JP2021027842A - CONSTRUCTION OF ONCOLYTIC HERPES SIMPLEX VIRUS (oHSV) OBLIGATE VECTOR AND CONSTRUCTS THEREOF FOR USE IN CANCER THERAPY - Google Patents

Abstract

To provide a safe but more effective oHSV for clinical use with immunotherapeutic agents.SOLUTION: The present invention provides an obligate oHSV vector comprising modified viral DNA genome, and further provides a recombinant oHSV-1 construct comprising the obligate oHSV vector and a foreign nucleic acid sequence encoding an immunostimulatory and/or immunotherapeutic agent. Compositions comprising the recombinant oHSV-1 construct can be used for treating cancers.SELECTED DRAWING: Figure 1

Description

The present invention relates to the treatment of cancer with an oncolytic herpes simplex virus (oHSV), more specifically, an obligate HSV vector that carries and expresses a plurality of genes encoding an immunostimulatory agent and / or an immunotherapeutic agent. Further, it relates to a genome newly designed as a vector that carries and expresses various therapeutic genes for treating cancer.

Treatment with oncolytic herpes simplex virus (oHSV) has many advantages over conventional cancer treatment methods (see Non-Patent Document 1), and research on solid tumor treatment using oncolytic herpes simplex virus is now underway. It is actively done. Specifically, since oHSV generally contains mutations, it is easily suppressed by innate immunity, and in cancer cells, one or many innate immune responses to infection are disrupted, as in normal cells. Due to the complete immune response, it cannot replicate in normal cells and can replicate in cancer cells. In general, oHSV is transported directly to the tumor entity and replicates within the tumor entity. In addition, since the virus is transported to the target tissue rather than systemically administered, the use of such an anticancer drug does not cause any side effects. Since the virus has the property of inducing an adaptive immune response, it cannot be used in the case of repeated administration, but repeated administration of oHSV to a tumor causes its efficacy to be lost or induces adverse events such as an inflammatory reaction. That is not admitted. HSV is a large DNA virus that can regulate gene expression when foreign DNA is integrated into its genome and administered to a tumor. Genes that act to induce an adaptive immune response against tumors are suitable as foreign genes for use with oHSV.

Defects in overcoming the innate immune response of cells determine the extent to which the virus lyses when used as an anticancer agent. The more sequences that are deleted, the narrower the range of cancer cells that can be treated, and the effectiveness of oHSV is determined by the function of the deleted viral gene. Recently, in order to realize the anticancer effect of oHSV, it is common to add at least one gene of a cell (see Non-Patent Document 2).

For the convenience of research, the structure of oHSV (referred to as the backbone) and foreign genes suitable for insertion will be examined individually. As can be seen from the above, the backbone structure defines the range of cancers that are susceptible to infection, and the foreign gene treats the cancer cells as legitimate targets in the adaptive immune response.

The HSV-1 genome consists of two covalently linked components, L and S. Each component is a unique sequence (L component U _L, S component U _S) consists, on both sides of the unique sequence is inverted repeat sequences. The reverse repeats of the L component are called ab and b'a', and the reverse repeats of the S component are called a'c' and ca. The reverse repeats b'a'and a'c' constitute an internal reverse repeat region. The reverse repeat regions of the L and S components contain two copies of five genes and a large amount of DNA that is transcribed but does not encode a protein, and these five genes are proteins ICP0, ICP4, ICP34.5, ORF, respectively. Code P and OFRO.

Currently, viruses tested in cancer patients are broadly divided into three types. Type 1 is designed based on the finding that deletion of the ICP34.5 gene alleviates the virulence of the virus (see Non-Patent Document 3). To ensure safety when used in the treatment of malignant glioma, by further mutation in the gene encoding the viral ribonucleotide reductase in G207 (the first virus tested in a patient) Attenuate (see Non-Patent Document 4). On the other hand, G207, which contains a mutation in ICP34.5 and a mutation in the ribonucleotide reductase gene, is so weakly toxic that replication is completely arrested (non-) in cancer cells expressing wild-type protein kinase R. See Patent Document 5).

Type 2 partially compensates for the adverse consequences of the ICP34.5 deletion and restores the ability to grow in cells expressing wild-type protein kinase R when the Us11 viral protein is expressed early in infection. It is designed based on the fact that it does (see Non-Patent Document 6). The design of the backbone of such a virus is consistent with the results published by Cassday (see Non-Patent Document 7) with the Us12 gene and Us11 promoters removed. As a result, Us11 is expressed as the earliest gene rather than the late gene.

The backbone of the Type 3 virus was first called R7020, but later renamed NV1020. It is modified and formed by spontaneous spontaneous mutation, and was first tested as a live attenuated vaccine (see Non-Patent Document 8). By the mutation, internal inverted repeat region ( 'a A'C'B'A consists, genes ICP0, ICP4, ICP34.5, encoding one copy of ORF P and ORF O) and the _U L 56 gene encoding U _L 24 are deleted. It also contains genes encoding multiple HSV-2 glycoproteins because it has a bacterial sequence and was originally manufactured for vaccine use. A large number of tests were performed on R7020 in patients with liver transfer of colon cancer. In addition, it was also tested in a head and neck squamous cell carcinoma model, a prostate cancer xenograft nude mouse model, and a gallbladder tumor model (see Non-Patent Document 9).

Successful treatment with oHSV depends on the degree of destruction of the cancer cells. At the beginning of developing treatments with oHSV, it was found that HSV alone could not kill all cancer cells in solid tumors, and that oHSV was unlikely to effectively kill all cancer cells, clinically. Studies have shown that tumor destruction by oHSV requires an adaptive immune response against the tumor. Further studies have also suggested that the antitumor immune response caused by the debris of infected tumor cells is enhanced by the introduction of cytokines, which are oHSV without cytokine genes and immunostimulatory cytokines. This was supported by the results of comparing the oHSVs introduced with (see Non-Patent Document 10). As a result, GM-CSF was introduced into oHSV to treat malignant melanoma (see Non-Patent Document 11).

The safety of oHSV is determined by the deletion status of one or more genes of the virus that inactivates the ability of the host to block the innate immune response to infection. Analysis of the previously published data revealed that previous clinical trials using oHSV, without exception, were over-attenuated and could be improved (see Non-Patent Document 12).

The introduction of genes encoding immunostimulatory cytokines can promote the immune response to tumors, but does not show the effective promotion of T cell-induced cytotoxicity, which is particularly important for antitumor activity. Tumors silence the immune system by the PD-1 and CTLA-4 inhibitory pathways. PD-1 is expressed on activated T cells and other hematopoietic cells, and CTLA-4 is expressed on activated T cells, including regulatory T cells (see Non-Patent Document 13). Tumors also evade host immune responses through the PD-1 and CTLA-4 inhibitory pathways. To maximize antitumor response, neutralize PD-1 with PD-1 antibody and, in some cases, activate cytotoxic T cells by neutralizing CTLA4 present on the surface of T cells. It is necessary (see Non-Patent Document 14). Systemic administration of a single-chain antibody of PD-1 or CTLA4 can effectively promote the therapeutic effect of oHSV, but it cannot be repeatedly administered over a long period of time due to the constant side effects.

Markert et al., 2000; Russell et al., 2012; Shen and Nemunaitis, 2006 Cheema et al., 2013; Goshima et al., 2014; Markert et al., 2012; Walker et al., 2011 Andreansky et al., 1997; Chou et al., 1995; Chou et al., 1990; Chou and Roizman, 1992 Mineta et al., 1995 Smith et al., 2006 Cassady et al., 1998a Cassady et al., 1998b Meignier et al., 1988; Weichselbaum et al., 2012 Cozzi et al., 2002; Cozzi et al., 2001; Currier et al., 2005; Fong et al., 2009; Geevarghese et al., 2010; Kelly et al., 2008; Kemeny et al., 2006; Wong et al., 2001 Andreanski et al. Andtbacka et al., 2015 Miest and Cattaneo, 2014 Fife and Pauken, 2011; Francisco et al., 2010; Keir et al., 2008; Krummel and Allison, 1995; Walunas et al., 1994 Topalian et al., 2015

Therefore, in clinical practice, it is required to develop a safer and more effective oHSV to be used together with an immunotherapeutic agent.

One aspect of the present invention relates to modified herpes simplex type I (hereinafter, also referred to as HSV-1, obligate vector, vector, HSV-1 virus) containing a modified HSV-1 genome. Modifications by deleting sequences between the promoter of U _L 56 gene in wild-type HSV-1 genome promoter of U _{S 1,} there is no single copy in (i) all 2 copy gene, Moreover, (ii) includes those in which the sequence required to express all open reading frames (ORFs) present in the deleted viral DNA is complete.

Another aspect of the invention is the sequence (i) required to express an open reading frame (ORF) of all single copies in the viral genome and one of each of all two copy genes in the viral genome. It relates to a tumor soluble herpes simplex type I (HSV-1) construct containing a copy (ii) and one copy (iii) of duplicated DNA encoding a non-coding RNA.

Another aspect of the present invention, by deleting the sequence between the promoter of U _L 56 gene in wild-type HSV-1 genome promoter of U _{S 1} gene, 1 in (i) all 2 copy gene Modified HSV- including that one copy is deleted and (ii) the sequence required to express all open reading frames (ORFs) present in the deleted viral DNA is complete. It comprises one genome (a) and at least a foreign nucleic acid sequence (b) that is stably introduced into the deleted region of the modified HSV-1 genome and encodes an immunostimulatory agent and / or an immunotherapeutic agent. It relates to a recombinant tumor-soluble simple herpes type I (HSV-1).

Another aspect of the present invention, all of the open reading frame (i.e. U _S 12 from U _{L 1} from U _L 56 and U _{S 1)} located and end of the genome includes one copy of the 'a' sequence With respect to the viral vector containing, said viral vector is an obligate vector, i.e., it cannot replicate itself in susceptible Vero cells. The vector can be replicated by inserting a DNA containing the coding sequence or non-coding sequence (a) of cellular DNA or the viral DNA (b) containing the non-coding sequence. The total DNA length allowed for the obligate vector may be at least 15 KB, or may reach 22 KB.

Another aspect of the invention relates to a pharmaceutical composition comprising an effective amount of a recombinant oncolytic HSV-1 according to the invention and a pharmaceutically acceptable carrier, wherein the composition is for intratumoral administration. It may be manufactured.

Another aspect of the invention relates to a method of treating cancer comprising administering an effective amount of the recombinant oncolytic HSV-1 according to the invention, or the pharmaceutical composition, to a subject in need of treatment. The present invention further relates to the application of the recombinant oncolytic HSV-1 in a method of treating cancer.

Another aspect of the present invention relates to the application of the recombinant oncolytic HSV-1 or pharmaceutical composition in the production of anticancer agents.

