.

On the other hand, the gene fragment 9 for expressing an artificial transcription factor comprises an artificial transcription factor coding gene 7 encoding the artificial transcription factor 6 and a promoter 8 linked to the upstream side (5'side) thereof. In this test example, the artificial transcription factor 6 has an active domain consisting of the amino acid sequences of 150 to 604aa on the downstream side of the transcription factor AmyR on the downstream side of the DNA binding domain consisting of the amino acid sequences of 1-118aa on the upstream side of the transcription factor KojR. It has a linked structure (for the base sequence of DNA encoding an artificial transcription factor: SEQ ID NO: 2).

As shown in FIG. 1, in the CBH1 producing bacterium, an artificial transcription factor 6 encoded by the artificial transcription factor expression gene fragment 9 is produced, and the artificial transcription factor 6 is added to the cis element 5 provided in the CBH1 expression gene fragment 1. Binding promotes high expression of CBH1 via promoter 4.

[2. Construction of gene fragment for expression of artificial transcription factor]
A gene fragment for expressing an artificial transcription factor for creating the CBH1-producing bacterium described in FIG. 1 was prepared as follows.

First, using the genomic DNA of Aspergillus oryzae HO2 strain (accession number: NITE BP-01750) as a template, primers 1 and 2 are used for the upstream sequence of the tppA gene, primers 3 and 4 are used for the downstream sequence, and primers 5 and 6 are used. Primers using the tef1 promoter gene, agdA terminator gene at primers 7 and 8, gene fragment for marker recycling at primers 9 and 10, and genomic DNA of Aspergillus awamori HA1 strain (accession number: NITE BP-01751) as a template. The gene cassettes for expressing the pyrG gene at 11 and 12 were PCR-amplified with a DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD FX neo), and purified kit (manufactured by QIAGEN, trade name: QIAquick PCR purification kit). ) To obtain a total of 6 gene fragments.

Next, E. Using the plasmid pMD20 (manufactured by Takara Bio Co., Ltd.) derived from coli as a template, the gene fragment containing the origin of replication derived from the plasmid and the ampicillin resistance gene was PCR-amplified with the above DNA polymerase using primers 13 and 14, and used in the above purification kit. Purified to obtain the gene fragment.

Next, the above seven gene fragments were sequentially processed using a cloning kit (manufactured by Takara Bio Inc., trade name: In-Fusion HD Cloning kit), and E.I. The plasmid pPT was constructed by transforming with the coli HST08 strain (manufactured by Takara Bio Inc.).

Next, the plasmid pPT was treated with a restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 ° C. and purified with the above purification kit to obtain a restriction-treated product (gene fragment) of the plasmid.

Next, using the genomic DNA of the Aspergillus oryzae HO2 strain (accession number: NITE BP-01750) as a template, the DNA encoding the DNA binding domain of the transcription factor KojR was transcribed with primers 15 and 16 with primers 17 and 18. The DNA encoding the active domain of the factor AmyR was PCR-amplified by the above DNA polymerase and purified by the above purification kit.

Next, the DNA derived from both of the transcription factors and the SmaI-treated fragment of the plasmid pPT were treated with the cloning kit, and E.I. A plasmid pPT-TF1 was constructed by transforming into the coli HST08 strain and introducing DNA (SEQ ID NO: 2) encoding an artificial transcription factor formed by binding the DNA binding domain of the transcription factor KojR and the active domain of the transcription factor AmyR. did.

On the other hand, using the genomic DNA of Aspergillus oryzae HO4 strain (accession number: NITE BP-01980) as a template, primers 19 and 20 are used for the upstream sequence of the ligD gene, primers 21 and 22 are used for the downstream sequence, and primers 23 and 24 are used. The pyrG gene was PCR-amplified with DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD FX neo) using the sequence for marker recycling and primers 25 and 26, respectively, and a purification kit (manufactured by QIAGEN, trade name: QIAquick) was used. Purification with PCR purification kit) gave a total of 4 gene fragments.

Next, E. Using the plasmid pMD20 (manufactured by Takara Bio Inc.) derived from coli as a template, a gene fragment containing the origin of replication derived from the plasmid and the ampicillin resistance gene was obtained with primers 13 and 14.

