JP2020511529A - CD19 compositions and methods for immunotherapy - Google Patents

Abstract

The present invention provides biological circuit systems, effector modules and compositions for cancer immunotherapy. Also provided are methods of inducing an anti-cancer immune response in a subject.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application is entitled U.S. Provisional Patent Application No. 62 / 466,601, filed March 3, 2017, entitled Compositions and Methods for Immunotherapy, and Anti CD19 compositions and methods for 17 years 4 years. Claims priority to U.S. Provisional Patent Application No. 62 / 484,052, filed March 11, the content of each of which is incorporated herein by reference in its entirety.

Sequence Listing This application is submitted with the Sequence Listing in electronic form. The array table is created on March 2, 2018, and has a file size of 2,116,001 bytes of 2095 — 1201PCT_SL. It is provided as a file named txt. Information in electronic form of the sequence listing is incorporated herein by reference in its entirety.

  The present invention relates to compositions and methods for immunotherapy. Provided in the present invention are polypeptides of biological circuit systems, effector modules, stimulus response elements (SREs) and immunotherapeutic agents, polynucleotides encoding the same, and polys thereof for use in cancer immunotherapy. Vectors and cells containing peptides and / or polynucleotides are included. In one embodiment, the composition comprises a destabilization domain (DD) that regulates protein stability.

  Cancer immunotherapy aims to eradicate cancer cells by rejuvenating the tumoricidal function of tumor-reactive immune cells, mainly T cells. Cancer immunotherapy strategies, including checkpoint blockade, adoptive cell transfer (ACT) and recent development of cancer vaccines that can increase anti-tumor immune effector cells, have produced significant results in some tumors. There is.

  The impact of host antitumor immunity and cancer immunotherapy is hampered by three major hurdles: 1) a low number of tumor antigen-specific T cells due to clonal deletion; 2) natural in the tumor microenvironment. Inadequate activation of immune cells and accumulation of tolerogenic antigen presenting cells; and 3) formation of immunosuppressive tumor microenvironment. Particularly in solid tumors, the therapeutic efficacy of immunotherapeutic regimens remains unsatisfactory due to the lack of an effective antitumor response in the immunosuppressive tumor microenvironment. Such tolerance is acquired because tumor cells often elicit tolerance or immunosuppression, and even truly foreign tumor antigens become tolerant. Such immune tolerance is also active and predominant because adoptive transfer of cancer vaccines and pre-activated immune effector cells (such as T cells) is suppressed by inhibitors of the tumor microenvironment (TME).

  Moreover, administration of modified T cells can lead to on-target / off-target toxicity and cytokine release syndrome (reviewed in Tey Clin. Transl. Immunol., 2014, 3: e17 10.1038).

In the case of adverse events, there is a need for the development of tunable switches that can turn expression of transgenic immunotherapeutics on or off. For example, the half-life of adoptive cell therapy can be very long and uncertain. Toxicity can be progressive, so a safety switch to eliminate injected cells is desired. Systems and methods that allow for high flexibility in adjusting transgenic protein levels and expression windows can enhance therapeutic efficacy and reduce potential side effects.
To develop regulatable therapeutic agents for disease treatment, particularly cancer immunotherapy, the present invention provides biological circuit systems that regulate the expression of immunotherapeutic agents. The biological circuit system includes a stimulus and at least one effector module that responds to the stimulus. The effector module may include a stimulus response element (SRE) that binds and responds to the stimulus, and an immunotherapeutic agent operably linked to the SRE. In one example, the SRE is a destabilization domain (DD) that is destabilized in the absence of its specific ligand and can be stabilized by binding to its specific ligand.

Tey Clin. Transl. Immunol. , 2014, 3: e17 10.10.38.

  The present invention provides compositions and methods for immunotherapy. The compositions relate to tunable systems and agents that induce an anti-cancer immune response within cells or within a subject. The adjustable system and agent may be a biologic circuit system that includes at least one effector module that responds to at least one stimulus. The biological circuit system may be, but is not limited to, a destabilization domain (DD) biological circuit system, a dimerized biological circuit system, a receptor biological circuit system, and a cell biological circuit system. These systems are based on co-owned US provisional patent application No. 62 / 320,864 filed April 11, 2016, No. 62 / 466,596 filed March 3, 2017 and International Publication WO2017 / 180587 (the contents of each of which is incorporated herein by reference in its entirety).

  In some embodiments, the composition for inducing an immune response can include an effector module. In some embodiments, the effector module may comprise a stimulus response element (SRE) operably linked to at least one payload. In one aspect, the payload may be an immunotherapeutic agent.

  In some embodiments, immunotherapeutic agents may be selected from, but not limited to, chimeric antigen receptors (CARs) and antibodies.

  In one aspect, the SRE of the composition is capable of responding to or interacting with at least one stimulus.

  In some embodiments, the SRE can include a destabilization domain (DD). DD can be derived from the parent protein or a mutant protein having one, two, three, or more amino acid mutations compared to the parent protein. In some embodiments, the parent protein is a human protein FKBP having the amino acid sequence of SEQ ID NO: 3; human DHFR having the amino acid sequence of SEQ ID NO: 2 (hDHFR); E. coli DHFR; PDE5 having the amino acid sequence of SEQ ID NO: 4; PPARγ having the amino acid sequence of SEQ ID NO: 5; CA2 having the amino acid sequence of SEQ ID NO: 6; or NQO2 having the amino acid sequence of SEQ ID NO: 7, Not limited to.

  In one aspect, the parent protein is hDHFR and the DD comprises a mutein. The mutein may include a single mutation, hDHFR (I17V), hDHFR (F59S), hDHFR (N65D), hDHFR (K81R), hDHFR (A107V), hDHFR (Y122I), hDHFR (N127Y), hDHFR (M140I). ), HDHFR (K185E), hDHFR (N186D), and hDHFR (M140I), hDHFR (wild type amino acids 2-187; N127Y), hDHFR (wild type amino acids 2-187; I17V), hDHFR (wild type amino acids). 2-187; Y122I), and hDHFR (wild type amino acids 2-187; K185E), but are not limited thereto. In some embodiments, the mutein may comprise two mutations, hDHFR (C7R, Y163C), hDHFR (A10V, H88Y), hDHFR (Q36K, Y122I), hDHFR (M53T, R138I), hDHFR (T57A, I72A), hDHFR (E63G, I176F), hDHFR (G21T, Y122I), hDHFR (L74N, Y122I), hDHFR (V75F, Y122I), hDHFR (L94A, T147A), DHFR (V121A, Y22I) 122HDHFR (H121FR). ), HDHFR (H131R, E144G), hDHFR (T137R, F143L), hDHFR (Y178H, E18IG), and hDHFR (Y183H, K185E), hDHFR (E16). G, I176F) hDHFR (wild type amino acids 2 to 187; I17V, Y122I), hDHFR (wild type amino acids 2 to 187; Y122I, M140I), hDHFR (wild type amino acids 2 to 187; N127Y, Y122I), hDHFR. (Wild type amino acids 2-187; E162G, I176F), and hDHFR (wild type amino acids 2-187; H131R, E144G), and hDHFR (wild type amino acids 2-187; Y122I, A125F). , But not limited to these. In some embodiments, the variant comprises three mutations, wherein the variant comprises hDHFR (V9A, S93R, P150L), hDHFR (I8V, K133E, Y163C), hDHFR (L23S, V121A, Y157C), hDHFR (K19E). , F89L, E181G), hDHFR (Q36F, N65F, Y122I), hDHFR (G54R, M140V, S168C), hDHFR (V110A, V136M, K177R), hDHFR (Q36F, Y122I, A125F), hDHFR (N49D, F49F, N49D, F49F). , And hDHFR (G21E, I72V, I176T), hDHFR (wild type amino acids 2-187; Q36F, Y122I, A125F), hDHFR (wild type amino acids 2-187; Y122I, H13. R, E144G), hDHFR (wild-type amino acid 2~187; E31D, F32M, V116I), and HDHFR (wild-type amino acid 2~187; Q36F, N65F, may be selected from Y122I), but are not limited to. In some embodiments, the variant may comprise 4 or more mutations, wherein the variant comprises hDHFR (V2A, R33G, Q36R, L100P, K185R), hDHFR (wild type amino acids 2-187; D22S, F32M). , R33S, Q36S, N65S), hDHFR (I17N, L98S, K99R, M112T, E151G, E162G, E172G), hDHFR (G16S, I17V, F89L, D96G, K123E, M140V, D146G, K156RK, RDHFR (hDFR), RDHFR (hDFR). L100P, E102G, N108D, K123R, H128R, D142G, F180L, K185E), hDHFR (R138G, D142G, F143S, K156R, K158E, E162G, V166A, K177E, Y1. 8C, K185E, N186S), hDHFR (N14S, P24S, F35L, M53T, K56E, R92G, S93G, N127S, H128Y, F135L, F143S, L159P, L160P, E173A, F180L), hDHFR (F35N, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R37G, R35G, R37G, R35G, R35G, R37G, R35G, R35G, R17G. K69E, R71G, L80P, K99G, G117D, L132P, I139V, M140I, D142G, D146G, E173G, D187G), hDHFR (L28P, N30H, M38V, V44A, L68S, N73G, R78G, A97T, 111T109K107R, K99R, A99T, K99R, K99R , L134P, F135V, T147A, I152V, K158R, E172G, V182A, E184R), hDHFR (V2A, I17 , N30D, E31G, Q36R, F59S, K69E, I72T, H88Y, F89L, N108D, K109E, V110A, I115V, Y122D, L132P, F135S, M140V, E144G, T147A, Y157C, V170A, K174R, N186L, D186R, D186H, D186H. E102G, Q103R, P104S, E105G, N108D, V113A, W114R, Y122C, M126I, N127R, H128Y, L132P, F135P, I139T, F148S, F149L, I152V, D153A, D169G, V170A, I176S18, 18K18R, K177R). , And hDHFR (A10T, Q13R, N14S, N20D, P24S, N30S, M38T, T 40A, K47R, N49S, K56R, I61T, K64R, K69R, I72A, R78G, E82G, F89L, D96G, N108D, M112V, W114R, Y122D, K123E, I139V, Q141R, D142G, F148L, E151G15R7R, E155G, E155G. Y183C, E184G, K185del, D187N), but is not limited thereto.

  In one aspect, the SRE stimulator may be trimethoprim or methotrexate.

  In some embodiments, the effector module immunotherapeutic agent is a chimeric antigen receptor (CAR). The chimeric antigen may have an extracellular targeting moiety; a transmembrane domain; an intracellular signaling domain; and optionally one or more costimulatory domains.

  In one aspect, the CAR may be selected from, but not limited to, a standard CAR, a split CAR, an off switch CAR, an on switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR. Not done.

  In some embodiments, the extracellular targeting portion of CAR is Ig NAR, Fab fragment, Fab ′ fragment, F (ab) ′ 2 fragment, F (ab) ′ 3 fragment, Fv, single chain variable fragment (scFv). , Bis-scFv, (scFv) 2, minibody, diabody, triabody, tetrabody, intracellular antibody, disulfide-stabilized Fv protein (dsFv), unibody, nanobody, and protein of interest, ligand, receptor, receptor It may be selected from, but is not limited to, an antigen binding region derived from an antibody capable of specifically binding to either a body fragment or a peptide aptamer.

  In one aspect, the extracellular targeting moiety may be an antibody-derived scFv. In one aspect, the scFv can specifically bind to the CD19 antigen.

  In one aspect, the CAR scFv may be a CD19 scFv. In some embodiments, the CD19 scFv is independent of the group consisting of any of SEQ ID NOs: 81-122 and a heavy chain variable region having an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 49-80. Light chain variable region having an amino acid sequence selected according to the present invention. In some embodiments, the CD19 scFv can have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 123-267 and 624.

  In some embodiments, the intracellular signaling domain of CAR may be the signaling domain derived from the T cell receptor CD3ζ. In some embodiments, the intracellular signaling domain may be selected from a cell surface molecule selected from the group consisting of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one aspect, the CAR can include a costimulatory domain. In some embodiments, the costimulatory domain is 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), gluco. It may be selected from the group consisting of corticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

  (B) A co-stimulatory domain exists, and 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid induction. Selected from the group consisting of tumor necrosis factor receptor (GITR), lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

  In some embodiments, the intracellular signaling domain of CAR can be the T cell receptor CD3ζ signaling domain, which can have the amino acid sequence of SEQ ID NO: 339.

  In some embodiments, the T cell receptor CD3ζ signaling domain of CAR having the amino acid sequence of SEQ ID NO: 626 can further comprise at least one costimulatory domain. The costimulatory domain can have the amino acid sequences of SEQ ID NOs: 268-374.

  In one embodiment, the transmembrane domain of CAR may be derived from the transmembrane region of the α, β or ζ chain of the T cell receptor. In one aspect, the transmembrane domain can be derived from the CD3ε chain of the T cell receptor. In one embodiment, the transmembrane domain is CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD148, DAP10, EpoRI, GITR, LAG3, ICOS, It may be derived from a molecule selected from Her2, OX40 (CD134), 4-1BB (CD137), CD152, CD154, PD-1 or CTLA-4. In another embodiment, the transmembrane domain may be derived from an immunoglobulin selected from the IgG1, IgD, IgG4, and IgG4 Fc regions. In one aspect, the transmembrane domain can have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 375-425 and 897-907.

  In some embodiments, the CAR of the effector module may further comprise a hinge region near the transmembrane domain. In one aspect, the hinge region may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 426-504.

  In some embodiments, the immunotherapeutic agent is an antibody that is specifically immunoreactive with an antigen selected from tumor-specific antigen (TSA), tumor-associated antigen (TAA), or antigenic epitopes. Good.

  In one aspect, the antigen may be an antigenic epitope. In some embodiments, the antigenic epitope may be CD19.

  In some embodiments, the antibody comprises a heavy chain variable region having an amino acid sequence independently selected from the group consisting of any of SEQ ID NOS: 49-80 and a group consisting of any of SEQ ID NOS: 81-122. Light chain variable regions having independently selected amino acid sequences. In one aspect, the antibody may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 123-267 and 624.

  In one aspect, the first effector module can have the amino acid sequence of any of SEQ ID NOs: 635-649, 1005-1010, 1015-1018 and 1215-1231.

  In some embodiments, the first SRE of the effector module may stabilize the immunotherapeutic agent at a stabilization ratio of 1 or greater, the stabilization ratio of the immunotherapeutic agent in the absence of stimulation. It may include the ratio of expression, function or level of immunotherapeutic agent in the presence of the stimulus to expression, function or level.

  In some embodiments, the SRE may destabilize the immunotherapeutic agent with a destabilization ratio of 0-0.09, the destabilization ratio in the absence of SRE-specific stimulation. It may include the ratio of the expression, function or level of the immunotherapeutic agent in the absence of SRE-specific stimulation to the expression, function or level of the constitutively expressed immunotherapeutic agent.

  The invention also provides a polynucleotide comprising the composition of the invention.

  In one aspect, the polynucleotide may be a DNA or RNA molecule. In one aspect, the polynucleotide may include spatiotemporally selected codons. In one aspect, the polynucleotide of the invention may be a DNA molecule. In some embodiments, the polynucleotide may be an RNA molecule. In one aspect, the RNA molecule may be a messenger molecule. In some embodiments, the RNA molecule may be chemically modified.

  In some embodiments, the polynucleotide may further comprise at least one additional feature selected from, but not limited to, a promoter, linker, signal peptide, tag, cleavage site, and targeting peptide.

  The invention also provides a vector comprising the polynucleotide described herein. In one aspect, the vector may be a viral vector. In some embodiments, viral vectors may be retroviral vectors, lentiviral vectors, gammaretroviral vectors, recombinant AAV vectors, adenoviral vectors, and oncolytic viral vectors.

  The invention also provides a composition of the invention, an immune cell for adoptive cell transfer (ACT) capable of expressing the polynucleotides described herein. In one aspect, immune cells may be infected or transfected with the vectors described herein. Immune cells for ACT include CD8 + T cells, CD4 + T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTL), tumor infiltrating lymphocytes (TIL), memory T cells, control It can be selected from, but not limited to, sex T (Treg) cells, cytokine-induced killer (CIK) cells, dendritic cells, human embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, or a mixture thereof.

  In some embodiments, immune cells may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

  In some embodiments, the immune cell may further express a composition comprising a second effector module, wherein the second effector module comprises a second SRE linked to a second immunotherapeutic agent. Including. In one aspect, the second immunotherapeutic agent can be selected from cytokines and cytokine-cytokine receptor fusions.

  In one aspect, the second immunotherapeutic agent may be a cytokine. In one aspect, the cytokine may be IL12 or IL15.

  In one aspect, the second immunotherapeutic agent may be a cytokine-cytokine receptor fusion polypeptide.

  In some embodiments, the cytokine-cytokine receptor fusion polypeptide can be selected from IL12-IL12 receptor fusion polypeptide, IL15-IL15 receptor fusion polypeptide, and IL15-IL15 receptor sushi domain fusion polypeptide. However, it is not limited to these.

  The invention provides a method of reducing a tumor volume or tumor burden in a subject, comprising contacting the subject with an immune cell of the invention. Also provided herein is a method of inducing an anti-tumor immune response in a subject, comprising administering immune cells of the system to the subject.

  The present invention also provides a method for enhancing the proliferation and / or survival of immune cells, which comprises contacting the immune cells with the composition of the present invention, the polynucleotide of the present invention, and / or the vector of the present invention.

  Also provided herein are methods of inducing an immune response in a subject and administering the composition of the invention, the polynucleotide of the invention, and / or the immune cells of the invention to the subject.

  The present invention also provides a method of identifying a domain of the CD19 antigen that does not bind to FMC63 antibody (a CD19 binding domain distinct from FMC63). This method comprises: (a) preparing a composition containing the CD19 antigen, (b) contacting the composition of (a) with a saturating level of the FMC63 antibody, and (c) of the composition of step (b) CD19 antigen based on differential binding of selected members of the library of CD19 binding agents compared to binding of FMC63 (d) binding to one or more selected members of the library of active CD19 binding agents. It may include identifying the domain. In some embodiments, phage display technology using the CD19 antigen as a seed sequence may be used to generate the binding domain of the library. In one aspect, the binding domain is Fab fragment, Fab ′ fragment, F (ab) ′ 2 fragment, F (ab) ′ 3 fragment, Fv, single chain variable fragment (scFv), bis-scFv, (scFv) 2, It can be selected from minibodies, diabodies, triabodies, tetrabodies, disulfide-stabilized Fv proteins (dsFv), unibodies, Nanobodies, or antigen binding regions of antibodies, and antibody fragments. In one aspect, the CD19 antigen may be selected from all or part of the human CD19 antigen and all or part of the rhesus CD19 antigen.

  The present invention also provides chimeric antigen receptors that may include a CD19 binding domain distinct from FMC63 obtained according to the methods described herein. Also provided herein is a stimulus response element (SRE) operably linked to a chimeric antigen receptor that comprises a CD19 binding domain distinct from FMC63.

  In some embodiments, the effector module comprises a stimulus response element (SRE) and at least one payload containing a protein of interest (POI).

  In some embodiments, the SRE may be the destabilization domain (DD). In some examples, the DD is a protein such as FKBP (FK506 binding protein), E. coli. E. coli DHFR (dihydrofolate reductase) (ecDHFR), human DHFR (hDHFR), or a mutant domain derived from any protein of interest. In this connection, the biological circuit system is a DD biological circuit system.

  The payload may be any immunotherapeutic agent used in cancer immunotherapy, eg, a chimeric drug receptor such as CD19 CAR that targets any molecule of a tumor cell, antibody, antigen binding domain, or combination of antigen binding domains ( CAR), IL12, IL15, or cytokines such as IL15 / IL15Ra fusions, or any agent capable of inducing an immune response. The SRE and payload may be operably linked via one or more linkers, and the location of the components may differ within the effector module.

  In some embodiments, the effector module comprises one or more additional features, such as expression of a protein of interest such as a linker sequence (having a particular sequence and length), a cleavage site, a regulatory element (a microRNA target site, etc.). A signal sequence that directs the effector module to a particular cellular or intracellular location, a penetrating sequence, or a tag and biomarker for tracking the effector module.

  In some embodiments, DD can stabilize the immunotherapeutic agent with a stabilizing ratio of at least 1 in the presence of the stimulus. According to the present invention, DD may destabilize immunotherapeutic agents in the absence of ligand with a destabilization ratio of 0-0.99.

  The invention provides isolated biological circuit polypeptides, effector modules, stimulus response elements (SREs) and payloads, and polynucleotides that encode any of the foregoing; vectors that include a polynucleotide of the invention; Cells expressing the peptides, polynucleotides and vectors are provided. The polypeptides, polynucleotides, viral vectors and cells are useful for inducing an anti-tumor immune response in a subject.

  In some embodiments, the vectors of the invention are viral vectors. Viral vectors can include, but are not limited to, retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, or lentivirus vectors.

  In some embodiments, the vectors of the invention may be non-viral vectors such as nanoparticles and liposomes.

  The invention also provides immune cells modified to include one or more of the polypeptides, polynucleotides, or vectors of the invention. The cells are cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CIK) cells, cytotoxic T lymphocytes (CTL). ), And immune effector cells including T cells such as tumor infiltrating lymphocytes (TIL). The modified cells may be used for adoptive cell transfer to treat disease (eg, cancer).

  The invention also provides methods of inducing an immune response in a subject using the compositions of the invention. Also provided are methods of reducing tumor burden in a subject using the compositions of the invention.

  Also provided herein are methods of identifying a binding domain distinct from FMC63 and using the CD19 antigen in which the FMC63 binding epitope is masked or absent. In some embodiments, the FMC63 binding domain can be included in the payload and effector modules of the invention.

The schematic diagram of the biological circuit system of this invention is shown. The biological circuit comprises a stimulus and at least one effector module responsive to the stimulus, the response to the stimulus producing a signal or result. The effector module includes at least one stimulus response element (SRE) and one payload. A representative effector module carrying one payload is shown. The signal sequence (SS), SRE, and payload may be located or placed in various configurations without a cleavage site (AF) or with a cleavage site (GZ, and AA-DD). An optional linker may be inserted between each component of the effector module. A representative effector module carrying two payloads and no cleavage site is shown. The two payloads may be directly linked or separated from each other. A representative effector module carrying two payloads and having a cleavage site is shown. In one embodiment, the SS is placed at the N-terminus of the construct, while the other components: SRE, the two payloads and the cleavage site may be placed at different positions (AL). In another embodiment, a cleavage site is placed at the N-terminus of the construct (MX). An optional linker may be inserted between each component of the effector module. Figure 3 shows an effector module of the invention carrying two payloads, placing the SRE at the N-terminus of the construct (AL), while SS, the two payloads and the cleavage site can be of any configuration. it can. An optional linker may be inserted between each component of the effector module. Figure 3 shows an effector module of the invention that carries two payloads, with either the two payloads (AF) or one of the two payloads (GX) placed at the N-terminus of the construct (A ~ L), while the SS, SRE, and cleavage sites can be of any configuration. An optional linker may be inserted between each component of the effector module. The typical structure of the stimulus and effector module in a biological circuit system is shown. Free (FIG. 7A) or membrane-bound (FIG. 7B) stimuli that bind to the SRE activate the transmembrane effector module. In response to the stimulus, intracellular signals / payloads are cleaved and downstream effectors / payloads are activated. Dual stimulus-a dual presenter type of biologic circuit is shown where two coupled stimuli (A and B) from two different presenters (eg different cells) are combined into a single receiver (eg another single). Cells) at the same time to bind to two different effector modules, producing a dual signal to the downstream payload. Dual stimulus-showing a single presenter type of biocircuit system, where two bound stimuli (A and B) from the same presenter (eg a single cell) are two different effector modules of another single cell. Bind simultaneously to and produce a dual signal. 1 shows a single stimulus-bridged receiver type biologic circuit system. In this configuration, the bound stimulus (A) binds to the effector module of the bridge cell and produces a signal that activates the payload, which stimulates the final receiver (eg, another cell) to another effector module (B). Become. Single stimulus-shows a single receiver type of biological circuit, where a single receiver contains two effector modules, which are successively activated by a single stimulus. Figure 3 shows a biocircuit system that requires dual activation. In this embodiment, one stimulus must first bind to the transmembrane effector module and pre-stimulate receiver cells activated by the other stimulus. The receiver is activated only when both stimuli are detected (B). 1 shows a standard effector module of the chimeric antigen receptor (CAR) system, which contains an antigen binding domain as the SRE and signaling domain (s) as the payload. Figure 3 shows a structural design of a tunable CAR system, where the transmembrane effector module contains an antigen-sensing antigen-binding domain and a first switch domain, and the intracellular module contains a second switch domain and a signaling domain. A stimulus (eg, a dimerized small molecule) can dimerize the first and second switch domains and assemble an activated CAR system. Figure 3 shows a schematic of a CAR system with one (A) or two (B and C) SREs incorporated into an effector module. 6 shows a design of split CAR to control T cell activation by dual stimulation (eg, antigen and small molecule). FIG. 16A shows normal T cell activation with dual activation of TCR and costimulatory receptors. A typical CAR design (FIG. 16B) combines an antigen recognition domain with a TCR signaling motif and a costimulatory motif into a single molecule. The split CAR system separates the components of normal CAR into two distinct effector modules, which can be reconstituted in the presence of heterodimerized small molecules (stimuli). Shows negative or positive regulation of CAR modified T cell activation. With or without the second stimulus, T cell activation can be controlled to be negative (A) or positive (B). Figure 3 shows a schematic of gated activation of CAR modified T cells. Whether it is unstimulated (eg, antigen) (FIG. 18A) or has an antigen that is unable to bind to the transmembrane effector module (FIG. 18B), activates the transmembrane effector module and prestimulates the receiver T cells. In the case of normal cells carrying only the antigen expressing the second effector (FIG. 18C), the receiver T cells remain inactive. T cells are activated when both stimuli (eg, two antigens) that bind the transmembrane effector module and the prestimulated effector are present in presenter cells (eg, cancer cells) (FIG. 18D). Figure 3 is a bar graph showing IL12 levels in various dilutions of medium derived from cells expressing DD-IL12. FIG. 6 is a bar graph showing Shield-1 dose-responsive induction of DD-IL12. Fig. 6 shows plasma IL12 levels in mice transplanted with SKOV3 cells. Figure 3 shows plasma IL12 levels in mice according to different Shield-1 dosing regimens. Western blot of IL15 protein levels in 293 cells. It is a histogram which shows the surface expression of IL15. It is a histogram which shows the surface expression of IL15Ra. 8 is a western blot of IL15 and hDHFR of HCT116 cells. 21A and 21B are Western blots showing CD3ζ and actin protein levels of the DD-CD19 CAR construct. FIG. 21C shows the expression of CD19 chimeric antigen receptor on Western blot using 4-1BB antibody. FIG. 21D is a bar graph showing surface expression of CD19 CAR. Same as above. The appearance frequency of IFNγ-positive T cells is shown. FIG. 23A shows IFNγ production in T cells. FIG. 23B shows T cell proliferation in the presence of IL15 / IL15Ra treatment. FIG. 23C is a dot plot showing the percentage of human cells after in vivo cell transplantation. FIG. 23D is a scatter plot showing CD4 + / CD8 + T cells. Same as above. FIG. 24A shows a T cell subpopulation that expresses CD19 CAR. FIG. 24B shows cell death caused by CD19 CAR expressing T cells. FIG. 25A is a bar graph showing IL15Ra positive cells in the presence of TMP treatment for 24 hours. FIG. 25B is a bar graph showing IL15Ra positive cells in the presence of TMP treatment for 48 hours. FIG. 25C is a bar graph showing IL15Ra positive cells in response to various concentrations of TMP. Same as above. 8 is a Western blot of IL15Ra protein levels in HCT116 cells. FIG. 27A shows the blood ratio of human T cells to mouse T cells. FIG. 27B represents the number of T cells in blood. FIG. 27C shows the ratio of CD4 cells to CD8 cells in blood. FIG. 27D shows the percentage of IL15Ra-positive CD4 and CD8 T cells in blood. Same as above. FIG. 28A shows T cell proliferation in response to cytokine treatment. 28B, 28C, and 28D show the appearance frequency of IFNγ-positive cells in the presence of IL12 treatment. Same as above. Same as above. 3 is a bar graph showing the effect of promoters on the expression of transgenes. Expression of CD19 in parental K562 cells and K562-CD19 cells is shown. 9 shows the proliferation of K562 cells co-cultured with T cells expressing the CAR construct under DD regulation in the presence or absence of ligand. Regions of target cells killed by T cells expressing the CAR construct under DD regulation in the presence of ligand are shown. FIG. 31A shows IFNγ concentration. FIG. 31B shows the IL2 concentration. The final IL12 concentration for each of the four groups tested is shown. It shows that IL12 is detectable in the kidney. It shows that IL12 is detectable in the tumor. Illustrates regulation of IL12 over 24 hours. The regulation in plasma is shown. 3 shows detection of flexi-IL12 in the kidney. It shows that IL12 expression was increased by restimulation. It shows that the ligand increased the production of IL12. It shows that the ligand increased the production of IL12. 3 shows concentration-dependent induction of IL12 secretion from human primary T cells in a concentration-dependent manner. 3 shows the induction of IL12 secretion from human primary T cells over time. FIG. 36A shows a dose response of Aquashield-induced DD-IL12 modulation in vivo. FIG. 36B shows that plasma levels of IL12 remain high in animals transplanted with constitutive IL12 transduced T cells. 37A and 37B show IL12 expression in vivo over 7 days. 37C and 37D show IL12 expression in vivo over 11 days. FIG. 37E shows the geometric MFI (GeoMFI) of granzyme B (GrB) after 7 days in CD8 + T cells. FIG. 37F shows GeoMFI of day 7 perforin in CD8 + T cells. Same as above. 5 shows the regulation of IL12 in the presence of PGK and EF1a promoters and FKBP domain. The relative expression of IL12 is shown. 5 shows the kinetics of IL15Ra surface expression on CD4 T cells after TMP treatment. FIG. 6 shows a Western blot of IL15-IL15Ra protein in HCT116 tumors from mice treated with TMP for 17 days in a xenograft assay. FIG. 9 is a graph of the results of an MSD assay of IL15 protein levels in HEK293 cells. 6 provides a FACS plot showing the expression of membrane bound IL15 after dose response testing of TMP. 2 is two graphs showing that the dose and time of TMP exposure in vitro affect the expression of membrane bound IL15. 43A-C show modulation of membrane-bound IL15 using IL15 (FIG. 43A), IL15Ra (FIG. 43B), or IL15 / IL15Ra dual ++ staining (FIG. 43C). FIG. 43D shows a FACS plot of IL15 expression. FIG. 43E is a graph of IL15 regulation in blood. FIG. 43F is a graph of plasma TMP levels. Same as above. Same as above. Same as above. FIG. 7 shows the regulation of membrane-bound IL15 by oral or intraperitoneal administration of TMP.

  The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are described herein. Other features, objects and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present description will control.

I. Introduction Cancer immunotherapy aims to induce or restore responsiveness of the immune system to cancer. Significant advances in immunotherapy research have led to the development of various strategies that can be broadly classified as active and passive immunotherapy. In general, these strategies can be utilized to kill cancer cells directly or to counter the immunosuppressive tumor microenvironment. Active immunotherapy aims to induce an endogenous, long-lasting tumor antigen-specific immune response. The response can be further enhanced by non-specific stimulation of immune response modifiers such as cytokines. In contrast, passive immunotherapy involves the approach of administering to the host immune effector molecules such as tumor antigen-specific cytotoxic T cells or antibodies. This approach is temporary and requires multiple treatments.

  Despite significant advances, the efficacy of current immunotherapy strategies is limited by the associated toxicity. These are often associated with narrow therapeutic durations associated with immunotherapy, and in part to therapeutic doses up to the potentially fatal limit of toxicity in order to achieve a clinically meaningful therapeutic effect. Arises from the need to push up. Moreover, adoptively transferred immune cells often continue to grow unpredictably in patients, leading to increased doses in vivo.

  A major risk associated with immunotherapy is the on-target but off-tumor side effect resulting from T cell activation in response to normal tissue expression of tumor-associated antigen (TAA). Clinical trials utilizing T cells expressing the T cell receptor for specific TAAs reported skin rashes, colitis, and hearing loss in response to immunotherapy.

  Immunotherapy can also result in on-target, on-tumor toxicity that emerges when tumor cells are killed in response to immunotherapy. Adverse effects include tumor lysis syndrome, cytokine release syndrome, and associated macrophage activation syndrome. Importantly, these adverse effects can occur during tumor destruction, thus toxicity can result from successful on-tumor immunotherapy. Therefore, the approach of regulatable control of immunotherapy is highly desirable as it has the potential to reduce toxicity and maximize efficacy.

  The present invention provides systems, compositions, immunotherapeutic agents and methods for cancer immunotherapy. These compositions provide tunable regulation of gene expression and function in immunotherapy. The invention also provides biological circuitry, effector modules, stimulus response elements (SREs) and payloads, and polynucleotides encoding any of the foregoing. In one aspect, the systems, compositions, immunotherapeutic agents and other components of the invention can be controlled by separately applied stimuli, thereby providing great freedom to regulate cancer immunotherapy. provide. Additionally, the systems, compositions and methods of the invention may be combined with therapeutic agents such as chemotherapeutic agents, small molecules, gene therapy and antibodies.

  The tunable nature of the systems and compositions of the invention has the potential to improve the efficacy and duration of efficacy of immunotherapy. Reversible silencing of biological activity of adoptively transferred cells using the compositions of the invention maximizes the potential for cell therapy without irreversibly killing and terminating treatment. can do.

  The present invention provides a method of fine tuning immunotherapy after administration to a patient. This improves the safety and efficacy of immunotherapy and increases the target population that can benefit from immunotherapy.

II. Compositions of the Invention According to the invention there is provided a biocircuit system comprising at least one effector module system in the core. Such effector module systems include at least one effector module associated with or integrated with one or more stimulus response elements (SREs). The overall architecture of the biocircuit of the present invention is shown in FIG. Generally, the stimulus response element (SRE) may be operably linked to a payload construct, which may be any protein of interest (POI) (eg, immunotherapeutic drug) to form an effector module. SREs are linked by producing a signal or result when activated by a particular stimulus, eg, a small molecule, by perpetuating a stabilizing or destabilizing signal, or any other type of regulation. The transcription level and / or protein level of the payload can be regulated up or down. For a detailed description of biological circuitry, see US Provisional Patent Application No. 62 / 320,864 filed April 11, 2016 or US Provisional Application No. 62 / 466,596 filed March 3, 2017 and International Publication. It can be found in WO2017 / 180587, the content of each of which is incorporated herein by reference in its entirety. According to the present invention, biological circuit systems, effector modules, SREs, and components that regulate the expression level and activity of any drug used in immunotherapy are provided.

  As used herein, "biological circuit" or "biological circuit system" refers to a circuit within a biological system or a circuit useful within a biological system that includes a stimulus and at least one effector module that responds to the stimulus. Defined, in which case the response to a stimulus produces at least one signal or result within, among, or as an indicator of, a biological system. Biological system is generally understood to be any cell, tissue, organ, organ system or organism such as an animal, plant, fungus, bacterium or virus. The biological circuit may also be an artificial circuit that uses the stimulation or effector module shown by the present invention to give a signal or result in a cell-free environment such as a diagnostic, reporter system, device, assay or kit. To be understood. Artificial circuits may be associated with one or more electronic, magnetic, or emissive components or components.

  According to the present invention, the biological circuitry may be destabilized domain (DD) biological circuitry, dimerized biological circuitry, receptor biological circuitry, and cellular biological circuitry. Any of these systems can act as a signal to any other of these biological circuit systems.

Effector module and SRE for immunotherapy
According to the present invention, biological circuit systems, effector modules, SREs, and components that regulate the expression level and activity of any drug used in immunotherapy are provided. By way of non-limiting example, immunotherapeutic agents include antibodies and fragments and variants thereof, cancer specific T cell receptors (TCR) and variants thereof, anti-tumor specific chimeric antigen receptors (CARs), chimeric switch receptors. , Co-inhibitory receptor or ligand inhibitor, costimulatory receptor and ligand agonist, cytokine, chemokine, cytokine receptor, chemokine receptor, soluble growth factor, metabolic factor, suicide gene, homing receptor, or cell and subject It may be any drug that induces an immune response in.

  As described above, the biological circuit of the present invention includes at least one effector module as a component of the effector module system. As used herein, an "effector module" is a single-component or multi-component construct or complex containing at least (a) one or more stimulus response elements (ie, a protein of interest (POI)). is there. As used herein, a "stimulus response element (SRE)" is a component of an effector module that binds, connects, associates with, or associates with one or more payloads of an effector module, and in some cases Is responsible for the responsiveness of the effector module to one or more stimuli. As used herein, the "responsive" nature of SREs to stimuli may be characterized by covalent or non-covalent interactions, direct or indirect association, or structural or chemical response to stimuli. Moreover, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response may ultimately result in a regulated signal or output. Such an output signal may be of a relative nature to the stimulus, for example a modulating effect between 1% and 100%, or a multiple such as 2, 3, 4, 5, 10 or more times. It may be an increase or a decrease.

  In some embodiments, the invention provides methods for regulating protein expression, function or level of protein. In some aspects, modulation of protein expression, function or level refers to at least about 20%, such as at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%. , 95%, 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20. -100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40 -60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50 ~ 95%, 50-100%, 60-70%, 60-80%, 60- 0%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90- 95%, 90-100% or 95-100% regulation of expression, function or level.

  In some embodiments, the present invention provides methods of modulating protein, expression, function or level by measuring stabilization and destabilization ratios. As used herein, the stabilization ratio is the expression, function, or level of a protein of interest in response to a stimulus relative to the expression, function, or level of the protein of interest in the absence of a SRE-specific stimulus. Can be defined as the ratio of In some aspects, the stabilization ratio is at least 1, such as at least 1-10, 1-20, 1-30, 1-40, 1-50, 1-60, 1-70, 1-80, 1. ~ 90, 1-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-95, 20-100, 30-40, 30-50 , 30-60, 30-70, 30-80, 30-90, 30-95, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-95, 40. -100, 50-60, 50-70, 50-80, 50-90, 50-95, 50-100, 60-70, 60-80, 60-90, 60-95, 60-100, 70-80. , 70-90, 70-95, 70-100, 80-90, 80-9 , It is a 80～100,90～95,90～100 or 95-100. As used herein, the destabilization ratio is a constitutively expressed effector module specific for expression, function, or level of a protein of interest in the absence of SRE-specific stimuli. It can be defined as the ratio of expression, function, or level of protein of interest in the absence of stimulus. As used herein, "constitutively" refers to the expression, function or level of a protein of interest that is not linked to the SRE and is therefore expressed both in the presence and absence of stimulus. In some aspects, the destabilization rate is at least 0, such as at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0. .9, or at least 0-0.1, 0-0.2, 0-0.3, 0-0.4, 0-0.5, 0-0.6, 0-0.7, 0-0. .8, 0-0.9, 0.1-0.2, 0.1-0.3, 0.1-0.4, 0.1-0.5, 0.1-0.6, 0 1-0.7, 0.1-0.8, 0.1-0.9, 0.2-0.3, 0.2-0.4, 0.2-0.5, 0.2 ~ 0.6, 0.2-0.7, 0.2-0.8, 0.2-0.9, 0.3-0.4, 0.3-0.5, 0.3-0 .6, 0.3 to 0.7, 0.3 to 0.8, 0.3 to 0.9, 0.4 to 0.5, 0.4 to 0.6, 0.4 to 0.7 , 0.4 to 0.8, 0.4 0.9, 0.5-0.6, 0.5-0.7, 0.5-0.8, 0.5-0.9, 0.6-0.7, 0.6-0. 8, 0.6-0.9, 0.7-0.8, 0.7-0.9 or 0.8-0.9.

  In some embodiments, the stimulation of the present invention may be ultrasonic stimulation. In some embodiments, the SREs of this invention may be derived from mechanosensitive proteins. In one embodiment, the SRE of the invention may be the mechanically sensitive ion channel, Piezo 1.

  Expression of the payload of interest in such cases is modulated by providing a focused ultrasound stimulus. In other embodiments, the SRE of the invention may be from a calcium biosensor and the stimulus of the invention may be calcium. Calcium may be produced by ultrasonically induced mechanical stimulation of mechanosensitive ion channels. Ultrasonic activation of ion channels causes an influx of calcium, which produces a stimulus. In one embodiment, the mechanosensitive ion channel is Piezo 1. Mechanical sensors may be advantageous for use because they provide spatial control at specific locations within the body.

  The SRE of the effector module may be selected from, but not limited to, a peptide, a peptide complex, a peptide-protein complex, a protein, a fusion protein, a protein complex, a protein-protein complex. The SRE can include any native or mutant protein, or one or more regions from an antibody. In this aspect, the SRE is an element that responds to the stimulus and can regulate subcellular localization, intramolecular activation, and / or payload degradation.

  In some embodiments, the effector module of the invention comprises one or more signal sequences (SS), one or more cleavage and / or processing sites, one or more targeting and / or penetrating peptides, one or more Additional properties that facilitate expression and regulation of the effector module may be included, such as tags and / or one or more linkers. Furthermore, the effector module of the present invention may further include other regulatory moieties such as inducible promoters, enhancer sequences, microRNA sites, and / or microRNA targeting sites. Each aspect or tailored modality can result in a differentially tailored characteristic of the effector module or biological circuit. For example, the SRE may represent a destabilizing domain, while mutations in the protein payload may alter its cleavage site or dimerization properties or half-life, resulting in one or more microRNA or microRNA binding sites. Inclusion may confer cell detargeting or transport properties. As a result, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biometric circuits may be designed to include one, two, three, four, or more tuned properties.

