JP2021083433A - Antigen-binding molecule, nucleic acid composition, vector composition and method for purifying cells and bifidobacterium longum - Google Patents

Abstract

To provide an antigen-binding molecule that has a high specificity to Bifidobacterium longum.SOLUTION: The present disclosure provides an antigen-binding molecule that binds to Bifidobacterium longum.SELECTED DRAWING: Figure 1

Description

The present invention relates to methods for purifying antigen-binding molecules, nucleic acid compositions, vector compositions, cells and Bifidobacterium longum.

It is said that about 1000 types and 100 trillion intestinal bacteria (called intestinal flora (so) and intestinal flora) inhabit the human intestine, mainly the large intestine. It is known that human intestinal bacteria are closely related to each other and are intricately balanced, and are extremely diverse and different depending on the individual, and also differ depending on factors such as diet and country of residence.

In recent years, among the intestinal bacteria, Bifidobacterium longum (hereinafter referred to as "B. longum") is known as a bacterium that has a positive effect on human health. This, B. There is an example of producing an antibody against longum (for example, Non-Patent Document 1).

J Microbiol; Methods. 2006 Apr: 65 (1): 159-70

The antibody disclosed in Non-Patent Document 1 has been shown to be cross-reactive with other types of bacteria of the genus Bifidobacterium, and there is room for improvement in terms of specificity.

The present invention has been made in view of such a background, and B.I. An object of the present invention is to provide an antigen-binding molecule having high specificity for longum.

The main invention of the present invention for solving the above-mentioned problems is an antigen-binding molecule that binds to Bifidobacterium longum.

Other problems disclosed in the present application and solutions thereof will be clarified in the columns and drawings of the embodiments of the invention.

According to the present invention, an antigen-binding molecule having high specificity for Bifidobacterium longum can be obtained.

It is a figure which shows the other kind of bacteria of the genus Bifidobacterium which examined the presence or absence of the crossing of this antigen-binding molecule. It is a figure which shows the result of having examined the presence or absence of the crossing property of this antigen-binding molecule with other Bifidobacterium genus. It is a figure which shows the gram-negative bacterium and the gram-positive bacterium which examined the presence or absence of the crossing of this antigen-binding molecule. It is a figure which shows the result of having examined whether or not this antigen-binding molecule is crossed with other Gram-negative bacteria and Gram-positive bacteria. Using this antigen-binding molecule, B.I. It is a figure which shows the intestinal bacterium reference strain used in the examination to perform isolation of longum. Using this antigen-binding molecule, according to MACS®, B.I. It is a figure which shows the result of having performed isolation of longum. According to MACS®, B.I. It is a figure which shows the base sequence of the primer for nucleic acid amplification used for RT-PCR for investigating whether longum was isolated. It is a figure which shows the result of RT-PCR. B. isolated by MACS. It is a figure which shows the result of culturing longum.

The contents of the embodiments of the present invention will be described in a list. The present invention has the following configurations.
[Item 1]
An antigen-binding molecule characterized by binding to Bifidobacterium longum.
[Item 2]
Do not bind to other Bifidobacterium genera,
The antigen-binding molecule according to Item 1.
[Item 3]
The other genus Bifidobacterium is Bifidobacterium pseudobacterium, Bifidobacterium influenza, Bifidobacterium breve, Bifidobacterium pseudobacterium, Bifidobacterium, Bifidobacterium.
2. The antigen-binding molecule according to item 2.
[Item 4]
The antigen-binding molecule is an antibody, antibody fragment or peptide.
As the amino acid sequence, the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8 or the amino acid sequence having 90% or more homology with the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8.
The antigen-binding molecule according to any one of items 1 to 3, wherein the antigen-binding molecule comprises.
[Item 5]
The antigen-binding molecule is an antibody or antibody fragment.
An amino acid sequence having 90% or more homology with the amino acid set forth in any of SEQ ID NOs: 3 to 5 or the amino acid sequence set forth in any of SEQ ID NOs: 3 to 5 as a heavy chain amino acid sequence.
An amino acid sequence having 90% or more homology with the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 or the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 as the amino acid sequence of the light chain.
The antigen-binding molecule according to item 4, wherein the antigen-binding molecule comprises.
[Item 6]
A VHCDR1 region containing an amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 3.
A VHCDR2 region containing an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence of SEQ ID NO: 4.
A VHCDR3 region containing an amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 5.
A VLCDR1 region containing an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 6.
A VLCDR2 region containing an amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 7.
A VLCDR3 region containing an amino acid sequence of SEQ ID NO: 8 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 8.
5. The antigen-binding molecule according to item 5, wherein the antigen-binding molecule comprises.
[Item 7]
A nucleic acid composition comprising a nucleic acid sequence encoding the antigen-binding molecule according to any one of items 1 to 6, or a plurality of nucleic acid sequences.
[Item 8]
The nucleic acid sequence according to item 7, or a vector composition containing a plurality of nucleic acid sequences, or a vector composition comprising a plurality of vectors.
[Item 9]
A cell comprising the vector composition according to item 8.
[Item 10]
A method for purifying Bifidobacterium longum, which isolates Bifidobacterium longum from a sample containing Bifidobacterium longum using the antigen-binding molecule according to any one of items 1 to 6.