Next, the gene fragment of the upstream sequence of the ligD gene, the gene fragment of the downstream sequence, and the gene fragment derived from the plasmid pMD20 were processed using a cloning kit (manufactured by Takara Bio Co., Ltd., trade name: In-Fusion HD Cloning kit). , E.I. The plasmid pM-AoΔligD was constructed by transforming with the coli HST08 strain (manufactured by Takara Bio Inc.).

Next, the plasmid pM-AoΔligD was treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 ° C. and purified with the purification kit to obtain a restricted product (gene fragment) of the plasmid pM-AoΔligD. did.

Next, the gene fragment of the plasmid pM-AoΔligD and the gene fragment of the pyrG gene were processed using the above cloning kit, and E.I. The plasmid pM-AoΔligD :: pyrG into which the pyrG gene was introduced was constructed between the upstream sequence and the downstream sequence of the ligD gene by transforming into the coli HST08 strain (manufactured by Takara Bio Inc.).

Next, the plasmid pM-AoΔligD :: pyrG was treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 ° C., purified with the above purification kit, and the plasmid pM-AoΔligD :: pyrG was restricted. Gene fragment) was obtained.

Next, the gene fragment of the plasmid pM-AoΔligD :: pyrG and the gene fragment of the sequence for marker recycling were processed using the above cloning kit, and E.I. A plasmid pM-AoΔligD :: pyrGR was constructed by transforming into a coli HST08 strain (manufactured by Takara Bio Inc.) and introducing a marker recycling sequence between the downstream sequence of the ligD gene and the pyrG gene.

Next, the plasmid pM-AoΔligD :: pyrGR was treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 ° C., purified with the above purification kit, and the plasmid pM-AoΔligD :: pyrGR was restricted. Gene fragment) was obtained.

Next, using the genomic DNA of the Aspergillus oryzae HO4 strain (accession number: NITE BP-01980) as a template, the enoA promoter gene at primers 27 and 28, and the above-mentioned plasmid pPT-TF1 as a template, using primers 29 and 30. The DNA encoding the artificial transcription factor in which the agdA terminator gene was inserted downstream was PCR-amplified by the DNA polymerase and purified by the purification kit.

Next, the DNA encoding the artificial transcription factor in which the above-mentioned plasmid pM-AoΔligD :: pyrGR gene fragment, the above-mentioned enoA promoter gene gene fragment, and the above-mentioned agdA terminator gene were inserted downstream was processed using the above-mentioned cloning kit. , E.I. A plasmid pM-AoΔligD :: pyrGR-TF1 into which an artificial transcription factor gene was introduced was constructed between the upstream sequence and the downstream sequence of the ligD gene by transforming with the coli HST08 strain (manufactured by Takara Bio Inc.).

Using the plasmid pM-AoΔligD :: pyrGR-TF1 into which the above artificial transcription factor gene was introduced as a template, the gene fragment for transformation of aspergillus with primers 31 and 32 was used as a DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD- PCR amplification was performed with plus-neo) and purified with the above purification kit to obtain a gene fragment for transformation of the aspergillus. The gene fragment for transformation of Jiuqu bacterium targets the region of the ligD gene for homologous recombination. That is, in the HO4 strain into which this gene fragment is introduced, which will be described later, the ligD gene is already deleted, but the upstream and downstream sequences of the gene remain, and homologous recombination can be performed using the upstream and downstream sequences. I am trying to do it.

Table 1 summarizes the sequences of PCR primers used to construct gene fragments for artificial transcription factor expression.

[3. Construction of gene fragment for CBH1 expression]
A gene fragment for CBH1 expression for creating the CBH1-producing bacterium described in FIG. 1 was prepared as follows.

First, a first gene fragment in which four cis elements (gacggaaaagtcgggtagat) of SEQ ID NO: 1 are ligated in tandem, and restriction enzyme sites SphI and BamHI sites are added to the 5'side and BglII and NcoI sites are added to the 3'side. It was prepared by oligo synthesis.