  In some embodiments, the effector modules of the present invention can include one or more degrons to regulate expression. As used herein, "degron" refers to the minimal sequence within a protein sufficient for recognition and degradation by the proteolytic system. An important property of degrons is that the degron is transposable, that is, the addition of the degron to the sequence degrades the sequence. In some embodiments, degrons may be added to the destabilization domain, the payload, or both. Incorporation of degron into the effector module of the invention may confer additional protein instability on the effector module, which may be used to minimize basal expression. In some embodiments, the degron may be an N degron, a phosphodegron, a heat-inducible degron, a photosensitive degron, an oxygen-dependent degron. As a non-limiting example, Degulon is described by Takeuchi et al. Ornithine decarboxylase degron described by (Takeuchi J et al. (2008). Biochem J. 2008 Mar 1; 410 (2): 401-7; the content of which is incorporated by reference in its entirety. ). Other examples of degrons useful in the present invention include degrons described in International Patent Publication Nos. WO2017004022, WO201610343, and WO2011062962; the contents of each are incorporated by reference in their entireties.

  As shown in FIG. 2, an exemplary effector module embodiment including one payload, ie, one immunotherapeutic agent, is shown. Each component of the effector module may be located or arranged in various configurations without a cleavage site (A-F) or with a cleavage site (G-Z, and AA-DD). An optional linker may be inserted between each component of the effector module.

  3-6 show an exemplary effector module embodiment that includes two payloads, two immunotherapeutic agents. In some aspects, the effector module may include more than two immunotherapeutic agents (payloads) under the control of the same SRE (eg, the same DD). Two or more agents may be directly linked to each other or separated (FIG. 3). The SRE may be located at the N-terminus of the construct, the C-terminus of the construct, or at an internal position.

  In some aspects, the two or more immunotherapeutic agents may be of the same type, eg, two antibodies, or different types, eg, CAR construct and cytokine IL12. Biological circuits and components that utilize such effector molecules are shown in FIGS.

  In some embodiments, the biocircuits of the invention may be modified to reduce their immunogenicity. Immunogenicity is the result of a series of complex reactions to substances recognized as foreign, including the production of neutralizing and non-neutralizing antibodies, the formation of immune complexes, complement activation, mast cells. Activation, inflammation, hypersensitivity reactions, and anaphylaxis can be included. Several factors can contribute to the immunogenicity of a protein, including, but not limited to, the sequence of the protein, the route and frequency of administration, and the patient population. In a preferred embodiment, protein engineering may be used to reduce the immunogenicity of the compositions of the invention. In some embodiments, modifications to reduce immunogenicity can include modifications that reduce binding of processed peptides derived from the parental sequence to MHC proteins. For example, amino acid modifications may be designed to zero or minimize the number of immune epitopes predicted to bind with high affinity to any common MHC allele. Several methods of identifying MHC binding epitopes of known protein sequences are known in the art and may be used to score the epitopes in the compositions of the invention. Such methods are disclosed in US Patent Publication Nos. US20020119492, US2004030380, and US20060148009; the contents of each are incorporated by reference in their entireties.

  Epitope identification and subsequent sequence modification may be applied to reduce immunogenicity. Identification of immunogenic epitopes may be accomplished physically or by electronic calculation. Physical methods of epitope identification can include, for example, mass spectrometry and tissue culture / cell techniques. Information obtained in antigen processing, antigen loading and presentation, structural data and / or proteomics data to identify non-self peptides that are likely to have good binding properties in the groove of MHC, which can be brought about by antigen processing An electronic computing approach that utilizes may also be used. One or more mutations that direct the expression of the protein may be introduced into the biological circuit of the invention to maintain its function while at the same time making the identified epitope less immunogenic or abrogated.

  In some embodiments, protein modifications incorporated into the structure of compositions of the invention to interfere with antigen processing and peptide loading such as glycosylation and PEGylation may also be useful in the invention. The compositions of the invention may also be designed to include non-classical amino acid side chains to design less immunogenic compositions. Any of the methods discussed in International Patent Publication No. WO20055051975 for reducing immunogenicity can be useful in the present invention, the contents of which are incorporated by reference in their entirety.

  In one embodiment, patients may be stratified according to immunogenic peptides presented by immune cells and used as a parameter to determine an appropriate patient cohort that may have therapeutic benefit for the compositions of the invention. Good.

  In some embodiments, reduced immunogenicity can be achieved by limiting immunoproteasome processing. The proteasome is an important cellular protease and is found in two forms: expressed in all cell types and in active form, for example a constitutive proteasome containing the catalytic subunit, as well as in hematopoietic cells. , An immunoproteasome containing different active subunits called low molecular weight proteins (LMP), LMP-2, LMP-7 and LMP-10. The immune proteasome exhibits altered peptidase activity and cleavage site preferences, leading to more efficient release of many MHC class I epitopes. The well-described function of the immune proteasome is to produce peptides with a hydrophobic C-terminus that can be processed to fit the groove of MHC class I molecules. Deol P et al. Have shown that the immune proteasome results in frequent cleavage of specific peptide bonds, which allows the specific peptide to appear faster on the surface of antigen presenting cells; and can increase peptide abundance (Deol P et (2007) J Immunol 178 (12) 7557-7562; the contents of which are incorporated herein by reference in their entirety). This study shows that reduced immune proteasome processing may be associated with reduced immunogenicity. In some embodiments, the sequences encoding the compositions of the invention may be modified to reduce the immunogenicity of the compositions of the invention and prevent immune proteasome processing. Also, the biological circuit of the present invention may be used in combination with an immunoproteasome selective inhibitor to achieve the same effect. Examples of inhibitors useful in the present invention include UK-101 (Bli selective compound), IPSI-001, ONX0914 (PR-957), and PR-924 (IPSI).

1. Destabilization domain (DD)
In some embodiments, biological circuit systems, effector modules, and compositions of the invention relate to post-translational modulation of protein (payload) function of the anti-tumor immune response of immunotherapeutic agents. In one embodiment, the SRE is a stabilization / destabilization domain (DD). The presence, absence, or amount of a small molecule ligand that binds or interacts with DD can modulate the stability of the payload (s) and thus the function of the payload, by virtue of such binding or interaction. Depending on the degree of binding and / or interaction, the altered functionality of the payload may be different, thus providing "coordination" of payload functionality.

  In some embodiments, a destabilization domain described herein or known in the art is associated with any of the immunotherapeutic agents (payloads) presented herein to provide a biocircuit of the invention. It may be used as the SRE of the system. The destabilization domain (DD) is a small protein domain that can add to a target protein of interest. DD destabilizes the adhesion protein of interest in the absence of DD binding ligands, such that the protein is rapidly degraded by the cell's ubiquitin-proteasome system (Stankunas, K., et al., Mol. Cell, 2003, 12: 1615-1624; Banaszynski, et al., Cell; 2006, 126 (5): 995-1004; Banaszynski, LA, and Wandless, T. J. Chem. Biol., 2006. 13: 11-21 and Rakhit R et al., Chem Biol. 2014; 21 (9): 1238-1252). However, when a particular small molecule ligand binds to its intended DD as a ligand binding partner, instability is reversed and protein function is restored. The conditional nature of DD stability allows a rapid and non-perturbative switch from a stable protein to a degradation-labile substrate. Furthermore, its ligand concentration dependence further provides adjustable control of the degradation rate.

  In some embodiments, the desired properties of DD are low protein levels (ie, low basal stability) in the absence of ligand for DD, large dynamic range, robust and predictable dose response behavior, and rapidity. Degradation rates can be included, but are not limited to. In some cases, DD that binds the desired ligand rather than the endogenous molecule is preferred.

  FKBP / shield-1 system (Egeler et al., J Biol. Chem. 2011,286 (36): 32328-31336; the contents of which are incorporated herein by reference in its entirety), ecDHFR and its ligand trimethoprim ( TMP); an estrogen receptor domain that can be regulated by several estrogen receptor antagonists (Miyazaki et al., J Am Chem. Soc., 2012, 134 (9): 3942-3945; , And a fluorescent destabilization domain (FDD) derived from the bilirubin-inducible fluorescent protein UnaG and its cognate ligand bilirubin (BR) (Navarro et al., ACS Chem Biol., 2). 016, June 6; the contents of which are hereby incorporated by reference in their entirety), and several protein domains with destabilizing properties and their small molecule pairs have been identified and used to control protein expression. in use.

  Known DD also include those described in US Pat. No. 8,173,792 and US Pat. No. 8,530,636, the contents of which are incorporated herein by reference in their entirety. ..

  In some embodiments, the DD of the present invention may be derived from a number of known sequences that are recognized as capable of post-translational regulation of proteins. For example, Xiong et al. GUS when the non-catalytic N-terminal domain (54 residues) of Arabidopsis ACS7 (1-aminocyclopropane-1-carboxylic acid synthase) was fused to a β-glucuronidase (GUS) reporter. It has been shown that the accumulation of fusion proteins can be significantly reduced (Xiong et al., J. Exp. Bot., 2014, 65 (15): 4397-4408). Xiong et al. Further showed that both exogenous 1-aminocyclopropane-1-carboxylic acid (ACC) treatment and salts were able to rescue the N-terminus of ACS and the accumulation level of GUS fusion protein. The N-terminus of ACS mediates regulation of ACS7 stability via the ubiquitin-26S proteasome pathway.

  Another non-limiting example is the stability control region of tropomyosin (Tm) that controls protein stability (SCR, residues 97-118). The destabilizing mutation L110A and the stabilizing mutation A109L dramatically affect the dynamics of the tropomyosin protein (Kirwan and Hodges, J. Biol. Chem., 2014, 289: 4356-4366). Such sequences can be screened for ligands that bind to them and regulate their stability. The identified sequence and ligand pair may be used as a component of the invention.

  In some embodiments, the DD of the present invention may be developed from known proteins. The region or portion or domain of the wild type protein may be utilized in whole or in part as SRE / DD. They may be combined and permuted to create new peptides, proteins, regions or domains, any of which may be used as SRE / DD or as a starting point for the design of additional SRE and / or DD. .

Ligands such as small molecules known to bind to candidate proteins can be tested for their regulation in protein response. Small molecules are approved as clinically safe and may have appropriate pharmacokinetics and distribution. In some embodiments, the stimulus is a ligand of the destabilization domain (DD), eg, a small molecule that binds to the destabilization domain and stabilizes the POI fused to the destabilization domain. In some embodiments, the ligands of the present invention, DD and SRE, include, but are not limited to, co-pending co-owned US provisional application No. 62 / 320,864, filed April 11, 2016. Tables 2 to 4 or any of those shown in U.S. Provisional Application No. 62 / 466,596 filed March 3, 2017 and WO 2017/180587, the contents of each of which is incorporated by reference in its entirety. Incorporated herein by reference. Table 1 shows some examples of proteins that can be used to develop DD and its ligands.

In some embodiments, the DD of the present invention can be FKBP DD or ecDHFR DD as listed in Table 2. The positions of the mutant amino acids listed in Table 2 are for ecDHFR (Uniprot ID: P0ABQ4) of SEQ ID NO: 1 in the case of ecDHFR DD, and for FKBP (Uniprot ID: P62942) of SEQ ID NO: 3 in the case of FKBP DD. is there.

  The inventors of the present invention have tested and identified several candidate human proteins that can be used to develop destabilizing domains. As shown in Table 2, these candidates include human DHFR (hDHFR), PDE5 (phosphodiesterase 5), PPARγ (peroxisome proliferator-activated receptor γ), CA2 (carbohydrate anhydrase II) and NQO2 (NRH: quinone oxidation). Reductase 2) is included. The destabilization domain sequence candidates (as templates) identified from the protein domains of these proteins may be mutated to generate variant libraries based on the template candidate domain sequences. The mutagenesis strategies used for DD library generation can include, for example, site-directed mutagenesis using structure-guided information; or random mutagenesis, eg, using error-prone PCR, or a combination of both. In some embodiments, the destabilization domains identified using random mutagenesis are used to identify structural features of the candidate DD that may be required for destabilization, which is then used to site-specifically. Mutagenesis may be used to further generate a mutation library.

  In some embodiments, E. A novel DD derived from E. coli DHFR (ecDHFR) may comprise amino acids 2-159 of the wild type ecDHFR sequence. This is sometimes called the M1del mutation.

  In some embodiments, the novel DD from ecDHFR may comprise amino acids 2-159 of the wild type ecDHFR sequence (also referred to as the M1del mutation), including M1del, R12Y, R12H, Y100I, and E129K. Can include 1, 2, 3, 4, 5 or more mutations, without limitation.

  In some embodiments, the novel FKBP-derived DD may have amino acids 2-107 of the wild-type FKBP sequence. This is sometimes called the M1del mutation.

  In some embodiments, the novel FKBP-derived DD may have amino acids 2-107 of the wild-type FBKP sequence (also referred to as the M1del mutation), and contains M1del, E31G, F36V, R71G, K105E, and L106P. It may include 1, 2, 3, 4, 5 or more mutations including but not limited to.

  In some embodiments, the DD mutant library may be screened for mutations with altered, preferably higher, binding affinity for the ligand as compared to the wild-type protein. DD libraries may be screened using more than one ligand, and DD mutations that are stabilized by some ligands but not others may be preferentially selected. Also, DD mutations that preferentially bind to the ligand as compared to the native protein may be selected. Such methods may be used to optimize ligand selection and ligand binding affinity of DD. Moreover, such an approach can be used to minimize the deleterious effects caused by off-target ligand binding.

  In some embodiments, barcodes may be used to screen mutant libraries to identify suitable DDs. Such a method may be used to detect, identify, and quantify individual mutant clones within a heterogeneous mutant library. Each DD variant in the library may have different barcode sequences (relative to each other). In other examples, the polynucleotide may also have different barcode sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleobases. Each DD variant in the library can have multiple barcode sequences. When using more than one, each bar code may be used such that it is unique to any other bar code. Alternatively, each barcode used may not be unique, but the combination of barcodes used may create a unique array that can be individually tracked. The barcode sequence may be located upstream of the SRE, downstream of the SRE, or in some cases within the SRE. DD variants may be identified by barcode, using sequencing approaches such as Sanger or next-generation sequencing, or by polymerase chain reaction or quantitative polymerase chain reaction. In some embodiments, polymerase chain reaction primers that amplify different size products for each barcode may be used to identify each barcode on an agarose gel. In another example, each barcode may have a unique quantitative polymerase chain reaction probe sequence that allows targeted amplification of each barcode.

  In some embodiments, the DD of the present invention may be derived from human dihydrofolate reductase (hDHFR). hDHFR is a small (18 kDa) enzyme that catalyzes the reduction of dihydrofolate and plays an important role in various anabolic pathways. Dihydrofolate reductase (DHFR) is an essential enzyme that converts 7,8-dihydrofolate (DHF) to 5,6,7,8 tetrahydrofolate (THF) in the presence of nicotinamide adenine dihydrogen phosphate (NADPH). Is. Antifolates, such as methotrexate (MTX), a structural analogue of folic acid, bind more strongly to DHFR than to its natural substrate DHF and interfere with folate metabolism, mainly by inhibiting dihydrofolate reductase, and purine and pyrimidine precursors. Suppress synthesis. Other inhibitors of hDHFR, such as folic acid, TQD, trimethoprim (TMP), epigallocatechin gallate (EGCG) and ECG (epicatechin gallate) may also bind to hDHFR variants and regulate their stability. it can. In one aspect of the invention, the DD of the invention is a single mutation hDHFR (Y122I), hDHFR (K81R), hDHFR (F59S), hDHFR (I17V), hDHFR (N65D), hDHFR (A107V), hDHFR (N127Y). , HDHFR (K185E), hDHFR (N186D), and hDHFR (M140I); Double mutation: hDHFR (M53T, R138I), hDHFR (V75F, Y122I), hDHFR (A125F, Y122I), hDHFR (L74N, H122I), hDFR. (L94A, T147A), hDHFR (G21T, Y122I), hDHFR (V121A, Y122I), hDHFR (Q36K, Y122I), hDHFR (C7R, Y163C), hDHFR (Y178H, E18). G), hDHFR (A10V, H88Y), hDHFR (T137R, F143L), hDHFR (E63G, I176F), hDHFR (T57A, I72A), hDHFR (H131R, E144G), and hDHFR (Y183H, K185E); hDHFR (Q36F, N65F, Y122I), hDHFR (G21E, I72V, I176T), hDHFR (I8V, K133E, Y163C), hDHFR (V9A, S93R, P150L), hDHFR (K19E, F89L, E181G, 54D, hD). , S168C), hDHFR (L23S, V121A, Y157C), hDHFR (V110A, V136M, K177R), and hDHFR (N49D, F59S, D153). ) May be hDHFR variant comprising.

In one embodiment, the stimulus is a small molecule that binds to the SRE and regulates post-translational protein levels. In one aspect, the DHFR ligands: trimethoprim (TMP) and methotrexate (MTX) are used to stabilize hDHFR variants. The destabilizing domains based on hDHFR are listed in Table 3. The positions of the mutant amino acids listed in Table 3 are relative to human DHFR (Uniprot ID: P00374) of SEQ ID NO: 2 in the case of human DHFR. In Table 3, "del" means that the mutation at that position compared to the wild type sequence is a deletion of an amino acid.

  In some embodiments, DD mutations that do not inhibit ligand binding may be preferentially selected. In some embodiments, mutation of residues in DHFR may improve ligand binding. As amino acid positions selected for mutation, aspartic acid at position 22 of SEQ ID NO: 2, glutamic acid at position 31 of SEQ ID NO: 2; phenylalanine at position 32 of SEQ ID NO: 2; arginine at position 33 of SEQ ID NO: 2; SEQ ID NO: 2 Glutamine at position 36; asparagine at position 65 of SEQ ID NO: 2; and valine at position 115 of SEQ ID NO: 2. In some embodiments, the DD of the invention utilizes one or more mutations, including but not limited to D22S, E31D, F32M, R33S, Q36S, N65S, and V116I, to improve TMP binding. You may let me. The positions of the mutant amino acids are relative to the wild type human DHFR (Uniprot ID: P00374) of SEQ ID NO: 2.

  In some embodiments, the novel DHFR-derived DD is M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S. , P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, N49D, M53T. , K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, N108D. K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H131R, N127S, N127H, H128R. L132P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, 137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G315, 1515E15D15A15D, I152V, D152G. Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, C174R, I176T, K176R, I176T, K176R, I176K, K176R, I176T, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K176R, K17R17E17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K17K8K V182A, Y183C, Y183H, E184R, E184G, K185 It may include 1, 2, 3, 4, 5 or more mutations including but not limited to R, K185del, K185E, N186S, N186D, D187G, and D187N.

  In some embodiments, the novel DD from human DHFR may comprise amino acids 2-187 of the wild-type human DHFR sequence. This is sometimes called the M1del mutation.

  In some embodiments, the novel DD from human DHFR may have amino acids 2-187 (also referred to as M1del mutation) of the wild-type human DHFR sequence, M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, F35L, F35L. Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65. , L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G. , L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R , K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L1 2P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H, 1, 2, 3, 4, 5, or more, including but not limited to F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N. Mutations may be included.

2. Payload: Immunotherapeutic Agents In some embodiments, the payload of the present invention may be an immunotherapeutic agent that induces an immune response in an organism. Immunotherapeutic agents are antibodies and fragments and variants thereof, chimeric antigen receptors (CARs), chimeric switch receptors, cytokines, chemokines, cytokine receptors, chemokine receptors, cytokine-cytokine receptor fusion polypeptides, or immune responses. It can be, but is not limited to, any agent that induces. In one embodiment, the immunotherapeutic agent induces an anti-cancer immune response in the cell or subject.

Antibodies In some embodiments, antibodies, fragments and variants thereof are payloads of the invention.

  In some embodiments, the antibodies of the invention include, but are not limited to, Table 5 of co-pending co-owned US provisional patent application No. 62 / 320,864, filed April 11, 2016. Or any of those shown in US Patent Application No. 62 / 466,596 filed March 3, 2017 and International Publication WO 2017/180587, the contents of each of which are herein incorporated by reference in their entirety. Incorporate.

Antibody Fragments and Variants In some embodiments, antibody fragments and variants can include an antigen binding region from an intact antibody. Examples of antibody fragments and variants are Fab, Fab ', F (ab') 2, and Fv fragments; bispecific antibodies; linear antibodies; single chain antibody molecules such as single chain variable fragments (scFv); and antibodies. It may include, but is not limited to, multispecific antibodies formed from fragments. Papain digestion of antibodies produces two identical antigen binding fragments, called "Fab" fragments, each with a single antigen binding site. The remaining "Fc" fragment was also generated and the name of this fragment reflects its ability to crystallize readily. Pepsin treatment yields an F (ab ') 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen. The effector module comprising the pharmaceutical composition, biological circuit, biological circuit component, SRE or payload of the present invention may comprise one or more of these fragments.

  For the purposes of this specification, an "antibody" can include heavy and light chain variable domains and Fc regions. As used herein, the term "native antibody" typically refers to a heterotetramer of about 150,000 daltons that consists of two identical light (L) chains and two identical heavy (H) chains. Refers to glycoprotein. The genes encoding the antibody heavy and light chains are known, and the segments that make up each are well characterized and described (Matsuda et al., The Journal of Experimental Medicine. 1998, 188 (11). : 2151-62 and Li et al., Blood, 2004, 103 (12): 4602-4609; the contents of each are incorporated herein by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds differs between heavy chains of different immunoglobulin isotypes. Also, each heavy and light chain has an intrachain disulfide bridge at regular intervals. At one end of each heavy chain is a variable domain (VH), followed by several constant domains. Each light chain has a variable domain (VL) at one end and a constant domain at the other end. The constant domain of the light chain is aligned with the first constant domain of the heavy chain and the variable domain of the light chain is aligned with the variable domain of the heavy chain.

  As used herein, the term "variable domain" refers to the heavy and light chains of an antibody that differ significantly in sequence between antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Refers to the particular antibody domain found in both. The variable domain includes the hypervariable region. As used herein, the term "hypervariable region" refers to the region within the variable domain that contains the amino acid residues involved in antigen binding. Amino acids present within the hypervariable region determine the structure of the complementarity determining regions (CDRs) that are part of the antibody's antigen binding site. As used herein, the term "CDR" refers to a region of an antibody that comprises a structure complementary to a target antigen or epitope. The other part of the variable domain that does not interact with the antigen is called the framework (FW) region. Antigen binding sites (also known as antigen junctions or paratopes) contain the amino acid residues necessary to interact with a particular antigen. The exact residues that make up the antigen binding site are usually elucidated by co-crystallography with the bound antigen, but computational evaluations based on comparison with other antibodies can also be used (Strohl, WR. Therapeutic Antibodies Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are incorporated herein by reference in their entirety). The residues constituting CDRs are determined by Kabat (Wu et al., JEM, 1970, 132 (2): 211-250 and Johnson et al., Nucleic Acids Res. 2000, 28 (1): 214-218, The content of each is incorporated herein by reference in its entirety), Cothia (Chothia and Lesk, J. Mol. Biol. 1987, 196, 901, Chothia et al., Nature, 1989, 342, 877, and Al. Lazikani et al., J. Mol. Biol. 1997, 273 (4): 927-948, the contents of each of which are incorporated herein by reference in their entirety), Lefranc (Lefranc et al., Immunome Res. 2005 : 3) and Honegger (Honegger and Pluckthun, J. Mol. Biol. 2001, 309 (3): 657-70, the contents of which are hereby incorporated by reference in their entirety). Can include the use of numbering schemes that are not limited to.

  The VH and VL domains each have 3 CDRs. VL CDRs are referred to herein as CDR-L1, CDR-L2 and CDR-L3, in order of appearance as they move from the N-terminus to the C-terminus along a variable domain polypeptide. VH CDRs are referred to herein as CDR-H1, CDR-H2 and CDR-H3, in order of appearance as they move from the N-terminus to the C-terminus along a variable domain polypeptide. Each of the CDRs prefers a canonical structure other than CDR-H3, and CDR-H3 is an amino acid that is highly variable in sequence and length among antibodies and can give various three-dimensional structures to the antigen-binding domain. Sequence (Nikoroudis, et al., Peer J. 2014, 2: e456). In some cases, CDR-H3 may be analyzed between a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, WR Therapeutic Antibodies Engineering. Woodhead Publishing, Philadelphia PA. 2012. 3, p47-54, the contents of which are incorporated herein by reference in their entirety).

  As used herein, the term "Fv" refers to an antibody fragment that comprises the minimum fragments on an antibody necessary to form a complete antigen binding site. These regions consist of a dimer of one heavy and one light chain variable domain in tight, non-covalent association. Fv fragments can be proteolytically produced, but are mostly unstable. Usually by inserting a flexible linker between the light and heavy chain variable domains (to form a single chain Fv (scFv)) or between the heavy and light chain variable domains. Recombinant methods for producing stable Fv fragments by introducing cross-links are known in the art (Strohl, WR Therapeutic Antibodies Engineering. Woodhead Publishing, Philadelphia PA 3, 2012. Ch. p46-47, the contents of which are incorporated herein by reference in their entirety).

  As used herein, the term "light chain" refers to any vertebrate species assigned to one of two distinct types, called kappa and lambda, based on the amino acid sequence of the constant domain. Refers to the components of the derived antibody. Antibodies can be assigned to different classes depending on the amino acid sequence of the constant domain of the heavy chain. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, some of which are further subclasses (isotypes), eg, IgG1, IgG2, IgG3, IgG4, IgA, and IgA2. Can be classified into.

  As used herein, the term "single chain Fv" or "scFv" refers to a fusion protein of VH and VL antibody domains, which domains are linked to a single polypeptide by a flexible peptide linker. Linked to chains. In some embodiments, the Fv polypeptide linker enables the scFv to form the desired structure for antigen binding. In some embodiments, the scFv is utilized in combination with a phage display method, a yeast display method, or other display method, wherein the scFv is expressed in association with a surface member (eg, phage coat protein), It may be used to identify high affinity peptides for a given antigen.

  Two scFvs can be designed in tandem using molecular genetics into a single polypeptide, separated by a linker domain, called a "tandem scFv" (tascFv). Construction of tascFv containing two different scFv genes produces a "bispecific single chain variable fragment" (bis-scFv). Only two tascFvs have been clinically developed by commercial companies; both are bispecific agents in active early-stage development by Micromet for oncological indications, the "bispecific T Cell Engager (BiTE) ”. Blinatumomab is an anti-CD19 / anti-CD3 bispecific tascFv that enhances T cell responses against Phase 2 B cell non-Hodgkin's lymphoma. MT110 is an anti-EP-CAM / anti-CD3 bispecific tascFv that enhances T cell responses to Phase 1 solid tumors. The bispecific, tetravalent "TandAb" has also been studied by Affimed (Nelson, AL, MAbs., 2010, Jan-Feb; 2 (1): 77-83). A maxibody, a bivalent scFv fused to the amino terminus of an IgG Fc (CH2-CH3 domain) can also be included.

  As used herein, the term "bispecific antibody" refers to an antibody capable of binding two different antigens. Such antibodies usually contain regions from at least two different antibodies. Bispecific antibodies are described by Riethmuller, G .; Cancer Immunity. 2012, 12: 12-18, Marvin et al. , 2005. Acta Pharmacologica Sinica. 2005, 26 (6): 649-658 and Schaefer et al. , PNAS. Mention may be made of any of the bispecific antibodies described in 2011, 108 (27): 11187-11192, the contents of each of which is incorporated herein by reference in its entirety.

  As used herein, the term "diabody" refers to a small antibody fragment that has two antigen binding sites. Diabodies are functional bispecific single chain antibodies (bscAbs). The diabodies include the heavy chain variable domain VH connected to the light chain variable domain VL in the same polypeptide chain. By using a linker that is too short to pair two domains on the same chain, the domains are forced to pair with the complementary domains on another chain, creating two antigen binding sites. Diabodies are described, for example, in EP 404,097; WO 93/11161; and Hollinger et al. (Hollinger, P. et al., "Diabodies": Small biological and bispecific antibody fragments. PNAS, 1993. 90: 6444-6448); each of which is incorporated by reference in its entirety. Incorporated into the book.

  The term "intracellular antibody" refers to a form of an antibody that is not secreted by the cell in which it is produced but instead targets one or more intracellular proteins. Intracellular antibodies may be used to affect a number of cellular processes including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling and cell division. In some embodiments, the methods of the invention may include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein may be incorporated into one or more constructs for intracellular antibody-based therapy.

  As used herein, the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous cells (or clones), ie, variants that may occur during the production of the monoclonal antibody. Except that (such variants are generally present only in small amounts), the individual antibodies in the population are the same and / or bind the same epitope. In contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody faces a single determinant on the antigen.

  The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and should not be construed as requiring production of the antibody by any particular method. In the monoclonal antibody herein, a part of its heavy chain and / or light chain is identical or homologous to the corresponding sequence of an antibody derived from a specific species or belonging to a specific antibody class or subclass. However, the rest of the chain (s) is / are homologous to the corresponding sequences of antibodies from different species or belonging to different antibody classes or subclasses, as well as fragments of such antibodies. "Chimeric" antibodies (immunoglobulins) are included.

  As used herein, the term "humanized antibody" is derived from the minimal portion derived from one or more non-human (eg, murine) antibody source (s) and from one or more human immunoglobulin sources. It refers to a chimeric antibody containing the rest. In most cases, the humanized antibody is a human immunoglobulin (recipient antibody), where the hypervariable region residues from the recipient antibody have the desired specificity, affinity, and / or performance. , A hypervariable region residue derived from a non-human species antibody (donor antibody) such as mouse, rat, rabbit or non-human primate. In one embodiment, the antibody may be a humanized full length antibody. As a non-limiting example, the antibodies may be humanized using the methods set forth in US Patent Publication No. US20130303399, the contents of which are incorporated herein by reference in their entirety.

  As used herein, the term “antibody variant” refers to a modified antibody (relative to a natural or starting antibody) or a biomolecule that is similar in structure and / or function to a natural or starting antibody (eg, an antibody mimic. Body). Antibody variants may have altered amino acid sequence, composition, or structure as compared to the native antibody. Antibody variants include antibodies with altered isotypes (eg, IgA, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, multispecific antibody variants (eg, bispecific variants). Specific variants), and antibody fragments.

  In some embodiments, the effector module comprising the pharmaceutical composition, biocircuit, component of biocircuit, SRE or payload of the invention may be an antibody mimetic. As used herein, the term "antibody mimetic" refers to any molecule that mimics the function or effect of antibodies and binds their molecular targets with specific and high affinity. In some embodiments, the antibody mimetic may be a monobody designed to incorporate the fibronectin type III domain (Fn3) as a protein scaffold (US6,673,901; US6,348,584). In some embodiments, antibody mimetics include, but are not limited to, affibody molecules, affilin, afitin, anticalin, avimer, Centyrin, DARPINSTM, Fynomer and Kunitz and domain peptides known in the art. It may be a mimic. In other embodiments, antibody mimetics may include one or more non-peptide regions.

  In one embodiment, the antibody may comprise a modified Fc region. As a non-limiting example, the modified Fc region may be made by the methods described in US Patent Publication No. US20150065690, or may be any region described therein, the contents of which are The entire contents of which are incorporated herein by reference.

  In some embodiments, the payload of the invention may encode a multispecific antibody that binds to more than one epitope. As used herein, the term "multibody" or "multispecific antibody" refers to an antibody in which two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In one embodiment, the multispecific antibody may be generated and optimized by the methods described in International Patent Publication No. WO2011109726 and US Patent Publication No. US201502521119, the contents of which are herein incorporated by reference in their entirety. Be used for. These antibodies are capable of binding multiple antigens with high specificity and high affinity.

  In certain embodiments, a multispecific antibody is a “bispecific antibody” that recognizes two different epitopes on the same or different antigens. In one aspect, bispecific antibodies are capable of binding two different antigens. Such antibodies typically include antigen binding regions from at least two different antibodies. For example, bispecific monoclonal antibodies (BsMAbs, BsAbs) are artificial proteins composed of fragments of two different monoclonal antibodies, so that BsAbs can bind to two different types of antigens. Bispecific antibody frameworks are described in Riethmuller, G. et al. , 2012. Cancer Immunity, 2012, 12: 12-18; Marvin et al. , Acta Pharmacologica Sinica. 2005, 26 (6): 649-658; and Schaefer et al. , PNAS. 2011, 108 (27): 11187-11192, the contents of each of which is incorporated herein by reference in its entirety. A new generation of BsMAbs called "trifunctional bispecific" antibodies has been developed. These consist of two heavy chains and two light chains, each derived from two different antibodies, with two Fab regions (arms) facing two antigens and two Fc regions (legs). It contains a heavy chain and forms a third binding site.

  In some embodiments, the payload may encode an antibody that comprises a single antigen binding domain. These molecules are very small, about one-tenth the molecular weight observed with full-sized mAbs. Additional antibodies may include "Nanobodies" derived from the antigen binding variable heavy chain region (VHH) of heavy chain antibodies lacking the light chains found in camels and llamas (Nelson, AL, MAbs. 2010. Jan. -Feb; 2 (1): 77-83).

  In some embodiments, antibodies may be "miniaturized." The best example of mAb miniaturization is Trubion Pharmaceuticals' Small Modular Immunopharmaceutical (SMIP). These molecules may be monovalent or bivalent and contain a single VL, a VH antigen binding domain, and one or two constant "effector" domains, all recombinant single molecules connected by a linker domain. It is a chain molecule. Presumably, such molecules may offer the advantage of increased tissue or tumor permeability acquired by the fragment while retaining the immune effector function conferred by the constant domain. At least three "miniaturized" SMIPs have entered the clinical development stage. TRU-015, an anti-CD20 SMIP co-developed with Wyeth, is the most advanced project and is in Phase 2 of rheumatoid arthritis (RA). Previous attempts at systemic lupus erythematosus (SLE) and B-cell lymphoma have finally been discontinued. Trubion and Facet Biotechnology are collaborating on the development of TRU-016, an anti-CD37 SMIP for the treatment of CLL and other lymphoid tumors, which is a Phase 2 project. Wyeth licensed the anti-CD20 SMIP, SBI-087, for the treatment of autoimmune diseases such as RA, SLE, and possibly multiple sclerosis, but these projects remain in the early stages of clinical trials (Nelson, AL, MAbs, 2010. Jan-Feb; 2 (1): 77-83).

  One example of a miniaturized antibody is called a "unibody," in which the hinge region has been removed from the IgG4 molecule. The IgG4 molecule is unstable and can exchange light-heavy chain heterodimers with each other, but the deletion of the hinge region completely prevents pairing of the heavy and heavy chains, resulting in a very specific monovalent It retains the light / heavy chain heterodimer while retaining the Fc region to ensure stability and half-life in vivo. This configuration may minimize the risk of immune activation or carcinogenic growth, as the interaction of IgG4 and FcR is poor and monovalent unibodies are unable to promote the formation of intracellular signaling complexes (eg Nelson). , AL, MAbs, 2010. Jan-Feb; 2 (1): 77-83).

  In some embodiments, a payload of the invention may encode a single domain antibody (sdAb, or Nanobody) that is an antibody fragment consisting of a single monomeric variable antibody domain. It can selectively bind to a particular antigen as well as whole antibodies. In one aspect, the sdAb may be "Camel Ig" or "Camelidae VHH". As used herein, the term "camel Ig" refers to the smallest known antigen binding unit of a heavy chain antibody (Koch-Nolte, et al, FASEB J., 2007, 21: 3490-3498. ). "Heavy chain antibody" or "camelid antibody" refers to an antibody that contains two VH domains and no light chains (Riechmann L. et al, J. Immunol. Methods, 1999, 231: 25-38; International Patent Publication Nos. WO1994 / 04678 and WO1994 / 025591; and US Pat. No. 6,005,079). In another aspect, the sdAb may be an "immunoglobulin novel antigen receptor" (Ig NAR). As used herein, the term "immunoglobulin novel antigen receptor" refers to a shark immunity consisting of a homodimer of one variable novel antigen receptor (VNAR) domain and five constant novel antigen receptor (CNAR) domains. Refers to the class of antibody from the repertoire. Ig NARs represent some of the smallest known immunoglobulin-based protein scaffolds, are very stable and have efficient binding properties. The intrinsic stability is (i) an underlying Ig scaffold that presents a significant number of charged and hydrophilic surface-exposed residues compared to the conventional antibody VH and VL domains found in murine antibodies; and ( ii) due to both interloop disulfide bridges and stabilizing structural features of the complementary determining region (CDR) loops, including intraloop hydrogen bonding patterns.

  In some embodiments, the payload of the invention may encode an intracellular antibody. Intracellular antibodies are a type of antibody that target one or more intracellular proteins rather than being secreted by antibody-producing cells. Intrabodies are used to express and function intracellularly and to affect numerous cellular processes including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, proliferative signaling, cell division. You may. In some embodiments, the methods described herein include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein are incorporated into one or more constructs for intracellular antibody-based therapy. For example, the intracellular antibody may target one or more glycated intracellular proteins or may regulate the interaction between one or more glycated intracellular proteins and a surrogate protein.

  By intracellular expression of intracellular antibodies in different compartments of mammalian cells, it is possible to block or regulate the function of endogenous molecules (Biocca, et al., EMBO J. 1990, 9: 101-108; Colby. et al., Proc. Natl. Acad. Sci. USA 2004, 101: 17616-17621). Intracellular antibodies can alter protein folding, protein-protein interactions, protein-DNA interactions, protein-RNA interactions, and protein modifications. Intracellular antibodies can function as neutralizing agents by inducing phenotypic knockouts, by direct binding to target antigens, bypassing intracellular trafficking, or inhibiting binding with binding partners. Due to their high specificity and affinity for target antigens, intracellular antibodies have the advantage that they block specific binding interactions of specific target molecules while leaving other molecules unaffected.

  Sequences from the donor antibody may be used to develop intracellular antibodies. Intracellular antibodies are often expressed recombinantly as single domain fragments such as isolated VH and VL domains or as intracellular single chain variable fragment (scFv) antibodies. For example, intracellular antibodies are often expressed as a single polypeptide, forming a single chain antibody that contains the variable domains of the heavy and light chains joined by a flexible linker polypeptide. Intrabodies usually lack disulfide bonds and can regulate the expression or activity of target genes by virtue of their specific binding activity. Single chain intracellular antibodies are often expressed from recombinant nucleic acid molecules and designed to be retained intracellularly (eg, retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intracellular antibodies are: (Marasco et al., PNAS, 1993, 90: 7889-7893; Chen et al., Hum. Gene Ther. 1994, 5: 595-601; Chen et al., 1994, PNAS, 91: Maciejewski et al., 1995, Nature Med., 1: 667-673; Marasco, 1995, Immunotech, 1: 1-19; Mashhilkar, et al., 1995, EMBO J. 14: 1542-51; Chen et al., 1996, Hum. Gene Therap., 7: 1515-1525; Marasco, Gene Ther. 4: 11-15, 1997; Rondon and Marasco, 199. , Annu. Rev. Microbiol. 51: 257-283; Cohen, et al., 1998, Oncogene 17: 2445-56; Proba et al., 1998, J. Mol. Biol. 275: 245-253; Cohen et al. , 1998, Oncogene 17: 2445-2456; Hassanzadeh, et al., 1998, FEBS Lett. 437: 81-6; Richardson et al., 1998, Gene Ther. 5: 635-44; Ohage and 99, Stepe. J. Mol. Biol. 291: 1119-1128; Ohage et al., 1999, J. Mol. Biol. 291: 1129-1134; Wirtz and Ste. pe, 1999, Protein Sci. 8: 2245-2250; Zhu et al., 1999, J. Immunol. Methods 231: 207-222; Arafat et al., 2000, Cancer Gene Ther. 7: 1250-6; der Maur. et al., 2002, J. Biol. Chem. 277: 45075-85; Mashilkar et al., 2002, Gene Ther. 9: 307-19; and Wheeler et al., 2003, FASEB J. 17: 1733-5. And methods disclosed in the art, such as those disclosed and outlined in references cited therein;

  In some embodiments, the payload of the present invention may encode a biosynthetic antibody described in US Pat. No. 5,091,513, the contents of which are incorporated herein by reference in their entirety. . Such antibodies may include one or more sequences of amino acids that make up the region that acts as a biosynthetic antibody binding site (BABS). This site can be either 1) non-covalently or disulfide-bonded synthetic VH and VL dimers, 2) VH-VL or VL-VH single chain in which VH and VL are linked by a polypeptide linker, or 3) individual VH or VL. Contains the domain. The binding domain comprises linked CDR and FR regions that may be derived from separate immunoglobulins. Biosynthetic antibodies may also include, for example, enzymes, toxins, binding sites, or other polypeptide sequences that function as attachment sites for immobilization media or radioactive atoms. Disclosed are methods of producing biosynthetic antibodies, methods of designing BABS with any specificity that can be induced by in vivo production of antibodies, and methods of producing analogs thereof.

  In some embodiments, the payload may encode an antibody with the antibody acceptor framework shown in US Pat. No. 8,399,625. Such antibody acceptor frameworks may be particularly suitable for accepting CDRs from the antibody of interest.

  In one embodiment, the antibody may be a conditionally active biological protein. The antibody is used to produce a conditionally active biological protein that is reversibly or irreversibly inactivated under normal physiological conditions of the wild type, and also for such conditionally active biological proteins. The use of proteins and such conditionally active biological proteins may be provided. Such methods and conditionally active proteins are shown, for example, in International Publication Nos. WO2015175375 and WO2160369916 and US Patent Publication No. US2140378660, the contents of each of which are herein incorporated by reference in their entirety. Be used for.