<Details of the embodiment>
The antigen-binding molecule according to the present embodiment is, for example, a monoclonal antibody that strongly and specifically binds to a specific antigen, a polyclonal antibody, or a multispecific antibody formed from at least two different epitope-binding fragments (for example, bispecificity). Antibody), human antibody, humanized antibody, camel family antibody, chimeric antibody, short chain Fv, single chain antibody, single domain antibody, domain antibody, Fab fragment, F (ab') 2 fragment, antibody fragment disulfide-bound Fv , And anti-idiotype antibodies, intracellular antibodies, antibody fragments, and any of the above epitope-binding fragments, including polypeptides, peptides, nucleic acids, synthetic small molecules, synthetic polymers, and the like.

In this embodiment, as an example of an antigen-binding molecule, a monoclonal antibody will be described with reference to the drawings.

The monoclonal antibody (hereinafter referred to as the present antibody) as the antigen-binding molecule according to the present embodiment is described in B.I. It is highly specific for longum. Therefore, by using the antigen-binding molecule according to the present embodiment, B.I. From the sample containing longum, B. longum. It is possible to isolate or concentrate longum.

In this embodiment, it is preferable that the antibody does not bind to other Bifidobacterium spp. As a result, B. From samples such as feces containing bacteria other than longum, B. longum. It is possible to isolate or concentrate longum.

In this embodiment, B.I. Examples of the genus Bifidobacterium other than longum include Bifidobacterium pseudobacterium, Bifidobacterium infantis, Bifidobacterium breve, and Bifidobacterium bacteria.

In the present embodiment, it is preferable that the antibody is not cross-reactive with Gram-positive and Gram-negative bacteria. As a result, by using this antibody, it is possible to obtain B.I. It is possible to isolate and concentrate longum.

Further, in the present embodiment, the antibody may be of any isotype (eg, IgG, IgA, IgM, IgD, IgA, and IgY), or a subisotype thereof, or an allotype.

Further, in the present embodiment, the antibody is used in any mammal, such as, but not limited to, humans, monkeys, rabbits, pigs, horses, rats, dogs, cats, mice, sheep, camels, etc. Alternatively, it may be derived from another animal, such as a bird (eg, a chicken).

In this embodiment, a part of the amino acid sequence of the present antibody is disclosed below. In the present embodiment, it is preferable to have 70% homology with the amino acid sequence disclosed below, more preferably 75% homology, further preferably 80% homology, and further 85. It is preferable to have% homology, further 90% homology, further 95% homology, and 100% homology to exert a preferable function.

A part of the amino acid sequence of this antibody is shown below. Equation 1 is SEQ ID NO: 3, Equation 2 is SEQ ID NO: 4, Equation 3 is SEQ ID NO: 5, Equation 4 is SEQ ID NO: 6, Equation 5 is SEQ ID NO: 7, and Equation 6 is SEQ ID NO: It is 8. The heavy chain amino acid sequence of the present antibody is shown in SEQ ID NO: 1 and the light chain amino acid sequence of the present antibody is shown in SEQ ID NO: 2, which are separately described in the sequence listing.
[Equation 1]
Gly Ph The Thr The Thr Asp Tyr Tyr Met Ser
[Equation 2]
The Ile Arg Asn Lys Ala Lys Ala Tyr Thr Ile Glu Tyr Ser Ala Ser Val
[Equation 3]
Glu Arg Gly Gly Phe Asp Tyr
[Equation 4]
Arg Ser Ser Grn Ser Leu Val His Ser Asn Gly Asn Thr Thr Leu His
[Equation 5]
Lys Val Ser Asn Arg The Ser
[Equation 6]
Ser Grn Ser Thr His Val Pro Trp Thr

That is, in the present embodiment, the present antibody has 90% or more homology as an amino acid sequence with respect to the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8 or the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8. It preferably contains an amino acid sequence having sex. The present antibody preferably contains, as an amino acid sequence, an amino acid sequence having 90% or more homology with the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2. As a result, B. From samples such as feces containing bacteria other than longum, more accurately B. longum. It is possible to isolate or concentrate longum.