Next, the above-mentioned first gene fragment and the plasmid pPEA2 containing the enoA promoter derived from Aspergillus oryzae were treated with restriction enzymes SphI and NcoI to fragment them, and after a ligation reaction, E.I. Transformed into coli to construct plasmid pEA4K.

Next, the first gene fragment is treated with the restriction enzyme BamHI, while the plasmid pEA4K is treated with the restriction enzymes BglII and NcoI, and the two treated products are subjected to a ligation reaction. Transformed into coli to construct plasmid pEA8K.

Next, using the plasmid pEA8K as a template, using primers 33 and 34, PCR amplification was performed with DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD-plus-), and a purification kit (manufactured by Promega Co., Ltd., trade name: Wizard). Purification by SV Gel and PCR Clean-Up System) was performed to obtain a second gene fragment.

Next, using the genomic DNA of Aspergillus oryzae as a template, using primers 35 and 36, PCR amplification was performed with DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD-plus-), and a purification kit (manufactured by Promega Co., Ltd., Product name: Wizard SV Gel and PCR Clean-Up System) was used for purification to obtain a third gene fragment.

Next, fusion PCR was performed using the primers 34 and 36 using the second gene fragment and the third gene fragment as templates, and the second gene fragment and the third gene fragment were bound to each other. A fourth gene fragment was prepared.

Next, E. A plasmid pMD20 derived from coli (manufactured by Takara Bio Inc.), 1000 bp upstream of the pyrG gene derived from Aspergillus oryzae, a pyrG expression cassette derived from Aspergillus oryzae, E. coli. DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD-plus-) using plasmid pPPG into which the uidA gene derived from E. coli has been introduced treated with a restriction enzyme and primers 37 and 38 using the plasmid pPPG as a template. The gene fragment for marker recycling obtained by PCR amplification with a purification kit (manufactured by Promega Co., Ltd., trade name: Wizard SV Gel and PCR Clean-Up System) was subjected to a ligation reaction, and then E. coli. Transformed into coli to construct the plasmid pPPRG.

Next, using the plasmid pPPRG as a template, PCR amplification was performed with DNA polymerase (manufactured by Toyo Spinning Co., Ltd., trade name: KOD-plus-) using primers 39 and 40, and a purification kit (manufactured by Promega Co., Ltd., trade name:). Purification by Wizard SV Gel and PCR Clean-Up System) was performed to obtain a fifth gene fragment.

Fusion PCR was performed using primers 36 and 39 using the fourth gene fragment and the fifth gene fragment as templates, and the fourth gene fragment and the fifth gene fragment were bound to form a cis element. A ligated GUS (β-glucuronidase) production cassette gene fragment was prepared.

On the other hand, using the genomic DNA of the Aspergillus oryzae HO4 strain (accession number: NITE BP-01980) as a template, the upstream sequence of the pyrG gene is linked to the primers 41 and 42, and the downstream sequence is linked to the downstream sequences by the primers 43 and 44. Using the GUS (β-glucuronidase) production cassette gene fragment as a template, the promoter gene to which the cis element was linked with primers 45 and 46, the agdA terminator gene with primers 47 and 48, and the acremonium cellulolyticus H1 Using the genomic DNA of the strain (accession number: FERM BP-11508) as a template, the cellobiohydrolase (cvh1) gene is used as a template with primers 49 and 50, and the genomic DNA of the Aspergillus awamori HA1 strain (accession number: NITE BP-01751). The gene cassette for expressing the pyrG gene was PCR-amplified by the above DNA polymerase with the primers 51 and 52, and purified by the above purification kit to obtain a total of 6 gene fragments.

Next, the plasmid pMD20 (manufactured by Takara Bio Inc.) was treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 ° C., purified with the above purification kit, and the restricted product (gene fragment) of the plasmid pMD20 was treated. Was acquired.

Next, the gene fragment of the upstream sequence of the pyrG gene, the gene fragment of the downstream sequence, the gene fragment of the promoter gene to which the cis element is linked, the gene fragment of the agdA terminator gene, the gene fragment of the cbh1 gene, and the gene cassette for expressing the pyrG gene. The gene fragment and the gene fragment of the plasmid pMD20 were sequentially processed using the above cloning kit to obtain E.I. The plasmid pPPeA8-CBH1 was constructed by transforming with the coli HST08 strain (manufactured by Takara Bio Inc.).