Aspects of the present invention also include:
[1] A modified herpes simplex virus type I (HSV-1).
By deleting the sequence between the promoter of U _L 56 gene promoter U _{S 1} gene in wild-type HSV-1 genome, there is no single copy in (i) all 2 copy gene, Note and (Ii) Contains a modified HSV-1 genome containing the complete sequence required to express all open reading frames (ORFs) present in the deleted viral DNA, a cellular gene or A modified herpes simplex virus type I (HSV-1) characterized by its ability to act as a vector of viral genes.
[2] The two-copy gene is characterized by containing a gene encoding ICP0, ICP4, ICP34.5, ORF P and ORFO and an overlapping non-coding sequence occupying a deleted region [1]. Modified HSV-1.
[3] The modified HSV-1 according to the above [1], wherein the HSV-1 comprises a prototype (P) genomic isomer.
[4] The modified HSV-1 according to the above [1], wherein the HSV-1 is selected from all existing HSV virus strains including F virus strain, KOS virus strain and 17 virus strain.
[5] The modified HSV-1 according to [3] above, wherein the deletion removes nucleotide positions 117005 to 132906 in the F virus strain genome.
[6] Recombinant oncolytic herpes simplex virus type I (HSV-1).
By deleting the sequence between the promoter of U _L 56 gene promoter U _{S 1} gene in wild-type HSV-1 genome, there is no single copy in (i) all 2 copy gene, Note and (Ii) A modified HSV-1 genome comprising the complete sequence required to express all open reading frames (ORFs) present in the deleted viral DNA.
Recombinant oncolytic virus that is stably introduced into the deleted region of the modified HSV-1 genome and contains at least a foreign nucleic acid sequence encoding an immunostimulatory agent and / or an immunotherapeutic agent. Herpes simplex virus type I (HSV-1).
[7] The recombinant oncolytic HSV-1 of the above [6], wherein the immunostimulant is selected from GM-CSF, IL 2, IL 5, IL 12, IL 15, IL 24 and IL 27. ..
[8] The recombinant oncolytic HSV-1 according to the above [6], wherein the immunotherapeutic agent is selected from an anti-PD-1 agent and an anti-CTLA-4 agent.
[9] The recombinant oncolytic HSV-1 according to [6] above, which comprises a foreign nucleic acid sequence encoding IL-12.
[10] The recombinant oncolytic HSV-1 according to the above [6], which comprises a foreign nucleic acid sequence encoding an anti-PD-1 agent.
[11] The recombinant oncolytic HSV-1 according to the above [6], which comprises a foreign nucleic acid sequence encoding an anti-CTLA-4 agent.
[12] The recombinant oncolytic HSV-1 according to the above [6], which comprises a first foreign nucleic acid sequence encoding IL-12 and a second foreign nucleic acid sequence encoding an anti-PD-1 agent.
[13] The recombinant oncolytic HSV-1 according to the above [6], which comprises a first foreign nucleic acid sequence encoding IL-12 and a second foreign nucleic acid sequence encoding an anti-CTLA-4 agent.
[14] The recombinant oncolytic HSV- of the above [6], which comprises a first foreign nucleic acid sequence encoding an anti-PD-1 agent and a second foreign nucleic acid sequence encoding an anti-CTLA-4 agent. 1.
[15] It is characterized by containing a first foreign nucleic acid sequence encoding IL-12, a second foreign nucleic acid sequence encoding an anti-PD-1 agent, and a third foreign nucleic acid sequence encoding an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 according to the above [6].
[16] The recombinant oncolytic HSV-1 according to [6] above, which further comprises a promoter sequence operably linked to the foreign nucleic acid sequence.
[17] The first foreign nucleic acid sequence is inserted into the deleted region of the modified HSV-1 genome, and the second foreign nucleic acid sequence is U in the modified HSV-1 genome. The recombinant tumor-soluble HSV-1 according to the above [12], which is inserted between the _UL 3 and _{UL 4 genes of the L} component.
[18] The first foreign nucleic acid sequence is inserted into the deleted region of the modified HSV-1 genome, and the second foreign nucleic acid sequence is U in the modified HSV-1 genome. The recombinant tumor-soluble HSV-1 according to the above [13], which is inserted between the _UL 3 and _{UL 4 genes of the L} component.
[19] The first foreign nucleic acid sequence is inserted into the deleted region of the modified HSV-1 genome, and the second foreign nucleic acid sequence is U in the modified HSV-1 genome. The recombinant tumor-soluble HSV-1 according to the above [14], which is inserted between the _UL 3 and _{UL 4 genes of the L} component.
[20] U in the first exogenous nucleic acid sequence has been inserted into the deleted region of the HSV-1 genome which is the modified, HSV-1 genome and the second foreign nucleic acid sequence is the modified _L It _{is inserted between the UL} 3 and _UL 4 genes of the components, and the third foreign nucleic acid sequence is _{between the UL} 37 and _UL 38 genes of the _UL components in the modified HSV-1 genome. The recombinant tumor-soluble HSV-1 according to the above [15], which is characterized by being inserted.
[21] the first foreign nucleic acid sequence has been inserted into the deleted region of the HSV-1 genome which is the modified, U _L in HSV-1 genome and the second foreign nucleic acid sequence is the modified It _{is inserted between the components UL} 37 and _UL 38, and the third foreign nucleic acid sequence is _{inserted between the UL} 3 and _UL 4 genes of the _UL component in the modified HSV-1 genome. The recombinant tumor-soluble HSV-1 according to the above [15], which is characterized by the above.
[22] The recombinant oncolytic HSV-1 of the above [16], wherein the promoter sequence is a CMV promoter or an Egr promoter.
[23] The recombinant oncolytic HSV-1 according to [6] above, wherein the immunostimulant and / or immunotherapeutic agent is humanized.
[24] The recombination of [8] above, wherein the anti-PD-1 agent or the anti-CTLA-4 agent contains an antibody variable region for specifically binding to a PD-1 or CTLA-4 epitope, respectively. Oncolytic HSV-1.
[25] The recombinant oncolytic HSV-1 according to [24] above, wherein the antibody variable region is a complete antibody, an antibody fragment, or a recombinant derivative of the antibody or antibody fragment.
[26] A pharmaceutical composition.
A pharmaceutical composition comprising an effective amount of the recombinant oncolytic HSV-1 according to any one of the above [6] to [25] and a pharmaceutically acceptable carrier.
[27] The pharmaceutical composition according to the above [26], wherein the composition is prepared for intratumoral administration.
[28] A method for treating or ameliorating cancer.
A method for treating or ameliorating a cancer, which comprises administering an effective amount of the pharmaceutical composition according to the above [26] or [27] to a subject in need of treatment.
[29] The method according to [28] above, wherein the second therapy is performed before, during, and after administration of the pharmaceutical composition.
[30] The method of [29] above, wherein the second therapy is selected from chemotherapy, radiotherapy, immunotherapy or surgical intervention.
[31] The method of the above [28], wherein the subject is a human.
[32] The method according to the above [28], wherein the cancer is selected from esophageal cancer, lung cancer, prostate cancer and bladder cancer.

The above aspects and advantages of the present invention, as well as other aspects and advantages, will become apparent from the following detailed description of the drawings.

It is a schematic diagram of HSV-1 virus. Of these, HSV-1 is the genomic structure of wild-type HSV-1 and exhibits an internal reverse repeat region b'a'-a'c'between bp117005 and bp132096. IMMV201 is the genomic structure of oHSV-1 and is also called an obligate vector. IMMV202 is an oHSV-1 that expresses mouse IL12. IMMV203 is an oHSV-1 that expresses IL12. IMMV303 is an oHSV-1 that expresses human CTLA-4 scFv. IMMV403 is an oHSV-1 that expresses human PD-1 scFv. FIG. 6 is a schematic diagram of an oncolytic HSV-1 virus based on an obligate vector expressing an immunostimulant and / or an immunotherapeutic agent. Of these, IMMV502 is an oHSV-1 that expresses human anti-PD-1 scFv and mouse IL12. IMMV504 is an oHSV-1 that expresses mouse anti-CTLA-4 scFv and mouse IL12. IMMV503 is an oHSV-1 that expresses human anti-PD-1 scFv and human IL12. IMMV505 is an oHSV-1 that expresses human anti-CTLA-4 scFv and human IL12. IMMV507 is an oHSV-1 that expresses human anti-CTLA-4 scFv and human anti-PD-1 scFv. IMMV603 is an oHSV-1 that expresses human anti-CTLA-4 scFv, human anti-PD-1 scFv and human IL 12. The expression status of anti-PD-1 scFv from the construct whose secretion is tested is shown. The His-tag scFv-anti-PD-1 is driven by the CMV promoter and expressed with signal peptide coding regions from different natural resources. The cell lysate and supernatant are collected, subjected to SDS-PAGE and Western blotting with anti-His antibody. Lane 1 corresponds to the GM-CSF signal peptide, lane 2 corresponds to the gausal cipherase signal peptide, lane 3 corresponds to the Hidden Markov Model 38 (HMM38) signal peptide, and lane 4 corresponds to the antibody V gene. Corresponds to the signal peptide. The results of the scFv-anti-PD-1 affinity assay targeting PD-1 are shown. An ELISA assay for His-tag scFv-anti-PD-1 and HMM38 signal peptides driven by the CMV promoter. The supernatant is collected and subjected to an ELISA assay and detected with an anti-His antibody. The results of the in vitro cell survival assay are shown. Of these, (FIG. 5a) is the result of human bladder cancer cells T24. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5b) is the result of human esophageal cancer cell ECA109. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5c) is the result of human nasopharyngeal cancer cell CNE1. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5d) is the result of human colon cancer cell HCT116. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5e) is the result of human laryngeal cancer cell Hep2. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5f) is the result of human breast cancer cell MD-MB-231. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5g) is the result of human adenocarcinoma cell Hela. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5h) is the result of human lung cancer epithelial cell A549. The results of the in vitro cell survival assay are shown. Of these, (Fig. 5i) is the result of human non-small cell lung cancer cell H460.

Related Definitions The term "one" or "one" entity herein refers to one or more of the entities. For example, "recombinant oncolytic HSV-1" is understood to represent one or more recombinant oncolytic HSV-1 viruses. Thus, terms such as "one,""one or more," and "at least one" can be used interchangeably herein.

Terms such as "homology," "identity," or "similarity" refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology may be determined by comparing the matching positions in each sequence. If the same base or amino acid occupies a position in the sequence to be compared, the molecule is considered to be homologous at that position. The degree of homology between sequences is related to the number of matching or homologous positions shared between the sequences. "Unrelated" or "non-homologous" sequences refer to those that are less than 40% identical to one sequence herein, preferably less than 25%.

Specific percentages (eg 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) between one polynucleotide or polynucleotide region and another sequence. ) Has "sequence identity" refers to those having the same percentage base (or amino acid) when comparing two sequences at the time of matching. The matching and percentage homology or sequence identity may be determined by software known to those of skill in the art.

As used herein, the term "antibody" or "antigen-binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds to one or more antigens. Of these, the antibody may be a complete antibody, any antigen-binding fragment thereof, or a single strand thereof. Thus, the term "antibody" includes at least some proteins or peptides of any immunoglobulin molecule that has bioactivity to bind an antigen. For example, heavy or light chain complementarity determining regions (CDRs), or ligand binding sites thereof, heavy or light chain variable regions, heavy or light chain constant regions, framework (FR) regions or any site thereof. , Or at least some of the binding proteins, but not limited to these. The term "antibody" also includes polypeptides or polypeptide complexes that have the ability to bind antigen when activated.