In the present embodiment, the present antibody is 90% or more homologous to the amino acid set forth in any of SEQ ID NOs: 3 to 5 or the amino acid sequence set forth in any of SEQ ID NOs: 3 to 5 as a heavy chain amino acid sequence. 90% or more homology between the amino acid sequence having sex and the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 or the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 as the amino acid sequence of the light chain. It is preferable to include an amino acid sequence having. The present antibody preferably contains, as an amino acid sequence, an amino acid sequence having 90% or more homology with the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2. As a result, B. From samples such as feces containing bacteria other than longum, more accurately B. longum. It is possible to isolate or concentrate longum.

In this embodiment, the antibody is
A VHCDR1 region containing an amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 3.
A VHCDR2 region containing an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence of SEQ ID NO: 4.
A VHCDR3 region containing an amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 5.
A VLCDR1 region containing an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 6.
A VLCDR2 region containing an amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 7.
It preferably contains the amino acid sequence of SEQ ID NO: 8 or the VLCDR3 region containing an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 8. The present antibody preferably contains, as an amino acid sequence, an amino acid sequence having 90% or more homology with the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2. As a result, B. From samples such as feces containing bacteria other than longum, more accurately B. longum. It is possible to isolate or concentrate longum.

This antibody is based on B.I. It can bind to the surface antigen of longum, but preferably does not specifically bind to other polypeptides. As a result, B. From samples such as feces containing bacteria other than longum, more accurately B. longum. It is possible to isolate or concentrate longum.

In the present embodiment, the base sequence encoding a part of the amino acid sequence of the present antibody is disclosed below. In the present embodiment, it is preferable to have 70% homology with the base sequence disclosed below, more preferably 75% homology, further preferably 80% homology, and further 85. It is preferable to have% homology, further 90% homology, further 95% homology, and 100% homology to exert a preferable function.

A part of the base sequence of this antibody is shown below. Equation 7 is SEQ ID NO: 11, Equation 8 is SEQ ID NO: 12, Equation 9 is SEQ ID NO: 13, Equation 10 is SEQ ID NO: 14, Equation 11 is SEQ ID NO: 15, and Equation 12 is SEQ ID NO: 16. The nucleotide sequence shown in SEQ ID NO: 9 is the nucleotide sequence encoding the full length of the heavy chain amino acid sequence of this antibody, and the nucleotide sequence shown in SEQ ID NO: 10 is the nucleotide sequence encoding the full length of the light chain amino acid sequence. It is an array.
[Equation 7]
GGGTTCCACTTCACTGATTTACCATGAGC
[Equation 8]
TTTATTAGAAACAAAGCTAAAGCTTACACATAGAGGTACAGTGCATCTGTG
[Equation 9]
GAGAGGGGGAGGGTTTTGACTAC
[Equation 10]
AGATTAGTCAGAGCCTTGTACACAGTAATGGAAACACTATTTACAT
[Equation 11]
AAAGTTTCCAACCGATTTTCT
[Equation 12]
TCTCAAAGTACACATGTTCCGTGGACG

That is, in the present embodiment, as the base sequence encoding the amino acid sequence of the present antibody, with respect to the amino acid sequence set forth in any of SEQ ID NOs: 11 to 16 or the base sequence set forth in any of SEQ ID NOs: 11 to 16. It preferably contains a base sequence having 90% or more homology. As a result, B. From samples such as feces containing bacteria other than longum, more accurately B. longum. It is possible to isolate or concentrate longum.

In the present embodiment, the nucleic acid composition also includes a nucleic acid sequence encoding an antigen-binding molecule according to the present embodiment, or a nucleic acid composition containing a plurality of nucleic acid sequences. The present embodiment also includes the nucleic acid sequence, a vector composition containing a plurality of nucleic acid sequences, or a plurality of vector compositions. Further, in this embodiment, the vector is also included. In this embodiment, the vector means a nucleic acid molecule that carries another linked nucleic acid. One example of a vector is a plasmid. The plasmid is a circular double-stranded DNA formed by ligating another DNA fragment therein. Moreover, as an example of a vector, there is a virus vector. The viral vector can ligate another DNA fragment into the viral genome. Certain vectors can replicate autonomously in the host cell into which they are introduced. As an example, there is also a vector that can be integrated into the genome of a host cell. Vectors that can be integrated into the genome are replicated with the host's genome.