Next, using the plasmid pPPeA8-CBH1 as a template, PCR amplification was performed with the above DNA polymerase using primers 31 and 32, purified with the above purification kit, and a gene fragment for aspergillus transformation (pyrG-CBH1 fragment). Was obtained. The gene fragment for transformation of Jiuqu (pyrG-CBH1 fragment) targets the region of the pyrG gene for homologous recombination. That is, in the HO4 strain into which this gene fragment is introduced, which will be described later, the pyrG gene is already deleted, but the upstream and downstream sequences of the gene remain, and homologous recombination can be performed using the upstream and downstream sequences. I am trying to do it.

Table 2 summarizes the sequences of PCR primers used to construct gene fragments for CBH1 expression.

[4. Introduction of gene fragments for expression of artificial transcription factors into Jiuqu]
Above 2. A gene fragment for expressing an artificial transcription factor for transformation of Jiuqu was introduced into Aspergillus oryzae HO4 strain (accession number: NITE BP-01980) according to the PEG-calcium method, and a trait capable of growing on a CD plate medium. Transformants were selected to obtain artificial transcription factor producing strains.

Next, the obtained artificial transcription factor-producing strain was placed on a CD medium with a final concentration of 1 mg / mL fluoroorotic acid monohydrate (manufactured by Wako Pure Chemical Industries, Ltd.) and a final concentration of 20 mM uridine (manufactured by Sigma Aldrich). Was inoculated into a medium containing 1 × 10 ⁶ cells / plate, and a strain capable of growing was selected to obtain a uridine-requiring strain of an artificial transcription factor-producing strain.

[5. Introduction of gene fragment for CBH1 expression into artificial transcription factor expressing strain]
Above 3. The gene fragment for CBH1 expression for transformation of Jiuqu, which was obtained in the above 4. A CBH1-producing bacterium was created by introducing it into the uridine-requiring strain of the artificial transcription factor-producing strain obtained in. At that time, the introduction of the gene fragment was carried out by the method of the present invention. Specifically, an attempt was made to create a CBH1-producing bacterium by incorporating a gene fragment (pyrG-CBH1 fragment) for producing CBH1 into the cells according to the following procedure.

(1) The artificial transcription factor-producing strain is cultured in a CD plate medium (minimum nutrient medium) for 1 week to form spores, and the spores are used in 0.01% POLYSORBATE 20 (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.). And collected to obtain a spore suspension.

(2) The obtained spore suspension was pre-cultured in PD medium supplemented with uridine to a final concentration of 20 mM, and the obtained cells were protoplasted using an enzyme. The details of the protoplastization method are described in the latter part (5).

(3) 50 μL of pyrG-CBH1 fragment adjusted to a concentration of about 500 ng / μL was added to 1 mL of the obtained protoplast solution (mycelium concentration: about 2 × 10 ^{7) for treatment.} The details of the method of allowing DNA to act on the protoplast solution are further described in the latter part (6).

(4) Put 100 mL of PD liquid medium containing 0.8M D-sorbitol in a 500 mL Erlenmeyer flask, and add 1 mL of the mixture after treating the protoplus solution and the pyrG-CBH1 fragment (of the first protoplast solution). prepared as cell concentration of 1.43 × ¹⁰ 5 / mL), while rocking every vessel in a reciprocating speed conditions 100 rpm, and incubated for 7 days at 30 ° C..