As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to a portion of an antibody, such as F (ab') ₂ , F (ab) ₂ , Fab', Fab, Fv, scFv, and the like. Regardless of structure, the antibody fragment binds to the same antigen recognized by the complete antibody. The term "antibody fragment" includes aptamers, enantiomers and bispecific antibodies, any synthesis or synthesis that acts similar to an antibody by binding to a particular antigen to form a complex. It also contains genetically modified proteins.

The antibodies, antigen-binding polypeptides or variants or derivatives thereof herein include polychronal antibodies, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, primated antibodies and chimeric antibodies, single-stranded antibodies. , Epitope-binding fragments (eg Fab, Fab'and F (ab') ₂ ), Fd, Fv, single-stranded Fv (scFv), single-stranded antibody, Fv (sdFv) linked by disulfide bond, VK or VH Contains, but is not limited to, domain-containing fragments, fragments produced by Fab expression libraries, and anti-idiotype (anti-Id) antibodies. The term "immunoglobulin" or "antibody molecule" herein refers to any type of immunoglobulin molecule (eg IgG, IgE, IgM, IgD, IgA and IgY), or any subclass (eg IgG1, IgG2, IgG3, IgG4). , IgA1 and IgA2).

The term "specific binding" or "having specificity" generally means that an antibody is bound to an epitope by its antigen binding domain, and a certain degree of complementarity is required between the antigen binding domain and the epitope in the binding. Point to that. By this definition, an antibody is "specifically bound" to an epitope if it is easier to bind to the epitope by its antigen binding domain than to optionally bind to an unrelated epitope. it is conceivable that. The term "specificity" as used herein is used to quantitatively describe the relative affinity of an antibody when it binds to an epitope. For example, antibody "A" may be considered to have higher specificity for a given epitope than antibody "B", or for antibody "A" it is more specific than bound to related epitope "D". It may be described that it binds to the epitope "C".

As used interchangeably herein, the terms "cancer" and "tumor" refer to a series of diseases that are treatable according to the contents of this specification and involve abnormal cell growth, invading or spreading into the body. there is a possibility. Not all tumors are carcinogenic, of which benign tumors do not spread to other parts of the body. Possible symptoms / findings include new masses, abnormal bleeding, delayed or chronic cough, unexplained weight loss and changes in bowel habits. So far, more than 100 types of cancers that can occur in humans have been confirmed. The contents of the present specification are preferably applied to the treatment of solid tumors. Non-limiting examples of tumors and cancers include bile sac cancer, basal cell cancer, bile duct cancer, colon cancer, endometrial cancer, esophageal cancer, Ewing sarcoma, prostate cancer, gastric cancer, glioma, hepatocellular carcinoma, hodgkin lymphoma, Laryngeal cancer, liver cancer, lung cancer, malignant melanoma, mesenteric tumor, pancreatic cancer, rectal cancer, renal cancer, thyroid cancer, malignant peripheral neurocytoma, malignant peripheral nerve sheath tumor (MPNST), skin / plexiform neurofibroma, smooth Myadenoma-like tumor, fibroma, uterine myoma, smooth myoma, papillary thyroid cancer, undifferentiated thyroid cancer, thyroid medullary cancer, thyroid follicular cancer, Hultre cell cancer, thyroid cancer, ascites, malignant ascites, mesopharyngoma Tumors, salivary gland mucocutaneous cancer, salivary gland adenocarcinoma, gastrointestinal stromal tumor (GIST), tumors that cause latent spatial fluid retention in the body, pleural effusion, pericardial effusion, ascites, giant cell tumor (GCT), bone GCT, Pigmented villous nodular synovitis (PVNS), tendon synovial giant cell tumor (TGCT), tendon sheath giant cell tumor (TGCT-TS) and other sarcomas. As a preferred embodiment, the present invention is used in the treatment of esophageal cancer, lung cancer, prostate cancer or bladder cancer.

As used herein, the term "treatment" refers to therapeutic and prophylactic measures to prevent or delay (alleviate) unwanted physiological changes or disorders such as cancer progression. Beneficial or desirable clinical outcomes include symptom remission, disease degree reduction, disease state stabilization (ie, no exacerbation), disease progression delay or reduction, disease state, both detectable and undetectable. Includes, but is not limited to, improvement or remission, or disappearance of symptoms (part or all). The term "treatment" also means that survival is prolonged compared to the expected survival without treatment. Patients in need of treatment include those who are already ill or have symptoms, those who are vulnerable to or symptomatic of the disease, or those who take precautions against the disease or symptom.

The terms "subject", "individual", "animal", "patient" or "mammal" refer to any subject wishing to be diagnosed, evaluated for prognosis, or treated, especially a mammalian subject. Mammals include humans, livestock, farm animals and zoo ornamental animals, competition animals or pets such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, dairy cows ( cow) etc. are included.

Terms such as "patient in need of treatment" or "subject in need of treatment" herein are administered, for example, antibodies or compositions used herein for detection, diagnostic procedures and / or treatment. Includes subjects that benefit from, such as mammalian subjects.

As will be apparent to those skilled in the art, the modified genomes disclosed herein can be modified to differ from the modified polynucleotides derived from them in the base sequence. For example, a polynucleotide sequence or base sequence derived from a given DNA sequence may be similar, eg, has a certain percentage identity with the starting sequence, eg, 60%, 70%, 75%, with the starting sequence. It may be 80%, 85%, 90%, 95%, 98% or 99% identical.

Conservative substitutions or mutations may also be made in "non-essential" regions by substituting, deleting or inserting nucleotides or amino acids. For example, in a polypeptide or amino acid sequence derived from a given protein, substitutions, insertions or deletions of one or more single amino acids (eg, 1, 2, 3, 4, 5, 6). , 7, 8, 9, 10, 15, 20 or more single amino acid substitutions, insertions or deletions), the rest may be identical to the starting sequence. In some embodiments, the polypeptide or amino acid sequence derived from a given protein is simply 1 to 5, 1 to 10, 1 to 15, or 1 to 20 compared to the starting sequence. One amino acid has been substituted, inserted or deleted.

The antibody may be detectably labeled by covalently binding to a chemiluminescent compound. Then, by detecting the presence or absence of luminescence in the process of the chemical reaction, the presence or absence of the chemiluminescentally labeled antigen-binding polypeptide can be detected. Particularly useful chemiluminescent labeling compounds include, for example, luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalic acid ester.

Modified HSV-1 Obligate Vector As one aspect of the present invention, an HSV-1 virus containing a modified HSV-1 genome is provided and is also referred to as an HSV-1 obligate vector. The HSV-1 genome consists of two covalently bound components (referred to as L and S). Each component is a unique sequence (L component U _L, S component U _S) consists, on both sides are inverted repeat sequences. The reverse repeats of the L component are called ab and b'a', and the reverse repeats of the S component are called a'c' and ca. The reverse repeat region contains two copies of the transcription unit. Open reading frames with at least five 2 copies are known in the art, and these proteins are named ICP0, ICP4, ICP34.5, ORFP and ORFO, respectively. The reverse repetitive sequences b'a'and a'c'(b'a'-a'c') combine to form an internal reverse repeat region. And the reverse repeats ab and ca are referred to herein as external repeats.

In one embodiment of the present invention, the modification, including sequence deletions between the promoters of the promoter and U _{S 1} gene U _L 56 gene in wild-type HSV-1 genome. In fact, the deleted sequence is one copy of the transcription unit encoding at least five proteins (ICP0, ICP4, ICP34.5, ORF-O and ORF-P) (but with all remaining open reading frames). (A), a transcription unit (b) that is entirely contained within the b'a'-a'c' sequence, and a transcription unit (c) that begins in the unique region and extends to the deleted region. including.

In the present invention, the exact deletion ensures that the sequences required for expression of any open reading frame (ORF) present in the deleted viral DNA are complete. In such cases, the "sequence required for the expression of any existing open reading frame" includes the ORF itself and the regulatory sequences required for the expression of each ORF (eg, promoter and enhancer), so that the expression of the ORF is successful. And ensure that the protein obtained by translation is functional. The term "complete" means that a sequence thus defined is at least functional, but does not necessarily mean that the sequence is 100% identical to the natural sequence. By including, for example, conservative substitutions or mutations in the "non-essential" region, the sequence may have slight mutations in the base sequence as compared to the natural sequence. In such cases, the sequence may have 90%, 95%, 98% or 99% identity with the natural sequence.

As will be apparent to those skilled in the art, the exact starting and terminating positions of deleted nucleotides in the present invention are determined by the strain and genomic isomers of the HSV-1 virus, and by techniques known in the art. It can be easily determined. The contents of the present specification are not intended to be limited to HSV-1 virus strains or specific genomic isomers. In one embodiment, the deletion removes nucleotides 117005 to 132906 in the genome. Further, as is obvious, other strains can be used in the present invention as long as the genomic DNA is sequenced. The sequencing technique can be easily known from the literature and commercial products. For example, in another embodiment, the HSV-1 virus strain 17 is deleted and its genome can be obtained at GenBank accession number NC_001806.2. In another embodiment, a deletion is made in the KOS 1.1 virus strain and its genome can be obtained at GenBank Accession No. KT899744. In yet another embodiment, the deletion is performed in virus strain F and its genome can be obtained at GenBank Accession No. GU734771.1.

In some embodiments, by performing the deletion accurately at a predetermined position, the first known genes in the S component from the promoter of the last one known genes (e.g., U _L 56) in the L component (e.g. U _{S 1)} Remove the DNA fragment up to the promoter sequence of. Thus, sequences required for expression of all of the ORF and these ORF of _{U L} 1 from _U L 56 gene and _{U S U} S 12 from _{U S} 1 in the component in the _{U L} component is fully both. Retaining the sequences necessary for the expression of any open reading frame (ORF) present in the viral DNA that has undergone the precise removal and deletion provides many benefits. Any gene, and any 2-copy gene (e.g. ICP0, ICP4, ICP34.5, the ORF P and ORF O gene) in the term "retention" is a unique sequence to the modified vector _{(U L} and _{U S)} of a single Refers to including only a copy. Note that the deleted sequence rarely encodes a protein and is an overlapping non-coding sequence that occupies the deleted region (eg, ICP0 intron, LAT domain, "a" sequence, etc.). The obligate vector of the present invention is also intended to contain only one copy of the overlapping non-coding sequence.

By retaining any ORF, a more potent virus can be obtained, maximizing resistance to environmental factors such as temperature, pressure and UV light before and after insertion of a foreign gene. It also maximizes the anti-cancer range of the oncolytic HSV-1.

Various genetic manipulation methods known in the art, such as bacterial artificial chromosome (BAC) techniques, can be used to obtain the modified HSV-1 vectors described herein (eg, Horsburgh BC, Hubinette MM, Qiang D, et al. Allele replacement: an application that permits rapid manipulation of herpes simplex virus type 1 genome. See Gene Ther, 1999, 6 (5): 922-30). As another example, the COS plasmid can also be used in the present invention (eg van Zijl M., Quint W, Briare J, et al. Regeneration of herpes viruses from molecularly cloned subgenomic fragments. J Virol, 1988, 62 (6). : See 2191-5).

One key feature of the constructs described herein is that they are used as obligate vectors. Such constructs are defined to be used as vectors expressing genes that do not proliferate in susceptible cells, but proliferate when a virus or cellular DNA sequence is inserted, and thus the gene inserted into the vector sequence. ..