In the present embodiment, the cell means a cell into which an expression vector is introduced. Host cells include bacterial cells, microbial cells, plant cells, or animal cells.

In the present embodiment, the antibody, for example, a method of producing a hybridoma, secondary lymphoid tissue transplantation; can be obtained by (S econdary L ymphoid O rgan T ransplantation SLOT) immunization containing treatment. The SLOT procedure can be performed by the method described in Japanese Patent No. 5996437, paragraphs 0031 to 0058. An example of the method for producing this antibody will be described below.

B. isolated from healthy subjects stored at -80 ° C. From the glycerol stock of the longum1 strain (hereinafter referred to as B. longum Jih1 strain), 20 μl is added to 5 ml of GAM liquid medium and cultured at 37 ° C. for 24 hours using Aneropack (registered trademark) Kenki (manufactured by Mitsubishi Gas Chemical Company, Inc.). .. Next, in an anaerobic chamber BACTRON 300 (manufactured by SHEL LAB), 2 ml of a culture solution is added to each of two 200 ml GAM liquid media, and the cells are further cultured for 24 hours. A total of 400 ml of the culture solution was added to 7500 r. p. Centrifuge at 4 ° C for 15 minutes and remove the supernatant. Wash the pellets by adding sterilized phosphate buffered saline (hereinafter referred to as PBS). Wash the cells 3 times in total. A part of the collected bacterial cells is dried for 24 hours using a VD-800R freeze-dryer (manufactured by TAITEC), and the ratio of the dry weight to the bacterial cell weight is determined. Dilute with sterilized PBS so that the cell / PBS becomes 100 μg / 100 μl, and use it as an antigen below.

Next, immunization is performed using the prepared antigen. Immunity Alum Adjuvant (manufactured by Invitrogen), which is an immunopotentiator, is added to the antigen in an equal amount (hereinafter referred to as an antigen for intraperitoneal administration), and then the mouse is intraperitoneally (ip) administered. At the time of caudal venule administration (iv), only the antigen is additionally administered to the mouse. The antigen for intraperitoneal administration was administered to 5 BALB mice twice a week. p. Administer. Of the five mice, 3 mice in secondary lymphoid tissue transplantation; and (S econdary L ymphoid O rgan T ransplantation SLOT) usually immunized group without the treatment (Conventional immunize group), the spleen was excised from 2 mice rest, Used for SLOT treatment.

The mice subjected to the SLOT treatment were immunized with i. v. After carrying out by the route, the spleen is removed and fused with myeloma cells to prepare a hybridoma. From the obtained hybridomas, those that show a specific reaction to the antigen and have the ability to produce an antibody having low cross-reactivity to other bacteria are selected by flow cytometry.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustration purposes only and do not limit the technical scope of the present invention.

In preparing the monoclonal antibody, which is an example of the present embodiment, first, the antigen B.I. The longum was adjusted.

B. isolated from healthy subjects stored at -80 ° C. From the glycerol stock of the longum Jih strain, 20 μl was added to 5 ml of GAM liquid medium (manufactured by Nissui Pharmaceutical Co., Ltd.) and cultured at 37 ° C. for 24 hours using Aneropack (registered trademark) Kenki (manufactured by Mitsubishi Gas Chemical Company, Inc.). .. Next, 2 ml of each of the culture solutions was added to two 200 ml GAM liquid media in an anaerobic chamber BACTRON 300 (manufactured by SHEL LAB), and the cells were further cultured for 24 hours. A total of 400 ml of the culture solution was added to 7500 r. p. The supernatant was removed by centrifugation at 4 ° C. for 15 minutes. Sterilized PBS was added to the remaining pellets for washing. The cells were washed 3 times in total. A part of the recovered cells was dried for 24 hours using a VD-800R freeze-dryer (manufactured by TAITEC), and the ratio of the dry weight to the cell weight was determined. The cells / PBS were diluted with sterilized PBS so as to be 100 μg / 100 μl, and used as an antigen below.

Next, immunization was performed using the prepared antigen. An equal amount of an immunopotentiator, Immuno Alum Adjuvant (manufactured by Invitrogen) was added to the antigen (hereinafter referred to as adjusted antigen), and then intraperitoneal (ip) administration of mice was performed. When the tail venule (iv) was administered, only the antigen was additionally administered to the mice. The adjusted antigen was applied to 5 BALB mice twice a week i. p. It was administered. Of the five mice, three were in the conventional immune group without SLOT treatment, and the spleens were removed from the remaining two mice and used for SLOT treatment.