(5) Protoplastization method-After culturing in PD medium, collect the cells with a glass filter 17G3 (Sansho Co., Ltd.).
-After washing with purified water and NaCl buffer, transfer the cells (approximately 3 g) to a 50 mL conical tube (Nippon Becton Dickinson Co., Ltd.).
-Add 15 mL of Enz Solution and 30 mL of NaCl buffer, and react at 30 and 55 rpm for about 2 hours.
-The reaction solution is filtered using a 70 μm cell strainer (Nippon Becton Dickinson Co., Ltd.) and centrifuged at 3500 rpm (2150 × g) for 20 minutes at 4 ° C.
-After centrifugation, discard the supernatant, add 1 mL of cooled Solution B, gently suspend, transfer to a 1.5 mL tube, and centrifuge at 4500 rpm (2220 x g) for 5 minutes.
・ After centrifugation, discard the supernatant, add 1 mL of cooled Solution B, and repeat the above operation.
・ After centrifugation, discard the supernatant, add 1 mL of cooled Solution B, suspend gently, and measure the protoplast number under a microscope.
· The Solution B was added an appropriate amount by adjusting the cell concentration of about 2~3 × ¹⁰ 7 / mL, and protoplast solution.

(6) Method of allowing DNA to act on protoplast solution-Add 1 mL of protoplast solution, 200 μL of Solution C, and 50 μL of pyrG-CBH1 fragment to a cooled 15 mL conical tube (Nippon Becton Dickinson Co., Ltd.) and stir gently. , Incubate in ice for 30 min.
-Add 150 μL of Solution C, stir gently and surely, and then let stand at room temperature for 20 to 30 minutes. Since Solution C has a high viscosity, stir well by pipetting. Also, do not leave it for more than 30 minutes after adding Solution C.

The details of the medium composition used in the test are shown below.
-PD medium (pH 6.0)
2% (w / v) Dextrin hydrate 1% (w / v) Polypeptone / Peptone 0.1% (w / v) Casamino acid 0.5% (w / v) KH ₂ PO ₄
0.1% (w / v) NaNO _{3
0.05% (w / v) MgSO} 4 · 7H 2 O

-CD medium (pH 6.0)
3% (w / v) Dextrin hydrate 0.2% (w / v) KCl
0.1% (w / v) KH ₂ PO ₄
0.3% (w / v) NaNO _{3
0.05% (w / v) MgSO} 4 · 7H 2 O
_{0.001% (w / v) FeSO} 4 · 7H 2 O

In addition to dextrin, glucose, maltose, fructose, sucrose, glycerol, and mannitol can be generally used as carbon sources, and ammonium salts (ammonium chloride, ammonium sulfate, etc.) other than sodium nitrate can be used as nitrogen sources. ) Can be used.

[6. result〕
A part of the obtained culture solution was taken, subjected to 10 to 20% SDS-PAGE gel electrophoresis, and the gel after electrophoresis was stained with AE-1340EzStainAQua (Ato Co., Ltd.), and 75 kilodaltons derived from CBH1. The production of proteins expressed in the vicinity was confirmed. FIG. 2 shows the results of the gel-stained image.

As a result, in the sample on the 7th day of culture, it was confirmed that the production amount of the protein expressed in the vicinity of 75 kilodalton, which is considered to be derived from CBH1, was increased.

Furthermore, when genomic DNA was extracted from the cultured cells and the copy number of the CBH1 gene was confirmed by real-time PCR, it was calculated to be approximately 0.84 per genome size (38 Mbp) of Jiuqu. Therefore, it was considered that the gene of interest was introduced into only about one place in the genome.

<Test Example 2>
The effect of osmotic pressure during the recovery phase from cell wall weakening was investigated.

Specifically, protoplasts were prepared in the same manner as in Test Example 1 except that the concentration of the protoplast solution ^{was adjusted to 3 × 10 7} / mL and the pyrG-CBH1 fragment was adjusted to a concentration of 900 ng / μL. After treating the liquid and the pyrG-CBH1 fragment, the cells were cultured in PD liquid media of various osmotic pressures.

The liquid culture conditions were as follows: 50 mL of PD liquid medium containing 0, 0.4.0.8, 1.6, 2.4 MD-sorbitol was placed in a 200 mL volume Erlenmeyer flask, and the above protoplus solution and pyrG-CBH1 fragment were added. Add 140 μuL of the mixed solution after the treatment (prepared so that the cell concentration of the initial protoplast solution is 6 × 10 ⁴ / mL), and shake the whole container under the reciprocating speed condition of 100 rpm, 30 ° C. Incubated for 7 days in

As a result, as shown in FIG. 3, when the osmotic pressure is too low (for example, 0.4 Osm / L or less) or too high (for example, 2.4 Osm / L or more) during the recovery period from the weakening of the cell wall. , The growth of the fungus was not good.