Preparation of Antibodies Preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Techniques for producing antibodies are well known in the art, for example, Harlow and Lane “Antibodies, A Laboratory Manual”, Cold Spring Harbor laboratory ororb sorbate sorbate lanes and lanes; Press, 1999 and "Therapeutic Antibodies Engineering: Current and Future Advances Driving the Stretching Area are in the Pharmaceutical Wounds". g, 2012.

  The antibodies and fragments and variants thereof described herein can be produced using recombinant polynucleotides. In one embodiment, the polynucleotide has a modular design that encodes at least one of an antibody, fragment or variant thereof. As a non-limiting example, the polynucleotide construct may encode any of the following designs: (1) antibody heavy chain, (2) antibody light chain, (3) antibody heavy chain and light. A chain, (4) heavy and light chains separated by a linker, (5) VH1, CH1, CH2, CH3 domains, linkers and light chains, or (6) VH1, CH1, CH2, CH3 domains, VL regions, and Light chain. Any of these designs may include an optional linker between any domains and / or regions. The polynucleotides of the present invention may be designed to produce a standard class of immunoglobulins using any of the antibodies or component parts thereof described herein as starting molecules.

  It is also well known in the art and described, for example, in Clackson et al. , 1991, Nature 352: 624-628; Marks et al. , 1991, J .; Mol. Biol. 222: 581-597, techniques may be used to isolate recombinant antibody fragments from phage antibody libraries. The recombinant antibody fragment may be derived from a large-scale phage antibody library produced by recombination in bacteria (Sblattero and Bradbury, 2000, Nature Biotechnology 18: 75-80; Incorporated herein by reference).

Antibodies for use in immunotherapy In some embodiments, the payload of the present invention may be antibodies, fragments and variants thereof, specific for tumor-specific antigen (TSA) and tumor-associated antigen (TAA). The antibody circulates in the body until it discovers and binds TSA / TAA. Once bound, the antibody recruits other parts of the immune system, enhancing ADCC (antibody dependent cell cytotoxicity) and ADCP (antibody dependent cell phagocytosis) and destroying tumor cells. As used herein, the term "tumor-specific antigen (TSA)" means an antigenic substance produced by tumor cells that is capable of eliciting an anti-tumor immune response within a host organism. In one embodiment, the TSA may be a tumorigenic antigen. Tumor antigen-specific antibodies mediate a complement-dependent cytotoxic response against tumor cells expressing the same antigen.

  In some embodiments, the tumor-specific antigen (TSA), tumor-associated antigen (TAA), pathogen-associated antigen, or fragment thereof can be expressed as a peptide or intact protein or part thereof. The intact protein or part thereof can be naturally occurring or mutagenized. Antigens associated with cancer or virus-induced cancers described herein are well known in the art. Such TSA or TAA may already be associated with cancer or may be identified by any method known in the art.

  In one embodiment, the antigen is CD19, which is a B cell surface protein expressed throughout B cell development. CD19 is a well-known B cell surface molecule, and activation of the B cell receptor promotes B cell antigen receptor-induced signal transduction and proliferation of B cell populations. CD19 is widely expressed on both normal and neoplastic B cells. B cell-derived malignancies such as chronic lymphocytic leukemia, acute lymphocytic leukemia, and many non-Hodgkin's lymphomas often retain CD19 expression. This nearly universal expression and specificity for single cell lines makes CD19 an attractive target for immunotherapy. Human CD19 has 14 exons, exons 1-4 encoding the extracellular portion of CD19, exon 5 encoding the transmembrane portion of CD19, and exons 6-14 encoding the cytoplasmic tail.

  In one embodiment, the payload of the present invention may be antibodies, fragments and variants thereof specific for the CD19 antigen.

  In one embodiment, the payload of the invention may be an antibody fragment of the FMC63 antibody, variant. FMC63 is an IgG2a mouse monoclonal antibody clone specific for the CD19 antigen that reacts with the CD19 antigen on cells of the B cell lineage. The CD19 epitope recognized by the FMC63 antibody is located on exon 2 (Sotillo et al (2015) Cancer Discov; 5 (12): 1282-95; the contents of which are incorporated by reference in their entirety). In some embodiments, the payloads of the invention may be other CD19 monoclonal antibody clones including, but not limited to, 4G7, SJ25C1, CVID3 / 429, CVID3 / 155, HIB19, and J3-119.

In some embodiments, the payload of the present invention may include a variable heavy chain and a variable light chain having an amino acid sequence selected from the sequences in Table 4.

  The tumor-specific antigen (TSA) may be a tumor neoplastic antigen. Neogenic antigens are mutated antigens that are expressed only in tumor cells due to genetic mutations or alterations in transcription that alter the coding sequence of the protein and thus create new foreign antigens. Genetic alterations result from gene substitutions, insertions, deletions, or any other genetic alteration of the native cognate protein (ie, a molecule expressed in normal cells). With respect to CD19, neogenic antigens have been described, such as transcription variants of CD19, which are exon 2 deficient, exon 5-6 deficient, or both (see International Patent Publication No. WO2201661368; Incorporated herein by reference in its entirety). Since the FMC63 binding epitope is located on exon 2, the CD19 neoantigen lacking exon 2 is not recognized by the FMC63 antibody. Thus, in some embodiments, a payload of the invention may include an antibody that is distinct from FMC63, or a fragment thereof. As used herein, "separate from FMC63" refers to an epitope of the CD19 antigen that is immunologically specific and is different or not similar to the epitope of the CD19 antigen bound by FMC63. Antibody or fragment thereof. In some examples, the antibodies of the invention can include CD19 antibodies, antibody fragments or variants that recognize CD19 neoantigens, including CD19 neoantigens that lack exon 2. In one embodiment, the antibody or fragment thereof is immunologically specific for CD19 encoded by exons 1, 3 and / or 4. In one example, the antibody or fragment thereof is specific for an epitope that bridges the portion of CD19 encoded by exon 1 and the portion of CD19 encoded by exon 3.

  Chimeric antigen receptor (CAR)

  In some embodiments, the payload of the present invention may be a chimeric antigen receptor (CAR), which is the extracellular target of CAR when transduced into immune cells (eg, T cells and NK cells). Immune cells can be redirected to targets that express the molecule recognized by the moiety (eg, tumor cells).

  As used herein, the term "chimeric antigen receptor (CAR)" refers to a synthetic receptor that mimics the TCR on the surface of T cells. Generally, CAR consists of an extracellular targeting domain, a transmembrane domain / region and an intracellular signaling / activation domain. In the standard CAR receptor, the components: extracellular targeting domain, transmembrane domain and intracellular signaling / activation domain are linearly constructed as a single fusion protein. The extracellular region contains targeting domains / moieties (eg, scFv) that recognize specific tumor antigens or other tumor cell surface molecules. The intracellular domain is a signal transduction domain of the TCR complex (eg, the signal domain of CD3ζ) and / or one or more costimulatory signaling domains, eg, CD28, 4-1BB (CD137) and OX-40 (CD134). ). For example, "first generation CAR" has only the CD3ζ signaling domain. A co-stimulatory intracellular domain was added to enhance T cell persistence and proliferation, a second generation CAR with one co-stimulatory signaling domain in addition to the CD3ζ signal domain, and 2 in addition to the CD3ζ signal domain. Third generation CARs with one or more costimulatory signaling domains are generated. CAR, when expressed on T cells, confers on the T cells the antigen specificity determined by the extracellular targeting portion of the CAR. Recently, it has also been desired to add one or more elements such as homing genes and suicide genes to develop a more qualified and safe CAR architecture called fourth generation CAR.

  In some embodiments, the extracellular targeting domain is attached to the intracellular signaling domain via a hinge (also called a gap domain or spacer) and a transmembrane region. The hinge connects the extracellular targeting domain to a transmembrane domain that crosses the cell membrane and connects to the intracellular signaling domain. Due to the size of the target protein to which the targeting moiety binds, and the size and affinity of the targeting domain itself, it may be necessary to change the hinge to optimize the potency of CAR transformed cells against cancer cells. is there. Upon recognition and binding of the targeting moiety to the target cell, the intracellular signaling domain directs an activation signal to CAR T cells, which is further amplified by a "second signal" from one or more intracellular costimulatory domains. It CAR T cells, when activated, can destroy target cells.

In some embodiments, the CARs of the invention may be split into two parts, each part linked to a dimerization domain, resulting in an input that is functionally intact by the input that causes dimerization. Assembly of the receptor is facilitated. Wu and Lim recently separated the extracellular CD19 binding domain from the intracellular signaling element and linked it to the FKBP domain and the FRB ^* (T2089L mutant of FKBP-rapamycin binding) domain, which in the presence of the rapamycin analog AP21967. We reported a split CAR that heterodimerizes. Split receptors are assembled in the presence of AP21967 and activate T cells with specific antigen binding (Wu et al, Science, 2015, 625 (6258): aab4077).

In some embodiments, the CAR of the invention may be designed as an inducible CAR. Sakemura et al. Recently reported the integration of the Tet-On induction system into the CD19 CAR construct. The CD19 CAR activates only in the presence of doxycycline (Dox). Sakemura shows that Tet-CD19CAR T cells in the presence of Dox are equally cytotoxic to the CD19 ⁺ cell line and have equivalent cytokine production and proliferation upon CD19 stimulation compared to conventional CD19CAR T cells. (Sakemura et al., Cancer Immuno.Res., 2016, Jun 21, electronic version). In one embodiment, this Tet-CAR may be the payload of an effector module under the control of the SRE (eg DD) of the present invention. The dual system provides more flexibility in turning on / off CAR expression in transduced T cells.

  According to the invention, the payload of the invention may be a first generation CAR, or a second generation CAR, or a third generation CAR, or a fourth generation CAR. Exemplary effector module embodiments that include CAR constructs are shown in FIGS. In some embodiments, the payload of the invention may be a complete CAR construct consisting of an extracellular domain, a hinge and transmembrane domain and an intracellular signaling region. In other embodiments, the payloads of the invention include extracellular targeting moieties that enhance CAR architecture and function, including but not limited to leader sequences, homing elements and safety switches, or combinations of such components. It may be a component of the complete CAR construct, including the hinge region, transmembrane domain, intracellular signaling domain, one or more costimulatory domains, as well as other additional elements.

  The CAR regulated by the biocircuits and compositions of the present invention is tunable, thereby providing several advantages. A reversible on / off switch mechanism can control the acute toxicity caused by excessive proliferation of CAR-T cells. Pulsed CAR expression using the SREs of the invention can be achieved by cycling ligand levels. Modulation of CAR by ligands offsets the tumor escape induced by antigen loss, avoids the functional depletion caused by persistent signaling due to chronic antigen exposure, and persists CAR expressing cells in vivo. May be effective in improving.

  In some embodiments, the biocircuits and compositions of the invention may be utilized to downregulate CAR expression and limit on-target, on-tissue damage caused by tumor lysis syndrome. The down-regulation of CAR expression of the present invention following the antitumor effect is (1) on-target, off-tumor toxicity caused by antigen expression in normal tissues, and (2) antigen-independent activation in vivo. Can be prevented.

  In one embodiment, selection of CAR with lower affinity may provide more T cell signaling and less cytotoxicity.

Extracellular targeting domain / moiety According to the present invention, the extracellular targeting moiety of CAR is any agent that recognizes and binds with high specificity and affinity a given target molecule, eg a neoantigen on a tumor cell. Good. The targeting moiety may be an antibody and variants thereof that specifically bind to a target molecule on tumor cells, or a peptide aptamer selected from a random sequence pool based on its ability to bind to target molecules on tumor cells, or on tumor cells. A target cell having a variant or fragment thereof capable of binding to a target molecule, or an antigen recognition domain derived from a natural T cell receptor (TCR) (for example, CD4 extracellular domain that recognizes HIV-infected cells), or a cytokine receptor It may be an exogenous recognition component such as a bound cytokine that induces the recognition of or a natural ligand for the receptor.

  In some embodiments, the CAR targeting domain is derived from an antibody that specifically recognizes a target molecule, eg, a tumor-specific antigen (TSA), Ig NAR, Fab fragment, Fab ′ fragment, F (ab) ′. 2 fragment, F (ab) ′ 3 fragment, Fv, single chain variable fragment (scFv), bis-scFv, (scFv) 2, minibody, diabody, triabody, tetrabody, disulfide-stabilized Fv protein (dsFv). , A unit body, a Nanobody, or an antigen binding region. In one embodiment, the targeting moiety is a scFv antibody. The scFv domain is expressed on the surface of CAR T cells and then binds to target proteins on cancer cells, which can keep CAR T cells close to the cancer cells and cause T cell activation. The scFv can be produced using conventional recombinant DNA technology and is discussed in this invention.

  In one embodiment, the targeting portion of CAR can recognize CD19. CD19 is a well-known B cell surface molecule, and activation of the B cell receptor promotes B cell antigen receptor-induced signal transduction and proliferation of B cell populations. CD19 is widely expressed on both normal and neoplastic B cells. B cell-derived malignancies such as chronic lymphocytic leukemia, acute lymphocytic leukemia, and many non-Hodgkin's lymphomas often retain CD19 expression. This nearly universal expression and specificity for single cell lines makes CD19 an attractive target for immunotherapy. Human CD19 has 14 exons, exons 1-4 encoding the extracellular portion of CD19, exon 5 encoding the transmembrane portion of CD19, and exons 6-14 encoding the cytoplasmic tail. In one embodiment, the targeting moiety may comprise a scFv derived from the variable region of the FMC63 antibody. FMC63 is an IgG2a mouse monoclonal antibody clone specific for the CD19 antigen that reacts with the CD19 antigen on B lineage cells. The epitope of CD19 recognized by the FMC63 antibody is located on exon 2 (Sotillo et al (2015) Cancer Discov; 5 (12): 1282-95; the contents of which are incorporated by reference in their entirety). In some embodiments, the targeting portion of CAR is derived from the variable region of other CD19 monoclonal antibody clones, including but not limited to 4G7, SJ25C1, CVID3 / 429, CVID3 / 155, HIB19, and J3-119. There are cases.

  In some embodiments, the targeting moiety of the CAR alters tumor-specific antigen (TSA), eg, a protein coding sequence, resulting in a genetic mutation or transcriptional change resulting in the creation of a novel foreign antigen. It can recognize a carcinogenic antigen that is expressed only in. Genetic alterations result from genetic substitutions, insertions, deletions, or any other genetic alteration of a naturally occurring cognate protein (ie, a molecule expressed in normal cells). With respect to CD19, TSA may include a transcriptional variant of human CD19 that is exon 2 deficient, exon 5-6 deficient, or both (see International Patent Publication No. WO201661368; the entire content thereof). Incorporated herein by reference). Since the FMC63 binding epitope is located in exon 2, CD19 lacking exon 2 is not recognized by the FMC63 antibody. Thus, in some embodiments, the targeting moiety of CAR may be a scFV distinct from FMC63. As used herein, "distinct from FMC63" refers to a CD19 antigen that is immunologically specific and that is different or not similar to the epitope of the CD19 antigen bound by FMC63. Refers to an antibody, scFv or fragment thereof that binds to an epitope. In some examples, the targeting moiety may recognize the CD19 antigen that lacks exon 2. In one embodiment, the targeting moiety recognizes a fragment of CD19 encoded by exons 1, 3, and / or 4. In one example, the targeting moiety recognizes an epitope that bridges the portion of CD19 encoded by exon 1 and the portion of CD19 encoded by exon 3.

In some embodiments, a targeting moiety of the invention may be a scFv having the amino acid sequence of Table 5.

Intracellular Signaling Domain The intracellular domain of a CAR fusion polypeptide, which, after binding to its target molecule, signals an immune effector cell and contains cytolytic activity (eg, cytokine secretion) or helper activity. Activates at least one of its normal effector functions. Thus, the intracellular domain comprises the "intracellular signaling domain" of the T cell receptor (TCR).

  In some embodiments, the entire intracellular signaling domain can be used. In other embodiments, a truncated portion of the intracellular signaling domain may be used in place of the intact chain, as long as that domain transduces an effector function signal.

  In some embodiments, the intracellular signaling domain of the invention may include a signaling motif known as the immunoreceptor activating tyrosine motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include ITAMs derived from TCR CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one example implementation, the intracellular signaling domain is the CD3 zeta (CD3ζ) signaling domain.

  In some embodiments, the intracellular region of the invention further comprises one or more costimulatory signaling domains that provide additional signals to immune effector cells. These costimulatory signaling domains can be used in combination with signaling domains to further improve the proliferation, activation, memory, persistence, and tumor eradication efficiency of CAR-modified immune cells (such as CAR T cells). . In some cases, the costimulatory signaling region comprises one, two, three, or four cytoplasmic domains of one or more intracellular signaling molecules and / or costimulatory molecules. The costimulatory signaling domains are CD2, CD7, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), GITR (glucocorticoid-induced tumor necrosis factor receptor), LFA-. 1 (lymphocyte function associated antigen-1), LIGHT, NKG2C, B7-H3 may be the intracellular / cytoplasmic domain of costimulatory molecules. In one example, the costimulatory signaling domain is derived from the cytoplasmic domain of CD28. In another example, the costimulatory signaling domain is derived from the cytoplasmic domain of 4-1BB (CD137). In another example, the costimulatory signaling domain may be the intracellular domain of GITR as shown in US Pat. No. 9,175,308; the content of which is herein incorporated by reference in its entirety. Incorporated into the book.

  In some embodiments, the intracellular domain of the invention comprises MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activating proteins (SLAMs), such as CD48. , CD229, 2B4, CD84, NTB-A, CRACC, BLAME, CD2F-10, SLAMF6, SLAMF7, activated NK cell receptor, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40. , CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTTR), SLAMF7. NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, IL15Ra, ITGA4, VLA1, CD49a, ITGA4, VLA1; , CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, NKD2C FR2, SLP76, TRANS / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile , CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG. (CD162), LTBR, LAT, CD270 (HVEM), GADS, SLP-76, PAG / Cbp, CD19a, ligand that specifically binds to CD83, DAP10, TRIM, ZAP70, killer cell immunoglobulin receptor (KIR), For example, KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3D L1 / S1, KIR3DL2, KIR3DL3, and KIR2DP1; may include a functional signaling domain from a protein selected from the group consisting of lectin-related NK cell receptors, eg Ly49, Ly49A, and Ly49C.

  In some embodiments, the intracellular signaling domain of the present invention may comprise a JAK-STAT derived signaling domain. In another embodiment, the intracellular signaling domain of the present invention may include a signaling domain derived from DAP-12 (cell death associated protein 12) (Topfer et al., Immunol., 2015, 194: 3201-3212). And Wang et al., Cancer Immunol., 2015, 3: 815-826). DAP-12 is an important signal transduction receptor of NK cells. Activation signals mediated by DAP-12 play an important role in inducing NK cell cytotoxic response to specific tumor cells and virus-infected cells. The cytoplasmic domain of DAP12 contains an immunoreceptor activating tyrosine motif (ITAM). Thus, CARs containing the DAP12-derived signaling domain may be used for adoptive transfer of NK cells.

  In some embodiments, T cells that are modified with two or more CARs that incorporate distinct costimulatory domains and are regulated by distinct DDs are also used to provide rate control of downstream signaling. Good.

In some embodiments, the intracellular domain of the invention may comprise the amino acid sequence of Table 6.

Transmembrane Domain In some embodiments, the CAR of the invention may comprise a transmembrane domain. As used herein, the term "transmembrane domain (TM)" broadly refers to an amino acid sequence of about 15 residues in length that spans the plasma membrane. More preferably, the transmembrane domain is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, It contains 40, 41, 42, 43, 44, or 45 amino acid residues and spans the plasma membrane. In some embodiments, the transmembrane domain of the invention may be derived from either natural or synthetic sources. The transmembrane domain of CAR may be derived from any naturally occurring membrane-bound or transmembrane protein. For example, the transmembrane region may be a T cell receptor, CD3ε, CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, or CD154. May be derived from the α, β, or ζ chains of (i.e., include at least the transmembrane region (s) thereof).

  Alternatively, the transmembrane domain of the present invention may be synthetic. In some aspects, the synthetic sequences may include predominantly hydrophobic residues such as leucine and valine.

In some embodiments, the transmembrane domain of the invention is a CD8α transmembrane domain, a CD4 transmembrane domain, a CD28 transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, and a human Ig _G4 Fc region. May be selected from the group consisting of As a non-limiting example, the transmembrane domain is a CTLA-4 transmembrane domain having the amino acid sequence of SEQ ID NOs: 1-5 of WO2014 / 100385; and SEQ ID NO: 6- of International Patent Publication WO2014100385. It may be a PD-1 transmembrane domain having an amino acid sequence of 8; the contents of each of which is incorporated herein by reference in its entirety.

In some embodiments, the CAR of the present invention can include any hinge region (also called a spacer). The hinge sequence is a short amino acid sequence that promotes flexibility of the extracellular targeting region, keeping the target binding domain away from the effector cell surface, allowing proper cell / cell contact, target binding, and effector cell activation. (Patel et al., Gene Therapy, 1999; 6: 412-419). The hinge sequence may be located between the targeting moiety and the transmembrane domain. The hinge sequence can be any suitable sequence derived from or obtained from any suitable molecule. The hinge sequence is all or part of the hinge region of an immunoglobulin (eg, IgG1, IgG2, IgG3, IgG4), that is, a sequence between the CH1 and CH2 domains of an immunoglobulin, eg, IgG4 Fc hinge, type 1, It may be derived from the extracellular region of a membrane protein, such as CD8α CD4, CD28 and CD7, which may be wild type sequence or derivative. Some hinge regions include the immunoglobulin CH3 domain or both the CH3 and CH2 domains. In certain embodiments, the hinge region may be modified from IgG1, IgG2, IgG3, or IgG4, with one or more residues substituted with amino acid residues different from those present in the unmodified hinge. , For example 1, 2, 3, 4 or 5 amino acid residues. Table 7 shows various transmembrane regions that can be used in the CARs described herein.

Hinge region sequences useful in the present invention are provided in Table 8A.

Hinge and transmembrane region sequences useful in the present invention are provided in Table 8B.

  In some embodiments, the CAR of the invention may include one or more linkers between any domains of the CAR. The linker may be 1 to 30 amino acids long. In this regard, the linker is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. , 23, 24, 25, 26, 27, 28, 29, or 30 amino acids long. In other embodiments, the linker may be flexible.

  In some embodiments, the components comprising the targeting moiety, transmembrane domain and intracellular signaling domain of the invention may be constructed as a single fusion polypeptide. The fusion polypeptide may be the payload of the effector module of the invention. In some embodiments, more than one CAR fusion polypeptide may be included in the effector module, eg, two, three or more CARs under the control of a single SRE (eg DD). May be included in the effector module. Representative effector modules containing CAR payloads are shown in Figures 2-6.

In some embodiments, CAR sequences can be selected from Table 9.

In one embodiment of the invention, the payload of the invention is a CD19-specific CAR that targets different B cells. In the context of the present invention, the effector module may comprise hDHFR DD, ecDHFR DD, or FKBP DD operably linked to a CD19 CAR fusion construct. In some examples, the promoter utilized to drive expression of the effector module in the vector may be the CMV promoter or EF1a. The efficiency of promoters in driving the expression of the same construct may be compared. For example, two constructs that differ only in the promoter CMV (OT-CD19N-001) or the EF1a promoter (OT-CD19N-017) may be compared. The amino acid sequences of the CD19 CAR construct and its components are shown in Tables 10a and 10b. The amino acid sequences in Table 10a and / or Table 10b may include the stop codons shown in the table with an " ^* " at the end of the amino acid sequence.

  In some examples, the constructs disclosed in Table 10 that are transcriptionally regulated by the CMV promoter may be placed under the transcriptional control of different promoters to test the role of the promoter in CD19 CAR expression. In one embodiment, the CMV promoter may be replaced with the EF1a promoter. In one embodiment, the CMV promoter of the OT-CD19-001 construct may be replaced with the EF1a promoter to generate the OT-CD19N-017 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-002 construct may be replaced with the EF1a promoter to generate the OT-CD19N-018 construct. In another embodiment, the CMV promoter of the OT-CD19 CAR-003 construct, which is the CD19 CAR, may be replaced with the EF1a promoter to produce the OT-CD19N-019 construct. In another embodiment, the CMV promoter of the OT-CD19 CAR-004 construct, which is the CD19 CAR, may be replaced with the EF1a promoter to produce the OT-CD19N-020 construct. In another embodiment, the CMV promoter of the OT-CD19 CAR-005 construct, which is the CD19 CAR, may be replaced with the EF1a promoter to produce the OT-CD19N-021 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-006 construct may be replaced with the EF1a promoter to generate the OT-CD19N-022 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-007 construct may be replaced with the EF1a promoter to generate the OT-CD19N-023 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-008 construct may be replaced with the EF1a promoter to generate the OT-CD19N-024 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-009 construct may be replaced with the EF1a promoter to produce the OT-CD19N-025 construct.

  In one embodiment, the CAR construct comprises a CD19 scFV (eg, CAT13.1E10 or FMC63), a CD8α spacer or transmembrane domain, and a 4-1BB and CD3ζ endodomain. These constructs with CAT13.1E10 show increased proliferation after stimulation in vitro, increased cytotoxicity to CD19 + targets, and increased effector-target interactions compared to constructs with FMC63. .

  In some embodiments, the payloads of the invention may be modulated with the catalytic domain of E3 ubiquitin ligase. The catalytic domain of E3 ligase may be fused to an antibody or fragment of an antibody. The payload is fused to the antigen recognized by the antibody or antibody fragment fused to the E3 ligase catalytic domain. E3 ligases useful in the present invention include, but are not limited to, Ring E3 ligase, HECT E3 ligase and RBR E3 ligase. Kanner SA et al. (2017) eLife; 6: e29744, any of which may be useful in the present invention, the contents of which are incorporated by reference in their entirety.

  In some embodiments, the payloads described herein may be regulated by the E3 ubiquitin ligase construct. The E3 ligase construct may include the catalytic domain of E3 ligase fused to an SRE and an antibody or antibody fragment. The payload is fused to the antigen recognized by the antibody or antibody fragment added to the catalytic domain of E3 ligase. In the absence of a stimulus corresponding to the SRE, the E3 ubiquitin ligase construct is destabilized and the payload fused with the antigen becomes expressible. In the presence of the ligand corresponding to the SRE, the E3 ubiquitin ligase construct is stabilized and able to bind to the antigen fused to the payload. Binding of the E3 ligase construct to the antigen targets the protein for degradation. The E3 ubiquitin ligase construct may be used to modulate any of the payloads described herein, so long as the payload is fused to the antigen recognized by the antibody or antibody fragment in the E3 ubiquitin ligase construct. In some embodiments, the payload is a chimeric antigen receptor. The E3 ubiquitin ligase construct may be used to design logic gates. In one embodiment, the E3 ubiquitin ligase construct may be used to generate a NOT gate, with one ligand inducing payload expression and another ligand inhibiting payload expression. In some embodiments, the E3 ubiquitin ligase construct may be used to generate a NOT gate by fusing the payload-antigen fusion protein with a second SRE that is separate from the SRE of the E3 ubiquitin ligase construct.

  In some embodiments, the payload of the present invention may be any of the costimulatory molecules and / or intracellular domains described herein. In some embodiments, one or more costimulatory molecules, each under the control of a different SRE, may be used in the present invention. SRE-modulating costimulatory molecules may also be expressed with first generation CAR, second generation CAR, third generation CAR, fourth generation, or any other CAR design described herein.

Tandem CAR (TanCAR)
In some embodiments, the CAR of the invention may be a tandem chimeric antigen receptor (TanCAR) capable of targeting 2, 3, 4, or more tumor-specific antigens. . In some aspects, the CAR is a bispecific TanCAR containing two targeting domains that recognize two different TSAs on tumor cells. Bispecific CARs have an extracellular region that includes a targeting domain specific to a first tumor antigen (eg, antigen recognition domain) and a targeting domain specific to a second tumor antigen (eg, antigen recognition domain). It can be further defined as having. In another aspect, the CAR is a multispecific TanCAR comprising three or more targeting domains arranged in a tandem arrangement. The spaces between the targeting domains of TanCAR are between about 5 and about 30 amino acids in length, for example 6,7,8,9,10,11,12,13,14,15,16,17,18,19. , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids.

Split car
In some embodiments, a component of the invention that comprises a targeting moiety, a transmembrane domain and an intracellular signaling domain is divided into two or more parts to provide multiple inputs that facilitate assembly of an intact functional receptor. You may make it depend on. In one embodiment, split synthetic CAR systems can be constructed in which the assembly of activated CAR receptors depends on the binding of ligands to SREs (eg, small molecules) and specific antigens to targeting moieties. As a non-limiting example, split CAR consists of two parts assembled in a small molecule-dependent manner, one part of the receptor featuring an extracellular antigen binding domain (eg, scFv) and the other part The portion has an intracellular signaling domain such as the CD3ζ intracellular domain.

  In other aspects, split parts of the CAR system can be further modified to increase signal. In one example, the second portion of the cytoplasmic fragment may be anchored to the plasma membrane by incorporating a transmembrane domain (eg, CD8α transmembrane domain) into the construct. Also, additional extracellular domains, eg extracellular domains that mediate homodimerization, may be added to the second part of the CAR system. These modifications may enhance receptor output activity, ie T cell activation.

  In some aspects, the two parts of the split CAR system comprise a heterodimerization domain that conditionally interacts upon binding of the heterodimerization small molecule. Thus, the components of the receptor are assembled in the presence of small molecules to form an intact system, which is subsequently activated by the participation of the antigen. Any known heterodimerization component can be incorporated into the split CAR system. Gibberellin-induced dimerization system (GID1-GAI), trimethoprim-SLF-induced ecDHFR and FKBP dimerization (Czlapinski et al., J Am Chem Soc., 2008, 130 (40): 13186-13187) and PP2C and. Other small molecule-dependent heterodimerizations including, but not limited to, ABA (abscisic acid) -induced dimerization of PYL domains (Cutler et al., Annu Rev Plant Biol. 2010, 61: 651-679). Domains may also be used. More flexible control of the activity of CAR-modified T cells by dual regulation using inducible assembly (eg, ligand-dependent dimerization) and degradation (eg, destabilization domain-induced CAR degradation) of the split CAR system You can

Switchable CAR
In some embodiments, the CAR of the present invention may be a switchable CAR. Julillat et al. (Juilerat et al., Sci. Rep., 2016, 6: 18950; the contents of which are hereby incorporated by reference in their entireties) temporarily switch in response to a stimulus (eg, a small molecule). Recently reported a controllable CAR that can be turned on. This CAR design incorporates the system directly into the hinge domain that separates the scFv domain from the CAR plasma membrane domain. Such systems are capable of splitting or binding different key functions of CAR, such as activation and costimulation within different chains of receptor complexes that mimic the complexity of the TCR's natural architecture. This integrated system can switch the interaction of scFv and antigen between on / off states controlled by the presence or absence of stimulation.

Reversible CAR
In other embodiments, the CAR of the invention may be a reversible CAR system. In this CAR architecture, the LID domain (ligand-induced degradation) is incorporated into the CAR system. CAR can be transiently downregulated by adding a ligand for the LID domain. The combination of LID and DD-mediated regulation provides regulatable regulation of continuously activated CAR T cells, thereby reducing CAR-mediated tissue damage.

Activation conditional CAR
In some embodiments, the payload of the invention may be an activated conditional chimeric antigen receptor expressed only on activated immune cells. Expression of CAR may be combined with activating conditional control regions, which means one or more nucleic acid sequences which under its control induce the transcription and / or expression of sequences such as CAR. Such an activation conditional control region may be the promoter of a gene that is upregulated during activation of immune effector cells, such as the IL2 promoter or NFAT binding site. In some embodiments, immune cell activation may be achieved by a constitutively expressed CAR (WO2016126608; the contents of which are hereby incorporated by reference in their entirety).

Cytokines, chemokines, and other soluble factors According to the invention, the CARs of the invention may be utilized with other payloads of the invention, including cytokines, chemokines, growth factors, as well as immune cells, cancer cells. And soluble proteins produced by other cell types, which function as chemical mediators between cells and tissues in the body. These proteins mediate a wide range of physiological functions, ranging from effects on cell proliferation, differentiation, migration, and survival to many effector activities. For example, activated T cells produce various cytokines for cytotoxic function and eliminate tumor cells.

  In some embodiments, payloads of the invention include cytokines, including but not limited to interleukins, tumor necrosis factor (TNF), interferon (IFN), TGFβ and chemokines, and fragments, variants, analogs, and It may be a derivative. In some embodiments, the payload of the present invention may be a cytokine that stimulates an immune response. In other embodiments, the payload of the present invention may be an antagonist of a cytokine that negatively affects the anti-cancer immune response.

  In some embodiments, the payloads of the invention may be cytokine receptors, recombinant receptors, variants, analogs, and derivatives thereof; or cytokine signal components.

In some embodiments, the cytokines of the invention are utilized to proliferate, survive, persist and maintain immune cells such as CD8 + _TEM , natural killer cells and tumor infiltrating lymphocyte (TIL) cells for use in immunotherapy. You may improve efficacy. In another embodiment, T cells modified with two or more DD-regulated cytokines are utilized to provide rate control of T cell activation and tumor microenvironment remodeling. In one aspect, the invention provides biocircuits and compositions for minimizing toxicity associated with cytokine therapy. Despite successful reduction of tumor burden, systemic cytokine therapy often produces severe dose limiting side effects. Two factors contribute to the observed toxicity: (a) pleiotropic expression, where cytokines affect different cell types and may produce opposite effects on the same cells depending on the context ( b) Cytokines have a short serum half-life and therefore need to be administered in high doses to achieve therapeutic effects, which aggravates the pleiotropic effect. In one aspect, the cytokines of the invention may be utilized to regulate cytokine expression in the event of an adverse effect. In some embodiments, the cytokines of the invention may be designed to prolong life or enhance specificity to minimize toxicity.

  In some embodiments, the payload of the present invention may be an interleukin (IL) cytokine. Interleukins (ILs) are a class of glycoproteins produced by leukocytes to regulate the immune response. As used herein, the term "interleukin (IL)" refers to interleukin polypeptides derived from any species or source, including full length proteins as well as fragments or portions of proteins. In some aspects, the interleukin payload comprises IL1, IL1α (also called hematopoietin-1), IL1β (catabolin), IL1δ, IL1ε, IL1η, IL1ζ, interleukin-1 family members 1-11 (IL1F1-IL1F11). , Interleukin-1 homologues 1 to 4 (IL1H1 to IL1H4), IL1 related proteins 1 to 3 (IL1RP1 to IL1RP3), IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11, IL11a, IL11b, IL12, IL13, IL14, IL15, IL16, IL17, IL17A, Il17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20-like (IL20L), I21, IL22, IL23, IL23A, IL23-p19, IL23-p40, IL24, Il25, IL26, IL27, IL28A, IL28B, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36α, IL36β, IL36γ, IL36RN, It is selected from IL37, IL37a, IL37b, IL37c, IL37d, IL37e and IL38. In another aspect, the payload of the invention comprises CD121a, CDw121b, IL2Rα / CD25, IL2Rβ / CD122, IL2Rγ / CD132, CDw131, CD124, CD131, CDw125, CD126, CD130, CD127, CDw210, IL8RA, IL11Rα, CD212, CD213α1. , CD213α2, IL14R, IL15Rα, CDw217, IL18Rα, IL18Rβ, IL20Rα, and IL20Rβ, which may be an interleukin receptor.

In one embodiment, the payload of the present invention may include IL12. IL12 is a heterodimeric protein of two subunits (p35, p40) secreted by antigen presenting cells such as macrophages and dendritic cells. IL12 acts on natural killer (NK) cells, macrophages, CD8 ⁺ cytotoxic T cells, and CD4 ⁺ T helper cells via the STAT4 pathway to induce IFN-γ production in these effector immune cells. 1 cytokine (reviewed in Trinchieri G, Nat Rev Immunol. 2003; 3 (2): 133-146). IL12 can promote the cytotoxic activity of NK cells and CD8 ⁺ T cells and thus has antitumor function. Intravenous injection of recombinant IL12 showed moderate clinical efficacy in a minority of patients with advanced melanoma and renal cell carcinoma (Gollob et al, Clin. Cancer Res. 2000; 6 (5): 1678-1692). IL12 is used as an adjuvant to enhance cytotoxic immunity using melanoma antigen vaccine or peptide pulsed peripheral blood mononuclear cells and to promote NK cell activity in breast cancer by trastuzumab treatment. ing. Local delivery of IL12 to the tumor microenvironment promotes tumor regression in some tumor models. All these studies indicate that locally increased IL12 levels can promote anti-tumor immunity. One major obstacle to systemic or topical administration of recombinant IL12 protein, or via oncolytic viral vectors, is the severe side effect of presenting high levels of IL12. The development of systems that tightly regulate IL12 levels may provide safe use of IL12 in the treatment of cancer.

  It is understood in the art that particular gene and / or protein nomenclature for the same gene or protein may or may not include punctuation marks such as the dash "-" or symbols such as the Greek letter. Whether or not they are included herein, their meaning is not meant to be changed, as will be appreciated by those skilled in the art. For example, IL2, IL2, IL2 refer to the same interleukin. Similarly, TNF alpha, TNF alpha, TNF-alpha, TNF-alpha, TNF alpha and TNF alpha all refer to the same protein.

  In one aspect, the effector module of the invention may be a DD-IL12 fusion polypeptide. This regulatable DD-IL12 fusion polypeptide can be used directly as an immunotherapeutic agent or transduced into immune effector cells (T cells and TIL cells) to provide greater in vivo proliferation and adoption for adoptive cell transduction. Viable modified T cells may be generated. Modulated IL12 may be used to minimize the need for stringent pretreatment regimens in current adoptive cell therapy. DD-IL12 may be utilized to modify the tumor microenvironment and enhance its persistence in solid tumors currently refractory to tumor antigen targeted therapy. In some embodiments, CAR expressing T cells may be protected with DD-regulated IL12 to reduce immunosuppression without systemic toxicity.

In some embodiments, IL12 may be Flexi IL12, in which case both the p35 and p40 subunits are encoded by a single cDNA, producing a single chain polypeptide. Single chain polypeptides may be produced by placing the p35 subunit at the N-terminus or C-terminus of the single chain polypeptide. Similarly, the p40 subunit may be located at the N-terminus or C-terminus of the single chain polypeptide. In some embodiments, the IL12 constructs of the invention may be under the transcriptional control of a CMV promoter (SEQ ID NO: 716), EF1a promoter (SEQ ID NO: 717, SEQ ID NO: 908) or PGK promoter (SEQ ID NO: 718). . Any portion of IL12 that retains one or more functions of full length or mature IL12 may be useful in the present invention. In some aspects, DD-IL12 comprises the amino acid sequences listed in Table 11. The amino acid sequences in Table 11 may include the stop codons shown in the table with an " ^* " at the end of the amino acid sequence.

In one embodiment, the payload of the present invention may include IL15. Interleukin 15 is a potent immunostimulatory cytokine and an essential survival factor for T cells and natural killer cells. Preclinical studies comparing IL2 with IL15 have shown that IL15 is less toxic than IL2. In some embodiments, the effector module of the present invention may be a DD-IL15 fusion polypeptide. The IL15 polypeptide may also be modified to increase its binding affinity for the IL15 receptor. For example, the asparagine at position 72 of IL15 may be replaced with aspartic acid (SEQ ID NO: 2 of US Patent Publication US20140134128A1; the contents of which are incorporated by reference in their entirety). In some embodiments, the IL15 constructs of the invention may be placed under the transcriptional control of a CMV promoter (SEQ ID NO: 716), EF1a promoter (SEQ ID NO: 717, SEQ ID NO: 908) or PGK promoter (SEQ ID NO: 718). . In some aspects, DD-IL15 has an amino acid sequence set forth in Table 12. The amino acid sequences in Table 12 may include the stop codon shown in the table with " ^* " added to the end of the amino acid sequence.

  A unique feature of IL15-mediated activation is the mechanism of transduction, where IL15 binds to and activates membrane-bound IL15β / γ receptors on the same or different cells. Presented as a complex with (IL15Ra). The IL15 / IL15Ra complex is more effective at activating IL15 signaling than IL15 itself. Thus, in some embodiments, effector modules of the invention may comprise a DD-IL15 / IL15Ra fusion polypeptide. In one embodiment, the payload may be an IL15 / IL15Ra fusion polypeptide described in US Patent Publication No. US2160158285A1, the content of which is incorporated herein by reference in its entirety. IL15 receptor α contains an extracellular domain called the sushi domain that contains most of the structural elements required for binding to IL15. Thus, in some embodiments, the payload may be an IL15 / IL15Ra sushi domain fusion polypeptide described in US Patent Publication No. US200902238791A1, the content of which is incorporated herein by reference in its entirety. ..

Modulated IL15 / IL15Ra may be used to promote proliferation, survival and efficacy of CD8T _EM cell populations without affecting regulatory T cells, NK cells and TIL cells. In one embodiment, DD-IL15 / IL15Ra may be utilized to enhance CD19-directed T cell therapy in B cell leukemias and lymphomas. In one aspect, IL15 / IL15Ra may be used as a payload of the invention to reduce the need for preconditioning regimens in the current CAR-T treatment paradigm.

  Effector modules comprising DD-IL15, DD-IL15 / IL15Ra and / or DD-IL15 / IL15Ra sushi domains are either secreted (eg, using the IL2 signal sequence) or membrane bound (eg, , IgE or CD8a signal sequences).