Insertion of a recombinant oncolytic HSV-1 virus foreign DNA sequence into a wild-type virus interferes with packaging the DNA into virions, thus limiting the amount of insertion. The exact deletion in a given region provides suitable space for inserting a foreign DNA sequence. According to one embodiment of the invention, the deletion removes at least 15 Kbp from the oncolytic viral vector, which allows a significant amount of foreign DNA sequence to be accepted. Also, according to other related studies, the wild-type genome can further accept 7KB of DNA.

In light of this, another aspect of the invention provides recombinant oncolytic herpes simplex virus type 1 (HSV-1). The virus by deleting sequences between the promoter of U _L 56 gene in wild-type HSV-1 genome promoter of U _{S 1} gene, (i) all in one copy in the two copies gene deletion However, (ii) the modified HSV-1 genome (a), which comprises the complete sequence required to express all open reading frames (ORFs) present in the deleted viral DNA. And at least a foreign nucleic acid sequence (b) that is stably introduced into the deleted region of the modified HSV-1 genome and encodes an immunostimulatory agent and / or an immunotherapeutic agent.

In one embodiment, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding an immunostimulant. In some embodiments, the immunostimulant is selected from GM-CSF, IL 2, IL 5, IL 12, IL 15, IL 24 and IL 27. In one embodiment, the immunostimulant is IL 12. In one embodiment, the immunostimulant is human IL 12 or humanized IL 12. In one embodiment, the immunostimulant is mouse IL 12. In another embodiment, the immunostimulant is IL 15.

In one embodiment, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding an immunotherapeutic agent. In some embodiments, the immunotherapeutic agent is selected from anti-PD-1 and anti-CTLA-4 agents. In one embodiment, the immunotherapeutic agent is an anti-PD-1 agent. In another embodiment, the immunotherapeutic agent is an anti-CTLA-4 agent.

When only one foreign nucleic acid sequence encoding an immunostimulant or immunotherapeutic agent is inserted, it is preferable to incorporate the foreign nucleic acid sequence into the deleted region of the genome. In one embodiment, the foreign nucleic acid sequence has approximately the same length as the deleted region. In one embodiment, the length of the foreign nucleic acid sequence is 20% longer or shorter than the deleted region. In another embodiment, the length of the foreign nucleic acid sequence is 15%, 10%, 5%, 4%, 3%, 2% or 1% longer or shorter than the deleted region.

In one embodiment, the length of the foreign nucleic acid sequence is shorter than about 18 Kbp, about 17 Kbp or about 16 Kbp. In one embodiment, the length of the foreign nucleic acid sequence is greater than about 10 Kbp, 11 Kbp, 12 Kbp, 13 Kbp or 14 Kbp. In one embodiment, the length of the foreign nucleic acid sequence is between about 14 Kbp and about 16 Kbp. In one embodiment, the length of the foreign nucleic acid sequence is about 15 Kbp.

In some embodiments, the recombinant oncolytic HSV-1 comprises at least two foreign nucleic acid sequences encoding immunostimulants and / or immunotherapeutic agents. Also in some embodiments, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding two different immunostimulants. For example, in one embodiment, recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding IL-12 and GM-CSF. In another embodiment, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding IL-15 and GM-CSF. In yet another embodiment, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding IL12 and IL15.

In some embodiments, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding two different immunotherapeutic agents. In one embodiment, for example, recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding an anti-PD-1 agent and an anti-CTLA-4 agent.

In some embodiments, the recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding three different immunostimulants and / or immunotherapeutic agents. For example, in one embodiment, recombinant oncolytic HSV-1 comprises a foreign nucleic acid sequence encoding IL12, an anti-CTLA4 agent and an anti-PD-1 agent.

When introducing one or more foreign nucleic acid sequences encoding immunostimulants and / or immunotherapeutic agents, it is preferable to insert the first foreign nucleic acid sequence into the deletion region of the genome. The second or other foreign nucleic acid sequence may be inserted into the L component of the genome. In one embodiment, a second foreign nucleic acid sequence is _{inserted between the UL} 3 and _UL 4 genes of the L component. In one embodiment, a second foreign nucleic acid sequence is _{inserted between the UL} 37 and _UL 38 genes of the L component.

In one embodiment, the first foreign nucleic acid sequence is inserted into the deletion region of the genome and the second foreign nucleic acid sequence is inserted between the _UL 3 and _{UL 4 genes.} In one embodiment, the first foreign nucleic acid sequence is inserted into the deleted internal reverse repeat region of the genome and the second foreign nucleic acid sequence is inserted between the _{L components UL} 37 and _{UL 38 genes.} .. In one embodiment, the first foreign nucleic acid sequence is inserted into the deleted internal reverse repeat region of the genome and the second foreign nucleic acid sequence is _{inserted between the UL} 3 and _UL 4 genes, the first. The foreign nucleic acid sequence of 3 is inserted between the _UL 37 gene and the _{UL 38 gene of the L component.}

In one embodiment, the first foreign nucleic acid sequence encodes IL 12. In one embodiment, the second foreign nucleic acid sequence encodes an anti-CTLA4 agent or an anti-PD-1 agent. In one embodiment, the third foreign nucleic acid sequence encodes an anti-PD-1 or anti-CTLA4 agent.

Obviously, inserting one or more foreign nucleic acid sequences into the tumor-soluble HSV-1 genome does not interfere with the expression of the natural HSV-1 gene, and the foreign nucleic acid sequence is transformed into the modified HSV-1 genome. When incorporated stably, the functional expression of foreign nucleic acid sequences can be predicted.

Recombinant genes encoding immunostimulants and / or immunotherapeutic agents include nucleic acids encoding proteins and regulatory elements in protein expression. In general, the regulatory elements present in the recombinant gene are operably linked to the nucleic acid sequence of expression and may be selected based on the host cell used for expression and include a transcriptional promoter, ribosome binding site and terminator. In a recombinant expression vector, the term "operable linkage" refers to the expression of a base sequence of the desired base sequence (eg, expression in an in vitro transcription / translation system, or expression in a host cell upon introduction of the virus into the host cell). Is used to mean that is linked to a regulatory sequence in a possible manner. The term "regulatory sequence" is intended to include promoters, enhancers and other expression regulatory elements (eg, polyadenylation signals). Regulatory sequences include regulatory sequences that guide the constitutive expression of nucleotide sequences in various types of host cells, and regulatory sequences that direct the expression of nucleotide sequences only in some host cells (eg, tissue-specific regulatory sequences). It is included.

Recently, a regulatory sequence called an insulator has been discovered, which contains one type of DNA element found on the chromosome of a cell, and a gene in one region of the chromosome is affected by the regulation of another region. Protect it from not. Amelio et al. Discovered a 1.5-kb region containing CTCF motif clusters in the LAT region, which has the effect of blocking and silencing insulator activity, especially enhancers (Amelio et al). .. A Chromatin Insulator-Like Element in the Herpes Simplex Virus Type 1 Latency-Associated Transcript RegionBinds CCCTC-Binding Factor and Displays Enhancer-Blocking and Silencing Activities. Journal of Virology, Vol. 80, No. 5, Mar. 2006, p . 2358-2368).

A promoter is a DNA sequence that guides the binding of RNA polymerase to DNA and initiates RNA synthesis, and a healthy promoter can cause frequent activation of mRNA. For processing in eukaryotic cells, the polyadenylation signal is a suitable element. There may also be introns associated with the antibody. Examples of expression cassettes for producing antibodies or antibody fragments are well known in the art (eg, Persic et al., 1997, Gene 187: 9-18; Boel et al., 2000, J Immunol. Methods 239: 153-166; Liang et al., 2001, J. Immunol. Methods 247: 1 19-130; Tsurushita et al., 2005, Methods 36: 69-83.).

Those skilled in the art can select appropriate regulatory elements, for example, according to the desired tissue specificity and expression level. For example, cell type-specific or tumor-specific promoters can be used to limit the expression of a gene product to a particular cell type. In addition to using a tissue-specific promoter, topical administration of the virus can be achieved to be locally expressed and effective. Available non-tissue-specific promoters include, for example, the early cytomegalovirus (CMV) promoter (US Pat. No. 4,168,062) and the Rous sarcoma virus promoter. Further, an HSV promoter, for example, an HSV-1E promoter can also be used. In some embodiments, the promoter is selected from the promoters shown in the following table.

For example, examples of tissue-specific promoters available in the present invention are prostate cell-specific prostate-specific antigen (PSA) promoters, muscle cell-specific desmin promoters, and nerve cell-specific. Enolase promoter, β-globin promoter specific for erythroid cells, tau-globin promoter specific for erythroid cells, growth hormone promoter specific for pituitary cells, pancreatic β cells Specific insulin promoter, glial fibrous acidic protein promoter specific for astrosites, tyrosine hydroxylase promoter specific for catecholaminergic nerve cells, amyloid precursor protein specific for nerve cells Promoter, dopamine β-monooxygenase promoter specific for noradrenalinergic / adrenalinergic nerve cells, tryptophanhydroxylase promoter specific for serotonin / pineapple cells, specific for cholinergic nerve cells Choline acetyl transferase promoter, aromatic L-amino acid decarbonase (AADC) promoter specific for catecholaminergic / 5-HT / D type cells, for nerve cells / spermatocytes / supraclavicular cells Proenkephalin promoter specific for colon / rectal tumor and pancreatic / renal cell specific reg (pancreatic stone protein) promoter, and liver / cecal tumor, nerve sheath tumor, renal cell, pancreatic cell and adrenal cell Includes a specific parathyroid hormone-related protein (PTHrP) promoter.

Examples of promoters that act specifically in tumor cells include stromericin 3 promoters specific for breast cancer cells, lung surfactant protein A promoter specific for non-small cell lung cancer cells, and tumor types expressing SLPI. Secretory leukocyte peptidase inhibitor (SLPI) promoter specific for, tyrosinase promoter specific for malignant melanoma cells, stress-induced grp78 / BiP promoter specific for fibrosarcoma / carcinogenic cells , AP2 enhancer specific for fat cells, α-1 anti-antitrypsin transsiletin promoter specific for hepatocytes, interleukin-10 promoter specific for polymorphic glioblastoma, C-erbB-2 promoter specific for pancreas, mammary gland, stomach, ovary and non-small cell lung cancer cells, α-B-crystallin / heat shock protein 27 promoter specific for brain tumor cells, glioma and Basic fibroblast proliferative factor promoter specific for meningeal tumor cells, epithelial growth factor receptor promoter specific for squamous cell carcinoma, glioma and mammary tumor cells, specific for breast cancer cells Mutin-like sugar protein (DF3, MUC1) promoter, mts1 promoter specific for metastatic tumors, NSE promoter specific for small cell lung cancer cells, somatostatin receptor specific for small cell lung cancer cells Promoter, c-erbB-3 / c-erbB-2 promoter specific for breast cancer cells, c-erbB4 promoter specific for breast cancer / gastric cancer, thyroglobulin promoter specific for thyroid cancer cells, liver cancer It contains a cell-specific α-fetoprotein (AFP) promoter, a gastric cancer cell-specific villin promoter, and a liver cancer cell-specific albumin promoter. In another embodiment, the TRT promoter or the survivin promoter is used.