The mice subjected to the SLOT treatment were immunized with i. v. After carrying out by the route, the spleen was removed and fused with myeloma cells to prepare a hybridoma.

Next, from the produced hybridomas, those having the ability to produce an antibody showing a specific reaction to the antigen were selected by flow cytometry.

The specificity and cross-reactivity to other bacteria of the selected antibodies produced by some hybridomas were examined. B. isolated from healthy subjects used as the antigen. In addition to the longum Jih1 strain, as another Bifidobacterium genus bacterium, a bacterial species (Fig. 1) purchased from the Japan Collection of Microorganisms (JCM) of the RIKEN BioResource Center was used as the first test bacterial group.

The culture conditions of the first test bacterial group (hereinafter referred to as test culture condition 1) are as follows. To 5 ml of GAM liquid medium (manufactured by Nissui Pharmaceutical Co., Ltd.), 20 μl was added from the glycerol stock of each bacterium, and the cells were cultured in an anaerobic chamber BACTRON 300 (manufactured by SHEL LAB) for 24 hours.

The first test bacterial group was confirmed to be a single bacterium after culturing using the Gram stain method shown below. 5 μl of the above-mentioned bacterial culture solution was applied to a slide glass and fixed by flame. 100 μl of crystal violet was allowed to act on each spot, stained for 1 minute, and then washed with water. Next, 100 μl of iodine was allowed to act, the mixture was stained for 30 seconds, and then washed with water. Iodine solution staining was repeated once more. An ethanol / acetone mixed decolorizing solution was allowed to act in an amount of 100 μl per spot, washed with water and dried. Finally, 100 μl of the Paifel solution was allowed to act, stained for 1 minute, and then washed with water. After drying, it was observed under an optical microscope and an image was acquired using ToupView (manufactured by ToupTek Photonics).

In order to examine the specificity and cross-reactivity, a cell culture supernatant containing an antibody (hereinafter referred to as an antibody-containing supernatant) was prepared. Adding the hybridoma cells 2X10 a flask cell culture medium was included in 50 ml ^6, and one week cultured under 37 ℃ 5% CO ₂ environment. The solution in the flask was transferred to a 50 ml tube and centrifuged at 1000 rpm, 5 min, 4 ° C. The supernatant was filtered through a 0.22 um filter to remove contaminants and collected in 50 ml tubes. _{NaN 3} was added to a final concentration of 0.05%, and the mixture was stored at 4 ° C. until use.

A flow cytometer Accuri C6 plus (manufactured by BD) was used to measure the specificity and cross-reactivity of the antibody in the antibody-containing supernatant. According to the test culture condition 1, the target bacterial species was cultured, and the culture solution was centrifuged at 8000 × g, 5 min, 4 ° C., and the culture supernatant was removed. Then, after washing twice with PBS, the cell pellet was resuspended with PBS. The OD value (optical concentration) was measured with a spectrophotometer Nanodrop (registered trademark) 2000 C (manufactured by Thermo Fisher Scientific), _{and based on 1OD 660} = 8 × 10 ⁸ cells / ml, which is a cell number conversion formula in Escherichia coli. It was diluted with 2% BSA / PBS to 1 × 10 ⁷ cells / tube or 1 × 10 ⁸ cells / tube. After dilution, the mixture was centrifuged at 17,800 × g, 5 min, 4 ° C. to remove the supernatant, and 100 μl of the antibody-containing supernatant was added to the remaining pellets for suspension, and the mixture was allowed to stand at 4 ° C. for 30 minutes. In addition, IgG1 Isotype Control (manufactured by SIGMA), which has no reactivity with the first test bacterial group, was used as a negative control, and was similarly reacted with the first test bacterial group. Then, 1 ml of sterilized PBS was added and washed, and the mixture was centrifuged at 17,800 × g, 5 min, 4 ° C., and the supernatant was removed. After repeating this process twice, 100 μl of the secondary antibody was added, and the mixture was allowed to stand at 4 ° C. for 30 minutes and used for the study. The secondary antibody was obtained by diluting Goat anti-mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor (registered trademark) 488 (manufactured by Thermo Fisher Scientific) with 2% BSA / PBS. Further, immediately before the FACS measurement, 1 μl of Propidium iodide (PI: manufactured by Invitrogen) was added to distinguish it from dead bacteria. The acquired FCS version 3.0 file was analyzed by FlowJo (FlowJo LLC).