In some aspects, DD-IL115 / IL15Ra has the amino acid sequences shown in Tables 13a, 13b, and 13c. The amino acid sequences in Tables 13a, 13b and 13c may include the stop codons shown in the table with an " ^* " at the end of the amino acid sequence.

In one embodiment, the payload of the present invention may include IL18. IL18 is an inflammatory and immunoregulatory cytokine that promotes IFN-γ production by T cells and NK cells. IL18 belongs to the IL1 family. Secreted IL18 binds to the heterodimeric receptor complex consisting of the IL18R α and β chains and initiates signal transduction. IL18 acts in concert with other cytokines to regulate functions of the immune system, including induction of IFN-γ production, Th1 response, and activation of NK cells in response to pathogen products. IL18 has shown anti-cancer effects in some tumors. Administration of recombinant IL18 protein or IL18 transgene induces regression of melanoma or sarcoma through activation of CD4 ⁺ T and / or NK cell-mediated responses (Srivastava et al., Curr. Med. Chem., 2010, 17: 3353-3357). The combination of IL18 with other cytokines such as IL12 and costimulatory molecules (eg CD80) enhances the antitumor effect of IL18. For example, the IL18 and IL12A / B or CD80 genes were successfully integrated into the genome of oncolytic viruses for the purpose of synergistically eliciting an anti-tumor immune response mediated by T cells (Choi et al., Gene Ther. , 2011, 18: 898-909). The IL2 / IL18 fusion protein also shows improved antitumor properties compared to both cytokines alone and low toxicity in preclinical models (Acres et al., Cancer Res., 2005, 65: 9536-9546). .

  IL18 alone or a combination of IL12 and IL15 activates NK cells. Preclinical studies have shown that adoptively transferred IL12, IL15 and IL18 pre-activated NK cells show enhanced effector function on tumors established in vivo (Ni et al., J Exp Med. 2012, 209: 2351-2365; and Romee et al., Blood. 2012, 120: 4751- 4760). In addition, human IL12 / IL15 / IL18 activated NK cells exhibit memory-like characteristics and secrete more IFN-γ in response to cytokines (eg low concentrations of IL2). In one embodiment, the effector module of the present invention may be a DD-IL18 fusion polypeptide.

In one embodiment, the payload of the present invention may include IL21. IL21 is another pleiotropic type I cytokine produced primarily by T cells and natural killer T (NKT) cells. IL21 exerts diverse effects on various cell types including but not limited to CD4 ⁺ and CD8 ⁺ T cells, B cells, macrophages, monocytes, and dendritic cells (DC). The functional receptor for IL21 consists of the IL21 receptor (IL21R) and the general cytokine receptor gamma chain, which is also a subunit of the receptors for IL2, IL4, IL7, IL9, and IL15. Studies have provided compelling evidence that IL21 is a promising immunotherapeutic agent for cancer immunotherapy. IL21 promotes maturation, enhances cytotoxicity, and induces IFN-γ and perforin production by NK cells. These effector functions inhibit the growth of B16 melanoma (Kasaian et al., Immunity. 2002, 16 (4): 559-569; and Brady et al., J Immunol. 2004,172 (4): 2048-. 2058). IL21, together with IL15, enhances the number of antigen-specific CD8 ⁺ T cells and their effector functions and causes tumor regression (Zeng et al., J Exp Med. 2005, 201 (1): 139-148). IL21 may also be used to rejuvenate multiple immune effector cells within the tumor microenvironment. IL21 may also directly induce apoptosis in certain types of lymphoma, such as diffuse large B-cell lymphoma, mantle cell lymphoma, chronic lymphocytic leukemia cells, through activation of the STAT3 or STAT1 signaling pathways. IL21, alone or in combination with anti-CD20 mAb (rituximab), can activate NK cell-dependent cytotoxicity. Interestingly, the discovery of the immunosuppressive effects of IL21 suggests that this cytokine is a "double-edged sword," and IL21 stimulation may lead to the induction or suppression of immune responses. When using immunotherapeutic agents related to IL21, both the stimulatory and inhibitory effects of IL21 must be considered. The level of IL21 needs to be tightly controlled by regulatory elements. In one aspect, the effector module of the invention may be a DD-IL21 fusion polypeptide.

In some embodiments, the payload of the present invention may include type I interferon. Type I interferon (IFN-I) is a soluble protein important in combating viral infections in humans. IFN-I includes IFN-α subtype (IFN-α1, IFN-α1b, IFN-α1c), IFN-β, IFN-δ subtype (IFN-δ1, IFN-δ2, IFN-δ8), IFN-. γ, IFN-κ, and IFN-ε, IFN-λ, IFN-ω, IFN-τ and IFN-ζ. IFN-α and IFN-β are the major IFN-I subtypes of the immune response. All subtypes of IFN-I signal via the unique heterodimer receptor interferon alpha receptor (IFNAR), which consists of two subunits, IFNAR1 and IFNAR2. IFNR activation regulates the host's response to viral infection and adaptive immunity. Janus kinase-signal transduction and transcriptional activator (JAK-STAT) pathway, mitogen-activated protein kinase (MAPK) pathway, phosphoinositide 3-kinase (PI3K) pathway, v-crk sarcoma virus CT10 oncogene homolog (bird) A number of signaling cascades can be activated by IFNR, including the like-like (CRKL) pathway and the NF-κB cascade. It has been established for a long time that type I IFN directly inhibits the growth of tumor cells and virus-infected cells, increases MHC class I expression, and enhances antigen recognition. IFN-I has also been shown to be involved in the regulation of the immune system. IFNs can regulate the immune system either directly through interferon receptors (IFNR) or indirectly by the induction of chemokines and cytokines. Type I IFN enhances NK cell function and promotes NK cell survival. Type I IFN also affects monocytes, supports the differentiation of monocytes into highly antigen-presenting DCs, and stimulates macrophage function and differentiation. Several studies have also shown that IFN-I promotes survival and function of CD8 ⁺ T cells. In some instances, it may be desirable to modulate the expression of type I IFN using the biocircuits of the invention to avoid immune suppression caused by long-term treatment with IFN.

  Novel anti-cancer immunotherapies using recombinant type I IFN protein, type I IFN transgene, type I IFN coding vector and type I IFN expressing cells have been developed. For example, IFN-α has been approved as a therapeutic agent for several neoplastic disorders such as melanoma, RCC, and multiple myeloma. Although type I IFN is a powerful tool that directly and indirectly regulates the function of the immune system, it has side effects from long-term systemic treatment and its efficacy is not high enough, so IFN for clinical use in oncology is -The interest in α is weakening. Type I IFNs appear to be more effective in tightly regulating IFN levels in malignant tissues. From the observation that optimizing the intermittent pace may help avoid IFN-I-induced (ie, SOCS1-induced) signaling of desensitization mechanisms (negative feedback mechanisms) of responding immune cells. , An intermittent delivery approach has been proposed. According to the invention, the effector module may comprise a DD-IFN fusion polypeptide. DD and its ligands regulate the expression of IFN to induce antiviral and antitumor immune responses, while minimizing the side effects caused by long-term exposure to IFN.

  In some embodiments, the payload of the present invention may include a member of the tumor necrosis factor (TNF) superfamily. As used herein, the term "TNF superfamily" refers to a group of cytokines capable of inducing apoptosis. Members of the TNF family include TNF-α, TNF-β (also called lymphotoxin-α (LT-α)), lymphotoxin-β (LT-β), CD40L (CD154), CD27L (CD70), CD30L (CD153). , FASL (CD178), 4-1BBL (CD137L), OX40L, TRAIL (TNF-related apoptosis-inducing ligand), APRIL (proliferation-inducing ligand), TWEAK, TRANCE, TALL-1, GITRL, LIGHT and TNFSF1 to TNFSF20 (TNF ligand super). Family members 1-20) are included. In one embodiment, the payload of the present invention may be TNF-α. TNF-α causes cytolysis of tumor cells and also induces cell proliferative differentiation. In one aspect, the effector module of the invention may comprise a DD-TNFα fusion polypeptide.

  In some embodiments, the payloads of the invention may include inhibitory molecules that block inhibitory cytokines. The inhibitor may be a blocking antibody specific to the inhibitory cytokine, an antagonist to the inhibitory cytokine, and the like.

In some aspects, the payload of the present invention may include an inhibitor of the secondary cytokine IL35. IL35 belongs to the interleukin-12 (IL12) cytokine family, and is a heterodimer composed of IL27β chain Ebi3 and IL12α chain p35. Secretion of bioactive IL35 has only been described in forkhead box protein 3 (Foxp3) ⁺ regulatory T cells (Treg) (resting and activated Treg). Unlike other membranes in the family, IL35 appears to function only in an anti-inflammatory manner by inhibiting effector T cell proliferation and possibly other parameters (Colison et al., Nature, 2007, 450). (7169): 566-569).

  In some embodiments, the payloads of the invention may include inhibitors that block the transforming growth factor beta (TGF-beta) subtypes (TGF-beta1, TGF-beta2 and TGF-beta3). TGF-β is secreted by many cell types including macrophages and often forms a complex with the two proteins LTBP and LAP. Serum proteinases such as plasmin catalyze the release of active TGF-β from the complex derived from activated macrophages. Increased expression of TGF-β has been shown to correlate with the malignancy of many cancers. The immunosuppressive activity of TGF-β in the tumor microenvironment contributes to carcinogenesis.

  In some embodiments, the payload of the present invention may include an inhibitor of IDO enzyme.

  In some embodiments, the payload of the present invention can include chemokines and chemokine receptors. Chemokines are signaling proteins that are capable of inducing directed chemotaxis in secreted families of small cytokines, or nearby responsive cells. The chemokine is SCY (small molecule cytokine) selected from the group consisting of SCY1-28 (CCL1-28), SCYB1-16 (CXCL1-16), SCYC1-2 (XCL1-2), SCYD-1 and SCYE-1. Or a C chemokine selected from XCL1 and XCL2; or CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19. , CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; or CXCL1, CXCL2, CXCL3, CXCL4, XCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXC chemokine is selected from CXCL16 and CXCL17; or a CX3C chemokine CX3CL1. In some aspects, the chemokine receptor is a receptor for C chemokines, including XCR1; or a receptor for CC chemokines, including CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9 and CCR10; or CXCR1. , CXCR2, CXCR3, CXCR4 and CXCR5 receptors for CXC chemokines; or CX3C chemokine receptor CX3CR1.

  In some embodiments, the payload of the invention comprises GM-CSF (granulocyte macrophage colony stimulating factor), erythropoietin (EPO), MIP3a, monocyte chemoattractant protein (MCP) -1, intracellular adhesion molecule (ICAM). ), Macrophage colony stimulating factor (M-CSF), interleukin-1 receptor activating kinase (iRAK-1), lactotransferrin, and granulocyte colony stimulating factor (G-CSF), important roles in immunotherapy. May include other immunomodulators that

  In some embodiments, the payload of the present invention may include amphiregulin. Amphiregulin (AREG) is an EGF-like growth factor that binds to the EGFR receptor and enhances the function of CD4 + regulatory T cells (Tregs). AREG promotes immunosuppression in the tumor environment. Thus, in some embodiments, an amphiregulin may be included in the payload of the invention to weaken the immune response during immunotherapy.

  In some embodiments, the payloads of the invention may include fusion proteins that may fuse cytokines, chemokines and / or other soluble factors to other biomolecules such as antibodies and / or receptor ligands. Such fusion molecules can extend the half-life of cytokines, reduce systemic toxicity, and increase local concentrations of cytokines at tumor sites. Fusion proteins containing more than one cytokine, chemokine, and / or other soluble factor may be utilized to achieve a synergistic therapeutic effect. In one embodiment, the payload may be a GM-CSF / IL2 fusion protein.

3. Additional Effector Module Functions The effector module of the invention regulates signal sequences that regulate the distribution of the payload of interest, cleavage and / or processing functions that facilitate cleavage of the payload from the effector module construct, cellular localization of the effector module. It may include one or more linker sequences that connect different components of the targeting and / or penetration signals, tags, and / or effector modules, which may be.

Signal Sequences In addition to the SRE (eg, DD) and payload regions, the effector modules of the invention may further include one or more signal sequences. A signal sequence (sometimes referred to as a signal peptide, targeting signal, target peptide, localization sequence, transit peptide, leader sequence or leader peptide) is a protein (e.g., effector module of the invention) that is assigned to cells and / or designated cells. Direct it to the extracellular location. Protein signal sequences play a central role in the targeting and translocation of almost all secreted proteins and many integral membrane proteins.

  Signal sequences are short (5-30 amino acids long) peptides present at the N-terminus of most of newly synthesized proteins that are directed to specific positions. The signal sequence is recognized by the signal recognition particle (SRP) and can be cleaved with type I and type II signal peptide peptidases. A signal sequence derived from a human protein can be incorporated as a regulatory module for the effector module to direct the effector module to specific cell and / or extracellular locations. These signal sequences have been experimentally verified and can be cleaved (Zhang et al., Protein Sci. 2004, 13: 2819-2824).

  In some embodiments, the signal sequence may, but need not, be located at the N-terminus or C-terminus of the effector module, but not necessarily, cleaves the desired effector module to produce a "mature" payload, That is, one may obtain the immunotherapeutic agents discussed herein.

  In some examples, the signal sequence may be a secretory signal sequence derived from naturally-occurring secretory proteins and variants thereof. In some examples, the secretory signal sequence is encoded by a cytokine signal sequence, eg, an IL2 signal sequence having amino acids of SEQ ID NO: 783 encoded by nucleotides of SEQ ID NOs: 788-791 and / or nucleotides of SEQ ID NOs: 736-744. It may be, but is not limited to, a p40 signal sequence having the amino acid sequence of SEQ ID NO: 719.

  In some examples, a signal sequence that directs the payload of interest to the surface membrane of the target cell may be used. Expression of the payload on the surface of the target cell may be useful in limiting the diffusion of the payload into the non-target in vivo environment, thereby potentially improving the safety properties of the payload. Furthermore, membrane presentation of the payload may allow physiological and qualitative signaling, as well as stabilization and recycling of the payload for a longer half-life. The membrane sequence may be the endogenous signal sequence of the N-terminal component of the payload of interest. In some cases it may be desirable to replace this sequence with a different signal sequence. The signal sequence may be selected based on its compatibility with the secretory pathway of the cell type of interest so that the payload is displayed on the surface of the T cell. In some embodiments, the signal sequence comprises an IgE signal sequence having the amino acid sequence of SEQ ID NO: 801 and the nucleotide sequence of SEQ ID NO: 810, 930, or 931, the amino acid sequence of SEQ ID NO: 628, and the nucleotide sequence of SEQ ID NO: 671-675. It may be a CD8a signal sequence having (also called CD8a leader) or an IL15Ra signal sequence having amino acid sequence SEQ ID NO: 932 and the nucleotide sequence of SEQ ID NO: 933 (also called IL15Ra leader).

  Other examples of signal sequences, including variants, are US Pat. Nos. 8,148,494; 8,258,102; 9,133,265; 9,279,007; and US Pat. It may be modified signal sequences described in published application WO20070141666; as well as in published international patent application WO1993018181, the contents of each of which is incorporated herein by reference in its entirety.

  In other examples, the signal sequence may be a heterologous signal sequence from another organism, such as a virus, yeast, and bacterium, which can direct the effector module to a particular cellular site, such as the nucleus (eg, , EP 1209450). As another example, Trichoderma-derived aspartic protease (NSP24) signal sequence (eg, US Pat. No. 8,093,016 to Cervin and Kim) capable of increasing secretion of fusion proteins such as enzymes, bacterial lipoproteins. Signal sequences (e.g. PCT Application Publication No. WO 199109952 to Lau and Rioux), E. E. coli enterotoxin II signal peptide (eg, US Pat. No. 6,605,697 to Kwon et al.), E. coli. E. coli secretion signal sequence (eg, US Patent Publication No. US20160904404 to Malley et al.), a lipase signal sequence from methylotrophic yeast (eg, US Pat. No. 8,975,041), and a signal peptide of DNase from Coryneform bacteria (eg, US Pat. , U.S. Pat. No. 4,965,197), the contents of each of which are incorporated herein by reference in their entirety.

  Signal sequences also include nuclear localization signals (NLS), nuclear export signals (NES), polarized cell tubular vesicle structure localization signals (see, eg, US Pat. No. 8,993,742; Cour et al. , Nucleic Acids Res. 2003, 31 (1): 393-396; the content of each of which is incorporated herein by reference in its entirety), extracellular localization signals, signals to intracellular locations (eg, , Lysosomes, endoplasmic reticulum, Golgi, mitochondria, plasma membranes and peroxisomes) (see, eg, US Pat. No. 7,396,811; and Negi et al., Database, 2015, 1-7; Each of which is incorporated herein by reference in its entirety).

  In some embodiments, the signal sequences of the invention include, but are not limited to, the table of co-pending co-owned US provisional application Ser. No. 62 / 320,864, filed April 11, 2016. 6, or any of the sequences set forth in US Provisional Application No. 62 / 466,596 filed March 3, 2017 and WO 2017/180587, the contents of each of which is incorporated by reference in its entirety. Incorporated herein by reference.

Cleavage Site In some embodiments, the effector module has cleavage and / or processing functions. The effector module of the present invention may include at least one protein cleavage signal / site. The protein cleavage signal / site may be N-terminal, C-terminal, any space between the N- and C-termini, such as, but not limited to, between the N- and C-termini, between the N- and mid-points, midpoints. It may be located between the C-termini and combinations thereof.

  The effector module may include one or more cleavage signal (s) / site (s) of any proteinase. The proteinase may be a serine proteinase, a cysteine proteinase, an endopeptidase, a dipeptidase, a metalloproteinase, a glutamate proteinase, a threonine proteinase and an aspartate proteinase. In some aspects, the cleavage site is a furin, actinidine, calpain-1, carboxypeptidase A, carboxypeptidase P, carboxypeptidase Y, caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, Caspase-6, caspase-7, caspase-8, caspase-9, caspase-10, cathepsin B, cathepsin C, cathepsin G, cathepsin H, cathepsin K, cathepsin L, cathepsin S, cathepsin V, clostripain, chymase, Chymotrypsin, elastase, endoproteinase, enterokinase, factor Xa, formic acid, granzyme B, matrix metallopeptidase-2, matrix metallopeptidase-3, pepsin, proteinase K, SUM Protease, subtilisin, TEV protease, thermolysin, thrombin, or may be a signal sequence of trypsin and TAGZyme.

  In one embodiment, the cleavage site is a furin cleavage site having the amino acid sequence SARNRQKRS (SEQ ID NO: 721) encoded by the nucleotide sequence of SEQ ID NO: 750; or the amino acid sequence ARNRQKRS (SEQ ID NO: 751) encoded by the nucleotide sequence of SEQ ID NO: 751. Modified furin cleavage site having 722); or a modified furin site having the amino acid sequence ESRRVRRNKRSK (SEQ ID NO: 630) encoded by the nucleotide sequences of SEQ ID NOs: 681-683.

  In some embodiments, cleavage sites of the invention include, but are not limited to, co-pending co-owned US provisional patent application No. 62 / 320,864, filed April 11, 2016, Table 7, or 2017. US Provisional Application No. 62 / 466,596 and any of those shown in International Publication WO2017 / 180587, filed Mar. 3, 2014, the contents of each of which are hereby incorporated by reference in their entirety. To do.

Protein Tag In some embodiments, the effector modules of the present invention may include a protein tag. Protein tags may be used to detect and monitor the effector module process. The effector module can include one or more tags such as an epitope tag (eg, FLAG or hemagglutinin (HA) tag). Multiple protein tags may be used in the effector module. They include self-labeled polypeptide tags (eg, haloalkane dehalogenase (halo tag 2 or halo tag 7), ACP tags, clip tags, MCP tags, snap tags), epitope tags (eg FLAG, HA, His, and Myc). ), Fluorescent tags (eg green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), and variants thereof), bioluminescent tags (eg luciferase and variants thereof), affinity tags (eg , A maltose binding protein (MBP) tag, a glutathione-S-transferase (GST) tag), an immunogenic affinity tag (for example, protein A / G, IRS, AU1, AU5, glu-glu, KT3, S-tag, HSV, VSV-G, Xpress and V5 , And other tags such as biotin (small molecule), Strep tag (StrepII), SBP, biotin carboxyl carrier protein (BCCP), eXact, CBP, CYD, HPC, CBD intein-chitin binding domain, Trx, NorpA, and Includes, but is not limited to, NusA.

  In other embodiments, the tag is also US Pat. No. 8,999,897; 8,357,511; 7,094,568; 5,011,912; No. 4,703,004; US Patent Application Publication Nos. US2013115635 and US2013012687; and International Application Publication No. WO2013091661. Are incorporated herein by reference.

  In some embodiments, multiple protein tags, either the same or different, may be used, each tag may be placed at the same N-terminus or C-terminus, while in other cases these tags may be Tags may be placed at each end.

  In some embodiments, the protein tags of the invention include, but are not limited to, Table 8 of co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or Included are any of the tags shown in US Provisional Application No. 62 / 466,596 filed March 3, 2017 and International Publication WO 2017/180587, the contents of each of which is hereby incorporated by reference in its entirety. Incorporated into the book.

Targeting Peptides In some embodiments, the effector modules of the invention may further comprise targeting and / or penetrating peptides. Using a small targeting peptide and / or a penetrating peptide that selectively recognizes a cell surface marker (eg, receptor, transmembrane protein, extracellular matrix molecule), the effector module can be used for a desired organ, tissue, or cell. Can be targeted to. In vitro synthesized short peptides (5-50 amino acid residues) and native peptides, or analogs, variants thereof, to home effector modules to desired organs, tissues and cells, and / or intracellular locations The derivative may be incorporated into the effector module.

  In some embodiments, targeting sequences and / or penetrating peptides may be included in the effector module to drive the effector module to a target organ, or tissue, or cell (eg, cancer cell). In other embodiments, the targeting peptide and / or the penetrating peptide may direct the effector module to a particular intracellular location within the cell.

  The targeting peptide has any number of amino acids from about 6 to about 30. The peptides are 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29. Or it may have 30 amino acids. In general, a targeting peptide may have 25 amino acids or less, eg 20 amino acids or less, eg 15 amino acids or less.

  Exemplary targeting peptides include, but are not limited to, those disclosed in the art, eg, US Pat. Nos. 9,206,231; 9,110,059; 8,706,219; And No. 8,772,449; and U.S. Patent Application Publication Nos. It may include those disclosed in International Application Publication Nos. WO2015179691 and WO2015183044, the contents of each of which are incorporated herein by reference in their entireties.

  In some embodiments, targeting peptides of the invention include, but are not limited to, Table 9 of co-pending co-owned US provisional application No. 62 / 320,864 filed April 11, 2016, or Includes any of those shown in US Provisional Application No. 62 / 466,596 filed March 3, 2017 and International Publication WO2017 / 180587, the contents of each of which are herein incorporated by reference in their entirety. Be used for.

Linkers In some embodiments, the effector modules of the present invention may further comprise a linker sequence. The linker region mainly functions as a spacer between two or more polypeptides in the effector module. As used herein, a "linker" or "spacer" refers to two molecules, or two parts of a molecule, eg, a molecule or group of molecules that connects two domains of a recombinant protein.

  In some embodiments, "linker" (L) or "linker domain" or "linker region" or "linker module" or "peptide linker", as used herein, refers to a domain / region of an effector module. It refers to an oligo- or polypeptide region of about 1 to 100 amino acids in length that connects either (also called a peptide linker). The peptide linker may be 1-40 amino acids long, 2-30 amino acids long, or 20-80 amino acids long, or 50-100 amino acids long. The length of the linker may be optimized based on the type of payload used and the crystal structure of the payload. In some cases, preferably shorter linkers may be selected. In some embodiments, the peptide linker is made up of amino acids linked together by peptide bonds, preferably 1-20 amino acids linked by peptide bonds, the amino acids being selected from the 20 naturally occurring amino acids: glycine ( G), alanine (A), valine (V), leucine (L), isoleucine (I), serine (S), cysteine (C), threonine (T), methionine (M), proline (P), phenylalanine ( F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), aspartic acid (D), glutamic acid (E), asparagine (N), and glutamine (Q). As will be appreciated by those in the art, one or more of these amino acids may be glycosylated. In some embodiments, the amino acids of the peptide linker are selected from alanine (A), glycine (G), proline (P), asparagine (R), serine (S), glutamine (Q) and lysine (K). Good.

  In one example, the artificially designed peptide linker preferably has flexible residues such as glycine (G) and serine (S), so that adjacent protein domains are free to move relative to each other. It consists of a polymer. Longer linkers may be used if it is desired that the two adjacent domains do not interfere with each other. The choice of a particular linker sequence may relate to whether it affects the biological activity, stability, folding, targeting, and / or pharmacokinetic properties of the fusion construct. Examples of peptide linkers: MH, SG, GGSG (SEQ ID NO: 822; encoded by the nucleotide sequence of SEQ ID NO: 823), GGSGG (SEQ ID NO: 629; encoded by any of the nucleotide sequences of SEQ ID NOs: 676-680). , GGSGGGG (SEQ ID NO: 824; encoded by any of the nucleotide sequences of SEQ ID NOs: 825-826), SGGGS (SEQ ID NO: 827; encoded by the nucleotide sequence of SEQ ID NOS: 828, 844, 909), GGSGGGGSGG (SEQ ID NO: 829; encoded by the nucleotide sequence of SEQ ID NO: 830), GGGGG (SEQ ID NO: 831), GGGGS (SEQ ID NO: 832) or (GGGGS) n (n = 1 (SEQ ID NO: 832), 2 (SEQ ID NO: 833), 3 (SEQ ID NO: 72 , Encoded by the nucleotide sequences of SEQ ID NOs: 910-915), 4 (SEQ ID NO: 834), 5 (SEQ ID NO: 835), or 6 (SEQ ID NO: 836)), SSSSG (SEQ ID NO: 837) or (SSSSG) n ( n = 1 (SEQ ID NO: 837), 2 (SEQ ID NO: 838), 3 (SEQ ID NO: 839), 4 (SEQ ID NO: 840), 5 (SEQ ID NO: 841), or 6 (SEQ ID NO: 842)), SGGGGSGGGGSGGGGSGGGGGSGGGSLQ (SEQ ID NO :) 802; SEQ ID NOS: 811, 916 to 920, encoded by the nucleotide sequences of 1002), EFSTF (SEQ ID NO: 784; encoded by the nucleotide sequences of SEQ ID NOs: 792 to 793), GKSSGSGSSESKS (SEQ ID NO: 845), GGSTSGSGKSSEGKG (sequence) Turn 846), GSTSGSGKSSSEGSGSTKG (SEQ ID NO: 847), GSTSGSGKPGSGEGSTKG (SEQ ID NO: 848), VDYPYDVPDYALD (SEQ ID NO: 849; encoded by the nucleotide sequence of SEQ ID NO: 850), EGKSSGSGSESKEF (SEQ ID NO: 851), SGGGSGGGGSGGGGSGGGGSGGGGSGGGGSGGGS (SEQ ID NO: 921; SEQ ID NO: 923), SGGGSGGGGGSGGGGSGGGGS (SEQ ID NO: 922; coded by SEQ ID NO: 924), GS (coded by GGTTCC), SG (coded by AGCGGC), GSG (coded by GGATCCGGA or GGATCCGGT). , Or MLLL Examples include, but are not limited to, VTSLLLCELPHPAFLIP (SEQ ID NO: 1031; encoded by SEQ ID NO: 1032).

  In another example, the peptide linker may be composed of the majority of non-sterically hindered amino acids such as glycine (G) and alanine (A). Exemplary linkers are polyglycine ((G) 4 (SEQ ID NO: 1233), (G) 5 (SEQ ID NO: 831), (G) 8 (SEQ ID NO: 1234), poly (GA), and polyalanine). is there. The linkers described herein are exemplary and linkers much longer than this and containing other residues are contemplated by the present invention.

  The linker sequence may be a natural linker derived from a multidomain protein. A natural linker is a short peptide sequence that separates two different domains or motifs within a protein.

  In some aspects, the linker may be flexible or rigid. In other aspects, the linker may be cleavable or non-cleavable. As used herein, the terms "cleavable linker domain or region" or "cleavable peptide linker" are used interchangeably. In some embodiments, the linker sequence may be cleaved enzymatically and / or chemically. Examples of enzymes (eg, proteinases / peptidases) useful for cleaving peptide linkers include Arg-C proteinase, Asp-N endopeptidase, chymotrypsin, clostripain, enterokinase, factor Xa, glutamyl endopeptidase, granzyme B, Achromobacter proteinase I, pepsin, proline endopeptidase, proteinase K, Staphylococcal peptidase I, thermolysin, thrombin, trypsin, and members of the caspase family of proteolytic enzymes (eg, caspases 1-10), but not limited to these. Not done. A chemical sensitive cleavage site may also be included in the linker sequence. Examples of chemical cleavage reagents include cyanogen bromide, which cleaves methionine residues; N-chlorosuccinimide, iodobenzoic acid or BNPS-skatole (2- (2-nitrophenylsulfenyl) -3-, which cleaves tryptophan residues. Methyl indole); a dilute acid that cleaves at the aspartyl-prolyl bond; and an aspartic acid-prophosphate cleavable recognition site (ie, a cleavable peptide linker containing one or more DP dipeptide moieties), including Not limited. A fusion module can include multiple regions encoding a peptide of interest separated by one or more cleavable peptide linkers.

  In other embodiments, the cleavable linker may be a "self-cleaving" linker peptide, such as a 2A linker (eg, T2A), a 2A-like linker or functional equivalents thereof, and combinations thereof. In some embodiments, the linker comprises a picornavirus 2A-like linker, a porcine tesco virus (P2A), a Chosea asigna virus (T2A) CHYSEL sequence or combinations, variants and functional equivalents thereof. Other linkers will be apparent to those of skill in the art and may be used in connection with alternative embodiments of the invention. In some embodiments, the biocircuit of the present invention can include a 2A peptide. The 2A peptide is a sequence of about 20 amino acid residues derived from a virus that is recognized by a protease (2A peptidase) endogenous to cells. The 2A peptide has been identified among picornaviruses, a typical example of which is foot-and-mouth disease virus (Robertson BH, et. Al., J Virol 1985, 54: 651-660). 2A-like sequences are also found in the Picornavirus family, such as equine rhinitis A virus, and in unrelated viruses such as porcine tescovirus-1 and insect Thosea signature virus (TaV). In such viruses, multiple proteins are derived from a large polyprotein encoded by an open reading frame. The 2A peptide mediates co-translational cleavage of this polyprotein at a single site forming the junction between the viral capsid and the replicative polyprotein domain. The 2A sequence contains the consensus motif DV / I-E-X-N-P-G-P (SEQ ID NO: 1235). It is believed that these sequences act co-translationally, preventing normal peptide bond formation between glycine and the last proline, resulting in ribosomal skipping of subsequent codons (Donnelly ML et al. (2001). J Gen Virol, 82: 1013-1025). After cleavage, the short peptide remains fused to the C-terminus of the protein upstream of the cleavage site, while proline is added to the N-terminus of the protein downstream of the cleavage site. Of the 2A peptides identified thus far, four, namely FMDV 2A (abbreviated herein as F2A), equine rhinitis virus (ERAV) 2A (E2A); porcine tescovirus-12A (P2A) and Thoseasigna. Virus 2A (T2A) is widely used. In some embodiments, the 2A peptide sequences useful in the present invention are selected from SEQ ID NOs: 8-11 of International Patent Publication WO2010042490, the contents of which are incorporated by reference in their entireties.

  As a non-limiting example, the P2A cleavable peptide may be GATNFSLLKQAGDVEENPGP (SEQ ID NO: 925; encoded by SEQ ID NO: 926).

The linker of the present invention may be a non-peptide linker. For _{example, -NH- (CH 2) a-} C (O) - it can be used alkyl linkers (wherein, a = 2 to 20) such as. These alkyl linkers are further substituted with any non-sterically hindered group such as lower alkyl (eg C ₁ -C ₆ ), lower acyl, halogen (eg Cl, Br), CN, NH ₂ , phenyl and the like. May be.

  In some aspects, the linker is an artificial linker of US Pat. Nos. 4,946,778; 5,525,491; 5,856,456; and International Patent Publication No. WO 2012/083424. The contents of each is incorporated herein by reference in its entirety.

  In some embodiments, the linkers of the present invention include, but are not limited to, Table 11 of co-pending co-owned US provisional patent application No. 62 / 320,864 filed April 11, 2016, or 2017. Includes any of those shown in US Provisional Application No. 62 / 466,596 and International Publication WO2017 / 180587, filed March 3, the content of each of which is hereby incorporated by reference in its entirety. Be used for.

  In one embodiment, the linker may be a spacer region of one or more nucleotides. Non-limiting examples of spacers are TCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 927), TATGGCCACAACACTAG (SEQ ID NO: 928), AATCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 929), GCTTGCCACAACCCACGAAGGAGACGACCTGTC, C # C, C, G, C, G, C, G, C, C, G, C, C, G, C, G, C, C, G, C, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, G, C, C, C, C, C, C, C, C, C, G, C, C, C, G, C, C and G, C, G and C and G and C and G can be used in these sequences.

  In one embodiment, the linker may be a BamHI site. As a non-limiting example, the BamHI site has the amino acid sequence GS and / or the DNA sequence GGATCC.

Implantation Stimulation, Signaling, and Other Regulatory Properties In some embodiments, effector modules of the invention may further comprise one or more microRNAs, microRNA binding sites, promoters and regulatable elements. In one embodiment, microRNA may be used to assist in the creation of tunable biocircuits. Each aspect or tailored modality can result in a differentially tailored characteristic of the effector module or biological circuit. For example, the destabilization domain may alter the cleavage site or dimerization properties or half-life of the payload, and may include one or more microRNA or microRNA binding sites to detarget or transport cells. Properties can be imparted. As a result, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biocircuits and effector modules may be designed to include one, two, three, four, or more tuned properties.

  In some embodiments, the microRNA sequences of the invention include, but are not limited to, Table 13 of co-pending co-owned US provisional patent application No. 62 / 320,864, filed April 11, 2016, Or include any of the sequences set forth in U.S. Provisional Application No. 62 / 466,596 and International Publication WO 2017/180587, filed March 3, 2017. The content of each of these is incorporated herein by reference in its entirety.

  In some embodiments, the compositions of the present invention may include any proteasome adapter. As used herein, the term "proteasome adapter" refers to any nucleotide / amino acid sequence that targets an attached payload for degradation. In some embodiments, the adapter targets the payload directly for degradation, thereby avoiding the need for ubiquitination reactions. Proteasome adapters may be used in combination with the destabilization domain to reduce basal expression of the payload. As an exemplary proteasome adapter, HPV binds with high affinity to the UbL domain of Rad23 or hHR23b, both the target protein Rb and the S4 subunit of the proteasome, allowing direct proteasome targeting and bypassing the ubiquitination machinery. E7; a protein gankyrin that binds to Rb and the proteasome subunit S6.

Polynucleotides The term "polynucleotide" or "nucleic acid molecule", in its broadest sense, includes polymers of nucleotides, eg, any compound and / or substance that comprises a linked nucleoside. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the invention include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, β-. LNA having a D-ribo configuration, α-LNA having an α-L-ribo configuration (diastereomer of LNA), 2′-amino-LNA having 2′-amino functionalization, and 2′-amino functionalization 2′-amino-α-LNA) or hybrids thereof.

  In some embodiments, the polynucleotides of the present invention may be messenger RNA (mRNA) or any nucleic acid molecule, which may or may not be chemically modified. In one aspect, the nucleic acid molecule is mRNA. As used herein, the term "messenger RNA (mRNA)" encodes a polypeptide of interest and is translated to produce a polypeptide of interest encoded in vitro, in vivo, in situ or ex vivo. Refers to any polynucleotide that can be.

  Traditionally, the basic building blocks of mRNA molecules include at least the coding region, the 5'UTR, the 3'UTR, the 5'cap, and the poly A tail. Based on this wild-type modular structure, the present invention maintains one or more structural and / or chemical modifications or alterations that maintain the modular configuration but confer useful properties on the polynucleotide, such as persistence of function. Providing a payload construct that includes extends the range of functionality of conventional mRNA molecules. As used herein, a "structural" property or modification refers to the insertion, deletion, duplication, inversion or insertion of two or more linked nucleosides into a polynucleotide without significant chemical modification to the nucleoside itself. A randomizing characteristic or modification. Structural alterations are of a chemical nature and are therefore chemical modifications, as they necessarily break chemical bonds and reconstitute to alter the structure. However, structural modifications result in different nucleotide sequences. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide may be structurally modified from "ATCG" to "ATCCCG". In this case, the dinucleotide "CC" has been inserted, resulting in a structural modification of the polynucleotide.

  In some embodiments, the polynucleotides of the invention may carry a 5'UTR sequence that plays a role in translation initiation. The 5'UTR sequence may include features such as the Kozak sequence, which are generally known to be involved in the process of initiation of gene translation by the ribosome, and the Kozak sequence has a consensus XCCR (A / G). Has CCAUG, where R 3 bases upstream of the start codon (AUG) is a purine (adenine or guanine) and X is any nucleotide. In one embodiment, the Kozak sequence is ACCGCC. The stability and protein production of the polynucleotides of the invention can be enhanced by modifying the features commonly found in genes that are abundantly expressed in target cells or tissues.

  Further provided are polynucleotides that may include an internal ribosome entry site (IRES) that plays an important role in initiating protein synthesis in the absence of a 5'cap structure in the polynucleotide. The IRES can function as the only ribosome binding site, or it can function as one of multiple binding sites. Polynucleotides of the invention containing two or more functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by the ribosome to yield a bicistronic and / or multicistronic nucleic acid molecule. .

  In some embodiments, the biological circuit, effector module, SRE, and payload of interest, eg, a polynucleotide encoding an immunotherapeutic agent, comprises about 30 to about 100,000 nucleotides (eg, 30-50, 30-100, 30). ~ 250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30 ~ 50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100-1,500, 100-3,000, 100-5,000, 100-7,000, 100 ~ 10,000, 100 to 25,000, 100 to 50,000, 100 to 70,000, 100 to 100,000, 500 to 1,000 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000, 500-25,000, 500-50,000, 500- 70,000, 500-100,000, 1,000-1,500, 1,000-2,000, 1,000-3,000, 1,000-5,000, 1,000-7,000, 1,000 to 10,000, 1,000 to 25,000, 1,000 to 50,000, 1,000 to 70,000, 1,000 to 100,000, 1,500 to 3,000, 1, 500-5,000, 1,500-7,000, 1,500-10,000, 1,500-25,000, 1,500-50,000, 1,500-70,000, 1,500- 100,00 , 2,000 to 3,000, 2,000 to 5,000, 2,000 to 7,000, 2,000 to 10,000, 2,000 to 25,000, 2,000 to 50,000, 2 , 7,000 to 70,000, and 2,000 to 100,000 nucleotides). In some aspects, the polynucleotides of the invention may contain more than 10,000 residues.

  Regions of a polynucleotide encoding a particular feature, such as a cleavage site, linker, transport signal, tag or other feature, are independently 10 to 1,000 nucleotides in length (eg 20, 30, 40, 45, 50). , 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and more than 900 nucleotides, or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, (600, 700, 800, 900, and 1,000 nucleotides).

  In some embodiments, the polynucleotides of the invention may further comprise an embedded regulatory moiety, such as a microRNA binding site, within the 3'UTR of the nucleic acid molecule, which regulatory moiety upon binding to the microRNA molecule. Downregulate gene expression by reducing the stability of the nucleic acid molecule or by inhibiting translation. Conversely, for the purposes of the polynucleotides of the invention, microRNA binding sites may be modified (ie, removed) from their native sequence to increase protein expression in specific tissues. For example, miR-142 and miR-146 binding sites may be removed to improve protein expression in immune cells. In some embodiments, any of the encoded payloads may be regulated by the SRE and then combined with one or more regulatory sequences to create a dual or multi-regulatory effector module or biocircuitry.

  In some embodiments, the polynucleotides of the present invention may encode fragments, variants, derivatives of the polypeptides of the present invention. In some aspects, the sequences of the variants may retain the same or similar activity. Alternatively, the variant may have altered (eg, increased or decreased) activity relative to the starting sequence. In general, variants of a particular polynucleotide or polypeptide of the invention will be identified by a particular reference polynucleotide or polypeptide as determined by the sequence alignment programs and parameters known to those of skill in the art described herein. To at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity. Such alignment tools include those of the BLAST suite (Stephen et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids, 89-3402, 19402, 972, 9797, 9797, 972, 9797, 9797, 972, 9797, 972, 9797, 972). ).

  In some embodiments, the polynucleotides of the invention may be modified. As used herein, the term "modified" or, where appropriate, "modification" refers to a chemical modification to A, G, U (T in DNA) or C nucleotides. The modification may be on the nucleoside base and / or the sugar portion of the nucleoside contained in the polynucleotide. In some embodiments, the modifying nucleic acid or one or more individual nucleosides or nucleotides comprises multiple modifications. For example, modifications to nucleosides can include one or more modifications to nucleobases and sugars. Modifications to the polynucleotides of the invention may include, for example, any of the modifications set forth in International Publication No. WO20130525523, the contents of which are incorporated herein by reference in their entireties.

  As used herein, a "nucleoside" is defined as a compound that comprises a sugar molecule (eg, pentose or ribose) or derivative thereof in combination with an organic base (eg, purine or pyrimidine) or derivative thereof ( Also referred to herein as "nucleobases"). As used herein, "nucleotide" is defined as a nucleoside that contains a phosphate group.