For example, in some embodiments, the foreign nucleic acid sequence is operably linked to a promoter, such as the CMV promoter or the Egr promoter. In one embodiment, the nucleotide sequence encoding mIL12 is operably linked to the Egr promoter. In another embodiment, the nucleotide sequence encoding scFv-anti-hPD1 is operably linked to the CMV promoter.

Immunostimulatory or immunosuppressive agents In some embodiments, the oHSV-1 according to the invention is a cytokine (eg IL-2, IL4, IL-12, GM-CSF, IFNγ), a chemokine (eg MIP-1, MCP). It encodes one or more immunostimulators (also called immunostimulatory molecules), including -1, IL-8) and growth factors (eg, FLT3 ligands).

In some cases, the oHSV-1 according to the invention further comprises a PD-1 binding comprising an antibody such as an anti-PD1 antibody that specifically binds PD-1 or an anti-CTLA-4 antibody that specifically binds CTLA-4 or a fragment thereof. It encodes one or more immunotherapeutic agents such as agents (or anti-PD-1 agents), CTLA-4 binding agents (or anti-CTLA-4 agents). Of these, the anti-PD-1 antibody may be a single-chain antibody that antagonizes the activity of PD-1. In other embodiments, the oncolytic virus is a reagent that antagonizes the binding of PD-1 ligand to the receptor, such as anti-PD-L1 antibody and / or PD-L2 antibody, PD-L1 and / or PD-L2 decoy. Or express a soluble PD-1 receptor.

The PD-1 signaling pathway plays an important role in tumor-related immune dysfunction. Tumor cell infection and lysis can elicit a highly specific anti-tumor immune response, killing tumor-inoculated cells and distantly established uninoculated tumor cells. In tumors and their microenvironments, mechanisms have been formed to avoid, suppress and inactivate the natural anti-tumor immune response. For example, a tumor downregulates a target receptor, coats itself with a fibrous extracellular matrix, or upregulates a host receptor or ligand involved in the activation or recruitment of regulatory immune cells. Natural and / or adaptive regulatory T cells (Tregs) are involved in tumor-mediated immunosuppression. Although not bound by any theory, PD-1 blockade is thought to be able to suppress the activity of Tregs and improve the effects of tumor-reactive CTLs. Other aspects of the technique will be described in more detail below. PD-1 blockade can also stimulate an antitumor immune response by blocking T cells (CTL and helper cells) and deactivating B cells.

As one aspect of the present invention, there is provided an oncolytic virus carrying a gene encoding a PD-1 binder. Programmed cell death 1 (PD-1) is a 50-55 kDa type I transmembrane receptor first identified by subtractive hybridization of apoptotic mouse T cell lines (Ishida et al., 1992, Embo J. 11: 3887-95). PD-1, a member of the CD28 gene family, is expressed on activated T cells, B cells and myeloid cells (Greenwald et al., 2005, Annu. Rev. Immunol. 23: 515-48; Sharpe et al., 2007, Nat. Immunol. 8: 239-45). It has about 60% amino acid identity between human and mouse PD-1 and is conservative at four potential N-glycosylation sites and residues that define the Ig-V domain. Two types of ligands for PD-1, namely PD-ligand 1 (PD-L1) and ligand 2 (PD-L2), have already been identified and both belong to the B7 superfamily. Of these, PD-L1 is expressed in various types of cells, including T cells, B cells, endothelial cells, epithelial cells and antigen-presenting cells. PD-L2 is expressed only in professional antigen-presenting cells (eg, dendritic cells and macrophages).

PD-1 negatively regulates T cell activation, and its inhibitory function is associated with the immunoreceptor inhibitory tyrosine motif (ITIM) of its cytoplasmic domain (Parry et al., 2005, Mol. Cell. Biol). . 25: 9543-53). Destruction of such inhibitory function of PD-1 causes autoimmunity. The opposite can also be harmful. In many pathological situations, such as tumor immune evasion and chronic viral infection, persistent negative signals by PD-1 are involved in T cell dysfunction.

Host anti-tumor immunity depends primarily on tumor-infiltrating lymphocytes (TIL) (Galore et al., 2006, Science 313: 1960-4). Much evidence supports that TIL is suppressively regulated by PD-1. First, expression of PD-L1 has been confirmed in many human or mouse tumor systems, and the expression can be further up-regulated by IFN-γ in vitro (Dong et al., 2002, Nat. Med. 8: 793-800). Second, PD-L1 expressed by tumor cells is directly associated with its resistance to lysis of antitumor T cells in vitro (Blank et al., 2004, Cancer Res. 64: 1 140-5). ). Third, PD-1 knockout mice are resistant to tumor attack (Iwai et al., 2005, Int. Immunol. 17: 133-44) and T cells derived from PD-1 knockout mice. When adopted into cancer-bearing mice, it is very effective in tumor rejection (Blank et al., Ibid.). Fourth, blocking PD-1 inhibitory signals with monoclonal antibodies can promote host antitumor immunity in mice (Iwai et al., Supra; Hirano et al., 2005, Cancer Res. 65:1089). -96). Fifth, high PD-L1 expression in tumors (detected by immunohistochemical staining) is associated with poor prognosis for various types of cancer in humans (Hamanishi et al., 2007, Proc. Natl). . Acad. Sci. USA 104: 3360-5).

Oncolytic virus therapy is an effective method for forming a host immune system by amplifying a T cell or B cell population specific for a tumor-specific antigen released after tumor lysis. .. The immunogenicity of a tumor-specific antigen is largely determined by the affinity of the host immunoreceptor (B cell receptor or T cell receptor) for the antigen epitope and the host tolerance threshold. High-affinity interactions act to transform host immune cells into long-term memory cells through multiple proliferations and differentiations. The host's immune tolerance mechanism minimizes potential tissue damage due to local immune activation by offsetting these proliferations and dilations. The PD-1 inhibitory signal is a component of such a host's immune tolerance mechanism, which is supported by the evidence provided below. First, PD-1 expression is enhanced in T cells that proliferate actively, especially in T cells that have a final differentiation phenotype (effector phenotype). Effector cells are generally involved in effective cytotoxic function and cytokine production. Second, PD-L1 plays an important role in maintaining peripheral tolerance and local restriction on overactive T cells. Therefore, PD-1 suppression using a PD-1 binder expressed in the tumor microenvironment is effective in enhancing the activity of TIL and eliciting an effective and long-lasting anti-tumor immune response. Method.

Cytotoxic T lymphocyte antigen 4 (CTLA-4) is a member of the immunoglobulin (Ig) superfamily. The Ig superfamily is a set of proteins with key structural features of the variable (V) or stationary (C) domains of the Ig molecule. Members of the Ig superfamily include, but are not limited to, immunoglobulins themselves, major histocompatibility complex (MHC) molecules (ie, class I and class II MHC) and TCR molecules. In T cells, two types of signals by antigen-presenting cells (APCs) are required for their activation and differentiation into effector function. One is an antigen-specific signal generated by the interaction between the TCR in T cells and the MHC molecule presenting the peptide in APC, and the other is the CD28 and B7 family (B7-1 (CD80) or It is an antigen-independent signal mediated by interaction with members of B7-2 (CD86)). CTLA-4 is initially evasive when it is incorporated into the immune response environment. Mouse CTLA-4 was first identified and cloned by Brunet et al. As part of a search for molecules favorably expressed in cytotoxic T lymphocytes (Brunet et al. Nature 328: 267-270 (1987)). Dariavac et al. Discovered human CTLA-4 and subsequently succeeded in cloning it (Dariavach et al. Eur. J. Immunol. 18: 1901-1905 (1988)). There is approximately 76% overall sequence homology between mouse and human CTLA-4 molecules, as well as near-perfect sequence identity in its cytoplasmic domain (Dariavach et al. Eur. J. Immunol. 18: 1901). -1905 (1988)).

Researchers began explaining the action of CTLA-4 on T cell stimulation in 1993, with great success in 1995. Walunas et al. (Walunas et al. Immunity 1: 405-13 (1994)) use anti-CTLA-4 monoclonal antibodies to present evidence for the first time that CTLA-4 can be used as a negative regulator of T cell activation. did.

With respect to cancer, Kwon et al. (Kwon et al. PNAS USA 94: 8099-103 (1997)) established a syngeneic mouse prostate cancer model to elicit an anti-prostate cancer response by enhanced T cell co-stimulation: Two different manipulations, (i) providing direct co-stimulation by transfection of prostate cancer cells expressing B7.1 ligand, and (ii) suppressing T cell downregulation, in vivo antibody-mediated T cells The blocking of CTLA-4 was verified. It has already been demonstrated that CTLA-4 in vivo antibody-mediated blockade promotes an immune response in anti-prostate cancer. Yang et al. (Yang et al. Cancer Res 57: 4036-41 (1997)) studied whether blocking CTLA-4 function promotes antitumor T cell responses at different stages of tumor growth. Based on in vitro and in vivo results, they show that CTLA-4 blockade in cancer-bearing individuals promotes the ability to generate antitumor T cell responses, but in the model these promoting effects are early in tumor growth. We found that it was found only in stages. In addition, Hurwitz et al. (Hurwitz et al. Proc Natl Acad Sci USA 95: 10067-71 (1998)) found that T cell-mediated generation of antitumor responses was T cells by major histocompatibility complex / antigen. We studied receptor binding and dependence on B7 ligation to CD28. For some tumors (eg, SM1 breast cancer), anti-CTLA-4 immunotherapy cannot provide satisfactory results. Therefore, the combination therapy using a CTLA-4 blocker and a vaccine consisting of SM1 cells expressing granulocyte-macrophage colony stimulating factor showed regression of the parental SM1 tumor, but treatment with only one of them is possible. It didn't work. Such combination therapies have long-lasting immunity to SM1 and are dependent on both CD4 (+) and CD8 (+) T cells. This finding suggests that CTLA-4 blockade acts at the level of host-derived antigen-presenting cells.

Anti-PD-1 Agent and Anti-CTLA-4 Agent As one aspect of the present invention, there is provided an oncolytic virus containing a foreign nucleic acid encoding an anti-PD-1 agent and / or an anti-CTLA-4 agent. In some embodiments, the anti-PD-1 or anti-CTLA-4 agent comprises an antibody variable region that specifically binds to a PD-1 or CTLA-4 epitope. The antibody variable region may be present, for example, in a complete antibody, antibody fragment and recombinant derivative of the antibody or antibody fragment. The term "antibody" refers to naturally occurring, partially synthesized or fully synthesized immunoglobulins. Thus, the anti-PD-1 or anti-CTLA-4 agents of the present invention include any polypeptide or protein having a binding domain that specifically binds to a PD-1 or CTLA-4 epitope.

Different types of antibodies have different structures, but different antibody regions may be described with reference to IgG. The IgG molecule contains four polypeptide chains: two long heavy chains and two short light chains interconnected by disulfide bonds. The heavy and light chains contain a constant region and a variable region, respectively. The heavy chain consists of a heavy chain variable region ( _VH ) and a heavy chain constant region (CH1, CH2 and CH3). The light chain consists of a light chain variable region ( _VL ) and a light chain constant region ( _CL ). Within the variable region, there are three highly variable regions involved in antigen specificity (eg Breitling et al., Recombinant Antibodies, John Wiley & Sons, Inc. and Spektrum Akademischer Verlag, 1999; and Lewin, Genes IV, Oxford. See University Press and Cell Press, 1990.).