FIG. 2 shows the results of the FACS using a hybridoma culture supernatant named Jih1 (hereinafter referred to as Jih1 culture supernatant) as an antibody-containing supernatant. The results show that the antibody contained in the Jih1 culture supernatant (hereinafter referred to as Jih1 antibody) is described in B.I. It was shown that it binds to longum but not to other Bifidobacterium genus shown in FIG.

Next, in order to examine the cross-reactivity with Gram-positive and Gram-negative bacteria other than the genus Bifidobacterium, the bacterial species purchased from JCM (shown in FIG. 3, hereinafter referred to as the second test bacterial group) and the Jih1 culture supernatant. The reactivity of was examined. The culture conditions of each bacterium were the same as those described in the test culture condition 1, the culture supernatant was the same as that described in paragraph 0044, and the FACS method used was that described in paragraph 0045.

FIG. 4 shows the results of FACS in which the Jih1 culture supernatant was reacted with the second test bacterial group. The results showed that the Jih1 culture supernatant did not react with the second test bacterial group. As a result, the Jih1 antibody becomes B.I. It proved to be an antibody with high specificity for longum and low cross-reactivity to other bacteria.

Next, in order to show the usefulness of the Jih1 antibody, B.I. From the pseudo-intestinal flora, which is a mixture of longum and a total of 6 types of gut microbiota reference strains shown in FIG. 5, using Magnetic-active cell sorting (MACS, registered trademark), B. longum. It was examined whether longum could be isolated and concentrated.

A flow cytometer Accuri C6 plus (manufactured by BD) was used to measure the specificity and cross-reactivity of the antibody in the antibody-containing supernatant. According to the test culture condition 1, the target strain of the intestinal bacterium was cultured, and the culture solution was centrifuged at 8000 × g, 5 min, 4 ° C., and the culture supernatant was removed. Then, after washing twice with PBS, the cell pellet was resuspended with PBS. The OD value (optical concentration) was measured with a spectrophotometer Nanodrop (registered trademark) 2000 C (manufactured by Thermo Fisher Scientific), _{and based on 1OD 660} = 8 × 10 ⁸ cells / ml, which is a cell number conversion formula in Escherichia coli. It was diluted with 2% BSA / PBS to 1 × 10 ⁷ cells / tube. After dilution, the mixture was centrifuged at 17,800 × g, 5 min, 4 ° C. to remove the supernatant, and 100 μl of the antibody-containing supernatant was added to the remaining pellets for suspension, and the mixture was allowed to stand at 4 ° C. for 30 minutes. In addition, IgG1 Isotype Control (manufactured by SIGMA), which has no reactivity with the gut microbiota reference strain, was used as a negative control and was similarly reacted with the gut microbiota reference strain. Then, 1 ml of sterilized PBS was added and washed, and the mixture was centrifuged at 17,800 × g, 5 minutes at 4 ° C., and the supernatant was removed. After repeating this process three times, 100 μl of the secondary antibody was added, and the mixture was allowed to stand at 4 ° C. for 30 minutes and used for the study. As the secondary antibody used for MACS (registered trademark), an Anti-mouse IgG PE-labeled antibody (manufactured by abcam) diluted 2000-fold with 2% BSA / PBS was used. After washing in the same manner as in the primary antibody washing, 400 μl of 2% BSA / PBS was added, and the mixture was stored at 4 ° C. until measurement. The acquired FCS file was analyzed with the analysis software FlowJo version 10.5.3.

Anti-PE-labeled MACS® beads (manufactured by Miltenyi Biotec) diluted 20-fold with 1% BSA / PBS were added to the culture medium in an amount of 200 μl each and reacted at 15 min and 4 ° C. 1 ml of sterilized PBS was added and suspended, and 14000 r. p. m. The supernatant was removed by centrifugation at 5 minutes and 4 ° C. After performing this washing step a total of 3 times, the mixture was suspended in 500 μl of 0.5% BSA / PBS (containing 2 mM EDTA) solution. The suspension was separated using a MACS® midi volume (manufactured by Miltenyi Biotec) and separated into a target fraction (Elution) to which magnetic beads were bound and another fraction (Flow Through). These separated solutions were centrifuged at 8,000 xg, 15 min, 4 ° C. and suspended in 400 μl of 2% BSA / PBS. Using Accuri C6 plus (manufactured by BD), the reactivity of various bacterial suspensions, Flow Through and Elution, with the Jih1 culture supernatant before and after separation by MACS® was analyzed. The acquired FCS file was analyzed with the analysis software FlowJo version 10.5.3. In addition, a part of Flow Through and Elution is 14000r. p. m. Bacterial pellets were collected at 10 min and 4 ° C and stored at −80 ° C until use.