  In some embodiments, the modification can be on an internucleoside linkage (eg, phosphate backbone). The terms "phosphate" and "phosphodiester" are used interchangeably herein with respect to the polynucleotide backbone. The backbone phosphate group can be modified by replacing one or more oxygen atoms with another substituent. In addition, modified nucleosides and nucleotides can include extensive replacement of the unmodified phosphate moiety with another internucleoside linkage. Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. However, it is not limited to these. Phosphorodithioate has both non-bonded oxygens replaced by sulfur. The phosphate linker can also be modified by replacing the bound oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene-phosphonate). Other modifications that may be used are set forth, for example, in International Application No. WO20130525223, the contents of which are incorporated herein by reference in their entirety.

  As the chemical modification and / or substitution of nucleotides or nucleobases of the polynucleotide of the present invention useful in the present invention, any modified substitution known in the art, for example, (±) 1- (2-hydroxypropyl) pseudouridine TP , (2R) -1- (2-hydroxypropyl) pseudouridine TP, 1- (4-methoxy-phenyl) pseudo-UTP, 2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1, 2'-O-dimethylinosine, 1-hexyl-pseudo-UTP, 1-homoallyl pseudouridine TP, 1-hydroxymethyl pseudouridine TP, 1-iso-propyl-pseudo-UTP, 1-Me-2- Thio-pseudo-UTP, 1-Me-4-thio-pseudo-UTP, 1-Me-α-thio-pseudo- UTP, 1-Me-GTP, 2'-amino-2'-deoxy-ATP, 2'-amino-2'-deoxy-CTP, 2'-amino-2'-deoxy-GTP, 2'-amino-2 '-Deoxy-UTP, 2'-azido-2'-deoxy-ATP, tubercidin, incompletely modified hydroxywaibutosine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, wibutosin, wyosin, xanthine, xanthosine -5'-TP, xyloadenosine, zebularine, α-thio-adenosine, α-thio-cytidine, α-thio-guanosine, and / or α-thio-uridine.

  The polynucleotides of the present invention may include one or more of the modifications set forth herein. Different sugar modifications, base modifications, nucleotide modifications, and / or internucleoside linkages (eg, backbone structures) may be present at various positions in the polynucleotides of the invention. Those skilled in the art will appreciate that the nucleotide analog or other modification (s) may be placed at any position (s) of the polynucleotide such that the function of the polynucleotide is not substantially reduced. Ah The modification may be a 5'or 3'end modification. Polynucleotides comprise from about 1% to about 100% (with respect to overall nucleotide content or with respect to one or more types of nucleotides, ie any one or more of A, G, U or C) or any intermediate. Ratio (for example, 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95) %, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% -100%, 50% -60%, 50% -70%, 50% -80%, 50% -90%, 50% -95% 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% ~ 95%, 90% -100%, and 95% -100%) modified nucleotides.

  In some embodiments, one or more codons of the polynucleotide of the invention may be replaced with other codons encoding the native amino acid sequence to regulate expression of the SRE through a process called codon selection. The codon selections described herein are spatiotemporal (ST) codon selections because mRNA codons and tRNA anticodon pools tend to differ by organism, cell type, subcellular location, and over time.

  In some embodiments of the invention, the characteristics of particular polynucleotides may be codon optimized. Codon optimization refers to maintaining the natural amino acid sequence to enhance expression in a host cell while maintaining at least 1, 2, 3, 4, 5, 10, 15, 20, 25 of the native sequence, Refers to the process of modifying a nucleic acid sequence by replacing 50 or more codons with the most frequently used codons in the host cell's genes. Codon usage may be measured using the Codon Adaptation Index (CAI), which measures the deviation of the coding polynucleotide sequence from the reference gene set. A codon usage table is available in the Codon Usage Database (http://www.kazusa.or.jp/codon/) and the CAI can be calculated with the EMBOSS CAI program (http://emboss.sourceforge.net/). it can. Codon optimization methods are known in the art and may be useful in attempts to achieve one or more of several goals. These goals include matching the codon frequencies of the target and host organisms to ensure proper folding, biasing the nucleotide content to alter stability or reduce secondary structure, and Minimize tandem repeat codons and base runs that can impair gene expression, customize transcription and translation control regions, insert or remove protein signal sequences, and post-translational modification sites (e.g., glycosylation) in encoded proteins. Sites) to add / remove or shuffle protein domains, insert or delete restriction enzyme sites, modify ribosome binding and degradation sites, and adjust translation rate to optimize various domains of proteins Or reduce or eliminate problematic secondary structures within the polynucleotide. It involves to be able to. Codon optimization tools, algorithms, and services are known in the art, and non-limiting examples include GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), OptimumGene (GenScript, Piscataway, NJ), Algorithms such as, but not limited to, DNAWorks v3.2.3, and / or patented methods. In one embodiment, the polynucleotide sequence or a portion thereof is codon optimized using an optimization algorithm. Codon choices for each amino acid are well known in the art, as are various species tables for optimizing expression in that particular species.

  In some embodiments of the invention, the characteristics of particular polynucleotides may be codon optimized. For example, a preferred region for codon optimization may be upstream (5 ') or downstream (3') of the polypeptide coding region. These regions may be incorporated into the polynucleotide before and / or after codon optimization of the payload coding region or open reading frame (ORF).

  After optimization (if desired), the polynucleotide components are reconstituted and converted into vectors including, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.

  Spatiotemporal codon choice can influence the expression of the polynucleotides of the invention, as codon composition determines the translation rate of an mRNA species and its stability. For example, tRNA anticodons for optimized codons are abundant and thus translationally enhanced. In contrast, the amount of tRNA anticodon for less common codons is small, so translation may proceed at a slower rate. Presnyak et al. Have shown that the stability of mRNA species depends on the content of codons, and by utilizing optimized codons higher stability and thus higher protein expression can be achieved (Presnyak et al. (2015) Cell 160, 1111-1124; the contents of which are incorporated herein by reference in their entirety). Thus, in some embodiments, ST codon selection may include optimized codon selection to enhance expression of SRESs, effector modules, and biological circuits of the invention. In other embodiments, spatiotemporal codon selection is less commonly used in host cell genes and may include codon selection that reduces expression of the compositions of the invention. The ratio of optimized codons to those less commonly used in host cell genes may also be varied to regulate expression.

  In some embodiments, particular regions of the polynucleotide may be preferred for codon selection. For example, a preferred region for codon selection may be upstream (5 ') or downstream (3') of the polypeptide coding region. These regions may be incorporated into the polynucleotide before and / or after codon selection of the payload coding region or open reading frame (ORF).

  The stop codon of the polynucleotide of the present invention may be modified to include sequences and motifs for altering the expression levels of the SRE, payload and effector modules of the present invention. Such sequences may be incorporated to induce stop codon readthrough, which may specify amino acids, for example, selenocysteine or pyrrolidine. In another example, the stop codon may be skipped altogether and translation resumed via an alternative open reading frame. Stop codon read-through may be used to tailor expression of effector module components at a particular ratio (eg, as defined by the context of the stop codon). Examples of preferred stop codon motifs include UGAN, UAAN, and UAGN, where N is either C or U. Modifications and manipulations of polynucleotides can be accomplished by methods known in the art such as, but not limited to, site-directed mutagenesis and recombination techniques. The resulting modified molecule is then tested for activity using an in vitro or in vivo assay, such as the assays described herein or any other suitable screening assay known in the art. Good.

  In some embodiments, the polynucleotide of the invention comprises two or more effector module sequences, which are patterns such as ABABAB or AABBAABBAABB or ABCABCCABC or variants thereof, repeated 1, 2, or more than 3 times, or 2 It may include one or more destination payload sequences. In these patterns, each letter A, B, or C represents a different effector module component.

  In yet another embodiment, the polynucleotide of the invention comprises a sequence of two or more effector module components, each component having one or more SRE sequences (DD sequences) or two or more payload sequences. May be included. As a non-limiting example, the sequence may be a pattern such as ABABAB or AABBAABBAABB or ABCABCCABC or variants thereof that is repeated once, twice, or more than three times in each region. As another non-limiting example, the sequence may be a pattern such as ABABAB or AABBAABBAABB or ABCABCCABC or variants thereof that is repeated once, twice, or more than three times throughout the polynucleotide. In these patterns, each letter A, B, or C represents a different array or component.

According to the invention, polynucleotides encoding separate biocircuits, effector modules, SREs and payload constructs may be linked together via their 3'ends with nucleotides modified at their 3'ends. Chemical coupling may be used to control the stoichiometry of delivery to cells. Polynucleotides, other polynucleotides, dyes, intercalating agents (such as acridine), cross-linking agents (soralen, mitomycin C, etc.), porphyrins (TPPC4, texaphyrin, sapphirine), polycyclic aromatic hydrocarbons (phenazine, dihydrophenazine, etc.) , Artificial endonuclease (EDTA, etc.), alkylating agent, phosphate, amino, mercapto, PEG (PEG-40K, etc.), MPEG, (MPEG) ₂ , polyamino, alkyl, substituted alkyl, radiolabel marker, enzyme, hapten ( Biotin), transport / absorption enhancers (eg aspirin, vitamin E, folic acid), synthetic ribonucleases, proteins such as glycoproteins or peptides, eg molecules with specific affinity for co-ligands, or antibodies , For example, cancer cells Can be designed to bind to antibodies, hormones and hormone receptors, non-peptide species such as lipids, lectins, carbohydrates, vitamins, cofactors, or drugs that bind to specific cell types such as endothelial cells, bone cells, etc. it can. As a non-limiting example, they may be complexes with other immune complexes.

  In some embodiments, compositions of polynucleotides of the present invention may be produced by combining various components of an effector module using the Gibson assembly method. The Gibson assembly reaction consists of three isothermal reactions, each with a 5'exonuclease that produces a long overhang, a polymerase that fills the gap in the annealed single-stranded region, and a nick of the annealed and filled gap. It relies on different enzymatic activities, including blocking DNA ligase. The polymerase chain reaction is performed prior to Gibson assembly and is used to generate PCR products with overlapping sequences. These methods can be repeated in sequence to assemble larger molecules. For example, this method comprises repeating the above method to bind a second set of two or more DNA molecules of interest to each other and then repeating this method again to bind the first and second sets of DNA molecules of interest. May be included. At any stage during these multiple rounds of assembly, the assembled DNA can be amplified by transforming into a suitable microorganism, or the DNA can be amplified in vitro (eg, using PCR). .

  In some embodiments, the polynucleotides of the present invention may encode a fusion polypeptide that includes a destabilization domain (DD) and at least one immunotherapeutic agent provided herein. The DD domain is a FKBP variant encoded by the nucleotide sequences of SEQ ID NOs: 684-686, 688-691, 987-989, 994, 1013, and / or 1028, SEQ ID NOs: 687, 692, 772, 798, 814-815. , 988, 991, and / or 993 nucleotide sequences encoded by ecDHFR variants, SEQ ID NOs: 693-700, 773, 852-857 and / or 934-980, and / or 995-998 nucleotide sequences. HDHFR mutant may be used.

  In some embodiments, the polynucleotide of the invention is a CD19 CAR as a payload having the nucleotide sequence of SEQ ID NOs: 701-715 and / or 1019-1042, or a payload having the nucleotide sequence of SEQ ID NOs: 774-782. IL12, or IL15 as a payload having the nucleotide sequence of SEQ ID NOs: 749, 799-800, and / or 1055-1056, or SEQ ID NOs: 816-821, 1086-1089, 1091-1095, 1098-1111, 1120, and / or Alternatively, it may encode an effector module comprising an IL15 / IL15Ra fusion polypeptide as a payload having the nucleotide sequence of 1123.

Cells According to the present invention there is provided a cell genetically modified to express at least one biological circuit, SRE (eg DD), effector module and immunotherapeutic agent of the present invention. The cells of the present invention include, but are not limited to, immune cells, stem cells and tumor cells. In some embodiments, the immune cells are T cells (eg, Th1, Th2, Th17, Foxp3 + cells), such as CD8 ⁺ T cells and CD4 ⁺ T cells, memory T cells, eg, T memory stem cells, central memory T cells. Cells, effector memory T cells, terminally differentiated effector T cells, natural killer (NK) cells, NK T cells, tumor infiltrating lymphocytes (TIL), cytotoxic T lymphocytes (CTL), regulatory T cells (Treg) , And immune effector cells, including but not limited to dendritic cells (DC), other immune cells capable of eliciting effector function, or mixtures thereof. T cells may be Tαβ cells and Tγδ cells. In some embodiments, the stem cells may be derived from human embryonic stem cells, mesenchymal stem cells, and neural stem cells. In some embodiments, the T cell may be a depleted endogenous T cell receptor (US Pat. Nos. 9,273,283; 9,181,527; and 9,028,812). Reference; the contents of each of which is incorporated herein by reference in its entirety).

  In some embodiments, the cells of the invention may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

  In some embodiments, the cells of the invention may be mammalian cells, especially human cells. The cells of the invention may be primary cells or immortalized cell lines.

  In some embodiments, the cells of the invention may include growth factors as a payload that induce cell proliferation and expansion. Exemplary payloads include RAS, such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS; DIRAS, such as DIRAS1, DIRAS2, and DIRAS3; RAP such as RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C, RASD such as RASD1, RASD2, RASL such as RASL10A, RASL10B, RASL11A, RASL11B, and REM such as RASL, REM1, and REM2; RRAD may be mentioned.

  Artificial immune cells are obtained by transforming a cell composition with a polypeptide of a biological circuit, an effector module, an SRE and / or a payload of interest (ie, an immunotherapeutic agent), a polynucleotide encoding the polypeptide, or a vector containing the polynucleotide. It can be achieved by introducing. The vector may be a viral vector such as a lentivirus vector, a gammaretrovirus vector, recombinant AAV, adenovirus vector, and an oncolytic virus vector. In other aspects, non-viral vectors such as nanoparticles and liposomes may also be used. In some embodiments, the immune cells of the invention may be genetically modified to express at least one immunotherapeutic agent of the invention that can be modulated using stimulation. In some embodiments, cells are loaded with two, three or more immunotherapeutic agents that are constructed in the same biological circuit and effector module. In other embodiments, two, three, or more biological circuits, effector modules, each containing an immunotherapeutic agent, may be introduced into the cell.

  In some embodiments, the immune cells of the invention are T cells modified to express the antigen-specific T cell receptor (TCR) or antigen-specific chimeric antigen receptor (CAR) set forth herein. (Known as CAR T cells). Thus, at least one polynucleotide encoding the CAR system (or TCR) described herein, or a vector containing that polynucleotide, is introduced into T cells. A T cell expressing CAR or TCR binds to a particular antigen via the extracellular targeting portion of CAR or TCR, thereby transducing a signal to the T cell via the intracellular signaling domain (s). As a result, T cells are activated. Activated CAR T cells alter their behavior, including the release of cytotoxic cytokines (such as tumor necrosis factor and lymphotoxin), increased cell proliferation rates, alterations in cell surface molecules, and the like. Such changes cause the destruction of target cells expressing the antigen recognized by the CAR or TCR. Furthermore, the release of cytokines or alterations in cell surface molecules stimulate other immune cells such as B cells, dendritic cells, NK cells, and macrophages.

  CAR introduced into T cells is a first generation CAR containing only an intracellular signaling domain derived from TCR CD3ζ, or a second generation CAR containing an intracellular signaling domain derived from TCR CD3ζ and a costimulatory signaling domain, or TCR. It may be a third generation CAR containing a CD3ζ-derived intracellular signaling domain and two or more costimulatory signaling domains, or a split CAR system, or an on / off switch CAR system. In one example, the destabilization domain (DD), such as the hDHFR variant of the effector module of the invention, regulates CAR or TCR expression. The presence or absence of hDHFR binding ligands such as TMP is used to modulate CAR or TCR expression in transduced T or NK cells.

  In some embodiments, CAR T cells of the invention may be further modified to express another, two, three or more immunotherapeutic agents. An immunotherapeutic agent is another CAR or TCR specific for a different target molecule; a cytokine such as IL2, IL12, IL15 and IL18, or a cytokine receptor such as IL15Ra; a chimeric switch receptor that converts an inhibitory signal into a stimulatory signal; Homing receptors that induce adoptively transferred cells to target sites such as tumor tissues; agents that optimize the metabolism of immune cells; or when a serious event is observed after adoptive cell transfer, or transferred immune cells It may be a safety switch gene (for example, a suicide gene) that kills activated T cells when no longer needed. These molecules may be included in the same effector module or separate effector modules.

  In one embodiment, CAR T cells (including TCR T cells) of the invention may be "armed" CAR T cells transformed with CAR-containing effector modules and cytokine-containing effector modules. Inducible or constitutively secreted active cytokines further arm CAR T cells to improve potency and persistence. In this context, such CAR T cells are also referred to as "armed CAR T cells". "Protective" molecules may be selected based on the tumor microenvironment and other elements of the innate and adaptive immune system. In some embodiments, the molecule may be a stimulatory factor, such as IL2, IL12, IL15, IL18, type I IFN, CD40L and 4-1BBL, which are hostile via different mechanisms. It has been shown to further enhance the potency and persistence of CAR T cells in the face of different tumor microenvironments (Yeku et al., Biochem Soc Trans., 2016, 44 (2): 412-418).

  In some aspects, the armed CAR T cells of the invention are modified to express CD19 CAR and IL12. Such T cells release inducible IL12 and enhance T cell activation after CAR-mediated activation in tumors, attracting and activating innate immune cells to eliminate CD19-negative cancer cells. .

  In one embodiment, the T cells of the invention may be modified to express an effector module that includes a CAR and an effector module that includes a suicide gene.

  In one embodiment, CAR T cells (including TCR T cells) of the invention may be transformed with an effector module containing a cytokine and a safety switch gene (eg, a suicide gene). The suicide gene may be an inducible caspase such as caspase 9 which induces apoptosis when activated by extracellular stimulation of biological circuit system. Such induced apoptosis eliminates transferred cells as needed, reducing direct toxicity and risk of uncontrolled cell proliferation.

  In some embodiments, the immune cells of the invention are NK modified to express the antigen-specific T cell receptor (TCR) or antigen-specific chimeric antigen receptor (CAR) set forth herein. It may be a cell.

  Natural killer (NK) cells are members of the innate lymphoid cell family and are characterized in humans by the expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T cell co-receptor). . NK cells are potent effector cells of the innate immune system that mediate cytotoxic attacks without the need for prior antigen priming and form the first line of defense against diseases such as cancer malignancies and viral infections.

  Several preclinical and clinical trials have shown that adoptive transfer of NK cells is a promising therapeutic approach for cancers such as acute myelogenous leukemia (Ruggeri et al., Science; 2002; 295: 2097-2100; and Geller et al., Immunotherapy, 2011, 3: 1445-1459). Adoptive transfer of NK cells expressing CAR, such as DAP12-based activated CAR, revealed improved eradication of tumor cells (Topfer et al., J Immunol. 2015; 194: 3201-3212). NK cells designed to express a CS-1 specific CAR also showed enhanced cytolysis and interferon-γ (IFN-γ) production in multiple myeloma (Chu et al., Leukemia, 2014). , 28 (4): 917-927).

  NK cell activation is characterized by a series of receptors with activating and inhibitory functions. Important activating receptors on NK cells include CD94 / NKG2C and NKG2D (C-type lectin-like receptors), and the natural cytotoxic receptor (NCR) NKp30 that recognizes ligands for tumor cells or virus-infected cells, NKp44 and NKp46 are included. Inhibition of NK cells is mediated by the interaction of polymorphic inhibitory killer cell immunoglobulin-like receptors (KIRs) with their cognate human-leukocyte-antigen (HLA) ligands via the α-1 helix of the HLA molecule. It is essentially mediated. The balance of signals produced by activating and inhibitory receptors primarily determines immediate cytotoxic activation.

  NK cells may be isolated from peripheral blood mononuclear cells (PBMC) or derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSC). Primary NK cells isolated from PBMCs may be further expanded for adoptive immunotherapy. Strategies and protocols that aid in the expansion of NK cells may include the use of interleukin 2 (IL2) stimulation and autologous feeder cells, or the use of transgenic allogeneic feeder cells. In some aspects, NK cells can be selectively expanded with a combination of stimulatory ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1 / SLAMF2. (For example, U.S. Patent Publication No. US20150190471).

  Immune cells expressing effector modules including CAR and / or other immunotherapeutic agents can be used as cancer immunotherapy. Immunotherapy includes cells expressing CAR and / or other immunotherapeutic agents as active ingredients, and may further include suitable excipients. Examples of excipients can include various cell culture media and pharmaceutically acceptable excipients described above including isotonic sodium chloride.

  In some embodiments, the cells of the invention may be dendritic cells that have been genetically modified to express the compositions of the invention. Such cells may be used as a cancer vaccine.

Methods of Development and Characterization of CD19 Antibodies In some embodiments, the present invention provides methods of producing CD19 antibodies, antibody fragments or variants. Such methods include: (1) preparing a composition comprising CD19, (2) contacting a library of antibodies or antibody fragments or variants with the composition, and (3) identifying one or more CD19 antibodies. Can be included. Also provided herein are methods of identifying a CD19 antibody, antibody fragment or variant that is distinct from FMC63.

In some embodiments, the invention provides methods for identifying a CD19 scFv. Such methods can include screening a phagemid library for CD19 scFv. Phagemid libraries expressing recombinant scFv associated with the surface of bacteria or bacteriophage are useful in the present invention. The phagemid library was generated by PCR amplification of polynucleotides encoding immunoglobulin IgM heavy and kappa light chains, and infection of Cre-recombinase-positive bacteria with Cre recombinase-positive bacteria at a high multiplicity of infection (MOI). Good. High MOI results in bacteria containing multiple phagemids, each encoding different VH and VL genes, which are recombined by Cre recombinase. The library that can be produced recombinantly is approximately about 10 ⁸ unique scFv. In some examples, libraries of CD19 scFv formatted into chimeric antigen receptor constructs may be screened to identify CD19 scFv useful in the invention.

  In some embodiments, immunologically specific scFvs for CD19 may be identified using cells that ectopically express the full length, fragment, or portion of CD19. Cell lines with low endogenous CD19 expression may be selected for ectopic expression. In some embodiments, CD19 may be the native isoform of human CD19.

  In some embodiments, a fusion protein (CD19sIg) containing the extracellular domain of CD19 (ie, exons 1 to exon 4) fused to the Fc region of human IgG1 is utilized to identify a CD19-specific scFv. Such fusion proteins are described in Oliveira et al (2013) Journal of Translational Medicine 11:23; the contents of which are incorporated herein by reference in their entirety.

  Further, in the present specification, FMC63 which is immunologically specific for an epitope of CD19 antigen different from or dissimilar to the epitope of CD19 antigen bound by FMC63, and which contains scFv binding thereto A method for identifying distinct scFvs is provided. In some embodiments, a scFv library is screened with a complex consisting of human CD19 bound to FMC63 to identify scFv distinct from FMC63. Rhesus (Macaca mulatta) CD19, referred to herein as Rhesus CD19, has 88% homology to human CD19. Despite this high degree of homology, rhesus CD19 was not recognized by FMC63, indicating that the FMC63 epitope is in a region of human CD19 that is heterologous to rhesus CD19. Thus, in some embodiments, Rhesus CD19 may be used to screen scFv libraries for scFv distinct from FMC63. Previously, mutations in a region of rhesus CD19 that is heterologous to human CD19 have been used to identify residues of human CD19 that confer binding to FMC63 ((Sommermeyer et al. (2017) Leukemia Feb 16). .Doi: 10.1038 / leu.2017.57) .In some embodiments, the mutational analysis described by Sommermeyer et al. May be utilized to design a human CD19 mutant that is unable to bind FMC63. Such variants may include human CD19 (H218R, A237D, M243V, E244D, P250T) and human CD19 (H218R, A237D), which are used to screen scFv libraries for scFv separate from FMC63. May be S tillo et al. identified a splice variant of human CD19 that lacks exon 2 in cancer patients (Sotillo et al. (2015) Cancer Discov. 2015 Dec; 5 (12): 1282-95). Splice variants are not recognized by FMC63 and may also be used to screen scFv libraries for scFv distinct from FMC63.

  Fc region of human IgG1 fused to human CD19 complete extracellular domain, ie exons 1 to 4 (CD19sIgG1 to 4), or exon 2 defective extracellular domain, ie exons 1, 3 and 4 (CD19sIgG1, 3, 4) The CD19 IgG fusion molecule generated by doing so may be used to screen scFv libraries for scFv distinct from FMC63.

CD14 proteins, variants and variants useful in the present invention are provided in Table 14.

III. Pharmaceutical Compositions and Formulations The present invention further includes one or more biological circuits, effector modules, SREs (eg, DDs), stimulatory and target payloads (ie, immunotherapeutic agents), vectors, cells and other components of the invention. , And optionally, at least one pharmaceutically acceptable excipient or inactive ingredient.

  As used herein, the term "pharmaceutical composition" refers to biological circuits, SREs, stimulatory and target payloads (ie, immunotherapeutic agents), other components, vectors, cells, as described herein. Or a pharmaceutically acceptable salt thereof, and optionally a preparation comprising other chemical components such as physiologically suitable carriers and excipients. A pharmaceutical composition of the invention comprises an effective amount of one or more active compositions of the invention. The preparation of pharmaceutical compositions comprising at least one composition of the invention and / or additional active ingredients is described in Remington's Pharmaceutical Sciences, 18th Ed. As is exemplified by the Mack Printing Company, 1990, known to those of skill in the art in light of the present disclosure, and incorporated herein by reference.

  The term “excipient” or “inactive ingredient” refers to an inert substance added to pharmaceutical compositions and formulations to further facilitate administration of the active ingredient. For the purposes of this disclosure, the phrase "active ingredient," as described herein, generally refers to any one or more biological circuits, effector modules, SREs, stimuli, and a payload of interest (ie, immune). Therapeutic agent), other components, vectors, as well as cells to be delivered. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not cause adverse reactions, allergic reactions, or other adverse reactions when properly administered to animals such as humans.

  In some embodiments, the pharmaceutical compositions and formulations are administered to humans, human patients or subjects. While the description of the pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for human administration, those of ordinary skill in the art will appreciate that such compositions are generally It will be appreciated that it is suitable for administration to any other animal, eg, a non-human animal, eg, a non-human mammal. The intended administration of the pharmaceutical composition includes agricultural animals such as cows, horses, chickens and pigs, domestic animals such as cats and dogs, or research animals such as mice, rats, rabbits, dogs, and non-human primates. Non-human mammals, including, but not limited to. It will be appreciated that for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.

  The pharmaceutical compositions and formulations according to the invention may be prepared, packaged, and / or sold in bulk as a single unit dose and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient will generally be equal to the dose of active ingredient and / or a convenient fraction of such dose that will be administered to a subject, eg, half or one third of such dose.

  The compositions of the invention may be formulated in any suitable manner for delivery. The formulation may be nanoparticles, poly (lactic-glycolic acid copolymer) (PLGA) microspheres, lipidoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids and combinations thereof. Good, but not limited to.

  In one embodiment, the formulation is nanoparticles that can include at least one lipid. The lipid is selected from DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG and PEGylated lipid. However, the present invention is not limited to these. In another aspect, the lipid may be a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA and DODMA.

  For the polynucleotides of the present invention, the formulation may be selected from, for example, any of the formulations set forth in International Application PCT / US2012 / 069610, the contents of which are incorporated herein by reference in their entirety.

  The relative amounts of active ingredient, pharmaceutically acceptable excipients or inactive ingredients, and / or any additional ingredients in the pharmaceutical composition according to the present invention may be determined by the identity, size and / or identity of the subject being treated. It will vary depending on the condition and further on the route of administration of the composition. As an example, the composition may contain from 0.1 to 100, such as from 0.5 to 50, 1 to 30, 5 to 80, at least 80 (w / w) active ingredients.

  Efficacy of treatment or amelioration of disease may include, for example, disease progression, disease remission, severity of symptoms, pain relief, quality of life, dose of drug required to maintain therapeutic effect, level of disease marker. , Or by measuring any other measurable parameter suitable for the disease to be treated or prevented. Monitoring the effectiveness of treatment or prevention by measuring any such parameter, or any combination of parameters, is well within the capabilities of those skilled in the art. Regarding the administration of the composition of the present invention, for example, “effectiveness” against cancer means that, when administered in a clinically appropriate manner, a beneficial effect, for example, a symptom of at least a statistically significant proportion of patients is obtained. Others commonly found positive by doctors who are familiar with improving, curing, reducing disease burden, reducing tumor volume or cell number, extending lifespan, improving quality of life, or treating certain types of cancer Means that the effect of is brought about.

  A therapeutic or prophylactic effect is manifest if there is a statistically significant improvement in one or more parameters of the disease state, or by otherwise expected exacerbation or onset of symptoms. As an example, at least 10, preferably at least 20, 30, 40, 50 or more favorable changes in the measurable parameters of the disease may be indicative of effective treatment. The effectiveness of a given composition or formulation of the invention may also be determined using experimental animal models for a given disease known in the art. When using experimental animal models, efficacy of treatment is demonstrated if statistically significant changes are observed.

IV. Application In one aspect of the present invention, a method of reducing tumor volume or tumor volume is provided. The method comprises administering a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or payload of interest (ie, immunotherapeutic agent), at least one vector, or cells to a tumor. Administering to a subject having. Biological circuits and effector modules having any of the immunotherapeutic agents described herein include polypeptides, polynucleotides such as mRNA, or viral vectors containing polynucleotides, or biocircuits, effector modules, DD, and purposes. It may be in the form of cells that have been modified to express the payload (ie, immunotherapeutic agent).

  In another aspect of the invention, a method of inducing an anti-tumor immune response in a subject is provided. The method comprises administering a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or payload of interest (ie, immunotherapeutic agent), at least one vector, or cells to a tumor. Administering to a subject having. Biological circuits and effector modules having any of the immunotherapeutic agents described herein are polynucleotides such as polypeptides or mRNA, or viral vectors containing polynucleotides, or biological circuits, effector modules, DD, and objects. It may be in the form of cells modified to express a payload (such as an immunotherapeutic drug).

  The method according to the present invention comprises a genetically modified cell such as an immune effector cell of the present invention, a cancer vaccine containing a biological circuit system, an effector module, DD, a target payload of the present invention (ie, an immunotherapeutic drug), or tumor immunosuppressive property. It may be adoptive cell transfer (ACT) using compositions that manipulate the microenvironment, or combinations thereof. These treatments may also be used in conjunction with other cancer treatments such as chemotherapy and radiation therapy.

1. Adoptive cell transfer (adoptive immunotherapy)
In some embodiments, cells genetically modified to express at least one biological circuit system, effector module, DD, and / or payload of interest (immunotherapy drug) are also used for adoptive cell therapy (ACT). Good. As used herein, adoptive cell transfer refers to the administration of immune cells (autologous, allogeneic or from a genetically modified host) that have direct anti-cancer activity. ACT holds promise in clinical applications for malignant and infectious diseases. For example, T cells that have been genetically modified to recognize CD19 have been used to treat follicular B-cell lymphoma (Kochenderfer et al., Blood, 2010, 116: 4099-4102; and Kochender and Rosenberg, Nat Rev. Clin Oncol., 2013, 10 (5): 267-276), ACT using autologous lymphocytes genetically modified to express anti-tumor T cell receptors has been used to treat metastatic melanoma. (Rosenberg and Dudley, Curr. Opin. Immunol. 2009, 21: 233-240).

  According to the present invention, biological circuits and systems may be used in the development and implementation of cell therapies such as adoptive cell therapy. Specific effector modules useful in cell therapy are shown in Figures 7-12. Biological circuits, their components, effector modules and their SREs, and payloads, in cell therapy that causes CAR therapy, in the manipulation or regulation of TIL, in allogeneic cell therapy, and with other therapeutic lines (eg, radiation, cytokines) In a combined T cell therapy, to encode a designed TCR or a modified TCR, or to enhance T cells other than TCR (eg, by introducing a gene for a cytokine gene, checkpoint inhibitor PD1, CTLA4 gene) May be used for

  Provided herein are methods of use in adoptive cell therapy. The method preconditions a subject in need thereof, modulates immune cells using the SREs, biological circuits and compositions of the invention, and administers modified immune cells expressing the composition of the invention to the subject. , Successfully engrafting modified cells in the subject.

  In some embodiments, the SREs, biocircuits and compositions of the invention may be used to minimize preconditioning regimens associated with adoptive cell therapy. As used herein, "preconditioning" refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy. Preconditioning strategies include, but are not limited to, total body irradiation and / or lymphopenia chemotherapy. Clinical trials of adoptive therapy without preconditioning failed to show clinical benefit, demonstrating the importance of preconditioning in ACT. However, preconditioning is associated with significant toxicity and limits the target cohort suitable for ACT. In some cases, ACT immune cells may be modified to express cytokines such as IL12 and IL15 as payloads using the SRE of the invention, reducing the need for preconditioning (Pengram et al. (2012) Blood 119 (18): 4133-41; the contents of which are incorporated by reference in their entirety).

In some embodiments, the ACT immune cells are dendritic cells, T cells such as CD8 ⁺ T cells and CD4 ⁺ T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTL). ), Tumor infiltrating lymphocytes (TIL), lymphokine-activated killer (LAK) cells, memory T cells, regulatory T cells (Treg), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof. May be In other embodiments, ACT immunostimulatory cells may be generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). In some embodiments, autologous or allogeneic immune cells are used for ACT.

  In some embodiments, the cells used for ACT may be T cells designed to express a CAR that includes an antigen binding domain specific for an antigen on a tumor cell of interest. In another embodiment, the cells used for ACT may be NK cells designed to express a CAR containing an antigen binding domain specific for an antigen on the tumor cell of interest. In addition to adoptive transfer of genetically modified T cells (such as CAR T cells) for immunotherapy, adoptive immunotherapy may use alternative forms of CAR expressing leukocytes alone or in combination with CAR T cells. In one example, a mixture of T cells and NK cells may be used for ACT. According to the present invention, the expression level of CAR in T and NK cells is regulated and regulated by a small molecule that binds to DD (s) operably linked to CAR in the effector module.

  In some embodiments, the CARs of the invention are placed under the transcriptional control of the T cell receptor α constant (TRAC) locus of T cells to enhance T cell potency while achieving uniform CAR expression. May be. The TRAC locus may be disrupted by inserting the CAR construct after CRISPR / Cas9, zinc finger nuclease (ZFN), TALEN. A method for modifying CAR constructs directed to the TRAC locus is described by Eyquem J. et al. et al (2017) Nature. 543 (7643): 113-117, the contents of which are incorporated herein by reference in their entirety.

  In some embodiments, NK cells modified to express the composition may be used for ACT. Activation of NK cells induces perforin / granzyme-dependent apoptosis in target cells. Activation of NK cells also induces secretion of cytokines such as IFN-γ, TNF-α and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and enhance the adaptive immune response through upregulation of antigen presentation by antigen presenting cells such as dendritic cells (DC) (Vivier et al., Nat. Immunol., 2008, 9 (5): 503-510).

  Other examples of genetic modification can include the introduction of chimeric antigen receptors (CARs) and downregulation of inhibitory NK cell receptors such as NKG2A.

  NK cells may also be genetically reprogrammed to evade NK cell inhibitory signals upon interaction with tumor cells. For example, CRISPR, ZFN, or TALEN may be used to genetically modify NK cells to silence inhibitory receptors to enhance their anti-tumor potential.

  Immune cells can be isolated and expanded ex vivo using a variety of methods known in the art. For example, methods of isolating and expanding cytotoxic T cells are described in US Pat. Nos. 6,805,861 and 6,531,451; US Pat. Pub. The content of each is incorporated herein by reference in its entirety. Isolation and expansion of NK cells is described in US Patent Publication No. US20150152387A1, US Patent No. 7,435,596; L. (2016). Cytotherapy. 18 (5): 653-63; the contents of each of which is incorporated herein by reference in its entirety. Specifically, human primary NK cells may be grown in the presence of feeder cells, eg, bone marrow cell lines genetically modified to express membrane bound IL15, IL21, IL12 and 4-1BBL.

  In some examples, a subpopulation of immune cells may be enriched for ACT. A method for enriching immune cells is shown in International Patent Publication No. WO2011039100A1. In another example, B and T lymphocyte attenuator marker (BTLA) positive T cells are used to produce anti-cancer reactive T cells as described in US Pat. No. 9,512,401. May be concentrated (the contents of each are incorporated herein by reference in their entirety).

  In some embodiments, immune cells for ACT may be depleted of selected subpopulations to enhance T cell proliferation. For example, the method set forth in US Patent Publication No. US21602988081A1 may be used to deplete Foxp3 + T lymphocytes from immune cells to minimize anti-tumor immune responses; the content of which is herein incorporated by reference in its entirety. Incorporated into the book.

  In some embodiments, activation and proliferation of T cells for ACT is achieved by antigenic stimulation of a chimeric antigen receptor (CAR) that is transiently expressed on the cell surface. Such an activation method is shown in International Patent No. WO2017015427, the content of which is incorporated herein by reference in its entirety.

  In some embodiments, immune cells may be activated by antigens associated with antigen presenting cells (APCs). In some embodiments, the APC can be dendritic cells, macrophages or B cells that are antigen-specific or non-specific. APCs may be autologous or allogeneic in organs. In some embodiments, the APCs can be artificial antigen presenting cells (aAPCs) such as cell-based aAPCs or acellular aAPCs. Cell-based aAPCs may be selected from either genetically modified allogeneic cells such as human erythroleukemia cells or xenogeneic cells such as mouse fibroblasts and Drosophila cells. Alternatively, the APC may be cell-free, in which case the antigen or costimulatory domain is presented on a synthetic surface such as latex beads, polystyrene beads, lipid vesicles or exosomes.

  In some embodiments, cells of the invention, particularly T cells, may be expanded using an artificial cell platform. In one embodiment, mature T cells are treated with Seet CS et al. 2017. Nat Methods. It may also be generated using the artificial thymus organoids (ATO) described by 14,521-530, the contents of which are incorporated herein by reference in their entirety. ATO is based on a stromal cell line that expresses a delta-like canonical notch ligand (DLL1). In this method, stromal cells and hematopoietic stem cells and progenitor cells are aggregated by centrifugation and placed in a cell culture insert at the gas-liquid interface to produce an organoid culture. ATO-derived T cells exhibit a naive phenotype, a diverse T cell receptor (TCR) repertoire, and a TCR-dependent function.

  In some embodiments, adoptive cell therapy is performed by autologous transplantation, where the cells are from a subject in need of treatment and the cells are administered to the same subject after isolation and processing. In another example, ACT may include an allograft, in which case cells are isolated and / or prepared from a donor subject other than the recipient subject who ultimately receives the cell therapy. Donor and recipient subjects may be genetically identical or similar or express the same HLA class or subtype.

  In some embodiments, multiple immunotherapeutic agents introduced into immune cells for ACT (eg, T cells and NK cells) may be controlled by the same biological circuit system. In one example, a cytokine such as IL12 and a CAR construct such as the CD19 CAR are linked to the same hDHFR destabilizing domain. Expression of IL12 and CD19 CAR is regulated using TMP simultaneously. In other embodiments, multiple immunotherapeutic agents introduced into immune cells for ACT (eg, T cells and NK cells) may be controlled by different biological circuit systems. In one example, a cytokine such as IL12 and a CAR construct such as the CD19 CAR can be linked to different DD of two separate effector modules, thereby being separately tuned using different stimuli. In another example, the suicide gene and CAR construct may be linked to two separate effector modules.

  Following gene regulation using the SREs, biocircuits and compositions of the invention, cells are administered to a subject in need thereof. Methods of administering cells for adoptive cell therapy are known and may be used in connection with the methods and compositions provided. For example, methods of adoptive T cell therapy are described, for example, in US Patent Application Publication No. 2003/0170238 to Gruenberg, et al .; US Patent No. 4,690,915 to Rosenberg; 8 (10): 577-85). For example, Themeli et al. (2013) Nat Biotechnol. 31 (10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438 (1): 84-9; Davila et al. (2013) PLoS ONE 8 (4): e 61338; the contents of each of which is incorporated herein by reference in its entirety.

  In some embodiments, immune cells for ACT may be modified to express one or more immunotherapeutic agents that promote immune cell activation, invasion, proliferation, survival, and anti-tumor function. . An immunotherapeutic agent is a second CAR or TCR specific to a different target molecule; a cytokine or a cytokine receptor; a chimeric switch receptor that converts an inhibitory signal into a stimulatory signal; Inducing homing receptors; agents that optimize the metabolism of immune cells; or activated T cells when a serious event is observed after adoptive cell transfer or when the transferred immune cells are no longer needed. It may be a safety switch gene that kills (eg, a suicide gene).

  In some embodiments, the immune cells used for adoptive cell transfer are genetically engineered to enhance their ability to kill tumors in cancer patients by genetically engineering them in vivo. Persistence, cytotoxicity, tumor targeting ability, and ability to home to disease sites can be improved. One example is the introduction of effector modules of the invention containing cytokines such as gamma cytokines (IL2 and IL15) into immune cells to promote immune cell proliferation and survival. Transduction of cytokine genes (eg, γ-cytokines IL2 and IL15) into cells can proliferate immune cells without the addition of exogenous cytokines and cytokine-expressing NK cells enhanced tumor cytotoxicity. .

  In some embodiments, biocircuits, their components, SREs, or effector modules can be utilized to prevent T cell depletion. As used herein, "T cell depletion" refers to the gradual and progressive loss of T cell function caused by chronic T cell activation. Depletion of T cells is a major factor limiting the efficacy of antiviral and antitumor immunotherapy. Depleted T cells have a low proliferation rate and cytokine production capacity, a high apoptosis rate, and a high surface expression of multiple inhibitory receptors. Activation of T cells leading to depletion can occur in the presence or absence of antigen.