Highly variable regions are commonly referred to as complementarity determining regions (CDRs) and are located between more conservative adjacent regions called framework regions (FWs). There are four FW regions and three CDRs from the NH2 end to the COOH end, that is, FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4. The amino acids associated with the framework region and CDRs are Kabat et al., Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, 1991; C. Chothia and AM Lesk, J Mol Biol 196 (4): 901 ( 1987); or B. Al-Lazikani, et al., J Mol Biol 273 (4): 27, 1997 Can be numbered and matched by the method described. For example, framework regions and CDRs can be identified by the definitions of Kabat and Chothia. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The two heavy chain carboxyl regions are constant regions that form Fc regions that are linked by disulfide bonds. The Fc region plays an important role in providing effector function (Presta, Advanced Drug Delivery Reviews 58: 640-656, 2006.). The two heavy chains constituting the Fc region extend to Fab regions that differ depending on the hinge region.

Anti-PD-1 or anti-CTLA-4 agents generally contain an antibody variable region. Such antibody fragments are (i) _{Fab fragments, which are monovalent fragments consisting of V H} , _VL , _CH and _CL domains, and (ii) two Fab fragments linked by disulfide bonds in the hinge region. _{Fab 2} fragment containing a bivalent fragment, Fd fragment consisting of (iii) V _H and C _H1 domains, Fv fragment consisting of (iv) single arm V _H and _{VL domains of (iv) antibody, (v) V H} or _VL A dAb fragment containing a domain, a _{scAb containing an antibody fragment containing (vi) V H} and _VL and C 1 or C _{H 1,} and a (vi) fibronectin type III polypeptide antibody (eg, US Patent Registration No. 6,703,199). ), But not limited to these. Includes, but is not limited to, artificial antibodies based on scaffold proteins. Moreover, although the two domains V _L and V _H of the Fv fragment are encoded by separate genes, by synthesizing a linker ligated using methods of recombinant, it is possible to form a single protein chain, this Among them, the _VL and _VE regions match to form a monovalent molecule called a single chain Fv (scFv). For this reason, the antibody variable region may be present in the recombinant derivative. Examples of recombinant derivatives include single chain antibodies, bispecific antibodies, trispecific antibodies, quadrispecific antibodies and small antibodies. Anti-PD-1 or anti-CTLA-4 agents may also contain one or more variable regions that recognize the same or different epitopes.

In some embodiments, the anti-PD-1 or anti-CTLA-4 agent is encoded by an oncolytic virus produced using nucleic acid recombination techniques. By a variety of techniques, such as single-chain protein (e.g. scFv) containing VH and VL domains linked by a linker sequence and the antibody or fragment, and multi-chain protein comprising the V _H and V _L regions into individual polypeptide Different anti-PD-1 agents can be produced, including. Nucleic acid recombination technology relates to the construction of nucleic acid templates used for protein synthesis. Suitable nucleic acid recombination techniques are generally known in the art (see, eg, Ausubel, Current Protocols in Molecular Biology, John Wiley, 2005; Harlow et al., Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). To do). Recombinant nucleic acids encoding anti-PD-1 or anti-CTLA-4 antibodies are expressed in cells infected with an oncolytic virus and released into the tumor microenvironment after virus lysis. Here, the cells are actually used as a factory for encoding proteins.

Nucleic acids containing one or more recombinant genes encoding one or both of the _VH or _VL regions of anti-PD-1 or anti-CTLA-4 agents are complete proteins that bind PD-1 / CTLA-4. / Can be used for the production of polypeptides. For example, V _H and V _L regions encode single chain protein (e.g. scFv) containing, or more V _H and V _L domains using recombinant regions linked by a linker with a single gene May produce a complete binder by producing.

Examples shown as anti-PD-1 antibodies, anti-CTLA-4 antibodies or fragments, derivatives thereof available in the present invention can be obtained from the art (eg, WO2006 / 121168, WO2014 / 055648, WO2008 / 156712, US2014 / 0234296). Or see US Patent Registration No. 6,984,720).

In the present invention, recombinant oHSV-1 does not transport systemically, but accurately transports immunostimulatory proteins only in tumors in need of treatment. Also, by alleviating protein production in tumors, and especially alleviating protein intake, it is very likely that the expression of cytotoxicity will be greatly alleviated, and thus not observed.

Compositions Oncolytic viruses can be prepared in suitable pharmaceutically acceptable carriers or excipients. Under normal storage and use conditions, these formulations contain preservatives that prevent the growth of microorganisms. Suitable dosage forms for injection include sterile aqueous solutions and sterile powders or sterile powders (US Patent Registration No. 5,466,468) used for the provisional preparation of sterile injection solutions and dispersions. In all cases, the formulation must be sterile and must be fluid to facilitate injection. It must remain stable under manufacturing and storage conditions and must also prevent contamination by bacteria and microorganisms such as fungi.

The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerin, propylene glycol and liquid polyethylene glycol, etc.), a suitable mixture thereof and / or vegetable oil. Appropriate fluidity is maintained by using a coating such as lecithin, maintaining a predetermined particle size in a dispersed state, or using a surfactant. Various antibacterial agents and antifungal agents, for example, paraoxybenzoic acid ester, chlorobutanol, phenol, sorbic acid, thimerosal and the like may exert antimicrobial activity. In many cases, isotonic agents such as sugar and sodium chloride are also preferably included. Reagents that delay absorption into the composition (eg, aluminum monostearate and gelatin) may be used to delay absorption into the injectable composition.

In the case of parenteral administration in an aqueous solution, for example, it is necessary to appropriately buffer the solution as necessary and to isotonic the liquid diluent with a sufficient amount of saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this regard, according to the content of the present invention, available sterile aqueous media are known to those of skill in the art. For example, a single dose may be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of subcutaneous infusion or injected into the recommended infusion site (eg, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038). and 1570-1580). The dose will inevitably vary depending on the condition of the subject being treated, but in each case the practitioner will determine the appropriate dose for the individual subject. Also, for human administration, the formulation should meet the sterility, pyrogenicity, general safety and purity standards required by the FDA's Biological Product Standards.

A sterile injection solution is produced by combining a predetermined amount of the active compound and various other components shown above with an appropriate solvent as needed, filtering and sterilizing. Usually, a dispersion is prepared by adding various sterilized active ingredients to a sterile carrier containing the basic dispersion medium and the other necessary ingredients shown above. For sterile powders for the preparation of sterile injectable solutions, vacuum drying and lyophilization are the preferred preparation methods, prior to which a powder containing the active ingredient and all other necessary ingredients from the aseptically filtered solution. To manufacture.

The compositions disclosed herein may be prepared in neutral or salt form. Pharmaceutically acceptable salts are acid addition salts that form with free amino groups of proteins and salts that form with inorganic acids (eg hydrochloric acid or phosphoric acid) or organic acids (eg acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). including. The salt formed with the free carboxy group may be derived from an inorganic base such as sodium, potassium, ammonium, calcium or iron hydroxide, and an organic base such as isopropylamine, trimethylamine, histidine, prokine and the like. At the time of preparation, the solution is used in a method suitable for the dose and dosage form and in a therapeutically effective amount. The preparation may be administered in various dosage forms (for example, injection solution, drug sustained-release capsule) and the like.

The term "carrier" herein refers to any or any solvent, dispersion medium, carrier, coating, diluent, antibacterial and antifungal agent, tonicity and absorption retarder, buffer, carrier solution, suspension. Contains turbidants, colloids, etc. Mediums and drugs used as drug-active substances are widely known in the art. Other media or reagents are expected to be available in the therapeutic composition, except for conventional media and reagents that are incompatible with the active ingredient. Auxiliary active ingredients may also be added to the composition.

The term "pharmaceutically acceptable" refers to a molecular entity or component that does not cause allergies or similar adverse events when administered to humans. The preparation of an aqueous composition containing a protein as an active ingredient is widely known in the art. In general, such compositions may be prepared as injections in solution or suspension form, or may be prepared in solid form suitable for dissolving or dispersing in a liquid prior to injection.

Therapy Another aspect of the invention comprises administering to a subject in need of treatment an effective amount of a recombinant oncolytic HSV-1 virus or a pharmaceutical composition comprising the recombinant oncolytic HSV-1 virus. Provide a method of treatment or remission. The present invention also provides an oncolytic HSV-1 virus used in the above-mentioned method for treating or ameliorating cancer.

In some embodiments, the recombinant oncolytic HSV-1 virus or pharmaceutical composition is administered in an intratumoral manner. In one embodiment, the HSV-1 virus or pharmaceutical composition is injected directly into the tumor mass in the form of an injectable solution.

In some embodiments, an oncolytic virus carrying a gene encoding an immunostimulatory agent and / or an immunotherapeutic agent may be combined with other agents effective in treating cancer. For example, oncolytic viruses and other anti-cancer therapies (eg, anti-cancer agents or surgery) can be used to treat cancer. In the present invention, it is expected that oncolytic virus therapy can be used in combination with chemotherapeutic agents, radiotherapy agents, immunotherapeutic agents or other means of biological interference.

"Anti-cancer" agents can negatively affect cancer in a subject, such as killing cancer cells, inducing cancer apoptosis, reducing the rate of growth of cancer cells, reducing the incidence of metastasis or its incidence. , Reduces tumor size, suppresses tumor growth, reduces blood supply to tumors or cancer cells, promotes immune response to cancer cells or tumors, prevents or suppresses cancer progression, lifespan of cancer patients Can be extended. Antineoplastic agents include biologics (biotherapeutic), chemotherapeutic agents and radiotherapeutic agents. More generally, these other compositions are provided in a combination amount effective for cell death or growth inhibition. The process may involve contacting the expression construct with reagents or various factors at the same time. This may be achieved by contacting the cells with a single composition or pharmacological formulation containing the two agents, or by contacting the cells at the same time with two different compositions or formulations. One composition comprises an expression construct and the other comprises a reagent.

In some embodiments, an oncolytic virus carrying a gene encoding an immunostimulant and / or an immunotherapeutic agent is combined with an adjunct. In one embodiment, the adjunct is an oligonucleotide that contains an unmethylated CpG motif. The unmethylated dinucleotide CpG motif in bacterial deoxyribonucleic acid (DNA) has the advantage of stimulating multiple types of immune cells to secrete cytokines and promote innate and adaptive immunity.

Others Virotherapy may be given within minutes to weeks after drug treatment or after treatment. In the embodiment in which the other drug and the oncolytic virus are respectively administered to the cells, generally, by setting the interval between each administration to an appropriate length, the drug and the virus preferably exert a combined effect on the cells. To do. In such situations, it is expected that cells may be contacted with the two therapies at intervals of about 12-24 hours. However, in some situations, between several days (2 days, 3 days, 4 days, 5 days, 6 days or 7 days) to weeks (1 week, 2 weeks, 3 weeks, 4 weeks) between each dose. It may be necessary to significantly extend the treatment period with an interval of 5 weeks, 6 weeks, 7 weeks or 8 weeks).