FIG. 6 shows the examination results of MACS (registered trademark). It was found that there was a difference between the Flow Through that flowed out without reacting with the Jih1 antibody and the Elution that flowed out from the antibody after reacting with the Jih1 antibody.

Next, the types of bacterial cells contained in Flow Through and Elution were confirmed using RT (Real Time) -PCR.

In paragraph 0051, 400 μl of TE10 was added and dissolved in the cells of Flow Through and Elution stored at −80 ° C., and 20 μl of Lysozyme (300 mg / ml) (manufactured by WAKO) was added thereto. The sample was reacted at 37 ° C. for 8 hours while rotating. Then, 12 μl of purified Achromopeptidase (registered trademark) (20000 units / ml) (manufactured by WAKO) was added to the sample, mixed, and further reacted at 37 ° C. for 8 hours while rotating. Then, 50 μl of 10% SDS (pH 7.2) is added and mixed, and then 12 μl of Proteinase K (25 mg / ml) (manufactured by MERCK) is added, and 1 at 55 ° C. using a heat block (manufactured by Waken). Incubated evening. Further, 500 μl of Phenol / Chloroform / Isoamyl alcohol (25: 24: 1) was added, and the mixture was stirred at a maximum speed of 3 min using a Micro Mixer (manufactured by TAITEC), and then centrifuged at 17,800 × g, 10 min, 20 ° C. It was separated and the supernatant was collected. To the supernatant, 500 μl of Phenol / Chloroform / Isoamyl alcohol was added again, and the supernatant was collected after stirring and centrifuging in the same manner. 40 μl of 3M Sodium Acatete was added to the collected supernatant, mixed, 1 ml of chilled 100% Ethanol was added, and the mixture was stirred with vortex and allowed to stand at −80 ° C. for 1 hour. Then, the mixture was centrifuged at 17,800 × g, 10 min, 4 ° C., the supernatant was discarded, 500 μl of 70% ethanol was added, and the mixture was inverted and mixed. Centrifugation at 17,800 xg, 10 min, 4 ° C. was performed, the supernatant was discarded, and the water content in the tube was evaporated with a centrifugal evaporator. The remaining precipitate is the produced nucleic acid. To the precipitate, 100 μl of TE10 was added, and after stirring for 1 min at the maximum speed using a Micro Mixer, 80 μl was transferred to another tube, 1 μl of RNaseA (10 mg / ml) was added, and 37 Incubated overnight at ° C.

Using the obtained nucleic acid, the DNA concentration was measured using Nanodrop, the sample concentration was diluted to 100 ng using Pure Water (manufactured by Wako), and stored at −30 ° C. Based on the measured DNA concentration, the DNA diluted to 100 ng was diluted 10-fold with Pure Water. RT-PCR was performed using diluted DNA as a template and SYBR® Premix Ex Taq2 (manufactured by TakaRa). The PCR conditions were initial denaturation 95 ° C., 30 sec → (96 ° C., 30 sec, 55 ° C., 45 sec, 72 ° C., 1 min) × 40 cycles. The primers used are shown in FIG. The analysis method was based on the gene expression level amplified by 16S rRNA sequence-specific primers (Fig. 7) targeting Eubacterium. The gene expression levels amplified by the longum-specific primer (Fig. 7) and the Bacteroides genus-specific primer (Fig. 7) were analyzed by the comparative Ct method.

FIG. 8 shows the results of RT-PCR. B. Results using longum-specific primers show that B. longum-specific primers were used during Elution. It proved to contain longum. As a result, using the Jih1 antibody, B.I. It was found that longum can be specifically isolated and concentrated.

Furthermore, isolated and concentrated B.I. It was examined whether longum could be cultivated.

The culture solution before MACS separation and each solution of Flow Through and Elution after separation were centrifuged at 17,800 × g, 5 min, and 4 ° C., and suspended in 400 μl with 2% BSA / PBS. 50 μl of the suspended solution was sprinkled on an agar medium using a sterilized spreader and cultured. After culturing for 24 hours, the colonies formed on the plate were photographed.

B. isolated and concentrated in FIG. The result of the culture test of longum is shown. Colonies were formed in the culture medium before MACS separation. In addition, from the results of the RT-PCR, B. Colony formation was also observed in Elution where longum was isolated, but from the results of the RT-PCR, B. longum was observed. No colony formation was observed in Flow Through, in which longum was not isolated.