  In some embodiments, biocircuits and their components may be utilized to prevent T cell depletion for chimeric antigen receptor-T cell therapy (CAR-T). In this regard, in some instances, cell surface CAR scFv oligomerization may cause depletion, leading to continuous activation of the intracellular domain of CAR. As a non-limiting example, the CAR of the invention may comprise a scFv that is not capable of oligomerization. As another non-limiting example, CARs that rapidly internalize and re-express after challenge may be selected to prevent chronic scFv oligomerization at the cell surface. In one embodiment, the framework regions of the scFv may be modified to prevent constitutive CAR signaling (Long et al. 2014. Cancer Research. 74 (19) S1; the contents thereof by reference in their entirety). Incorporated). The regulatable biocircuitry of the present invention may also be used to regulate surface expression of CAR on the surface of T cells to prevent chronic T cell activation. The CAR of the present invention may be modified to minimize depletion. As a non-limiting example, the 41-BB signaling domain may be incorporated into CAR designs to improve T cell depletion. In some embodiments, any of the strategies disclosed by Long HA et al. May be utilized to prevent depletion (Long A H et al. (2015) Nature Medicine 21, 581-590; The contents of which are incorporated herein by reference in their entirety).

  In some embodiments, the tunable nature of the biocircuits of the invention may be utilized to reverse the human T cell depletion observed in sustained CAR signaling. Reversible silencing of biological activity of adoptively transferred cells with the compositions of the invention may be used to reverse persistent signaling, which in turn may reactivate T cells. Reversal of depletion may be measured by downregulation of multiple inhibitory receptors associated with depletion.

  In some embodiments, T cell metabolic pathways may be modified to reduce T cell sensitivity to depletion. Metabolic pathways include, but are not limited to, glycolysis, urea cycle, citric acid cycle, β-oxidation, fatty acid biosynthesis, pentose phosphate pathway, nucleotide biosynthesis, and glycogen metabolic pathway. As a non-limiting example, a payload that slows glycolysis may be utilized to limit or prevent T cell depletion (Long et al. Journal for Immunotherapy of Cancer 2013, 1 (Suppli 1)): P21; the contents of which are incorporated by reference in their entirety). In one embodiment, the T cells of the invention may be used in combination with 2-deoxyglucose and an inhibitor of glycolysis such as rapamycin.

  In some embodiments, effector modules of the invention useful for immunotherapy may be placed under the transcriptional control of the T cell receptor α locus constant (TRAC) locus of T cells. Eyquem et al. Showed that expression of CAR from the TRAC locus prevents T cell depletion and accelerated T cell differentiation caused by excessive T cell activation (Eyquem J. et al (2017). ) Nature.543 (7643): 113-117; the contents of which are incorporated herein by reference in their entirety).

  In some embodiments, the payloads of the invention may be used with antibodies or fragments that target T cell surface markers associated with T cell depletion. T cell surface markers associated with T cell depletion that may be used include, but are not limited to, CTLA-1, PD-1, TGIT, LAG-3, 2B4, BTLA, TIM3, VISTA, and CD96. Not done.

  In one embodiment, the payload of the invention may be CD276 CAR (having CD28, 4-IBB, and CD3ζ intracellular domains) that does not show upregulation of markers associated with early T cell depletion. See Patent Publication No. WO2017044699; the contents of which are incorporated herein by reference in their entirety).

  In some embodiments, the compositions of the invention may be utilized to alter a subject's TIL (tumor infiltrating lymphocyte) population. In one embodiment, any of the payloads described herein may be utilized to alter the ratio of CD4 + cells to CD8 + population. In some embodiments, TILs may be sorted ex vivo and modified to express any of the cytokines described herein. The payloads of the invention may be used to expand the CD4 and / or CD8 population of TILs and enhance TIL-mediated immune responses.

2. Cancer Vaccines In some embodiments, the biocircuits, effector modules, payloads of interest (immunotherapeutic agents), vectors, cells and compositions of the invention may be combined with cancer vaccines.

  In some embodiments, cancer vaccines may include peptides and / or proteins derived from tumor associated antigens (TAA). Such strategies may be utilized to induce an immune response in a subject, which in some cases may be a cytotoxic T lymphocyte (CTL) response. Also, the peptides used in cancer vaccines may be modified to match the mutational characteristics of interest. For example, EGFR-derived peptides having mutations that are consistent with those found in subjects in need of treatment have been successfully used in patients with lung cancer (Li F et al. (2016) Oncoimmunology. Oct 7; 5 (12): e1238539; the contents of which are incorporated herein by reference in their entirety).

  In one embodiment, the cancer vaccine of the present invention may be a TAA-derived modified peptide ligand (APL) that is a super agonist. These are variant peptide ligands that deviate from the native peptide sequence by one or more amino acids and activate certain CTL clones more efficiently than the native epitope. These changes may allow the peptide to bind better to restriction class I MHC molecules or to interact better with the TCR of a given tumor-specific CTL subset. APLs may be selected using the methods set forth in US Patent Publication No. US20160317633A1, the contents of which are incorporated herein by reference in their entirety.

3. Combination Therapy In some embodiments, it may be desirable to combine the compositions, vectors and cells of the invention for administration to a subject. The compositions of the present invention containing different immunotherapeutic agents may be used in combination for enhanced immunotherapy.

  In some embodiments, it is desirable to be able to combine the compositions of the invention with an adjuvant to enhance the potency and longevity of an antigen-specific immune response. Adjuvants for use as immunostimulants in combination therapy include biomolecules or delivery carriers that deliver the antigen. As a non-limiting example, the compositions of the invention may be combined with biological adjuvants such as cytokines, Toll-like receptors, bacterial toxins, and / or saponins. In other embodiments, the compositions of the invention may be combined with a delivery carrier. Exemplary delivery vehicles include polymeric microspheres, immunostimulatory complexes, emulsions (oil in water or water in oil), aluminum salts, liposomes or virosomes.

  In some embodiments, immune effector cells modified to express the biological circuits, effector modules, DDs and payloads of the invention may be combined with the biological adjuvants described herein. Dual regulation of CAR and cytokines and ligands is used to decouple the kinetic control of target-mediated activation from the proliferation of endogenous T cells. Such dual adjustment also minimizes the need for patient preconditioning regimens. As a non-limiting example, a DD-regulated CAR, such as the CD19 CAR, may be combined with a cytokine, such as IL12, to enhance the antitumor effect of CAR (Pegram HJ, et al. Tumor-targeted T). cells modified to secret IL12 eradicated systematic tuners without need for priority conditioning. Blood. 2012; 119: 4133-4; the entire contents of which are incorporated herein by reference). As another non-limiting example, Merchant et al. Combined dendritic cell-based vaccination with recombinant human IL7 to improve outcomes in high-risk pediatric sarcoma patients (Merchant, MS et. Adjuvant immunotherapy to Impulse Outcome in High-Risk Pediatric Sarcomas. Clin Cancer Res. 2016.22 (13): 3182-91; each of which is incorporated herein by reference in its entirety).

  In some embodiments, immune effector cells modified to express one or more antigen-specific TCRs or CARs are combined with a composition of the invention that includes an immunotherapeutic agent that transforms the immunosuppressive tumor microenvironment. You may.

  In one aspect, effector immune cells modified to express CARs specific for different target molecules on the same cell may be combined. In another aspect, different immune cells modified to express the same CAR construct, such as NK cells and T cells, may be combined in tumor therapy, eg, T cells modified to express CD19 CAR are B cell malignancies may be treated in combination with NK cells modified to express the same CD19 CAR.

  In other embodiments, immune cells modified to express CAR may be combined with a checkpoint blocker.

  In some embodiments, immune effector cells modified to express the biological circuits, effector modules, DDs and payloads of the invention may be used in combination with the cancer vaccines of the invention.

  In some embodiments, the methods of the present invention combine the compositions of the present invention with other agents effective in the treatment of cancer, infectious diseases, and other immunodeficiency disorders, such as anti-cancer agents. May be included. As used herein, the term "anti-cancer agent" refers to, for example, killing cancer cells, inducing apoptosis of cancer cells, reducing the growth rate of cancer cells, Reduce the incidence or number of metastases, reduce tumor size, inhibit tumor growth, reduce blood supply to tumors or cancer cells, or promote an immune response to cancer cells or tumors It refers to any drug that can negatively affect the cancer of a subject by preventing or inhibiting the progression of cancer, or extending the lifespan of the subject with the cancer.

  In some embodiments, the anti-cancer agent or anti-cancer therapy is a chemotherapeutic agent, or radiation therapy, immunotherapy agent, surgery, or any other combination used in conjunction with the present invention to enhance the therapeutic effect of the treatment. It may be a therapeutic agent.

  In one embodiment, an effector module comprising a CD19 CAR is labeled with a Burkitt tyrosine receptor kinase (BTK) inhibitor using the method set forth in International Patent Application No. WO2016164580, which is incorporated herein by reference in its entirety. You may use together with aminopyrimidine derivatives, such as.

  In some embodiments, a composition of the invention is used in combination with an immunotherapeutic agent other than the inventive therapy described herein, eg, an antibody specific for some target molecule on the surface of tumor cells. You may.

  Exemplary chemotherapeutic agents include acivicin; aclarubicin; acodazole hydrochloride; acronin; adzelecine; aldesleukin; altretamine; ambomycin; amethantrone acetate; amsacrine; anastrozole; anthramycin; asparaginase; asperlin, sulindac, curcumin, Alkylating agents: Nitrogen mustards such as mechlorethamine, cyclophosphamide, ifosfamide, melphalan, and chlorambucil; carmustine (BCU), lomustine (CCNU), and nitrosoureas such as semustine (methyl CCU); triethylenemelamine. (TEM), triethylene, thiophosphoramide (thiotepa), hexamethylmelamine (HMM, altretamine) etc. Lamin; an alkyl sulfonate such as busulfan; a triazine such as dacarbazine (DTIC); an antimetabolite such as a folate analogue such as methotrexate or trimetrexate, 5-fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside ( AraC, cytarabine), 5-azacytidine, pyrrolidine analogues such as 2,2′-difluorodeoxycytidine, 6-mercaptopurine, 6-thioguanine, azathioprine, 2′-deoxycoformycin (pentostatin), erythrohydroxynonyladenine. (EHNA), fludarabine phosphate, and purine analogs such as 2-chlorodeoxyadenosine (cladribine, 2-CdA); paclitaxel, vinca alkaloids, such as vinblastine (VLB). , Vincristine, and vinorelbine, natural products, including anti-mitotic agents such as taxotere, estramustine, and estramustine phosphate; epipodophyllotoxins such as etoposide and teniposide; actimomycin D, daunomycin ( Rubidomycin), doxorubicin, mitoxantrone, idarubicin, bleomycin, plicamycin (mitramycin), mitomycin C, and antibiotics such as actinomycin; enzymes such as L-asparaginase, cytokines such as interferon (IFN) -γ, tumor necrosis. Factor (TNF) -α, TNF-β and GM-CSF, anti-angiogenic factors such as angiostatin and endostatin, inhibitors of FGF or VEGF, such as soluble VGF / VEGF receptors, including neovascularization Soluble forms of factor receptors, platinum coordination complexes such as cisplatin and carboplatin, anthracenediones such as mitoxantrone, substituted ureas such as hydroxyurea, methylhydrazine derivatives such as N-methylhydrazine (MIFf) and procarbazine, mitotane (o , P'-DDD) and corticosteroids such as aminoglutethimide; hormones and antagonists, including prednisone and equivalents, corticosteroid antagonists such as dexamethasone and aminoglutethimide; hydroxyprogesterone caproate, med-acetate Roxyprogesterone and progestins such as megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol equivalents; anti-estrogens such as tamoxifen; testosterone propionate And androgens, including fluoxymesterone / equivalents; antiandrogens such as flutamide, gonadotropin releasing hormone analogs, and leuprolide; nonsteroidal antiandrogens such as flutamide; kinase inhibitors, histone deacetylase inhibitors, methyl Inhibitors, proteasome inhibitors, monoclonal antibodies, oxidants, antioxidants, telomerase inhibitors, BH3 mimetics, ubiquitin ligase inhibitors, stat inhibitors, and imatinib mesylate (sold as Gleevac or Glivac) and now sold as Tarveca Receptor tyrosine kinase inhibitors such as erlotinib (EGF receptor inhibitor); antiviral drugs such as oseltamivir phosphate, amphotericin B, and palivizumab; Sdi1 mimetic Semustine; senescence-derived inhibitor 1; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stippiamide; stromelysin inhibitors; sulfinosine; hyperactive vasoactive intestinal peptide antagonists; veraresol; veramine; virgin Verteporfin; Vinorelbine; Vinxartine; Vitaxin; Borozole; Zanoterone; Zeniplatin; Dilascorb; and Zinostatin Stimalamer; PI3Kβ small molecule inhibitor, GSK263671; Pan PI3K inhibitor (BKM120); BRAF inhibitor, Vemurafenib (Zeloraf). And Dabrafenib (Tafinlar); or any analog or derivative and variant of the foregoing, but is not limited thereto.

  Radiotherapeutic agents and factors include, for example, gamma irradiation, X-rays, UV irradiation, microwaves, electron emission, radiation and waves that induce DNA damage such as radioisotopes. Therapy may be achieved by irradiating the localized tumor site with radiation in the form described above. All of these factors most likely result in a wide range of damaged DNA in DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. The X-ray dose range is from a daily dose of 50 to 200 roentgens for a long period (3 to 4 weeks) to a single dose of 2000 to 6000 roentgens. Radioisotope dose ranges vary widely and depend on the half-life of the isotope, the intensity and type of radiation emitted, and uptake by tumor cells.

  In some embodiments, the chemotherapeutic agent may be an immunomodulatory agent such as lenalidomide (LEN). Recent studies have shown that lenalidomide can enhance the anti-tumor function of CAR-modified T cells (Otahal et al., Oncoimmunology, 2015, 5 (4): e1115940). Some examples of anti-tumor antibodies include tocilizumab, siltuximab.

  Other agents that may be used in combination with the compositions of the present invention also include agents that affect upregulation of cell surface receptors and their ligands (eg Fas / Fas ligand, DR4 or DR5 / TRAIL) and GAP junctions. , Cell growth inhibitors and differentiators, focal adhesion kinase (FAK) inhibitors and cell adhesion inhibitors such as lovastatin, or agents that sensitize hyperproliferative cells to apoptosis inducers such as antibody C225. Not limited to.

  Combinations may include administering the compositions of the present invention and the other agent (s) simultaneously or separately. Alternatively, the immunotherapy may be given before or after the other drug / therapy at intervals ranging from minutes, days, weeks to months.

4. Diseases In the present invention, there is provided a method for reducing the tumor volume or tumor burden of a subject in need thereof, which method comprises introducing the composition of the present invention into the subject.

  The present invention also provides a method of treating cancer in a subject, comprising administering to the subject an effective amount of an immune effector cell that has been genetically modified to express at least one effector module of the present invention.

Cancer A variety of cancers can be treated using the effector module containing the pharmaceutical composition, the biological circuit, the components of the biological circuit, the SRE or the payload of the present invention. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites. , Also refers to pathological conditions characterized by the growth of such malignant neoplasms. The cancer may be a tumor or a hematological malignancy, which includes all types of lymphomas / leukemias, carcinomas and sarcomas, such as anus, bladder, bile ducts, bones, brain, breast, cervix, colon. / Rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, coccyx, Includes, but is not limited to, cancers or tumors found in the testicles, thyroid and uterus.

  Types of carcinoma that can be treated with the compositions of the invention include papilloma / carcinoma, choriocarcinoma, yolk sac tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyomas. , Mesothelioma, hemangioma, osteoma, chondroma, glioma, lymphoma / leukemia, squamous cell carcinoma, small cell carcinoma, undifferentiated large cell carcinoma, basal cell carcinoma, undifferentiated sinus cancer, It is not limited to these.

  Types of carcinoma that can be treated with the compositions of the present invention include soft tissue sarcomas, such as hydatidiform soft tissue sarcoma, angiosarcoma, cutaneous fibrosarcoma, tendinoma, fibrogenic small round cell tumor, extraosseous chondrosarcoma, Extraosseous osteosarcoma, fibrosarcoma, hemangiopericytoma, angiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, Includes, but is not limited to, synovial sarcoma, askin tumor, Ewing sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.

  By way of non-limiting example, treatable carcinomas are acute granulocytic leukemia, acute lymphocytic leukemia, acute myelogenous leukemia, adenocarcinoma, adenosarcoma, adrenal carcinoma, adrenal cortical carcinoma, anal cancer, anaplastic astrocytoma. , Hemangiosarcoma, appendiceal carcinoma, astrocytoma, basal cell carcinoma, B cell lymphoma), cholangiocarcinoma, bladder cancer, bone cancer, intestinal cancer, brain cancer, brain stem glioma, brain tumor, breast cancer, carcinoid tumor, cervix Cancer, cholangiocellular carcinoma, chondrosarcoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous lymphoma, cutaneous melanoma, diffuse astrocytoma, ductal carcinoma in situ , Endometrial cancer, ependymoma, epithelioid sarcoma, esophageal cancer, Ewing sarcoma, extrahepatic cholangiocarcinoma, eye cancer, fallopian tube cancer, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal cancer, gastrointestinal carcinoid cancer, general type digestion Tube stromal tumor, germ cell tumor, glioblastoma multiforme, glioma, hair cell white Disease, head and neck cancer, hemangioendothelioma, Hodgkin lymphoma, Hodgkin's disease, Hodgkin lymphoma, hypopharyngeal cancer, invasive ductal carcinoma, invasive lobar adenocarcinoma, inflammatory breast cancer, intestinal cancer, intrahepatic cholangiocarcinoma, invasive breast cancer / Invasive breast cancer, pancreatic islet cell cancer, jaw cancer, Kaposi's sarcoma, kidney cancer, laryngeal cancer, leiomyosarcoma, pial meningeal metastasis, leukemia, lip cancer, liposarcoma, liver cancer, non-invasive lobular cancer, low-grade star Melanoma, lung cancer, lymph node cancer, lymphoma, male breast cancer, medullary cancer, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesenchymal chondrosarcoma, mesenchyme, mesothelioma , Metastatic breast cancer, metastatic melanoma, metastatic squamous neck cancer, mixed glioma, oral cancer, mucinous cancer, mucosal malignant melanoma, multiple myeloma, nasal cavity cancer, nasopharyngeal cancer, cervical cancer, Neuroblastoma, neuroendocrine tumor, non-Hodgkin lymphoma, non-Hodgkin lymphoma, non-small cell Cancer, oat cell carcinoma, eye cancer, intraocular melanoma, oligodendroglioma, oral cancer, oral cancer, oropharyngeal cancer, osteogenic sarcoma, osteosarcoma, ovarian cancer, Ovarian epithelial cancer, ovarian germ cell tumor, ovarian primary peritoneal cancer, ovarian cord cord interstitial tumor, Paget's disease, pancreatic cancer, papillary cancer, sinus cancer, parathyroid cancer, pelvic cancer, penile cancer, peripheral nerve cancer, Peritoneal cancer, pharyngeal cancer, pheochromocytoma, pilocytic astrocytoma, pineal tumor, pineal blastoma, pituitary cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cells Cancer, renal pelvic cancer, rhabdomyosarcoma, salivary gland cancer, sarcoma, osteosarcoma, soft tissue sarcoma, uterine sarcoma, sinus cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, spinal cancer, spinal column cancer, spinal cancer , Spinal tumor, squamous cell carcinoma, gastric cancer, synovial sarcoma, T cell lymphoma), testicular cancer, pharyngeal cancer, Thymoma / thymoma, thyroid cancer, tongue cancer, tonsil cancer, transitional cell carcinoma, transitional cell carcinoma, transitional cell carcinoma, type III negative breast cancer, fallopian tube cancer, tubular cancer, ureteral cancer, ureteral cancer, urethral cancer, uterus It may be adenocarcinoma, uterine cancer, uterine sarcoma, vaginal cancer, and vulvar cancer.

Infections In some embodiments, the biocircuits of the invention may be used to treat infections. The biological circuit of the present invention may be introduced into cells suitable for adoptive cell transfer such as macrophages, dendritic cells, natural killer cells, and / or T cells. The infectious disease treated by the biological circuit of the present invention may be a disease caused by a virus, bacterium, fungus, and / or parasite. The IL15-IL15Ra payloads of the invention may be used to enhance immune cell proliferation and / or immune cell persistence useful in the treatment of infections.

  As used herein, "infectious disease" refers to a disease caused by any pathogen or substance that infects mammalian cells, preferably human cells, causing the disease state. Examples include bacteria, yeasts, fungi, protozoa, mycoplasmas, viruses, prions, and parasites. As an example, (a) viral diseases such as adenovirus, herpes virus (for example, HSV-I, HSV-II, CMV, or VZV), poxvirus (for example, smallpox or vaccinia, or molluscum contagiosum) Orthopoxvirus), picornavirus (eg rhinovirus or enterovirus), orthomyxovirus (eg influenza virus), paramyxovirus (eg parainfluenza virus, mumps virus, measles virus, and RS virus (RSV)) ), Coronavirus (eg, SARS), papovavirus (eg, papillomavirus that causes genital warts, vulgaris vulgaris, or plantar warts), hepadnavirus (eg, hepatitis B virus), flavivirus ( For example, diseases caused by infection with hepatitis C virus or dengue virus), or retroviruses (eg, lentiviruses such as HIV); (b) bacterial diseases such as Escherichia, Enterobacter, Salmonella, Staphylococcus, Shigella genus, Listeria genus, Aerobacterium genus, Helicobacter genus, Klebsiella genus, Proteus genus, Pseudomonas genus, Streptococycolumus Clyde, ChumyladiceC, Pneumococcus, Pneumocycous, Pneumococcus. (c) Chlamydia, a disease caused by infection with bacteria of genus mpylobacterium, genus Vibrio, genus Serratia, genus Providencia, genus Chromobacterium, genus Brucella, genus Yersinia, genus Haemophilus, or Bordetella; Parasitism including but not limited to mycosis, malaria, Pneumocystis carnii pneumonia, leishmaniasis, cryptosporidiosis, toxoplasmosis, and asthma, aspergillosis, histoplasmosis, cryptococcal meningitis, and Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), Gerstmann-Stroisler- Yainka syndrome, fatal familial insomnia, and infectious diseases that are involved in trypanosome infection and prions cause human diseases such as kuru disease.

5. Microbiome Changes in the composition of the microbiome can affect the action of anticancer therapies. Diverse communities of commensal, commensal and pathogenic microorganisms are present at all sites of environmental exposure in the body and are referred to herein as "microbiomes." Sites of environmental exposure of the body where microbiomes can inhabit include the skin, nasopharynx, oral cavity, respiratory tract, gastrointestinal tract, and reproductive system.

  In some embodiments, natural or immunotherapeutic agent-modified microbiomes may be used to enhance the efficacy of anti-cancer immunotherapy. A method for improving responsiveness to immunotherapeutic agents using a microbiome has been described by Sivan et al. 350: 1084-9; hereby incorporated by reference in its entirety). In one embodiment, microbiome-derived proteins, RNA, and / or other biomolecules may be used as payloads to influence the efficacy of anti-cancer immunotherapy.

6. Tools and Agents for Making a Therapeutic Agent In the present invention, there are provided tools and agents that can be used in producing an immunotherapeutic agent for reducing the tumor volume or tumor burden of a subject in need thereof. A number of variables are involved in the production of therapeutics such as payload structure, cell type, gene transfer method, ex vivo growth method and time, preconditioning, and tumor volume and type of interest. . Such parameters may be optimized using the tools and agents described herein.

Cell Lines The present disclosure provides mammalian cells genetically modified with the compositions of the invention. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human embryonic kidney cell line 293, fibroblast cell line NIH 3T3, human colorectal cancer cell line HCT116, ovarian cancer cell line SKOV-3, immortalized T cell line (eg Jurkat cell line. And SupT1 cells), lymphoma cell lines Raji cells, NALM-6 cells, K562 cells, HeLa cells, PC12 cells, HL-60 cells, NK cell lines (eg, NKL, NK92, NK962, and YTS) and the like. , But not limited to these. In some examples, the cells are cells obtained from an individual rather than an immortalized cell line and are referred to herein as primary cells. For example, the cell is a T lymphocyte obtained from an individual. Other examples include, but are not limited to, cytotoxic cells, stem cells, peripheral blood mononuclear cells or progenitor cells obtained from an individual.

Tracking SREs, Biological Circuits, Cell Lines In some embodiments, it may be desirable to track the compositions of the invention or cells modified by the compositions of the invention. Tracking may be accomplished by using a reporter moiety, which as used herein refers to any protein capable of producing a detectable signal in response to an input. Examples include alkaline phosphatase, β-galactosidase, chloramphenicol acetyltransferase, β-glucuronidase, peroxidase, β-lactamase, catalytic antibodies, bioluminescent proteins such as luciferase, and fluorescent proteins such as green fluorescent protein (GFP). To be

  The reporter moiety may be used to monitor the response of DD upon addition of the ligand corresponding to DD. In other examples, the reporter moiety may be used to track cell survival, persistence, cell proliferation, and / or localization in vitro, in vivo, or ex vivo.

  In some embodiments, the preferred reporter moiety may be a luciferase protein. In one embodiment, the reporter moiety is Renilla luciferase (encoded by the nucleic acid sequence of SEQ ID NO: 866, SEQ ID NO: 867) or firefly luciferase (encoded by the nucleic acid sequence of SEQ ID NO: 868, SEQ ID NO: 869). .

Animal Models The utility and efficacy of the compositions of the invention may be tested in in vivo animal models, preferably mouse models. The mouse model used may be a syngeneic mouse model in which mouse cells are modified with the composition of the invention and tested in mice of the same genetic background. Examples include the pMEL-1 and 4T1 mouse models. Alternatively, xenograft models in which human cells such as tumor cells and immune cells are introduced into immunodeficient mice may also be utilized in such studies. The immunodeficient mice used are CByJ. ^{Cg-Foxn1 nu / J, B6} ; 129S7-Rag1 tm1Mom /J,B6.129S7-Rag1 tm1Mom / J, B6. CB17-Prkdc ^scid / SzJ, NOD. 129S7 (B6) -Rag1 tm1 ^Mom / J, NOD. Cg-Rag1 ^tm1 Mom ^Prf1 tm1 ^Sd z / Sz, NOD. CB17-Prkdc ^scid / SzJ, NOD. Cg-Prkdc ^scid B2m ^tm1Unc / J, NOD-scid IL2Rg ^null , nude (nu) mouse, SCID mouse, NOD mouse, RAG1 / RAG2 mouse, NOD-Scid mouse, IL2rgnull mouse, b2mnull mouse, NOD-nulDIL null. It may be -scid-B2mnull mouse, beige mouse, and HLA transgenic mouse.

Cellular Assays In some embodiments, the effectiveness of compositions of the invention as immunotherapeutic agents may be assessed using cellular assays. The expression level and / or identity of the compositions of the invention may be determined according to any method known in the art for identifying proteins and / or quantifying protein levels. In some embodiments, such methods can include Western blotting, flow cytometry, and immunoassays.

  Provided herein are methods for functionally characterizing cells expressing the SREs, biological circuits and compositions of the invention. In some embodiments, functional characterization may be performed on primary immune cells or immortalized immune cell lines and determined by expression of cell surface markers. Examples of cell surface markers for T cells include, but are not limited to, CD3, CD4, CD8, CD14, CD20, CD11b, CD16, CD45 and HLA-DR, CD69, CD28, CD44, IFNγ. Markers of T cell depletion include PD1, TIM3, BTLA, CD160, 2B4, CD39, and LAG3. Examples of cell surface markers for antigen presenting cells include MHC class I, MHC class II, CD40, CD45, B7-1, B7-2, IFN-γ receptor and IL2 receptor, ICAM-1 and / or Fcγ receptor. But is not limited to these. Examples of cell surface markers for dendritic cells include MHC class I, MHC class II, B7-2, CD18, CD29, CD31, CD43, CD44, CD45, CD54, CD58, CD83, CD86, CMRF-44, CMRF-56. , DCIR and / or Dectin-1 and the like; but in some cases, at the same time, CD2, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD20, CD56, And / or CD57 is absent. Examples of cell surface markers for NK cells include CCL3, CCL4, CCL5, CCR4, CXCR4, CXCR3, NKG2D, CD71, CD69, CCR5, phospho JAK / STAT, phospho ERK, phospho p38 / MAPK, phospho AKT, phospho STAT3, granuricin. , Granzyme B, Granzyme K, IL10, IL22, IFNg, LAP, Perforin, and TNFa, but are not limited thereto.

V. Delivery Methods and / or Vector Vectors The invention also provides vectors that package the polynucleotides of the invention encoding biocircuits, effector modules, SRE (DD) and payload constructs, and combinations thereof. The vectors of the invention may also be used to deliver packaged polynucleotides to cells, local tissue sites or subjects. These vectors may be of any type including DNA vectors, RNA vectors, plasmids, viral vectors and particles. Viral vector technology is well known and can be found in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). Viruses useful as vectors include, but are not limited to, lentivirus vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus vectors, retrovirus vectors, oncolytic viruses, and the like.

  Generally, the vector contains an origin of replication functional in at least one organism, a promoter sequence and convenient restriction endonuclease sites, and one or more selectable markers, such as drug resistance genes.

  As used herein, a promoter is defined as a DNA sequence recognized by the cellular transcription machinery necessary to initiate specific transcription of a polynucleotide sequence of the present invention. The vector can include a natural or non-natural promoter operably linked to the polynucleotide of the present invention. The selected promoter may be strong, weak, constitutive, inducible, tissue-specific, developmental stage-specific, and / or biospecific. One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of a polynucleotide sequence operably linked thereto. Another example of a preferred promoter is elongation growth factor-1. α (EF-1.α). Includes simian virus 40 (SV40), mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV), terminal repeat (LTR), promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter Include, but are not limited to, other constitutive promoters, as well as phosphoglycerate kinase (PGK) promoter, actin promoter, myosin promoter, hemoglobin promoter, ubiquitin C (Ubc) promoter, human U6 micronucleus protein promoter and creatine kinase promoter. Human gene promoters that are not limited to these may also be used. In some examples, inducible promoters such as, but not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters may be used. In some embodiments, the promoter may be selected from SEQ ID NOs: 716-718.

  In some embodiments, an optimal promoter is selected based on the minimal expression of the SRE and payload of the invention in the absence of ligand and the ability to achieve detectable expression in the presence of ligand. Good.

  Additional promoter elements, such as enhancers, may be used to regulate the frequency of transcription initiation. Such regions may be located 10-100 base pairs upstream or downstream of the start site. In some examples, more than one promoter element may be used to activate transcription coordinately or independently.

  In some embodiments, recombinant expression vectors may include regulatory sequences, such as transcription and translation initiation and termination codons, that are specific to the type of host cell into which the vector is introduced.

1. Lentiviral Vectors In some embodiments, lentiviral vectors / particles may be used as vehicles and delivery modalities. Lentiviruses are a subgroup of viruses of the Retroviridae family, named because they require reverse transcription of the viral RNA genome into DNA prior to integration into the host genome. Therefore, the most important feature of the lentiviral vehicle / particle is the integration of genetic material into the genome of the target / host cell. Some examples of lentiviruses are human immunodeficiency viruses: HIV-1 and HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), genbrana disease virus ( JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna-maedi virus and goat arthritis encephalitis virus (CAEV).

  Generally, the lentiviral particles that make up the gene delivery vehicle themselves are replication-defective (also called "self-inactivating"). Lentiviruses can infect both dividing and non-dividing cells by an entry mechanism through the intact host nuclear envelope (Naldini L et al., Curr. Opin. Biotechnol, 1998, 9: 457-463. ). Recombinant lentivirus vehicles / particles have been generated by multiple attenuation of HIV virulence genes, for example by deleting the Env, Vif, Vpr, Vpu, Nef, and Tat genes to render the vector biological. To be safe. Similarly, lentiviral vehicles derived from HIV-1 / HIV-2, for example, can mediate efficient delivery, integration, and long-term expression of transgenes in non-dividing cells. As used herein, the term "recombinant" refers to a vector or other nucleic acid that contains both lentiviral and non-lentiviral retroviral sequences.

  Lentiviral particles may be produced by co-expressing viral packaging elements with the vector genome itself in producer cells such as human HEK293T cells. These elements are usually provided in three (2nd generation lentiviral system) or 4 separate plasmids (3rd generation lentiviral system). A plasmid (called the packaging system) encoding a lentiviral component containing the viral core (ie structural protein) and enzyme components, and the envelope protein (s), and the genome containing the foreign transgene to be introduced into target cells The resulting plasmid, the vehicle itself (also called the transfer vector), is co-transfected into producer cells. Generally, the plasmid or vector is contained in a producer cell line. The plasmid / vector is introduced into the producer cell line via transfection, transduction, or infection. Methods of transfection, transduction or infection are well known to those of skill in the art. As a non-limiting example, after introducing the packaging and transducing constructs into the producer cell line by calcium phosphate transfection, lipofection or electroporation, usually a dominant selectable marker such as neo, DHFR, Gln synthetase or ADA is added. Can be used to select and isolate clones in the presence of the appropriate drug.

  Producer cells produce recombinant viral particles that contain a foreign gene, such as an effector module of the invention. Recombinant viral particles are recovered from the medium and titered by standard methods used by those of skill in the art. The recombinant lentivirus vehicle can be used to infect target cells.

  Cells that can be used to produce high titer lentiviral particles include HEK293T cells, 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11: 452-459), FreeStyle (trademark). ) 293 Expression System (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (eg, Stewart et al., Hum Gene Ther. 2011, 22 (3): 357-369, Lee. Et al. Bioeng, 2012, 10996): 1515-1560; Throm et al. , Blood. 2009, 113 (21): 5104- 5110; the contents of each of which are incorporated herein by reference in their entirety), but are not limited thereto.

  In some aspects, the envelope protein may be a heterologous envelope protein from another virus, such as the vesicular stomatitis virus G protein (VSV G) or the baculovirus gp64 envelope protein. The VSV-G glycoprotein is a species that is particularly classified in the genus Vecyclovirus: Carajas virus (CJSV), Chandipla virus (CHPV), Coccus virus (COCV), Isfahan virus (ISFV), Maraba virus (MARAV), pyrivirus. Virus (PIRYV), Vesicular Stomatitis Aragoas Virus (VSAV), Vesicular Stomatitis Indiana Virus (VSIV) and Vesicular Stomatitis New Jersey Virus (VSNJV), and / or Saw Gorhabdo Virus, BeAn157575 Virus (BeAn157575), Botecvirus ( BTKV), Calchachivirus (CQIV), L virus American (EVA), Gray lodge virus (GLOV), Jurona virus (JURY), Klamath virus (KLAV) Quatta virus (KWAV), La Jolla virus (LJV), Malpes spring virus (MSPV), Mt. Ergon bat virus (MEBV), Perineto virus (PERV), Pike fly rhabdo virus (PFRV), Porton virus (PORV), Strains tentatively classified in the genus Vecyclovirus as Radi virus (RADIV), carp spring viremia virus (SVCV), Tupai virus (TUPV), ulcer disease rhabd virus (UDRV) and Yagbogdanova virus (YBV). You may choose from. gp64 or other baculovirus env proteins are known as Autographa californica nuclear polyhedrosis virus (AcMNPV), Anagrapha falcifera nuclear polyhedrosis virus, Bombyx mori pus nucleopolyhedrosis virus, Choristoneura puja virus polymorphosis virus, Choristoneura sugria fever. Nuclear polyhedrosis virus, Epiphyas postvittana nuclear polyhedrosis virus, Hyphantria cunea nuclear polyhedrosis virus, Galleria mellonella nuclear polyhedrosis virus, dorivirus, togoto virus, Antheraea pemii nuclear polyhedrosis virus or Batoken virus Can be That.

  Additional elements provided in lentiviral particles include retroviral LTRs (terminal repeats) at either the 5'or 3'ends, retroviral transport elements, optionally lentiviral reverse response elements (RREs), their promoters or It may include an active portion and a locus control region (LCR) or active portion thereof. Other elements include a central polyprint lacto sequence (cPPT) sequence that improves the transduction efficiency of non-dividing cells, a woodchuck hepatitis virus (WHP) post-transcriptional regulator (WPRE) that enhances the expression of the transgene and enhances its titer. Is mentioned. The effector module is linked to the vector.

  Methods of producing recombinant lentiviral particles are known in the art, for example, US Pat. Nos. 8,846,385; 7,745,179; 7,629,153; No. 7,179,903; and 6,808,905; the contents of each of which is incorporated herein by reference in its entirety.

  The lentiviral vector used is pLVX, pLenti, pLenti6, pLJM1, FUGW, pWPXL, pWPI, pLenti CMV puro DEST, pLJM1-EGFP, pULTRA, pInducer20, pHIV-EGFP, pCW57.L, pTRPER, pTRWp.R, pTRPER, pCW57.L, pTRWp. Can be selected from, but is not limited to.

  Lentivirus vehicles known in the art may also be used (US Pat. Nos. 9,260,725; 9,068,199; 9,023,646; 8,900,858). No.8,748,169; 8,709,799; 8,420,104; 8,329,462; 8,076,106; 6,013,516; And 5,994,136; International Patent Publication No. WO2012079000; the contents of each of which are incorporated herein by reference in their entirety).

2. Retrovirus vector (γ-retrovirus vector)
In some embodiments, retroviral vectors may be used to package and deliver the biocircuits, components of biocircuits, effector modules, SREs or payload constructs of the invention. Retroviral vectors (RV) allow the transgene to be permanently integrated into target cells. In addition to complex HIV-1 / 2-based lentiviral vectors, simple gamma-retrovirus-based retroviral vectors are widely used to deliver therapeutic genes and transduce a wide range of cell types. Has been clinically demonstrated as one of the most efficient and powerful gene delivery systems that can be achieved. Exemplary species of gamma retroviruses include murine leukemia virus (MLV) and feline leukemia virus (FeLV).

  In some embodiments, the γ-retroviral vector derived from a mammalian γ-retrovirus, such as murine leukemia virus (MLV), is recombinant. The MLV family of gamma retroviruses includes allotropic, amphotropic, xenotropic and multidirectional subfamilies. An ecotropic virus can only infect mouse cells that use the mCAT-1 receptor. Examples of allotropic viruses are Moloney MLV and AKV. Amphotropic viruses infect mice, humans and other species via the Pit-2 receptor. An example of an amphotropic virus is the 4070A virus. Heterotrophic and multitropic viruses utilize the same (Xpr1) receptor, but differ in the tropism of their species. Heterotrophic viruses such as NZB-9-1 infect humans and other species but not mouse species, while multitropic viruses such as focus-forming virus (MCF) affect mice, humans. And infect other species.

  A plasmid encoding a retrovirus structural and enzymatic (gag-pol) polyprotein, a plasmid encoding an envelope (env) protein, and a plasmid encoding a vector mRNA containing a polynucleotide encoding the composition of the present invention. The cells may be co-transfected with several plasmids, including the γ-retroviral vector in the packaging cells, which are packaged into newly formed viral particles.

  In some aspects, the recombinant gamma-retroviral vector is pseudotyped with envelope proteins from other viruses. Envelope glycoproteins can be incorporated into the outer lipid layer of viral particles and enhance / alter cell tropism. Examples of envelope proteins include the gibbon ape leukemia virus envelope protein (GALV) or vesicular stomatitis virus G protein (VSV-G), or the monkey endogenous retrovirus envelope protein, or the measles virus H and F proteins, or the human immunodeficiency virus. gp120 envelope protein, or coccus vesiculovirus envelope protein (see, eg, US Application Publication No. 2012/164118; the contents of which are incorporated herein by reference in their entirety). In another aspect, the envelope glycoproteins may be genetically modified to incorporate targeting / binding ligands into the γ-retroviral vector, including binding ligands including peptide ligands, single chain antibodies and growth factors. (Wahehler et al., Nat. Rev. Genet. 2007, 8 (8): 573-587: 573-587; the contents of which are hereby incorporated by reference in their entirety). These modified glycoproteins can retarget the vector to cells that express the corresponding targeting moiety. In other embodiments, "molecular bridges" may be introduced to direct the vector to specific cells. Molecular bridges have dual specificity: one end can recognize viral glycoproteins and the other end can bind to molecular determinants of target cells. Such molecular cross-links, such as ligand receptors, avidin-biotin, and chemical conjugation, monoclonal antibodies and modified membrane fusion proteins can attach viral vectors to target cells for transduction (Yang et. al., Biotechnol. Bioeng., 2008, 101 (2): 357-368; and Maetzig et al., Viruses, 2011, 3, 677-713; the contents of each of which are herein incorporated by reference in their entirety. Incorporated into).

  In some embodiments, the recombinant gamma retroviral vector is a self-inactivating (SIN) gamma retroviral vector. The vector is non-replicable. The SIN vector may contain a deletion in the 3'U3 region which initially has enhancer / promoter activity. In addition, the 5'U3 region may be replaced with a strong promoter from cytomegalovirus or RSV (required for the packaging cell line), or an internal promoter of choice, and / or enhancer elements. The choice of internal promoter may be made according to the particular requirements of gene expression required for the particular purpose of the invention.

  In some embodiments, the biological circuit, the components of the biological circuit, the effector module, the polynucleotide encoding the SRE are inserted into the recombinant viral genome. Other components of the viral mRNA of the recombinant γ-retroviral vector may be inserted or deleted in the native sequence (eg, IRES insertion, heterologous polynucleotide encoding the polypeptide of interest or inhibitory nucleic acid, substitute for wild-type promoter). May be modified by different retroviruses or more effective promoter shuffling from viruses). In some embodiments, the recombinant gamma-retroviral vector has a modified packaging signal, and / or a primer binding site (PBS), and / or 5 in the U3 region of the 5'-terminal repeat (LTR). It may include a'-enhancer / promoter element and / or a modified 3'-SIN element in the U3 region of the 3'-LTR. These modifications can increase titer and infectivity.