Construction of an oHSV that expresses an immunostimulatory gene or an immunotherapeutic gene

Construction of Modified oHSV-1 Obligate Vector (IMMV201) In the production of oblivious vector-IMMV201 by bacterial artificial chromosome (BAC) technology, the ATGCAGGTGCAGTAATAGTAA cassette, which is a CMV promoter cassette that produces three stop codons, is used. -Inserted into an Easy vector. HSV-1 with a prototype (P) arrangement is used. HCS The pKO-CMV-STOP was obtained by inserting into a plasmid containing three stop codons and constructing the gene replacement plasmid in pKO5. IMMV201 was obtained by introducing pKO-CMV-STOP into Escherichia coli RecA + carrying BAC HSV by electroporation.

Viral replication failure due to BAC-IMMV201 in mammalian cells According to the instructions using OptiMEM agency (Life Technologies), 2-3 μg of BAC-IMMV201 constructed as described above in 70% confluent Vero cells. Transfected to. Incubate for 4 hours in an incubator at 37 ° C. and 5% CO _2. After incubation, replace with 4 mL of fresh complete growth medium (5% neonatal bovine serum / DMEM). No viral plaque was found within 3-4 days. When the experiment was repeated 3 times, no viral plaque was found.

Construction of oHSV-1 (IMMV202, 203, 303, 403) expressing a single immunostimulatory or immunotherapeutic gene Immunization by introducing a pKO gene cassette into Escherichia coli RecA + carrying IMMV201 by electroperforation. A CMV promoter gene cassette driving a stimulating gene (mouse IL12, human IL12) or an immunotherapeutic gene (human PD-1 scFV (SEQ ID NO: 1 or 3)) and a human CTLA-4 scFV (SEQ ID NO: 5) was obtained (Fig. 1).

Construction of oHSV-1 (IMMV502, 503, 504, 505, 507) expressing two immunostimulatory genes or immunotherapeutic genes Immunostimulatory gene (IL12) and immunotherapeutic gene (PD-1 scFV, CTLA-4 scFV) The CMV promoter cassette that drives the immunostimulatory gene was further inserted between the UL3 and UL4 genes in the IMMV202, 203, 303, and 403 vectors to generate recombinant oHSV that expresses the combination of the immunostimulatory gene (IL12) and the immunotherapeutic gene. (See FIG. 2).

Construction of oHSV-1 (IMMV603) Expressing One Immunostimulatory Gene and Two Immunotherapeutic Genes Humans by inserting CTLA-4 scFV between the UL37 and UL38 genes in the IMMV503 vector (see FIG. 2). IMMV603 was constructed to express three immunostimulatory cDNAs and immunotherapeutic cDNAs encoding IL12, PD-1 scFV and CTLA-4 scFV.

in vitro assay

Expression of PD-1 scFV In a series of experiments described herein, 2 × 10 ⁶ H293T cells transfected with a mock or plasmid were driven by the CMV promoter to produce His-tag scFV-anti-PD-1. Includes cDNA encoding and signal peptide coding regions derived from various natural sources. Forty-six hours after transfection, cell lysates and supernatant were collected, subjected to SDS-PAGE and Western blotting with anti-His antibody. 40 μL from 2 mL of the supernatant and 30 μL from 200 μL of cell lysate were removed and loaded on a 12% PAGE gel. The amount of PD-1 scFV accumulated in the cell culture supernatant (see FIG. 3) reflects the efficiency of the different signal peptides.

Binding Affinity of PD-1 scFV to PD-1 ^{2 × 10 6} H293T cells transfected with a mock or plasmid are driven by the CMV promoter and encode the His-tag scFV-anti-PD-1 cDNA and HMM38 signal peptide. including. Forty-six hours after transfection, the supernatant was collected and subjected to an ELISA assay for detection with anti-His antibody (see Figure 4). The secreted PD-1 scFV binds PD-1 in a dose-dependent manner.

Using in vitro cell viability mock (negative control) or IMMV507 (oHSV-1 expressing PD-1 and CTLA-4 antibodies) in the growth assay, 0.01, 0.1, 1, for each cell, respectively. The following human tumor cells were infected with ^{5 × 10 3} cells inoculated into a 96-well plate with a PFU at a magnification of 10, 100. Using the CCK-8 kit, cell viability of growth was measured every 24 hours until 96 hours had passed (see Figure 5). Absorbance at 450 nm was measured using a microplate reader (Biotech Epoch).

The tumor cell lines used in these studies were human bladder cancer T24, human esophageal cancer ECA109, human nasopharyngeal cancer CNE1, human colon cancer HCT116, human laryngeal cancer Hep2, human breast cancer MD-MB-231, human adenocarcinoma Hela, and human. Laryngeal cancer epithelial cell A549 and human non-small cell lung cancer cell H460.

IMMV507 killed tumor cells in a dose-dependent manner. Tumor cells decreased over time upon contact with the oHSV-1 virus.

As will be apparent to those skilled in the art, the present invention is particularly suitable for obtaining the purposes and advantages referred to herein or specific to this specification. The methods, variants and compositions described herein as representative and preferred embodiments are merely exemplary and have no limitation on the scope of the invention. For those skilled in the art, modifications and applications for other purposes are possible, but these are also included in the gist of the present invention, which is limited by the scope of the appended claims.

The specific content of the technical means exemplified herein is in the absence of one or more elements, one or more restrictions not specifically disclosed herein. It can be carried out as appropriate. The terms and expressions used are used for illustration purposes only, not for limitation, and when these terms and expressions are used, the features indicated or described or any equivalents thereof are intended to be excluded. However, various modifications may be included in the scope of the present invention. Therefore, although the present invention is specifically disclosed using preferred embodiments and features included in some cases, those skilled in the art may modify or modify the concepts disclosed herein. However, these modifications and changes are also included in the scope of the present invention, which is limited by the scope of the appended claims.

When the features or aspects of the present invention are described in the form of a Markush group or other alternative group, the present invention is in the form of a member of any single member or subgroup of the Markush group or other group. It is self-evident to those skilled in the art that it is equivalent to described in.