The maintenance of hybridomas producing Jih1 antibody was performed as follows. Frozen vial tubes containing hybridomas were rapidly thawed at 37 ° C. Add 10 ml of cell culture medium (RPMI / 10% FCS / 1% sodium pyruvate solution / 1X penicillin-streptomycin-glutamine solution (manufactured by GIBCO)) to 1 ml of hybridoma cell solution, and centrifuge at 1000 rpm, 5 min, 4 ° C. separated. The supernatant was removed, resuspended in 1 ml of medium, transferred to a culture flask containing 14 ml of medium, and cultured in a _{CO 2 environment at 37 ° C. and 5%.} Immediately before reaching saturation, passage was continued to multiply the extracellular fluid by a factor of 10.

Furthermore, for sequence analysis, Jih1 antibody-producing hybridoma cells were prepared as follows. The cultured hybridoma was collected and centrifuged at 1000 rpm, 5 min, and 4 ° C. The supernatant was removed and the cells were resuspended in 10 ml sterile PBS. Centrifugation was performed at 1000 rpm, 5 min, and 4 ° C., sterile PBS was added, and the number of cells was counted using a hemocytometer. The cells were adjusted to 2 x 10 ⁷ / ml, 100 μl of cell solution was dispensed into a new tube, 900 μl of RNA later was added and suspended, and the sample was incubated overnight at 4 ° C. and the sample was used for DNA sequence analysis. There was.

As shown above, the obtained antibody was obtained from B.I. It has high specificity for longum, and B. longum. Longum can be specifically purified. Therefore, this antibody is based on B.I. From samples such as feces containing bacteria other than longum, more accurately B. longum. Since longum can be isolated and further concentrated, it can contribute to the fields of medicine, health care and the like. As described above, according to the present embodiment, B. cerevisiae, which is one of the intestinal bacteria constituting the intestinal flora. Using an antigen-binding molecule having high specificity for longum and the antigen-binding molecule, B. longum is used. From a bacterial population containing longum, target B. longum. Only longum can be efficiently isolated and concentrated.

The above-described embodiments are merely examples for facilitating the understanding of the present invention, and are not intended to limit the interpretation of the present invention. It goes without saying that the present invention can be modified and improved without departing from the spirit thereof, and the present invention includes an equivalent thereof.

Claims (10)

An antigen-binding molecule characterized by binding to Bifidobacterium longum. Do not bind to other Bifidobacterium genera,
The antigen-binding molecule according to claim 1. The other genus Bifidobacterium is Bifidobacterium pseudobacterium, Bifidobacterium influenza, Bifidobacterium breve, Bifidobacterium pseudobacterium, Bifidobacterium, Bifidobacterium.
2. The antigen-binding molecule according to claim 2. The antigen-binding molecule is an antibody, antibody fragment or peptide.
As the amino acid sequence, the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8 or the amino acid sequence having 90% or more homology with the amino acid sequence set forth in any of SEQ ID NOs: 3 to 8.
The antigen-binding molecule according to any one of claims 1 to 3, wherein the antigen-binding molecule comprises. The antigen-binding molecule is an antibody or antibody fragment.
An amino acid sequence having 90% or more homology with the amino acid set forth in any of SEQ ID NOs: 3 to 5 or the amino acid sequence set forth in any of SEQ ID NOs: 3 to 5 as a heavy chain amino acid sequence.
An amino acid sequence having 90% or more homology with the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 or the amino acid sequence set forth in any of SEQ ID NOs: 6 to 8 as the amino acid sequence of the light chain.
The antigen-binding molecule according to claim 4, wherein the antigen-binding molecule comprises. A VHCDR1 region containing an amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 3.
A VHCDR2 region containing an amino acid sequence of SEQ ID NO: 4 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence of SEQ ID NO: 4.
A VHCDR3 region containing an amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 5.
A VLCDR1 region containing an amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 6.
A VLCDR2 region containing an amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having 90% or more homology with respect to the amino acid sequence set forth in SEQ ID NO: 7.
A VLCDR3 region containing an amino acid sequence of SEQ ID NO: 8 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 8.
The antigen-binding molecule according to claim 5, wherein the antigen-binding molecule comprises. A nucleic acid composition comprising a nucleic acid sequence encoding the antigen-binding molecule according to any one of claims 1 to 6, or a plurality of nucleic acid sequences. The nucleic acid sequence according to claim 7, or a vector composition containing a plurality of nucleic acid sequences, or a vector composition comprising a plurality of vectors. A cell comprising the vector composition according to claim 8. A method for purifying Bifidobacterium longum, which isolates Bifidobacterium longum from a sample containing Bifidobacterium longum using the antigen-binding molecule according to any one of claims 1 to 6.

Images