  Γ-retroviral vectors suitable for delivering the biocircuit components, effector modules, SREs or payload constructs of the present invention are described in US Pat. Nos. 8,828,718; 7,585,676; No. 351,585; U.S. Application Publication No. 2007/048285; PCT Application Publication No. WO2010 / 113037; WO2014 / 121005; WO2015 / 056014; and EP Patent EP1757702; EP1757703. It may be selected from the vectors, the contents of each of which are incorporated herein by reference in their entirety.

3. Adeno-associated virus vector (AAV)
In some embodiments, the polynucleotides of the invention may be packaged in a recombinant adeno-associated virus (rAAV) vector. Such vectors or viral particles may be designed to utilize any of the known serotype capsids or combinations of serotype capsids. Serotype capsids include any identified AAV serotype and variants thereof, such as AAV1, AAV2, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and A capsid from AAVrh10 may be included.

  In one embodiment, the AAV serotype is a sequence described in US Publication No. US 20030138772, which is incorporated herein by reference in its entirety, such as, but not limited to, AAV1 (SEQ ID NOS: 6 and 64 of US 20030138772). , AAV2 (SEQ ID NOS: 7 and 70 of US 20030138772), AAV3 (SEQ ID NOS: 8 and 71 of US 20030138772), AAV4 (SEQ ID NO: 63 of US 200301387772), AAV5 (SEQ ID NO: 114 of US 20030138772), AAV6 (SEQ ID NO: 65 of US 20030138772), AAV7 (SEQ ID NOS: 1 to 3 of US 20030138772), AAV8 (SEQ ID NOS: 4 and 95 of US 20030138772), AAV9 (SEQ ID NO: 5 of US 20030138772) 00), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772) or a variant thereof. Or it may have the sequence. Non-limiting examples of variants include SEQ ID NO: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, 101-113 of US20030187772, the content of which is Are incorporated herein by reference in their entirety.

  In one embodiment, the AAV serotype is described by Purichella et al. (Molecular Therapy, 2011, 19 (6): 1070-1078), U.S. Patent No. 6,156,303; 7,198,951; U.S. Patent Publication Nos. US2015 / 0159173 and US2014 / 0359799; and It may have the sequences set forth in International Patent Publication Nos. WO 1998/011244, WO 2005/033321, and WO 2014/14422, the contents of each of which are incorporated herein by reference in their entireties.

  AAV vectors include self-complementary AAV vectors (scAAV) as well as single-stranded vectors. The scAAV vector contains DNA that anneals together to form the double-stranded vector genome. By skipping second strand synthesis, scAAV can be rapidly expressed intracellularly.

  The rAAV vector may be produced in sf9 insect cells or in suspension cell culture of human cells such as HEK293 cells by standard methods such as triple transfection.

  One or more viral genomes packaged in the AAV capsids described herein may encode a biocircuit, a biocircuit component, an effector module, an SRE, or a payload construct.

  Such a vector or viral genome may include at least one or two ITRs (terminal inversion sequences) as well as specific regulatory elements required for expression from the vector or viral genome. Such regulatory elements are well known in the art and include, for example, promoters, introns, spacers, stuffer sequences and the like.

  In some embodiments, more than one effector module or SRE (eg, DD) may be encoded in the viral genome.

4. Oncolytic Viral Vectors In some embodiments, the polynucleotides of the invention may be packaged in an oncolytic virus, such as a vaccine virus. As an oncolytic vaccine virus, thymidine kinase (TK) deficient granulocyte macrophage (GM) colony stimulating factor (CSF) -expressing replicable vaccinia virus vector virus particles sufficient to induce oncolysis of tumor cells (For example, US Pat. No. 9,226,977).

5. Messenger RNA (mRNA)
In some embodiments, effector modules of the invention may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) encodes a polypeptide of interest, which is translated in vitro, in vivo, in situ or ex vivo, to encode the encoded polypeptide of interest. Refers to any polynucleotide that can be produced. Such mRNA molecules may have any of the structural components or features of those set forth in International Application No. PCT / US2013 / 030062, the contents of which are incorporated herein by reference in their entirety. .

  Polynucleotides of the present invention are disclosed, for example, in Ribostem Limited, UK Patent Application No. 0316089.2, filed Jul. 9, 2003, now abandoned, which is incorporated herein by reference in its entirety. PCT Application No. PCT / GB2004 / 002981, filed July 9, 2004, published as WO2005005622, filed June 8, 2006, published as US20060247195, now abandoned US patent application Phased Registration No. 10 / 563,897, and European Patent Application National Phased Registration EP 2004473322, filed July 9, 2004, published as EP 1646714 and now withdrawn; Novozymes, Inc. PCT Application No. PCT / US2007 / 88060, filed Dec. 19, 2007 and published as WO2008140615; U.S. Patent Application National Phase Registration No. 12, filed Jul. 2, 2009 and published as US201208943; / 520,072 and European Patent Application National Phase No. EP2007847376, filed on 7th July 2009 and published as EP 2104739; PCT, filed on 4th December 2006, published as WO2007064952, University of Rochester Application No. PCT / US2006 / 46120 and US Patent Application No. 11 / 606,995, filed December 1, 2006, published as US20070141030, BioNTtech AG, December 14, 2007. Filed and now abandoned European Patent Application No. EP2007024312, PCT Application No. PCT / EP2008 / 01059, filed December 12, 2008, published as WO2009907134, filed June 2, 2010 European Patent Application National Phase Registration No. EP2008861423, published as EP2240572, US Patent Application National Phase Registration No. 12 / 735,060, published on November 24, 2010 and published as US20110065103, September 2005. German patent application DE 10 2005 046 490, filed on 28th, PCT application PCT / EP2006 / 0448, published on 28th September 2006, published as WO2007036366, published on 21st March 2012 European Patent National Phase EP 1934345 and US Patent Application National Phase No. 11 / 992,638, filed August 14, 2009 and published as 20111002877; Immunize Disease Institute Inc. No. 13 / 088,009 filed April 15, 2011 and published as US20120046346, PCT application PCT / US2011 / 32679 filed April 15, 2011 and published as WO2011130624. Shire Human Genetic Therapeutics, U.S. Patent Application No. 12 / 957,340, filed Nov. 20, 2010 and published as US201102444026; Sequitur Inc .; PCT application PCT / US1998 / 0194492, filed Sep. 18, 1998 and published as WO1999014346; PCT application No. PCT / PCT / PCT application, filed February 24, 2010, of the Scripps Research Institute. US 2010/00567 and US Patent Application National Phase Registration No. 13 / 203,229 filed on November 3, 2011 and published as US20120053333; filed on July 30, 2010 at Ludwig-Maximilians University. PCT Application No. PCT / EP2010 / 004681, published as WO 20110121616; Cellscript Inc. U.S. Pat. No. 8,039,214 filed on Jun. 30, 2008 and filed on Oct. 18, 2011, U.S. patent application filed on Dec. 7, 2010 and published as US20110143436. No. 12 / 962,498, filed on Dec. 7, 2010, published as US2011041397, No. 12 / 962,468, filed on Sep. 20, 2011, published as US2012049649, No. 13/237 , 451 and PCT application PCT / US2010 / 59305 filed December 7, 2010 and published as WO2011071931 and PCT / US2010 / 59317 filed December 7, 2010 and published as WO20111071936; Pennsylvania University trustee , PCT Application No. PCT / US2006 / 32372, filed Aug. 21, 2006 and published as WO2007024708, and U.S. Patent Application National Phase Registration No. 11 filed Mar. 27, 2009 and published as US20090286852. / 990,646; Curevac GMBH, all abandoned, German patent application DE 102001027283.9 filed June 5, 2001, DE 102001062480.8 filed December 19, 2001. , And DE 202006051516 filed on October 31, 2006, European Patent EP1392341 filed on March 30, 2005 and EP1458410 patented on January 2, 2008, June 2002. Appear on the 5th PCT Application No. PCT / EP2002 / 06180, filed Dec. 19, 2002, published as WO2002098443, PCT / EP2002 / 14577, published Dec. 31, 2007, published as WO2003051401 No. PCT / EP2007 / 09469, published as WO2008052770, filed April 16, 2008, PCT / EP2008 / 03033, published as WO2009127230, filed May 19, 2005, published as WO2006122828 PCT / EP2006 / 004784, filed Jan. 9, 2007 and published as WO2008083949, No. PCT / EP2008 / 00081, Dec. 5, 2003. U.S. Patent Application No. 10 / 729,830, filed June 18, 2004, filed US 2005032730, and filed on July 7, 2008, US Patent No. 2005/0059624. No. 11 / 914,945, published as US20080267787, filed October 27, 2009, published as US2010047261, now abandoned 12 / 446,912, January 4, 2010. No. 12 / 522,214, filed May 26, 2010, published as US2011918729, filed on May 26, 2010, No. 12 / 787,566, published as US20110077287, US20100239608 Published 12 / 787,755, filed July 18, 2011, published as US20110269950, and published May 12, 2011, published as US20110311472. No. 13 / 106,548, which is incorporated herein by reference.

  In some embodiments, effector modules may be designed as self-amplifying RNA. As used herein, "self-amplifying RNA" refers to an RNA molecule capable of replicating in a host and increasing the amount of RNA and proteins encoded by RNA. Such self-amplifying RNA may have any of the structural features or components of those set forth in International Patent Application Publication No. WO 2011005799, the contents of which are incorporated herein by reference in its entirety. .

VI. Dosing, Delivery and Administration The compositions of the invention may be delivered to cells or subjects via one or more routes and modalities. Viral vectors containing one or more of the effector modules, SREs, immunotherapeutic agents, and other components described herein may be used to deliver them to cells and / or subjects. Other formats such as mRNA, plasmids, and recombinant proteins may also be used.

1. Delivery to Cells In another aspect of the invention, polynucleotides encoding the biocircuits, effector modules, SREs (eg DD), payloads of interest (immunotherapeutic agents) and compositions of the invention and vectors comprising said polynucleotides. May be introduced into cells such as immune effector cells.

  In one aspect of the invention, the polynucleotide encoding the biocircuit, effector module, SRE (eg DD), payload of interest (immunotherapeutic drug) and composition of the invention is packaged in a viral vector or a viral vector. It may be integrated into the genome to allow transient or stable expression of the polynucleotide. Preferred viral vectors are retroviral vectors, including lentiviral vectors. To construct a retroviral vector, a polynucleotide molecule encoding a biological circuit, an effector module, a DD or a payload of interest (ie, an immunotherapeutic drug) is inserted at a position of a specific viral sequence in the viral genome, and the replication ability is defective. To produce the virus. The recombinant viral vector is then introduced into a packaging cell line containing the gag, pol, and env genes but no LTR and packaging components. The recombinant retroviral particles are secreted into the medium, collected, concentrated if necessary, and used for gene transfer. Lentiviral vectors are particularly preferred as they can infect both dividing and non-dividing cells.

  In addition, the vector may be treated with a non-viral vector by a physical method such as needle, electroporation, sonoporation, or hydroporation; a chemical carrier such as inorganic particles (eg, calcium phosphate, silica, gold) and / or a chemical method. It may be introduced into cells by the method. In some embodiments, synthetic or natural biodegradable agents such as cationic lipids, lipid nanoemulsions, nanoparticles, peptide-based vectors, or polymer-based vectors may be used for delivery.

  In some embodiments, the polypeptides of the invention may be delivered directly to cells. In one embodiment, the polypeptides of the invention may be delivered using a synthetic peptide containing an endosomal leaky domain (ELD) fused to a cell penetrating domain (CLD). The polypeptides of the invention are co-transfected into cells with ELD-CLD-synthetic peptides. ELD promotes escape of proteins trapped within endosomes into the cytosol. Such domains are proteins of microbial and viral origin and have been described in the art. CPD allows the transport of proteins across the plasma membrane, which has also been described in the art. The ELD-CLD fusion protein synergistically enhances transduction efficiency when compared to co-transduction with either domain alone. In some embodiments, a histidine-rich domain may optionally be added to the shuttle construct as an additional method to allow escape of cargo from the endosome to the cytosol. The shuttle may also include a cysteine residue at the N- or C-terminus to generate fusion peptide multimers. The ELD-CLD fusion peptide multimers produced by adding a cysteine residue to the end of the peptide show even higher transduction efficiency when compared to a single fusion peptide construct. The polypeptides of the invention may also be added to appropriate localization signals to direct the cargo to appropriate intracellular locations, such as the nucleus. In some embodiments, any of the ELD, CLD or fused ELD-CLD synthetic peptides set forth in International Patent Publications WO2016161516 and WO20171755072 may be useful in the invention (each content in its entirety). Incorporated herein by reference).

2. Dosing The present invention provides a method comprising administering to a subject in need thereof any one or more compositions for immunotherapy. These may be administered to a subject using any amount and any route of administration effective to prevent or treat clinical conditions such as cancer, infectious diseases and other immunodeficiency diseases.

  The compositions according to the invention are usually formulated in a unit dosage form for ease of administration and uniformity of dosage. It will be appreciated, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment. The particular therapeutically effective or prophylactically effective dose level for any particular patient will depend on various factors, including the disorder being treated and the severity of the disorder. The activity of the particular compound used; the particular composition used; the patient's age, weight, general health, sex and diet; time of administration, route of administration, previous or contemporaneous therapeutic intervention, and of the particular compound used. Excretion rates; duration of treatment; drugs used in combination with or co-administered with the particular compound used; as well as similar factors well known in the medical arts will be dependent.

  The compositions of the invention may be used at various doses to avoid T cell energy, prevent cytokine release syndrome, and minimize toxicity associated with immunotherapy. For example, the compositions of the invention are used at low doses to initially treat patients with high tumor burden, while patients with low tumor burden are treated with high and repeated doses of the compositions of the invention. Used to treat and ensure minimal recognition of tumor antigen load. In another example, the compositions of the invention may be delivered in a pulsatile manner to reduce persistent T cell signaling and enhance persistence in vivo. In some embodiments, low doses of the compositions of the invention may be used initially, prior to administration of the high dose, to minimize toxicity. If serum markers such as ferritin, serum C-reactive protein, IL6, IFN-γ, and TNF-α are elevated, the dosage may be altered.

  In some embodiments, the neurotoxicity may be associated with CAR or TIL therapy. Such neurotoxicity may be associated with CD19-CAR. Toxicity may be due to excessive T cell infiltration into the brain. In some embodiments, neurotoxicity may be mitigated by preventing passage of T cells across the blood brain barrier. This can also be achieved by targeted gene deletion of endogenous α4 integrin inhibitors such as tisabri / natalizumab, which may also be useful in the present invention.

3. Administration In some embodiments, immunotherapeutic compositions may be administered to cells ex vivo, followed by administration to a subject. Immune cells may be isolated and expanded ex vivo using various methods known in the art. For example, methods for isolating cytotoxic T cells are described in US Pat. Nos. 6,805,861 and 6,531,451, the contents of each of which are herein incorporated by reference in their entirety. Be used for. Isolation of NK cells is described in US Pat. No. 7,435,596; the content of which is incorporated herein by reference in its entirety.

  In some embodiments, the compositions of the present invention are co-pending co-owned US Provisional Patent Application No. 62 / 320,864 filed April 11, 2016, or filed March 3, 2017. No. 62 / 466,596, and International Patent Publication WO2017 / 180587, each of which is incorporated herein by reference in its entirety. Be used for.

  In some embodiments, depending on the nature of the cells, the cells may be introduced into the host organism, eg, a mammal, by a variety of methods including injection, blood transfusion, infusion, local instillation or transplantation. In some embodiments, the cells of the invention may be introduced at the tumor site. The number of cells used will depend on many factors, the purpose of transfer, the life span of the cells, the protocol used, such as the number of doses, the proliferative capacity of the cells, etc. The cells may be present in a physiologically acceptable medium.

  In some embodiments, cells of the invention may be administered to a subject having a disease or condition in multiple doses. Administration generally results in amelioration of one or more symptoms of cancer or clinical condition, and / or treatment or prevention of cancer or clinical condition or symptoms thereof.

  In some embodiments, immunotherapeutic compositions may be administered in vivo. In some embodiments, the polypeptides of the invention, including the biological circuits, effector molecules, SREs, payloads of interest (immunotherapy agents) and compositions of the invention, may be delivered to a subject in vivo. In vivo delivery of immunotherapeutic agents is well described in the art. For example, methods of delivering cytokines are described in EP 093089292 A1, the contents of which are incorporated herein by reference.

  In one embodiment, the payload of the invention may be administered with an inhibitor of SHP-1 and / or SHP-2. The tyrosine protein phosphatases SHP1 (also known as PTPN6) and SHP2 (also known as PTPN11) are involved in the programmed cell death (PD1) inhibitory signaling pathway. The intracellular domain of PD1 contains an immunoreceptive tyrosine motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM). ITSM has been shown to recruit SHP-1 and SHP-2. This creates negative costimulatory microclusters that induce dephosphorylation of proximal TCR signaling molecules, which may lead to suppression of T cell activation and lead to T cell depletion. In one embodiment, inhibitors of SHP-1 and SHP-2 can include expressing a dominant negative version of the protein in T cells, TILs or other cell types to reduce depletion. Such variants may bind to the endogenous catalytically active protein and inhibit its function. In one embodiment, the dominant negative mutant of SHP-1 and / or SHP-2 lacks the phosphatase domain required for catalytic activity. In some embodiments, Bergeron S et al. (2011). Endocrinology. 2011 Dec; 152 (12): 4581-8. Dustin JB et al. (1999) J Immunol. Mar 1; 162 (5): 2717-24. Berchold S (1998) Mol Endocrinol. Apr; 12 (4): 556-67 and Schram et al. (2012) Am J Physiol Heart Circ Physiol. 1; 302 (1): H231-43, any of the dominant negative SHP-1 variants may be useful in the present invention, the contents of each of which are incorporated by reference in their entirety.

Delivery Routes The pharmaceutical compositions, biological circuits, components of biological circuits, effector modules containing SREs (eg DD), payloads (ie immunotherapeutic agents), vectors and cells of the invention may be administered by any route. , May achieve therapeutically effective results.

  These include enteral (intestinal), gastrointestinal, epidural (dural), oral (via mouth), transdermal, epidural, intracerebral (intracerebral), lateral ventricle (intracerebroventricular), On the skin (application to the skin), intradermally (to the skin itself), subcutaneously (under the skin), intranasal administration (nasal), intravenous (intravenous), intravenous bolus, intravenous drip, intraarterial (arterial) Intra), intramuscular (intramuscular), intracranial (intracardiac), intraosseous injection (intramedullary), intrathecal (intravertebral canal), intraperitoneal, (intraperitoneal injection or injection), intrasinus injection, Intravitreous, (intraocular), intravenous infusion (pathological cavity), intracavity (base of penis), vaginal administration, intrauterine, extraamnion administration, transdermal (through intact skin for systemic distribution) Diffusion), transmucosal (diffusion through mucous membrane), vagina, insufflation (suction), sublingual, sublabial, enema, eye drop (on conjunctiva), ear drop, auricle (in ear or trans ear), cheek Side (to cheek), conjunctiva, Skin, teeth (teeth or teeth), electroosmosis, endocervical, intrasinus, intratracheal, extracorporeal, hemodialysis, permeation, interstitial, intraperitoneal, amniotic fluid, intraarticular, biliary, intrabronchial, intracapsular, Intrachondral (intrachondral), intracaudal (intracauda), intracisternal (in cerebellar medulla oblongata), intracorneal (intracorneal), intratracheal, intracoronary (intracoronary), intracavernosal ( In the expandable space of the corpora cavernosa of the penis, in the intervertebral disc (in the intervertebral disc), in the duct (in the duct), in the duodenum (in the duodenum), intradural (in the dura or subdural), in the epidermis (in the epidermis). Intraepidermal), Intraesophageal (Intraesophageal), Intragastric (Intragastric), Intragingival (Intragingival), Intestinal ileum (In distal portion of small intestine), Intralesional (Intralesional or direct to focal lesion) Introduction), intraluminal (intraluminal of the duct), intralymphatic (intralymphatic), intramedullary (intramedullary cavity of bone), intrathecal (intrathecal), myocardial (cardiac) Intramuscular), Intraocular (Intraocular), Intraovarian (Intraovarian), Intrapericardial (Intrapericardial), Intrapleural (Intrapleural), Intraprostatic (Intraprostatic), Intrapulmonary (Lung or its Bronchial) , In sinuses (in the nose or periorbital sinus), in the spinal cord (in the spinal column), in the synovial bursa (in the synovial cavity of the joint), in the tendon (in the tendon), in the testicle (in the testicle), subarachnoid Intracavity (cerebral spinal fluid of any level cerebrospinal axis), intrathoracic (intrathoracic), intraductal (intracapillary canal), intratumor (intratumoral), tympanic cavity (in middle ear), intravascular (vascular) ), Intracerebroventricular (intraventricular), iontophoresis (by electric current that moves ions of soluble salts into body tissues), irrigation (soaking or rinsing wound or body cavity), larynx (directly to larynx), nasogastric (Nose to stomach), occlusive bandage therapy (administered by topical route, then covered with a bandage that seals the area), eye (outer eye), oropharynx (directly to oral cavity and pharynx). Parenteral, percutaneous, periarticular, periural, perineural, periodontal, rectal, respiratory (oral or nasal inhalation for local or systemic effects), posterior (behind the pons) Or behind the eyeball, intramyocardium (entry into the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through placenta or through placenta), transtrachea (of trachea) Through the wall), transtympanic (through or through the tympanic cavity), ureter (to the ureter), urethra (to the urethra), vagina, sacral anesthesia, diagnosis, nerve anesthesia, bile perfusion, heart Includes but is not limited to perfusion, photopheresis or spinal cord.

VII. Definitions At various places in the specification, features or functions of the disclosed compositions are disclosed in groups or in ranges. The present disclosure is specifically intended to include any individual subcombination of the members of such groups and ranges. The following is a non-limiting list of term definitions.

  Activity: As used herein, the term "activity" refers to the state in which something is happening or is taking place. The compositions of the present invention may have activity, which activity may involve one or more biological events. In some embodiments, the biological event can include a cell signaling event. In some embodiments, the biological event is a cellular signal associated with a protein interaction with one or more corresponding proteins, receptors, small molecules or any of the components of the biological circuits described herein. It may include a transfer event.

  Adoptive Cell Therapy (ACT): As used herein, the term “adoptive cell therapy” or “adoptive cell transplant” refers to cell therapy involving the transplantation of cells into a patient, where the cells are in the patient. Alternatively, it may be from another individual and the cells are modified (altered) before returning to the patient. The therapeutic cells are derived from the immune system such as immune effector cells: CD4 + T cells; CD8 + T cells, natural killer cells (NK cells); and B cells and tumor infiltrating lymphocytes (TIL) derived from resected tumors. Good. The most commonly transplanted cells are autologous anti-tumor T cells after expansion or manipulation ex vivo. For example, autologous peripheral blood lymphocytes can be genetically modified to recognize specific tumor antigens by expressing the T cell receptor (TCR) or chimeric antigen receptor (CAR).

  Drug: As used herein, the term “drug” refers to a biological, pharmaceutical, or chemical compound. Non-limiting examples include simple or complex organic or inorganic molecules, peptides, proteins, oligonucleotides, antibodies, antibody derivatives, antibody fragments, receptors, and soluble factors.

  Agonist: As used herein, the term "agonist" refers to a compound that can be combined with a receptor to elicit a cellular response. An agonist may be a ligand that directly binds to the receptor. Alternatively, the agonist may, for example, (a) form a complex with another molecule that binds directly to the receptor, or (b) otherwise bind another compound such that another compound directly binds to the receptor. The compound may be modified to indirectly bind to the receptor. Agonists may be referred to as agonists of a particular receptor or family of receptors, eg, agonists of costimulatory receptors.

  Antagonist: As used herein, the term "antagonist" refers to any agent that inhibits or reduces the biological activity of the target (s) to which it binds.

  Antigen: As used herein, the term "antigen" is defined as a molecule that elicits an immune response when introduced into a subject or when produced by a subject, such as a tumor antigen produced by the onset of cancer itself. To be done. This immune response includes the production of antibodies or the activation of certain immunologically competent cells such as cytotoxic T lymphocytes and T helper cells, or both. Antigens may be derived from organisms, protein / antigen subunits, killed or inactivated whole cells or lysates. In the context of the present invention, the term "antigen of interest" or "desired antigen" immunospecifically binds to the antibodies and / or fragments, variants, variants and / or variants of the invention described herein or Refers to the proteins and / or other biomolecules provided herein that interact. In some embodiments, the antigen of interest can include any of the polypeptides or payloads or proteins described herein, or fragments or portions thereof.

  Approximately: As used herein, the term “approximately” or “about” when applied to one or more values of interest refers to a value that is similar to the referenced value referred to. In certain embodiments, the term "approximately" or "about", unless specified otherwise or apparent from context, is in any direction (greater than or less than) of the referenced value. 25, 20, 19, 18, 17, 16, 15, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or less Refers to a range of values (unless such a number exceeds 100 possible values).

  Associative: As used herein, the terms “associate,” “conjugate,” “link,” “attach,” and “connect” are used with respect to two or more moieties. If so, the moieties are physically associated with or connected to each other, either directly or through one or more additional moieties that function as linking agents, to form a sufficiently stable structure, thereby It is meant that the moieties remain physically associated under the conditions of use of the structure, eg physiological conditions. "Association" need not be by strictly direct covalent chemical bonding. The term may also suggest ionic or hydrogen bonding, or sufficiently stable hybridization-based connectivity such that the "association" entities remain physically associated.

  Self: The term "self" as used herein is meant to refer to any substance derived from the same individual when subsequently reintroduced into the individual.

  Barcode: As used herein, the term "barcode" refers to a polynucleotide or amino acid sequence that distinguishes one polynucleotide or amino acid from another.

  Cancer: As used herein, the term "cancer" refers to a broad group of various diseases characterized by uncontrolled growth of abnormal cells in the body. Unregulated cell division and proliferation results in the formation of malignant tumors that invade adjacent tissues and eventually metastasize through the lymphatic system or bloodstream to distant parts of the body.

  Co-stimulatory molecule: As used herein, of an immune cell surface receptor / ligand that participates between T cells and APCs and produces a stimulatory signal for T cells, according to its meaning in immune T cell activation. Refers to the group, this stimulatory signal combined with the T cell stimulatory signal resulting from T cell receptor (TCR) recognition of the antigen / MHC complex (pMHC) on APC.

  Cytokine: As used herein, the term "cytokine" refers to a small soluble factor with a pleiotropic function produced by many cell types that can influence and regulate the function of the immune system. Refers to the family.

  Delivery: As used herein, the term “delivery” refers to the act or manner of delivering a compound, substance, entity, portion, cargo or payload. "Delivery agent" refers at least in part to the in vivo delivery of one or more substances, including but not limited to compounds and / or compositions of the invention, to cells, subjects or cells of other biological systems. Refers to any drug that promotes.

  Destabilization: As used herein, the terms "destable", "destabilization", "destabilization region" or "destabilization domain" refer to the start, reference, wild. It refers to a region or molecule that is less stable than the same or native form of the same region or molecule.

  Modifications: As used herein, embodiments of the present invention include features that alter them, whether structural or chemical, from the starting point, wild-type or naturally-occurring molecule. Or it is "modified" when it is designed to have the property.

  Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (eg, by transcription); (2 ) RNA transcript processing (eg, by splicing, editing, 5'capping, and / or 3'end processing); (3) translation of RNA into a polypeptide or protein; (4) folding of the polypeptide or protein. And (5) post-translational modification of the polypeptide or protein.

  Feature: As used herein, "feature" refers to a feature, characteristic, or characteristic element.

  Formulation: As used herein, "formulation" includes at least a compound and / or composition of the invention, and a delivery agent.

  Fragment: As used herein, "fragment" refers to a portion. For example, a protein fragment can include a polypeptide obtained by digesting a full-length protein. In some embodiments, the protein fragments are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25. , 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250 or more amino acids. In some embodiments, antibody fragments include portions of antibodies.

  Functional: As used herein, a "functional" biomolecule is a biological entity having a structure and morphology that exhibits the properties and / or activities that characterize the molecule.

  Immune cell: As used herein, the term "immune cell" refers to any cell of the immune system that is derived from hematopoietic stem cells in the bone marrow and has two major lineages: myeloid progenitor cells ( Produces myeloid cells such as monocytes, macrophages, dendritic cells, megakaryocytes, and granulocytes) and lymphoid progenitor cells (T cells, B cells, and lymphoid cells such as natural killer (NK) cells) Cause) to occur. Exemplary immune system cells include CD4 + T cells, CD8 + T cells, CD4-CD8- double negative T cells, Tγδ cells, Tαβ cells, regulatory T cells, natural killer cells, and dendritic cells. Macrophages and dendritic cells are sometimes referred to as "antigen presenting cells" or "APCs", in which the major histocompatibility complex (MHC) receptors on the APC surface complexed with peptides are on the T cell surface. They are specialized cells that can activate T cells when they interact with the TCR.

  Immunotherapy: As used herein, the term "immunotherapy" refers to a type of treatment of a disease by inducing or restoring the responsiveness of the immune system to the disease.

  Immunotherapeutic agent: As used herein, the term "immunotherapeutic agent" refers to the treatment of a disease by inducing or restoring the responsiveness of the immune system to the disease with a biological, pharmaceutical, or chemical compound. .

  In vitro: As used herein, the term "in vitro" refers to an artificial environment, such as a test tube or reaction vessel, cell culture, not within an organism (eg, animal, plant, or microorganism). Refers to events that occur in Petri dishes.

  In vivo: As used herein, the term "in vivo" refers to an event that occurs within an organism (eg, an animal, plant, or microorganism or cells or tissues thereof).

  Linker: As used herein, a linker refers to a moiety that connects two or more domains, moieties or entities. In one embodiment, the linker can include 10 or more atoms. In a further embodiment, the linker may comprise a group of atoms, for example 10 to 1,000 atoms, such as carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. Can consist of, but is not limited to: In some embodiments, the linker can include one or more nucleic acids that include one or more nucleotides. In some embodiments, the linker can include amino acids, peptides, polypeptides or proteins. In some embodiments, the moieties attached by the linker include atoms, chemical groups, nucleosides, nucleotides, nucleobases, sugars, nucleic acids, amino acids, peptides, polypeptides, proteins, protein conjugates, payloads (eg, therapeutics. Drugs) or markers (including but not limited to chemical markers, fluorescent markers, radioactive markers, bioluminescent markers). As described herein, the linker can be used for any useful purpose, such as forming multimers or complexes, and administering payload. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl. Each can be optionally substituted as described herein. Examples of linkers include unsaturated alkanes, polyethylene glycols (eg ethylene or propylene glycol monomer units such as diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol or tetraethylene glycol), and dextran polymers. But is not limited to these. Other examples include cleavable moieties within the linker, such as disulfide bonds (-SS-) or azo bonds (-N = N-) that are cleavable using reducing agents or photolysis. , But not limited to these. Non-limiting examples of selectively cleavable bonds include, for example, tris (2-carboxyethyl) phosphine (TCEP), or other reducing agents, and / or amide bonds that can be cleaved by use of photolysis, and , For example ester bonds which can be cleaved by acidic or basic hydrolysis.

  Checkpoint / factor: As used herein, a checkpoint factor is any part or molecule whose function acts at the junction of the process. For example, checkpoint proteins, ligands or receptors can function to stall or accelerate the cell cycle.

  Metabolite: A metabolite is an intermediate product of a metabolic reaction catalyzed by an enzyme that naturally occurs in the cell. This term is commonly used to describe a small molecule, a fragment of a large biomolecule, or a processed product.

  Modification: As used herein, the term “modification” refers to an altered state or structure of a molecule or entity relative to a parent or reference molecule or entity. The molecule may be modified in many ways, such as chemically, structurally, and functionally. In some embodiments, the compounds and / or compositions of the invention are modified by the introduction of unnatural amino acids.

  Mutation: As used herein, the term "mutation" refers to an alteration and / or an alteration. In some embodiments, mutations can be changes and / or alterations to proteins (including peptides and polypeptides) and / or nucleic acids (including polynucleic acids). In some embodiments, mutations include changes and / or alterations to protein and / or nucleic acid sequences. Such changes and / or alterations are additions, substitutions and / or deletions of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleic acids, eg polynucleotides). Can be included. In some embodiments where the mutation comprises an amino acid and / or nucleotide addition and / or substitution, such an addition and / or substitution may comprise one or more amino acid and / or nucleotide residues, and is a modified amino acid. And / or may include nucleotides. The resulting mutation, change or alteration construct, molecule or sequence may be referred to herein as a variant.

  Neoantigen: As used herein, the term "neoantigen" is present in tumor cells, but not in normal cells, and does not induce the deletion of cognate antigen-specific T cells in the thymus (ie, central Immune tolerance) Refers to a tumor antigen. These tumor neoantigens provide "foreign" signals similar to pathogens and induce an effective immune response required for cancer immunotherapy. Neoantigens may be restricted to certain tumors. Neoantigens are peptides / proteins with missense mutations (missense neoantigens) or novel peptides with long fully novel amino acid stretches from a novel open reading frame (neoORF). The neoORF is an out-of-frame insertion or deletion in some tumors (due to a defect in DNA mismatch repair that causes microsatellite instability), gene fusion, stop codon readthrough mutation, or translation of improperly spliced RNA. (Eg, Saeterdal et al., Proc Natl Acad Sci USA, 2001, 98: 13255-13260).

  Off-target: As used herein, “off-target” refers to an unintended effect on any one or more targets, genes, cell transcripts, cells, and / or tissues.

  Operably linked: As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties and the like.

  Payload or Objective Payload (POI): As used herein, the terms "payload" and "objective payload (POI)" are used interchangeably. The payload of interest (POI) refers to any protein or compound whose function is to be altered. In the context of the present invention, a POI is a component of the immune system which includes both the innate immune system and the adaptive immune system. The payload of interest may be a protein, a fusion construct encoding a fusion protein, or a non-coding gene, or variants and fragments thereof. The target payload may be referred to as the target protein if it is amino acid based.

  Pharmaceutically acceptable excipient: As used herein, the term "pharmaceutically acceptable excipient" is present in a pharmaceutical composition and is substantially non-toxic and non-toxic within the subject. Refers to any ingredient other than an active agent having inflammatory properties (eg, as described herein). In some embodiments, the pharmaceutically acceptable excipient is a vehicle that can suspend and / or dissolve the active agent. Excipients include, for example: anti-adhesion agents, antioxidants, binders, coating agents, compression aids, disintegrants, dyes (colorants), emollients, emulsifiers, fillers (diluents), film-forming agents. Further, coating agents, fragrances, fragrances, lubricants (glidants), lubricants, antiseptics, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and water of hydration can be mentioned. Exemplary excipients: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethyl cellulose, gelatin, hydroxy. Propylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, dioxide. Silicon, sodium carboxymethylcellulose, sodium citrate, sodium starch glycol , Sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and although xylitol, and the like.

  Pharmaceutically acceptable salt: A pharmaceutically acceptable salt of a compound described herein is one in which the acid or base moiety is formed by reaction of its salt form (eg, the free base with a suitable organic acid). ) Is the form of the disclosed compound. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, Camphor sulfonate, citrate, cyclopentane propionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptoneate, hexane Acid salt, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, Malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectic Acid salt, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfone Examples thereof include acid salts, undecanoates, valerates and the like. Representative alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. Include, but are not limited to, non-toxic ammonium, quaternary ammonium, and amine cations. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts derived from non-toxic inorganic or organic acids. In some embodiments, pharmaceutically acceptable salts are prepared from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts are prepared by reacting the free acid or free base form of these compounds with a stoichiometric amount of a suitable base or acid in water or an organic solvent, or in a mixture of the two. A non-aqueous medium such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile is generally preferred. A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed. , Mack Publishing Company, Easton, Pa. , 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.M. H. Stahl and C.I. G. FIG. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al. , Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety. Pharmaceutically acceptable solvate: As used herein, the term "pharmaceutically acceptable solvate" refers to a crystalline form of a compound in which molecules of the appropriate solvent are incorporated into the crystal lattice. Point to. For example, solvates may be prepared by crystallization, recrystallization, or precipitation from a solution containing an organic solvent, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (eg monohydrate, dihydrate, and trihydrate), N-methylpyrrolidinone (NMP), dimethylsulfoxide (DMSO), N, N'-dimethyl. Formamide (DMF), N, N'-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2- ( 1H) -pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate and the like. When water is the solvent, solvates are called "hydrates". In some embodiments, the solvent incorporated into the solvate is of a physiologically acceptable type or level for the organism to which the solvate is administered (eg, in the unit dosage form of the pharmaceutical composition). is there.

  Stable: As used herein, "stable" is a compound or entity that is robust enough to withstand isolation from a reaction mixture to useful purities and is preferably capable of being formulated into an effective therapeutic agent. Refers to.

  Stabilized: As used herein, the terms "stabilize," "stabilized," "stabilized region" means to stabilize or to become stable. To do. In some embodiments, stability is measured against absolute values. In some embodiments, stability is measured against a secondary status or condition, or reference compound or entity.

  Standard CAR: As used herein, the term "standard CAR" refers to a standard design chimeric antigen receptor. The components of the CAR fusion protein, which include an extracellular scFv fragment, a transmembrane domain and one or more intracellular domains, are constructed linearly as a single fusion protein.

  Stimulus Response Element (SRE): The term “stimulus response element (SRE)” as used herein comprises a structure of an effector module that is joined, attached, linked or associated with one or more payloads of the effector module. Element, which in some cases is responsible for the responsiveness of the effector module to one or more stimuli. As used herein, the "responsive" nature of an SRE to a stimulus may be characterized by covalent or non-covalent interactions with the stimulus, direct or indirect association, or structural or chemical response. Furthermore, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response can ultimately lead to a regulated signal or output. Such output signals are of a nature relative to the stimulus, eg, a regulatory effect of 1-100, or a 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more fold increase. Alternatively, it may cause a decrease. One non-limiting example of SRE is the destabilization domain (DD).

  Subject: As used herein, the term “subject” or “patient” refers to any organism to which the composition of the invention may be administered, eg, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. . Common subjects include animals (eg, mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

T cells: T cells are immune cells that produce the T cell receptor (TCR). T cells, naive (not exposed to the _antigen; compared to _{T CM, CD62L, CCR7, CD28} , CD3, CD127, and expression of CD45RA increased expression of CD45RO is decreased), memory T cells ( _TM ) (antigen experience and long-term survival), and effector cells (antigen experience, cytotoxicity). T _M is a subset of central memory T cells (T _CM , with increased expression of CD62L, CCR7, CD28, CD127, CD45RO, and CD95, and decreased expression of CD54RA compared to naive T cells) and effectors. It can be further subdivided into memory T cells, which have decreased expression of CD62L, CCR7, CD28, CD45RA and increased expression of CD127 compared to T _EM , naive T cells or T _CM . Effector T cells (T _E ) refer to antigen-experienced CD8 + cytotoxic T lymphocytes that have reduced expression of CD62L, CCR7, CD28 and are positive for granzyme and perforin compared to T _CM . Other exemplary T cells include regulatory T cells such as CD4 + CD25 + (Foxp3 +) regulatory T cells and Treg17 cells, and Tr1, Th3, CD8 + CD28−, and Qa-1 restricted T cells.

T cell receptor: A T cell receptor (TCR) has a variable antigen binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail capable of specifically binding to an antigen peptide bound to an MHC receptor. Refers to members of the immunoglobulin superfamily. TCRs can be found on the surface of cells or in soluble form and are generally known as α and β chains (also known as TCRα and TCRβ, respectively) or γ and δ chains (also known as TCRγ and TCRδ, respectively). )). The extracellular portion of the TCR chain (eg, α chain, β chain) has two immunoglobulin domains, the variable domain at the N-terminus (α chain variable domain or V _α , β chain variable domain or V _β ), and the cell membrane. In the vicinity of one constant domain (eg, α chain constant domain or C _α and β chain constant domain or C _β ). Like immunoglobulins, variable domains include complementarity determining regions (CDRs) separated by framework regions (FRs). The TCR normally associates with the CD3 complex to form the TCR complex. As used herein, the term "TCR complex" refers to the complex formed by the association of CD3 and TCR. For example, a TCR complex can consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of CD3ζ chains, a TCRα chain, and a TCRβ chain. Alternatively, the TCR complex may consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of CD3ζ chains, a TCRγ chain, and a TCRδ chain. As used herein, “a component of the TCR complex” refers to a TCR chain (ie, TCRα, TCRβ, TCRγ or TCRδ), a CD3 chain (ie, CD3γ, CD3δ, CD3ε or CD3ζ), or two or more. Complex formed by the TCR chain or CD3 chain (eg, TCRα and TCRβ complex, TCRγ and TCRδ complex, CD3ε and CD3δ complex, CD3γ and CD3ε complex, or TCRα, TCRβ, CD3γ, CD3δ, and the sub-TCR complex of two CD3ε chains).

  Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an infection when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition. , A drug to be delivered (eg, nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) sufficient to treat, ameliorate, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition ) Means the amount. In some embodiments, the therapeutically effective amount is provided in a single dose. In some embodiments, the therapeutically effective amount is administered in a dosing regimen that comprises multiple doses. Those of skill in the art will appreciate that in some embodiments, when administering a unit dosage form as part of such a dosing regimen, if it comprises an effective amount, a therapeutically effective amount of the particular agent or entity is It will be appreciated that it can be considered to include.