List of references
1. Andreansky, S., Soroceanu, L., Flotte, ER, Chou, J., Markert, JM, Gillespie, GY, Roizman, B., and Whitley, RJ (1997). Evaluation of genetically engineered herpes simplex viruses as oncolytic agents for human malignant brain tumors. Cancer Res 57, 1502-1509.
2. Andreansky, S., He, B., van Cott, J., McGhee, JV, Markert, JM, e, Y., Roizman, B. and Whitley, RJ Treatment of intracranial gliomas in immunocompetent mice using herpes simplex viruses that express murine interleukins. Gene Ther. 5: 121-130, 1998.
3. Andtbacka, RH, Kaufman, HL, Collichio, F., Amatruda, T., Senzer, N., Chesney, J., Delman, KA, Spitler, LE, Puzanov, I., Agarwala, SS, Milhem, M ., Cranmer, L., Curti, B., Lewis, K., Ross, M., Guthrie, T., Linette, GP, Daniels, GA, Harrington, K., Middleton, MR, Miller, WH, Jr. , Zager, JS, Ye, Y., Yao, B., Li, A., Doleman, S., VanderWalde, A., Gansert, J., and Coffin, RS (2015). Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. J Clin Oncol.
4. Brunda, MJ (1994). Interleukin-12. J Leukoc Biol 55, 280-288.
5. Burgess, AW, Camakaris, J., and Metcalf, D. (1977). Purification and properties of colony-stimulating factor from mouse lung-conditioned medium. J Biol Chem 252, 1998-2003.
6. Cassady, KA, Gross, M., and Roizman, B. (1998a). The herpes simplex virus US11 protein effectively compensates for the gamma1 (34.5) gene if present before activation of protein kinase R by precluding its phosphorylation and that of the alpha subunit of eukaryotic translation initiation factor 2. J Virol 72, 8620-8626.
7. Cassady, KA, Gross, M., and Roizman, B. (1998b). The second-site mutation in the herpes simplex virus recombinants lacking the gamma134.5 genes precludes shutoff of protein synthesis by blocking the phosphorylation of eIF-2alpha . J Virol 72, 7005-7011.
8. Cheema, TA, Wakimoto, H., Fecci, PE, Ning, J., Kuroda, T., Jeyaretna, DS, Martuza, RL, and Rabkin, SD (2013). Multifaceted oncolytic virus therapy for glioblastoma in an immunocompetent cancer stem cell model. Proc Natl Acad Sci USA 110, 12006-12011.
9. Chou, J., Chen, JJ, Gross, M., and Roizman, B. (1995). Association of a M (r) 90,000 phosphoprotein with protein kinase PKR in cells exhibiting enhanced phosphorylation of translation initiation factor eIF-2 alpha and premature shutoff of protein synthesis after infection with gamma 134.5- mutants of herpes simplex virus 1. Proc Natl Acad Sci USA 92, 10516-10520.
10. Chou, J., Kern, ER, Whitley, RJ, and Roizman, B. (1990). Mapping of herpes simplex virus-1 neurovirulence to gamma 134.5, a gene nonessential for growth in culture. Science 250, 1262-1266 ..
11. Chou, J., and Roizman, B. (1992). The gamma 1 (34.5) gene of herpes simplex virus 1 precludes neuroblastoma cells from triggering total shutoff of protein synthesis characteristic of programmed cell death in neuronal cells. Proc Natl Acad Sci USA 89, 3266-3270.
12. Cozzi, PJ, Burke, PB, Bhargav, A., Heston, WD, Huryk, B., Scardino, PT, and Fong, Y. (2002). Oncolytic viral gene therapy for prostate cancer using two immunod, replication- competent, genetically engineered herpes simplex viruses. Prostate 53, 95-100.
13. Cozzi, PJ, Malhotra, S., McAuliffe, P., Kooby, DA, Federoff, HJ, Huryk, B., Johnson, P., Scardino, PT, Heston, WD, and Fong, Y. (2001) Intravesical oncolytic viral therapy using immunogend, replication-competent herpes simplex viruses G207 and Nv1020 is effective in the treatment of bladder cancer in an orthotopic syngeneic model. FASEB J 15, 1306-1308.
14. Currier, MA, Adams, LC, Mahller, YY, and Cripe, TP (2005). Widespread intratumoral virus distribution with fractionated injection enables local control of large human rhabdomyosarcoma xenografts by oncolytic herpes simplex viruses. Cancer Gene Ther 12, 407- 416.
15. Dharmadhikari, N., Mehnert, JM, and Kaufman, HL (2015). Oncolytic virus immunotherapy for melanoma. Curr Treat Options Oncol 16, 326.
16. Fife, BT, and Pauken, KE (2011). The role of the PD-1 pathway in autoimmunity and peripheral tolerance. Ann NY Acad Sci 1217, 45-59.
17. Fong, Y., Kim, T., Bhargava, A., Schwartz, L., Brown, K., Brody, L., Covey, A., Karrasch, M., Getrajdman, G., Mescheder, A ., Jarnagin, W., and Kemeny, N. (2009). A herpes oncolytic virus can be delivered via the vasculature to produce biologic changes in human colorectal cancer. Mol Ther 17, 389-394.
18. Francisco, LM, Sage, PT, and Sharpe, AH (2010). The PD-1 pathway in tolerance and autoimmunity. Immunol Rev 236, 219-242.
19. Geevarghese, SK, Geller, DA, de Haan, HA, Horer, M., Knoll, AE, Mescheder, A., Nemunaitis, J., Reid, TR, Sze, DY, Tanabe, KK, and Tawfik, H (2010). Phase I / II study of oncolytic herpes simplex virus NV1020 in patients with extensively pretreated refractory colorectal cancer metastatic to the liver. Hum Gene Ther 21, 1119-1128.
20. Goshima, F., Esaki, S., Luo, C., Kamakura, M., Kimura, H., and Nishiyama, Y. (2014). Oncolytic viral therapy with a combination of HF10, a herpes simplex virus type 1 variant and granulocyte-macrophage colony-stimulating factor for murine ovarian cancer. Int J Cancer 134, 2865-2877.
21. Hsieh, CS, Macatonia, SE, Tripp, CS, Wolf, SF, O'Garra, A., and Murphy, KM (1993). Development of TH1 CD4 + T cells through IL-12 produced by Listeria-induced macrophages. Science 260, 547-549.
22. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S., and Steinman, RM (1992). Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte / macrophage colony-stimulating factor. J Exp Med 176, 1693-1702.
23. Keir, ME, Butte, MJ, Freeman, GJ, and Sharpe, AH (2008). PD-1 and its ligands in tolerance and immunity. Annu Rev Immunol 26, 677-704.
24. Kelly, KJ, Wong, J., and Fong, Y. (2008). Herpes simplex virus NV1020 as a novel and promising therapy for hepatic malignancy. Expert Opin Investig Drugs 17, 1105-1113.
25. Kemeny, N., Brown, K., Covey, A., Kim, T., Bhargava, A., Brody, L., Guilfoyle, B., Haag, NP, Karrasch, M., Glasschroeder, B. , Knoll, A., Getrajdman, G., Kowal, KJ, Jarnagin, WR, and Fong, Y. (2006). Phase I, open-label, dose-escalating study of a genetically engineered herpes simplex virus, NV1020, in subjects with metastatic colorectal carcinoma to the liver. Hum Gene Ther 17, 1214-1224.
26. Krummel, MF, and Allison, JP (1995). CD28 and CTLA-4 have decreasing effects on the response of T cells to stimulation. J Exp Med 182, 459-465.
27. Markert, JM, Cody, JJ, Parker, JN, Coleman, JM, Price, KH, Kern, ER, Quenelle, DC, Lakeman, AD, Schoeb, TR, Palmer, CA, Cartner, SC, Gillespie, GY, and Whitley, RJ (2012). Preclinical evaluation of a genetically engineered herpes simplex virus expressing interleukin-12. J Virol 86, 5304-5313.
28. Markert, JM, Gillespie, GY, Weichselbaum, RR, Roizman, B., and Whitley, RJ (2000). Genetically engineered HSV in the treatment of glioma: a review. Rev Med Virol 10, 17-30.
29. Markowicz, S., and Engleman, EG (1990). Granulocyte-macrophage colony-stimulating factor promotes differentiation and survival of human peripheral blood dendritic cells in vitro. J Clin Invest 85, 955-961.
30. Meignier, B., Longnecker, R., and Roizman, B. (1988). In vivo behavior of genetically engineered herpes simplex viruses R7017 and R7020: construction and evaluation in rodents. J Infect Dis 158, 602-614.
31. Miest, TS, and Cattaneo, R. (2014). New viruses for cancer therapy: meeting clinical needs. Nat Rev Microbiol 12, 23-34.
32. Mineta, T., Rabkin, SD, Yazaki, T., Hunter, WD, and Martuza, RL (1995). Attenuated multi-mutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1, 938- 943.
33. Russell, SJ, Peng, KW, and Bell, JC (2012). Oncolytic virotherapy. Nat Biotechnol 30, 658-670.
34. Shen, Y., and Nemunaitis, J. (2006). Herpes simplex virus 1 (HSV-1) for cancer treatment. Cancer Gene Ther 13, 975-992.
35. Smith, KD, Mezhir, JJ, Bickenbach, K., Veerapong, J., Charron, J., Posner, MC, Roizman, B., and Weichselbaum, RR (2006). Activated MEK suppresses activation of PKR and enables efficient replication and in vivo oncolysis by Deltagamma (1) 34.5 mutants of herpes simplex virus 1. J Virol 80, 1110-1120.
36. Topalian, SL, Drake, CG, and Pardoll, DM (2015). Immune Checkpoint Blockade: A Common Denominator Approach to Cancer Therapy. Cancer Cell 27, 450-461.
37. Valiante, NM, Rengaraju, M., and Trinchieri, G. (1992). Role of the production of natural killer cell stimulatory factor (NKSF / IL-12) in the ability of B cell lines to stimulate T and NK cell proliferation. Cell Immunol 145, 187-198.
38. Walker, JD, Sehgal, I., and Kousoulas, KG (2011). Oncolytic herpes simplex virus 1 encoding 15-prostaglandin dehydrogenase mitigates immunosuppression and reduces ectopic primary and metastatic breast cancer in mice. J Virol 85, 7363-7371 ..
39. Walunas, TL, Lenschow, DJ, Bakker, CY, Linsley, PS, Freeman, GJ, Green, JM, Thompson, CB, and Bluestone, JA (1994). CTLA-4 can function as a negative regulator of T cell activation. Immunity 1, 405-413.
40. Weichselbaum, RR, Roizman, B., and Whitley, RJ (2012). Treatment of tumors with genetically engineered herpes virus. In, pp. 11-27.
41. Wong, RJ, Kim, SH, Joe, JK, Shah, JP, Johnson, PA, and Fong, Y. (2001). Effective treatment of head and neck squamous cell carcinoma by an oncolytic herpes simplex virus. J Am Coll Surg 193, 12-21.

Claims (28)

A herpes simplex virus type 1 (HSV-1) vector
Contains deletion modifications in the wild-type HSV-1 genome
a) Only one copy of all two copy genes of the wild-type HSV-1 genome,
b) Only one copy of the wild-type HSV-1 genome in overlapping non-coding sequences and
c) A sequence required for the expression of all single-copy open reading frames (ORFs) of the wild HSV-1 genome, which comprises the ORF itself and the regulatory sequence required for the expression of each ORF. An HSV-1 vector comprising a sequence, which comprises a fully maintained promoter. The HSV-1 vector according to claim 1, wherein the two-copy gene comprises a gene encoding ICP0, ICP4, ICP34.5, ORF P and ORFO. The HSV-1 vector according to claim 1, wherein the HSV-1 has a genomic isomer of a prototype (P). The HSV-1 vector according to claim 1, wherein the HSV-1 is selected from the group consisting of F strain, KOS, and 17 strains. The HSV-1 vector according to claim 4, wherein the deletion removes nucleotide positions 117005 to 132096 in the genome of the F strain. The deletion variant in the case of I _L isomer of HSV-1 genome, including deletion of the promoter of the last gene in U _L component to the first gene in U _S component, according to claim 1 HSV-1 vector. The last known genes in _{U L component,} HSV-1 vector according to claim 6, wherein the _U L 56. The first known gene in _{U S} component, HSV-1 vector according to claim 6, wherein the _{U S} 1. The HSV-1 vector according to claim 1, which cannot replicate in mammalian cells sensitive to wild-type HSV-1. The HSV-1 vector according to claim 1, which cannot replicate in mammalian cells sensitive to wild-type HSV-1, but can replicate after insertion of additional cells or viral DNA sequences. The HSV-1 vector according to claim 1, wherein the overlapping non-coding sequence comprises a LAT domain and an "a" sequence. Recombinant oncolytic herpes simplex virus type 1 (HSV-1)
a) The HSV-1 vector according to claim 1 and
b) A foreign nucleic acid sequence encoding an immunostimulatory agent and / or an immunotherapeutic agent, which is stably integrated into at least a deleted region of the HSV-1 vector according to claim 1. , Containing, recombinant oncolytic HSV-1. The recombinant oncolytic HSV-1 according to claim 12, wherein the immunostimulant is selected from the group consisting of GM-CSF, IL-2, IL-12, IL-15, IL-24 and IL-27. The recombinant oncolytic HSV-1 according to claim 12, wherein the immunotherapeutic agent is an anti-PD-1 agent and / or an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 according to claim 12, wherein the foreign nucleic acid sequence encodes IL-12, an anti-PD-1 agent and / or an anti-CTLA-4 agent. The recombinant oncolytic HSV- according to claim 12, which comprises a first foreign nucleic acid sequence encoding IL-12 and a second foreign nucleic acid sequence encoding an anti-PD-1 or anti-CTLA-4 agent. 1. The recombinant oncolytic HSV-1 according to claim 12, which comprises a first foreign nucleic acid sequence encoding an anti-PD-1 agent and a second foreign nucleic acid sequence encoding an anti-CTLA-4 agent. Claim 12 comprising a first foreign nucleic acid sequence encoding IL-12, a second foreign nucleic acid sequence encoding an anti-PD-1 agent, and a third foreign nucleic acid sequence encoding an anti-CTLA-4 agent. The recombinant oncolytic HSV-1 according to. The recombinant oncolytic HSV-1 of claim 12, further comprising a promoter sequence operably linked to the foreign nucleic acid sequence. U _L in the first foreign nucleic acid sequence is inserted into the deleted region of the HSV-1 genome has been modified, the second foreign nucleic acid sequence is U _L component in HSV-1 genome is the modified 3 and _{U L} 4 recombinant oncolytic HSV-1 according to claim 16 or 17 being inserted between the genes. U _L in the first foreign nucleic acid sequence is inserted into the deleted region of the HSV-1 genome has been modified, the second foreign nucleic acid sequence is U _L component of HSV-1 genome is the modified It is inserted between the 3 and _UL 4 genes, and the third foreign nucleic acid sequence is _{inserted between the UL} 37 and _UL 38 genes in the _UL component of the modified HSV-1 genome. , The recombinant tumor-soluble HSV-1 according to claim 18. U _L in the first foreign nucleic acid sequence is inserted into the deleted region of the HSV-1 genome has been modified, the second foreign nucleic acid sequence is U _L component of HSV-1 genome is the modified It is inserted between the 37 and _UL 38 genes, and the third foreign nucleic acid sequence is _{inserted between the UL} 3 and _UL 4 genes in the _UL component of the modified HSV-1 genome. , The recombinant tumor-soluble HSV-1 according to claim 18. The recombinant oncolytic HSV-1 according to claim 19, wherein the promoter sequence is a CMV promoter or an Egr-1 promoter. The recombinant oncolytic HSV-1 according to claim 12, wherein the immunostimulant and / or the immunotherapeutic agent is humanized. The recombinant oncolytic HSV- according to claim 14, wherein the anti-PD-1 agent or the anti-CTLA-4 agent contains a variable region of an antibody for specific binding to a PD-1 or CTLA-4 epitope, respectively. 1. The recombinant oncolytic HSV-1 according to claim 25, wherein the antibody is a complete antibody, an antibody fragment, or a recombinant derivative of an antibody or antibody fragment. A pharmaceutical composition comprising an effective amount of the recombinant oncolytic HSV-1 according to any one of claims 12 to 26, and a pharmaceutically acceptable carrier. 28. The pharmaceutical composition of claim 27, which is prepared for intratumoral administration.

Images