[Strain]
(1) Aspergillus oryzae HO1 strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microorganisms Depositary Center, 2-5-8 Room 122, Kazusakamatari, Kisarazu City, Chiba Prefecture, Deposit date: November 12, 2013, Deposit number : NITE BP-01749)
(2) Aspergillus oryzae HO2 strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microorganisms Depositary Center, 2-5-8 Room 122, Kazusakamatari, Kisarazu City, Chiba Prefecture, Deposit date: November 12, 2013, Deposit number : NITE BP-01750)
(3) Aspergillus oryzae HO3 strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microorganisms Depositary Center, 2-5-8 Room 122, Kazusakamatari, Kisarazu City, Chiba Prefecture, Deposit date: October 24, 2014, Deposit number : NITE BP-01954)
(4) Aspergillus oryzae HO4 strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microorganisms Depositary Center, 2-5-8 Room 122, Kazusakamatari, Kisarazu City, Chiba Prefecture, Deposit date: December 9, 2014, Deposit number : NITE BP-01980)
(5) Aspergillus awamori HA1 strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microorganisms Depositary Center, 2-5-8 Kazusakamatari Room 122, Kisarazu City, Chiba Prefecture, Deposit date: November 12, 2013, Deposit number : NITE BP-01751)
(6) Acremonium Cellulariticus H1 Strain (Independent Administrative Institution Product Evaluation Technology Infrastructure Organization Patent Microbial Deposit Center, 2-5-8 Kazusakamatari, Kisarazu City, Chiba Prefecture, Room 122, Deposit Date: September 5, 2011 Date, accession number: FERM BP-11508)

1 ... CBH1 expression gene fragment, 2 ... protein, 3 ... cbh1 gene, 4, 8 ... promoter, 5 ... cis element, 6 ... artificial transcription factor, 7 ... artificial transcription factor coding gene, 9 ... artificial transcription factor expression gene fragment.

Claims (6)

The process of causing the DNA encoding the gene of interest to act on the filamentous fungus that has weakened the cell wall,
The step of liquid-culturing the filamentous fungus on which the DNA was allowed to act in a liquid medium, and
It is a method of gene transfer into filamentous fungi equipped with
The liquid medium is a selective medium for selectively growing bacterial cells incorporating the DNA, and has an osmotic pressure for culturing the cell wall of the fragile filamentous fungus. Yes,
The DNA has a sequence for homologous recombination into the filamentous fungus genome.
A method for introducing a gene into a filamentous fungus, wherein the filamentous fungus is a filamentous fungus modified so that the frequency of illegitimate recombination is reduced. In the method for introducing a gene into a filamentous fungus according to claim 1,
A method for introducing a gene into a filamentous fungus, wherein the osmotic pressure of the liquid medium is 0.6 Osm / L or more and 1.6 Osm / L or less. In the method for introducing a gene into a filamentous fungus according to claim 1 or 2.
The method for introducing a gene into a filamentous fungus, wherein the filamentous fungus is a aspergillus. In the method for introducing a gene into a filamentous fungus according to claim 3,
A method for introducing a gene into a filamentous fungus, wherein the aspergillus is a strain lacking the ligD gene. In the method for introducing a gene into a filamentous fungus according to any one of claims 1 to 4.
Aspergillus oryzae HO1 strain (accession number: NITE BP-01749), Aspergillus oryzae HO2 strain (accession number: NITE BP-01750), Aspergillus oryzae HO3 strain (accession number: NITE BP-01954), Alternatively, a method for introducing a gene into a filamentous fungus, which is Aspergillus oryzae HO4 strain (accession number: NITE BP-01980). A foreign gene is introduced into a filamentous bacterium by the method for introducing a gene into a filamentous bacterium according to any one of claims 1 to 5, and the filamentous bacterium into which the foreign gene has been introduced is used to determine the functionality of the introduced foreign gene. A gene evaluation method characterized by evaluation.

Images