  Treatment or treating: As used herein, the term "treatment" or "treating" refers to an approach for obtaining beneficial or desired results, preferably including beneficial or desired clinical results. Such beneficial or desired clinical results include, but are not limited to, one or more of the following: diminished growth (or destruction) of cancer cells or other diseased cells, cancers found in cancer. Reduction of cell metastasis, reduction of tumor size, reduction of symptoms caused by disease, improvement of quality of life of people suffering from disease, reduction of dose of other drugs required for treatment of disease, of disease Delayed progression and / or extended survival of the individual.

  Modulation: As used herein, the term “modulation” means adjusting, balancing, or adapting one in response to a stimulus or toward a particular outcome. In one non-limiting example, the SREs and / or DDs of the invention adjust, balance, or balance the function or structure of the composition to which they attach, attach, or associate, in response to a particular stimulus and / or environment. To fit.

Equivalents and Scope One skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. . The scope of the invention is not limited to the above description, but rather is set forth in the appended claims.

  In the claims, articles such as “a”, “an”, and “the” may mean one or more unless there is a conflicting indication or unless apparent from the context. Claims or recitations that include "or" between one or more members of a group are such that one, more, or all of the group members are present, used, or used in a given product or process. If they are otherwise relevant, they are considered to be met unless conflicting instructions are given or are not clear from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members, are present, used, or otherwise associated with a given product or process.

  It should also be noted that the term “comprising” is intended to be open and allows for additional elements or steps, but need not necessarily be included. Thus, when the term "comprising" is used herein, the term "consisting of" is also intended to be included and disclosed.

  If a range is given, the endpoints are included. Further, unless otherwise indicated by context and understanding by those of skill in the art, or unless otherwise apparent, the values expressed as ranges are of the lower limit of the range, unless the context clearly dictates otherwise. It is to be understood that up to one tenth of the unit can take any particular value or subrange within the stated ranges in different embodiments of the invention.

  Furthermore, it is to be understood that certain embodiments of the invention that are included in the prior art may be explicitly excluded from any one or more of the claims. Such embodiments are considered to be known to those of ordinary skill in the art and thus may be excluded even if exclusion is not explicitly indicated herein. Whether any particular embodiment of the composition of the present invention (eg, any antibiotic, therapeutic or active ingredient; any method of manufacture; any method of use; etc.) is related to the presence of prior art Regardless, for any reason, any one or more claims may be excluded.

  The words used are words of description rather than of limitation, and in their broader aspects are modified within the scope of the appended claims without departing from the true scope and spirit of the invention. Please understand that it is good.

Example 1. Generation of Novel Ligand-Responsive SREs or DDs by Mutagenesis Screening Study Design To design a construct that exhibits ligand-dependent stability, a candidate ligand binding domain (LBD) was selected and yellow as a reporter of protein stability. Cell-based screens using fluorescent protein (YFP) have been designed to have desirable properties: low protein levels (ie low basal stability) in the absence of ligand for LBD, large dynamic range, robust and predictable We identify mutants of the candidate LBD that harbor a destabilization domain with a dose-response behavior and a rapid degradation rate (Banaszynski, et al., (2006) Cell; 126 (5): 995-1004). The candidate LBD binds to the ligand of interest rather than the endogenous signaling molecule.

  The candidate LBD sequence (as a template) is first mutated using a combination of nucleotide analog mutagenesis and error-prone PCR to generate a library of variants based on the template candidate domain sequence. The library generated is cloned in frame at the 5'or 3'ends of the YFP gene and a library of YFP fusions is stably transduced into NIH3T3 fibroblasts using a retroviral expression system.

  The transduced NIH3T3 cells are subjected to 3-4 rounds of sorting using fluorescence labeled cell sorting (FACS) to screen a library of candidate DD. Transduced NIH3T3 cells are cultured in the absence of a high affinity ligand of the ligand binding domain (LBD) and cells showing low levels of YFP expression are selected by FACS.

Screening strategy I
Selected cell populations are cultured in the presence of high affinity ligands of the ligand binding domain for a period of time (eg, 24 hours) at which time the cells are re-sorted by FACS. Cells showing high levels of YFP expression are selected by FACS, the selected cell populations are divided into two groups and treated again with different concentrations of high affinity ligands of the ligand binding domain. One group is treated with a low concentration of ligand and another group is treated with a high concentration of ligand for a period of time (eg 24 hours), at which point the cells are re-sorted by FACS. Cells expressing mutants that respond to low concentrations of ligand are isolated.

  Isolated cells that respond to lower concentrations of ligand are treated again with the ligand and cells exhibiting low fluorescence levels are harvested 4 hours after removal of the ligand from the medium. This fourth sort is designed to concentrate cells with a fast rate of degradation (Iwamoto et al., Chem Biol. 2010 Sep 24; 17 (9): 981-988).

Screening strategy II
Selected cell populations are subjected to one or more additional selections by FACS in the absence of high affinity ligands of LBD and cells showing low levels of YFP expression are selected for further analysis. Cells are treated with a high affinity ligand of the ligand binding domain for a period of time (eg 24 hours) and re-sorted by FACS. Cells expressing high levels of YFP are selected through FACS. High YFP expressing cells are treated again with ligand and 4 hours after removing the ligand from the medium, cells exhibiting low fluorescence levels are collected and cells exhibiting fast degradation rates are enriched. Any of the sorting steps may be repeated to identify DD with ligand-dependent stability.

  After selection, cells are harvested. The identified candidate cells are collected and genomic DNA is extracted. Candidate DD is amplified by PCR and separated. The candidate DD is sequenced and compared to the LBD template to identify mutations in the candidate DD.

Embodiment 2. FIG. Expression of DD Regulated Recombinant IL12 FKBP (DD) -IL12 and DHFR (DD) -IL12 constructs were packaged in a pLVX IRES-Puro lentiviral vector with or without a CMV, EF1a, or PGK promoter. did. IL12 consists of two subunits, p40 and p35, separated by a linker. The p40 signal sequence was inserted next to DD or IL12. Some constructs contained a furin protease cleavage site or a modified furin site.

HEK293T cells were transiently transfected with 200 ng or 1 μg of FKBP-IL12 plasmid (OT-IL12-001 to OT-IL12-005), followed by treatment with 10 μM Shield-1 or vehicle control for 6 hours. Medium was collected from transfected cells, diluted 1:50 and IL12 levels were measured using p40 ELISA. Stabilization ratio was defined as the fold change in IL12 expression with ligand treatment compared to treatment with DMSO using the same construct (ie in the absence of ligand). Stabilization ratios greater than 1 are desirable. Average IL12 ELISA measurements and stabilization ratios are shown in Table 15.

  OT-IL12-002 and OT-IL12-004 showed low levels of IL12 expression in the absence of ligand when compared to IL12 levels in HEK293T parental cells. Treatment with Shield-1 increased the IL12 levels of the OT-IL12-002, OT-IL12-004, and OT-IL12-005 constructs, resulting in a stabilization ratio of 2-4. These data indicate that OT-IL12-002 and OT-IL12-004 are destabilized in the absence of these constructs and stabilized by Shield-1.

IL12 expression was measured in cells after stable transduction. 500,000 cells stably transduced with OT-IL12-004 were seeded in 12-well plates and incubated in growth medium consisting of Dulbecco's Modified Eagle Medium (DMEM) and 10% Fetal Bovine Serum (FBS). Incubated overnight. The next day, cells were treated with 1 μM Shield-1 or vehicle control for 6 or 24 hours. After treatment with Shield-1, growth medium was harvested from cells, diluted 10, 40, 160 or 640 fold and IL12 levels quantified using an IL12-p40 ELISA. Stabilization ratio was defined as the fold change in IL12 expression upon ligand treatment compared to treatment with DMSO using the same construct (ie in the absence of ligand). Stabilization ratios greater than 1 are desirable. Table 16 shows the average IL12 ELISA measurement values and the stabilization ratio at 6 hours.

  IL12 stabilization ratios greater than 1 were observed at 10, 40 and 160 fold dilutions of medium, indicating that at these dilutions, Shield-1 treatment stabilized IL12 at 6 hours.

Average IL12 ELISA measurements and stabilization ratios at 24 hours are shown in Table 17.

  The IL12 stabilization ratio was greater than 1 at all media dilutions tested, and the highest stabilization ratio was observed at 40-fold dilution of media at 24 hours, suggesting ligand-dependent stabilization.

To evaluate Shield-1 dependent FKBP-1L12 induction over time, 2 million cells were seeded in growth medium and incubated overnight in the presence of 1 μM Shield-1 or vehicle control. Cells were then incubated in the presence of ligand for 2, 4, 6, 8, 24, 48, or 72 hours, and cell growth medium was collected at all time points. Growth medium was diluted 400-fold and IL12 levels were measured using the IL12 p40 ELISA. Stabilization ratio was defined as the fold change in IL12 expression upon ligand treatment compared to treatment with DMSO using the same construct (ie in the absence of ligand). Stabilization ratios greater than 1 are desirable. Average IL12 ELISA measurements and stabilization ratios are shown in Table 18.

  The stabilization ratio increased with time, reaching a peak at 48 hours, suggesting that Shield-1 stabilized IL12 as the duration of ligand treatment increased.

To assess the dependence of FKBP-IL12 production on Shield-1 dose levels, OT-IL12-004 transduced HEK293T cells were treated with different densities (40,000, 20,000, 10,000 or well cells per well). 5,000 cells) on 96 well plates. After overnight incubation, cells were treated with growth medium containing 0-10 μM Shield-1 for 24 hours. The medium was then harvested, diluted 400-fold and FKBP-IL12 levels were measured using the IL12-p40 ELISA. Mean IL12 ELISA measurements are shown in Table 19.

  Dose-dependent IL12 induction was observed in all cell numbers tested. IL12 induction was increased with Shield-1 up to a dose of 1 μM; thereafter IL12 induction reached a plateau. In particular, greater IL12 induction was observed at 2000 and 4000 cells / well.

Example 3. Function mediated by DD-regulated recombinant IL12 in HEK293T cells HEK-Blue sensor cells (InvivoGen, San Diego, CA) were used to evaluate whether DD-regulated IL12 can regulate signal transduction downstream of IL12. . In these cells, the IL12 receptor, STAT4 and downstream transcriptional elements are linked to a reporter gene, which allows IL12 signaling to be monitored. Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA) was used to transfect 1 million HEK293Ts with 200 ng of OT-IL12-003 plasmid. 48 hours after transfection, cells were treated with growth medium containing 10 μM Shield-1 and incubated for a further 24 hours after which the medium was harvested. 50,000 HEK293 Blue sensor cells were seeded in a 96-well plate and incubated overnight with Shield-treated OT-IL12-003 expressing HEK-293T cell-derived media (at different dilutions). After overnight incubation, 20 μl of medium was removed from each well and incubated for 30 minutes at 37 ° C. in the presence of 180 μl Quanti-Blue reagent (InvivoGen, San Diego, Calif.). Absorption was measured at 620 nm using a spectrophotometer. To generate a standard curve, 180 μl of Quanti-Blue reagent at 20 μl of recombinant at the following concentrations of 500, 250, 125, 62.5, 31.25, 15.62, 7.8 and 3.9 pg / ml. Mixed with IL12. Functional IL12 concentration was determined by comparing the optical density of each sample to the IL12 standard curve. Measurable levels of functional IL12 were reached with a 640-fold dilution of growth medium containing IL12, reaching a further plateau in high concentration medium (FIG. 19A).

  The dependence of functional IL12 production on the dose of Shield-1 used was measured. 10,000 HEK293T cells stably transduced with OT-IL12-004 were seeded in a 96 well plate, 10, 3.33, 1.11, 0.37, 0.12, 0.04, 0. Treatment with growth medium containing 0.01, 0.005, 0.002 or 0 μM Shield-1 for 24 hours. Following Shield-1 treatment, cell-derived medium was diluted 200-fold and 20 μL of the diluted medium was added to HEK Blue sensor cells. After overnight incubation, 20 μl of medium was removed from each well and incubated for 30 minutes at 37 ° C. in the presence of 180 μl Quanti-Blue reagent (InvivoGen, San Diego, Calif.). Absorption was measured at 620 nm using a spectrophotometer. To generate a standard curve, 180 μl Quanti-Blue reagent at 20 μl recombination at the following concentrations 500, 250, 125, 62.5, 31.25, 15.62, 7.8 and 3.9 pg / ml. Mixed with IL12. Functional IL12 concentration was determined by comparing the optical density of each sample to the IL12 standard curve. A dose-dependent increase in functional IL12 levels was observed (Figure 19B).

Example 4. Expression of DD-regulated recombinant IL12 in vivo SKOV3 tumor cells or parental cells expressing FBP-regulated IL-12 (# OT-IL12-009) were transplanted into SCID beige mice (day 0). Mice transplanted with FKBP IL12 were treated with Shield-1 (10 mg / kg) or vehicle control intraperitoneally on days 2 and 7, while parental cells remained untreated. Blood samples were collected at 0, 2, 4, 6, 8, 24 hours after Shield-1 administration and plasma human IL12 levels were measured using ELISA. Mean adjusted concentrations of plasma IL12 are shown in Figure 19C. On day 2, Shield-1 treatment increased IL12 levels and was higher at 4, 6, 8 and 24 hours than vehicle controls. Maximum IL12 levels were detected in Shield-1 treated mice 8 hours after treatment. In contrast, at day 7, IL12 levels were very low, about the same as IL12 levels in parental SKOV3 cells.

  The experiment was repeated 28 days after implantation of SKOV3 tumor cells. Mice were divided into 3 groups and the groups were dosed with the ligand or vehicle control once, twice or three times. Mice received multiple doses at 2 hour intervals. Blood samples were collected immediately before the first dose (0 hours) and 6 and 24 hours after the first dose. Plasma IL12 levels were measured and the average IL12 concentration is shown in Figure 19D. The two-dose and three-dose schemes resulted in higher plasma IL12 levels when compared to vehicle treated samples. In all dosing schemes, peak plasma IL12 levels were detected 6 hours after shield-1 treatment, with the highest IL12 plasma levels detected in the three dose regimen. This indicates ligand-dependent stabilization of IL12 in vivo.

Example 5. DD regulated IL15
To test ligand-dependent IL15 production, 1 million HEK-293T cells were seeded in 6-well plates in growth medium containing DMEM and 10% FBS and incubated overnight at 37 ° C. with 5% CO 2. . Cells were then transfected with 100 ng of OT-IL15-001 (constitutive) or OT-IL15-002 (ecDHFR-IL15) using Lipofectamine 2000 and incubated for 48 hours. After incubation, medium was replaced with growth medium containing 10 μM trimethoprim or vehicle control and incubated for a further 24 hours. Media was harvested and undiluted samples or samples diluted 4, 16, 256, 1024, 4096, or 16384 times were tested using the human IL15 ELISA. Stabilization ratio was defined as the fold change in IL15 expression upon ligand treatment compared to treatment with DMSO using the same construct (ie in the absence of ligand). Stabilization ratios greater than 1 are desirable. Average IL15 ELISA measurements and stabilization ratios are shown in Table 20.

  The 16-fold, 4-fold diluted, and undiluted media samples showed stabilization ratios above 1.5, suggesting trimethoprim-dependent stabilization of IL15 at these dilutions.

Example 6. DD regulated expression of IL15-IL15Ra fusion molecules Fusion molecules fuse membrane-bound IL15, IL15 receptor α subunit (IL15Ra) and DD such as ecDHFR (DD), FKBP (DD), or human DHFR (DD). It is generated by These fusion molecules were cloned into the pLVX-EF1a-IRES-Puro vector.

  To test ligand-dependent IL15-IL15Ra production, 1 million HEK-293T cells were seeded in 6-well plates in growth medium containing DMEM and 10FBS and incubated overnight at 37 ° C, 5% CO2. . Then, using Lipofectamine 2000, 100 ng of constitutive IL15-IL15Ra (OT-IL15-008) or DD-linked IL15-IL15Ra (OT-IL15-006, OT-IL15-007, OT-IL15-009) was added to the cells. OT-IL15-010, OT-IL15-011) was transfected and incubated for 24 hours. After incubation, medium was replaced with growth medium in the presence or absence of 10 μM trimethoprim or 1 μM Shield-1 and incubated for a further 24 hours. Cells were harvested and analyzed for IL15 levels by Western blotting using human IL15 antibody (Abeam, Cambridge, UK). OT-IL15-009 showed potent ligand (trimethoprim) -dependent IL15 stabilization, OT-IL15-006 and OT-IL15-007 showed moderate ligand-dependent IL15 stabilization (Fig. 20A).

  The surface expression of the membrane-bound IL15-IL15Ra constructs (OT-IL15-006, OT-IL15-007, OT-IL15-008, OT-IL15-009, OT-IL15-010, OT-IL15-011) was compared with anti-IL15. And FACS using anti-IL15Ra antibody. HEK293T cells were transfected with the IL15-IL15Ra construct and treated with the appropriate ligand (Shield-1 or trimethoprim). 48 hours after transfection, cells were analyzed using FACS. As expected, the constitutive IL15-IL15Ra construct OT-IL15-008 showed high surface expression of IL15 and IL15Ra both in the presence and absence of ligand. Consistent with the Western blot results, OT-IL15-009 showed potent ligand (trimethoprim) -dependent surface expression of IL15 and IL15Ra (FIGS. 20B, 20C).

  The membrane-bound IL15-IL15Ra constructs (OT-IL15-008 to OT IL15-011) were transduced into the human colorectal cancer cell line HCT-116 and stable integrants were selected with 2 μg of puromycin. The stably integrated cells were then incubated for 24 hours in the presence or absence of 10 μM trimethoprim or 1 μM methotrexate.

Surface expression of the IL15-IL15Ra fusion construct was examined by staining with PE-conjugated IL15Ra antibody (catalog number 330207, Biolegend, San Diego, CA). Median fluorescence intensities obtained with different constructs in the presence or absence of the corresponding ligand are shown in Table 21.

Stabilization ratio was calculated as the fold change in GFP intensity of ligand-treated samples compared to treatment with DMSO (ie, in the absence of ligand) using the same construct. The destabilization ratio was calculated as the fold change in GFP intensity in the DD-regulated construct compared to the constitutive construct (OT-IL15-008) in the absence of ligand. For DD, a destabilization ratio of less than 1 and a stabilization ratio of greater than 1 are desirable. The ratio is shown in Table 22.

  A destabilization ratio of less than 1 was observed for OT-IL15-006 (ecDHFR (R12H, E129K)) and OT-IL15-011 (hDHFR (Q36F, N65F, Y122I)), indicating a strong instability in the absence of ligand. Stabilization was shown. Stabilization ratios of greater than 1 were observed for all TMP treated constructs and for both MTX treated OT-IL15-010 and 11. These data indicate that both OT-IL15-006 and OT-IL15-011 are strongly destabilized in the absence of ligand and strongly stabilized in the presence of ligand.

  Expression and ligand-dependent stabilization of IL15-IL15Ra constructs (OT-IL15-008 to OT-IL15-011) were measured with HCT-116. Cells were incubated for 24 hours in the presence of 10 μM trimethoprim or 1 μM methotrexate or DMSO. After the incubation, the cells were collected and a cell extract was prepared. Cell extracts were electrophoresed on SDS-PAGE and Western blotted with anti-IL15 antibody (catalog number 7213, Abcam, Cambridge, UK). As shown in FIG. 20D, the IL15 / IL15Ra constitutive construct (OT-IL15-008) exhibits ligand-independent IL15 expression, while the DD-regulated constructs (OT-IL15-009 to OT-IL15-011). Showed ligand-dependent IL15 expression. The identity of the IL15 band was also confirmed by immunoblotting with anti-human DHFR antibody (catalog number 117705, Genetex, Irvine, CA). As shown in FIG. 20D, both IL15-IL15Ra fusion constructs (OT-IL15-010 and 011) showed ligand-dependent expression of DHFR expression.

To assess the dose-dependence of ligand-induced stabilization, IL15-IL15Ra fusion constructs, OT-IL15-009 (ecDHFR (R12Y, Y100I)), OT-IL15-010 (hDHFR (Y122I, A125F)), and HCT-116 cells were stably transduced with OT-IL15-011 (hDHFR (Q36F, N65F, Y122I)) and incubated for 24 hours with increasing concentrations of trimethoprim. Surface expression of the IL15-IL15Ra fusion construct was quantified by FACS using the IL15Ra-PE antibody. Table 23 shows the median value of the fluorescence intensity when the dose of TMP was increased.

  As shown in Table 23, all three constructs showed a dose-dependent increase in median fluorescence intensity, indicating that the addition of DD stabilizing ligands resulted in a dose-dependent increase in surface expression of the IL15-IL15Ra fusion. It was

The time course of ligand-dependent stabilization of the IL15-IL15Ra fusion construct was measured in HCT-116 cells. Cells were transduced with the OT-IL15-009 (ecDHFR (R12Y, Y100I) construct and incubated in the presence of 10 μM trimethoprim for 0, 12, 16, 24, 48 or 72 hours After incubation, the IL15-IL15Ra fusion construct. Was expressed by FACS using IL15Ra-PE antibody and compared to parental non-transfected cells, median fluorescence intensity (MFI) over time is shown in Table 24.

  As shown in Table 24, OT-IL15-009 (ecDHFR (R12Y, Y100I) showed a time-dependent increase in median fluorescence intensity, with the surface of the IL15-IL15Ra fusion increasing with the duration of treatment with DD stabilizing ligands. It was shown that the expression was increased.

Embodiment 7 FIG. DD regulated CD19 CAR expression The CD19 CAR fusion polypeptide was ligated to either FKBP-DD, ecDHFR-DD or human DHFR-DD and the construct cloned into the pLVX-IRES-Puro vector.

  FKBP, ecDHFR and hDHFR DD have a CD8α hinge and a transmembrane domain (OT-CD19C-004, OT-CD19C-005) between the CD19 scFv and the CD8α hinge (OT-CD19C-002, OT-CD19C-003). Either in between or at the C-terminus of the construct (OT-CD19C-007, OT-CD19C-008, OT-CD19C-009, OT-CD19C-010, OT-CD19C-011). In some examples, a furin cleavage site was added between DD and CD19 scFv. The constitutively expressed CAR construct, OT-CD19C-001, was used as a positive control.

  To test the ligand-dependent expression of the DD-CD19 CAR construct, 1 million HEK293T cells were cultured in growth medium containing DMEM and 10% FBS and transfected with the CAR construct using Lipofectamine 2000. . Forty-eight hours after transfection, cells were treated with 1 μM or 10 μM Shield-1, 10 μM trimethoprim, 1 μM methotrexate, or vehicle control and incubated for 24 hours. Cells were harvested, lysed, and anti-CD247 (BD Pharmingen, Franklin Lanes, NJ) and Alexa555-conjugated goat anti-mouse antibody (red) (Li-Cor, Lincoln, NE) were used to CD3ζ, a component of CAR. It was immunoblotted. In addition, the lysate was immunoblotted against actin with Alexa488-conjugated secondary antibody (green) to confirm uniform protein loading in all samples. Compared to untreated controls, OT-CD19C-002 and OT-CD19C-003 showed increased levels of CD3ζ in the presence of the ligands Shield-1 and TMP, respectively, indicating stabilization of CD19 CAR. (FIG. 21A). As shown in FIG. 21B, the OT-CD19C-008 and OT-CD19C-010 constructs showed a strong increase in CD3ζ levels in the presence of methotrexate, low levels in the absence of ligand, and strong ligands of CD19 CAR. Dependency stabilization was shown. OT-CD19C-007 and OT-CD19C-009 showed moderate increase in CD3ζ levels in the presence of Shield-1 and methotrexate, respectively, indicating moderate ligand-dependent stabilization of CD19 CAR. . As expected, the constitutively expressed OT-CD19C-001 showed strong expression of CD19 CAR in the absence of ligand treatment.

  Lysates from cells expressing the CD19 CAR construct were also immunoblotted against 41-BB, a component of CAR. As shown in FIG. 21C, OT-CD19C-008, OT-CD19C-009, OT-CD19C-010 and OT-CD19C-011 have low levels of 4-1 BB in the absence of ligand, the ligand methotrexate. Showed a high level of 4-1 BB in the presence of A, and showed strong ligand-dependent stabilization of CD19 CAR using these constructs. OT-CD19C-003, OT-CD19C-006, and OT-CD19C-007 show a moderate increase in 4-1BB expression levels upon treatment with the corresponding ligands TMP and Shield-1, and CD19 CAR moderate. Was shown to have a ligand-dependent stabilization of. Constructs OT-CD19N-014 and OT-CD19N-015 containing the furin cleavage site showed an even smaller 41 BB size protein product upon treatment with MTX. This small size band of the 4-1BB protein was observed only when the ligand was added, and its molecular weight is consistent with the size of the CD19 CAR of OT-CD19-001. These data indicate that furin cleavage occurs only in the presence of ligand treatment.

Surface expression of the DD-CD19 CAR construct in HEK293T cells was performed using fluorescence labeled cell sorting (FACS) using protein L-biotin-streptavidin-allophycocyanin (ThermoFisher Scientific, Waltham, MA) that binds to the CAR kappa light chain. Was measured using. Cells were treated with 1 μM Shield-1, 1 μM methotrexate, 10 μM trimethoprim or vehicle control for 24 hours and subjected to FACS analysis. As shown in FIG. 21D, surface expression of OT-CD19C-002 using FKBP-DD was detected only in the presence of Shield-1, while OT-CD19C-003 using ecDHFR-DD showed the presence of trimethoprim. Surface expression was shown only below. As expected, the constitutive expression construct OT-C19C-001 showed high expression in both ligand-treated and control vehicle-treated cells. In a separate experiment, additional constructs were analyzed by FACS with protein L-biotin-streptavidin-allophycocyanin. The percentage of GFP-positive cells obtained with each construct in the presence or absence of ligand is shown in Table 25. In Table 25, N / A indicates not applicable.

  An increase in the percentage of GFP-positive cells is due to OT-CD19C-007, OT-CD19C-008, OT-CD19C-009, OT-CD19C-010, OT-CD19C-011, OT-CD19C-014, and OT-CD19C-. Observed at 015. The greatest increase in the percentage of GFP-positive cells was observed with the OT-CD19C-014, and OT-CD19C-015 constructs.

The average fluorescence intensity is shown in Table 26. In Table 26, MFI stands for mean fluorescence intensity. Stabilization ratio was calculated as the fold change in GFP intensity of ligand-treated samples compared to treatment with DMSO (ie, in the absence of ligand) with the same construct. The destabilization ratio was calculated as the fold change in GFP intensity in the DD regulated construct compared to the constitutive construct (OT-CD19C-001) in the absence of ligand. A destabilization ratio less than 1 and a stabilization ratio greater than 1 are desirable.

  A destabilization ratio of less than 1 was observed for all constructs, indicating that all DD-regulated constructs were destabilized in the absence of ligand. Stabilization ratios greater than 1 were observed for OT-CD19C-008, OT-CD19C-009, OT-CD19C-010, OT-CD19C-011, OT-CD19C-014 and OT-CD19C-015. Notably, these constructs were also destabilized in the absence of ligand, indicating a suitable CD19-DD construct.

Example 8. In Vitro T Cell Assay Development The goal of this study was to determine the T cell stimulating regimen and IL12 dose required to maximize T cell persistence and T cell differentiation in vitro. This study summarizes the design of an adoptive cell therapy regimen in which T cells are first exposed to antigen in vitro, resulting in activation and subsequent resting phase, and finally in the T cells re-encountering antigen. results in in vivo transfer. T cells were stimulated with CD3 / CD28 beads or soluble CD3 / CD28 on day 0 and CD3 / CD28 stimulators were washed out at the end of 48 hours. Cells were treated with doses of IL12 ranging from 0.01 to 1000 ng / mL. On day 9, the Th1 phenotype of the cells was assessed by examining the frequency of IFNγ-positive CD4 + and CD8 + cells. On day 14, cells were divided into two groups, one group receiving a second CD3 / CD28 stimulation and the second group unstimulated. On day 16, Th1 phenotype was assessed in both groups using FACS. The results on day 16 are shown in FIG. IFNγ expression was higher in cells that received CD3 / CD28 restimulation at day 14 compared to cells that did not receive the second stimulation. This indicates that the Th1 phenotype requires both antigen restimulation and IL12 exposure. Furthermore, only 0.1 ng / mL IL12 caused Th1 skewing and IFNγ production from T cells in vitro, and higher doses of IL12 further enhanced this effect.

Example 9. Measurement of human T cell responses in vitro and in vivo IL12 promotes the differentiation of naive T cells into Th1 cells, leading to the secretion of IFNγ from T cells. Human T cells were treated with IL12 or left untreated and analyzed by flow cytometry for expression of IFNγ and the T cell marker CD3. Treatment with IL12 resulted in T cell differentiation as measured by an increase in the percentage of IFNγ positive T cells from 0.21 to 22.3 (see inset in Figure 23A).

  To test whether the membrane-bound IL15 / IL15Ra fusion protein (OT-IL15-008) was able to induce human T cell proliferation, human T cells were transduced with the construct. T cell proliferation was measured by evaluating the forward and side scatter of the T cell population using flow cytometry. Transduction with the membrane-bound IL15 / IL15Ra fusion construct increased human T cells (58.9) compared to the non-transfected cell control (37.8) (FIG. 23B).

Tracing of T cells after adoptive transfer is important to determine their distribution at different sites in the host, their identity and persistence over time. Human T cells were stimulated with CD3 / CD28 beads and incubated in the presence of 50 U / ml IL2. Cells were grown in vitro for 7 days supplemented with IL2 on days 3 and 5. On day 5, CD3 / CD28 beads were removed and cells were cultured for 2 days. On day 7, cells were washed to remove IL2 and 5 million human T cells were immunodeficient NOD. Cg-Prkdc ^scid Il2rg ^tm1Wjl / SzJ mice were injected intravenously. Blood samples were taken at 4, 24, 120 and 168 hours after cell transplantation. Mice were euthanized 168 hours after cell transplantation and bone marrow and spleen were harvested. Immune cells were isolated from all samples and analyzed for the presence of human T cells using the CD3 and CD45 cell surface markers. As shown in FIG. 23C, in the animals injected with human T cells, the percentage of blood CD3-positive and CD45-positive human T cells was particularly high at 120 and 168 hours. CD3-positive and CD45-positive human T cells were also detected in the spleen and bone marrow of animals injected with human T cells. As expected, CD3 +, CD45 + human T cells were not detected in control animals that were not injected with human T cells.

  Blood samples were taken from mice 48 hours after injection to determine the identity of T cells after adoptive transfer. CD4 and CD8 T cells were analyzed for surface expression of CD45RA and CD62L. Both markers are highly expressed on naive T cells but are lost upon exposure of T cells to antigen. As shown in FIG. 23D, human CD4 and CD8 T cells showed high surface expression of both markers prior to injection into mice, but were lost 48 hours after in vivo cell transplantation, and human T cells were lost. It was shown to be exposed to the antigen in vivo.

Example 10. DD-regulated IL12-mediated function Establish tumors and evaluate the ability of tumor cells to express these constructs to grow under treatment with corresponding synthetic ligands, such as Shield-1, trimethoprim or methotrexate. Thereby characterizing the function of DD-IL12 in vivo. Two to ten million HCT-116 cells stably transduced with the construct are subcutaneously xenografted with 50 Matrigel into mice capable of producing functional B and NK cells. Approximately 2 weeks after injection, when the tumor reaches a size of approximately 300 cubic mm, the corresponding stabilizing ligands such as Shield-1, trimethoprim or methotrexate are administered to the mice every 2 days at various concentrations. Shield-1 is infused with a carrier consisting of 10 dimethylacetamide, 10 Solutol HS15, and 80 saline. Tumor volume and body weight are monitored twice a week and the experiment is terminated when the tumor size reaches 1000 cubic mm. Plasma and tumor samples are taken 8 hours after the last dose of ligand and IL12 to measure ligand levels.

  To assess the tumorigenic potential of IL12-expressing cells, HCT-116 cells stably transduced with the DD-IL12 construct were pretreated with the corresponding stabilizing ligand, Shield-1, trimethoprim or methotrexate, followed by mice. Xenograft. Decreased tumor growth and concomitant increase in IL12 levels in ligand-treated mice as compared to untreated controls indicate conditional regulation of IL12 in vivo.

Example 11. Function via DD-regulated recombinant IL12 in T cells The functional response to DD-IL12 is evaluated in primary human T cells and human / transformed hematopoietic cell lines, eg Raji cells. Human T cells are purified from peripheral blood mononuclear cells (PBMC) by negative selection using the CD4 + T cell separation kit (Miltenyi Biotec, Germany). T cells are treated with the growth medium of HEK293 T cells expressing the DD-IL12 construct for 5 days. Cells are then activated with beads conjugated to CD3 / CD28 beads (Thermo Fisher Scientific, Waltham, MA) at a ratio of 3 beads per T cell and cultured for 3 days. After treatment with ligand or vehicle control, flow cytometry is used to determine the functional response to DD-IL12 by measuring interferon-gamma in CD3-positive cells. IL12 promotes the differentiation of naive T cells to Th1 cells and causes IFNγ to be secreted from T cells.

  To assess IL12-induced phosphorylation of STAT4 (signal transduction and transcriptional activator 4), human T cells were isolated from PBMCs, activated with phytohemagglutinin (PHA, 2 μg / ml) for 3 days, then 50 IU / Treat with ml of Interleukin 2 (IL2) for 24 hours. The cells are then washed, resuspended in fresh medium and left in the presence of ligand or vehicle control for 4 hours. Supernatants from HEK293T cells expressing DD-IL12 are added to the primary cells and then incubated for 30 minutes. Cells are then harvested and analyzed for STAT4 phosphorylation using the STAT4 antibody (Cell Signaling Technology, Danvers, MA).

Example 12. Functional analysis of DD-regulated IL15-IL15Ra fusion molecules IL15-mediated activation can maintain T cell persistence by conferring survival advantage. Furthermore, the IL15 / IL15Ra fusion molecule has been shown to confer a memory phenotype on T cells and increase NK cell proliferation (Hurton (2016), PNAS, 113: E7788-7797; Incorporated herein by reference in its entirety).

  To assess signaling by the DD-regulated IL15-IL15Ra fusion construct, NK-92 cells are incubated with HCT-116 cells expressing the DD-regulated IL15-IL15Ra fusion construct. Transsignaling by IL15 / IL15Ra is expected to increase STAT5 phosphorylation of NK92, which is measured by Western blotting and FACS. Proliferation of NK92 cells is also measured.

  To assess the effect of the DD-regulated IL15-IL15Ra fusion construct on primary T cells, cells are transduced with the fusion construct. T cell proliferation in the absence of exogenous IL15 supplementation is measured. T cell memory phenotype is measured by quantifying CD62L expression by FACS.

  To assess whether T cells expressing DD-IL15 / IL15R maintain long-term persistence in vivo, mice are injected with DD-modified T cells. The construct is tagged with the luciferase reporter, which allows in vivo tracking in mice. Depending on the construct utilized, mice are treated with vehicle control or the corresponding ligand, Shield-1, trimethoprim or methotrexate and monitored using bioluminescence imaging (PerkinElmer, Massachusetts) for 40-50 days. Mice treated with ligand are expected to retain T cells expressing DD-IL15 / IL15Ra, whereas T cells from animals treated with vehicle control are not expected to persist.

Example 13. DD regulated CD19 CAR expression and function in T cells The ligand-dependent expression of DD-CD19 CAR constructs was evaluated in primary human T cells and immortalized / transformed hematopoietic cell lines such as Raji cells, Jurkat cells, and K562 cells. To do. Human T cells are purified from peripheral blood mononuclear cells (PBMC) by negative selection using the CD4 + T cell separation kit (Miltenyi Biotec, Germany). Primary T cells and hematopoietic cell lines are stably transduced with the DD-CD19 CAR construct. Cells are treated with 10 μM Shield-1, 10 μM trimethoprim, 1 μM methotrexate or vehicle control and immunoblotted for CD3ζ using anti-CD247 antibody.

  Production of functional DD-CD19 CAR is analyzed in primary human T cells or human cell lines (NALM6, K562, Jurkat and Raji cells). Cells are incubated with CD19-expressing antigen presenting cells or CD19 / Fc fusion proteins in the presence of the DD stabilizing ligands Shield-1, TMP or MTX. After incubation, cells are stained with fluorescently labeled anti-CD69 antibody and analyzed by flow cytometry. Cells with high expression of CD69 are thought to have a functional DD-CD19 CAR. Functional response to DD-CD19 CAR is also determined by measuring interferon gamma levels using an ELISA. DD-CD19 CAR expressing cells are expected to show higher interferon gamma levels in the presence of ligand than untreated cells.

The cytolytic capacity of DD-CD19 CAR expressing cells is assessed in primary human T cells or human cell lines (eg NALM6, K562 and Raji) using a chromium-51 release assay. Target cells are loaded with Na ₂ ⁵¹ CrO ₄ and washed twice and resuspended in growth medium without phenol red. Untreated or ligand-treated DD-CD19 CAR and mock-transduced cells are co-incubated with CD19-expressing target cells at various effector: target cell ratios and chromium release into the supernatant is measured using a liquid scintillation counter. . Cells bearing the DD-CD19 CAR are expected to show specific cytolysis only in the presence of ligand. Cells with DD-CD19 CAR or mock-transfected cells in the absence of ligand are expected to show minimal cytolytic activity.

  The in vivo antitumor effect of DD-CD19 CAR is also evaluated. Immunodeficient mice are injected with a human leukemia cell line expressing luciferase (NALM-6). Then, the mice are injected with DD-CD19 CAR T cells by tail vein injection. Mice are subdivided into treatment groups and treated with various ligand doses. Two control groups are also included in the study: a control group that did not receive any ligand and another group that did not receive any T cells. Tumor burden as measured by luciferase activity is monitored over time using bioluminescence imaging. Mice treated with DD-CD19 CAR T cells and ligand are expected to have reduced tumor burden when compared to control animals.

Example 14. Assessment of DD Tumor Payload Antitumor Response in Syngeneic Mouse Models The efficacy of cancer immunotherapy in organisms with intact immune cells is assessed using syngeneic mouse models, such as the pMEL-1 and 4T1 mouse models. Immune cells such as T cells and NK cells are isolated from syngeneic mice and transduced with DD-regulated payloads such as DD-IL12, DD-IL15, DD1L15-IL15Ra, and DD-CD19 CAR. The cells are then injected into mice bearing subcutaneous syngeneic tumors and treated with various concentrations of ligand, Shield-1, trimethoprim or methotrexate, depending on the DD used. Mice treated with immune cells transduced with DD regulatory payloads are expected to have reduced tumor burden when compared to control animals.

Example 15. Optimization of workflow for discovery of DD-regulated immunotherapeutics To identify DD-CD19 CAR constructs suitable for immunotherapy, the constructs are introduced into cell lines such as HEK293T cells and Jurkat cells. The expression of the construct is tested in the presence or absence of the corresponding ligand. Constructs showing low basal expression in the absence of ligand and robust ligand-dose responsive expression are selected for further analysis. If no DD-CD19 CAR constructs exhibit ligand-dependent expression, redesign the constructs and repeat the experiment until regulatable constructs are identified. The ligand-dependent regulation of the DD-CD19 CAR construct is then tested in vitro on primary T cells. If the constructs show low basal and ligand-dose responsive expression in the absence of ligand, they are subjected to in vivo PK / PD demonstration experiments. Otherwise, the construct is redesigned and the new construct is subjected to similar analysis. The constitutively expressed CD19 CAR construct is transduced into T cells and CD19 CAR expression is measured in parallel with the regulated construct. If no expression is detected in vitro, refocus on testing the DD-CD19 CAR construct in T cells in vitro. In contrast, when the constitutive construct shows expression, the expression of CD19 CAR is measured in vivo.

  To test in vivo PK / PD, mice are injected with T cells expressing the DD-CD19 CAR construct and a ligand corresponding to DD is administered to the test group, while the control group receives an appropriate vehicle control. Administer. Constructs showing ligand-dependent expression of CD19 CAR are selected for demonstration experiments of in vivo function. Parallel experiments are also performed using the constitutive CD19 CAR construct. Constructs are selected for functional experiments if constitutive CD19 CAR expression is detected in vivo. If no expression is detected in vivo, redesign the construct.

  In vivo functional analysis is performed by testing whether constitutive and DD-regulated CD19 CAR expressing T cells exhibit antitumor activity in a constitutive or ligand dependent manner, respectively. If active, proof-of-concept in vivo is achieved and constructs suitable for immunotherapy are identified. If none of the DD-regulated constructs show antitumor activity, an alternative dosing regimen is considered. If the constitutive CD19 CAR construct does not show anti-tumor activity, then we focus on identifying the DD-CD19 CAR construct that shows expression in T cells in vivo.

Example 16. Co-expression of DD-regulated payloads The toxicity associated with systemic administration of interleukins can be avoided by using CAR-T cells to deliver interleukins to target tissues. This combinatorial approach also has superior antitumor activity over interleukin and CAR therapies alone. Cells are co-transfected with CD19 CAR (constitutive or DD regulated) and DD-interleukins such as DD-IL12, DD-IL15, and DD-IL15 / IL15Ra constructs. The transfected cells are treated with stabilizing ligand depending on the DD utilized. CD19 CAR expression is assessed by immunoblotting of CD3ζ. The expression of DD-IL12, DD-IL15 and DD-IL15 / IL15Ra in the medium is measured by ELISA.

Example 17. Expression and function of CAR in T cells Primary T cells were transduced with the CD19 CAR construct. Surface expression of CD19 CAR constructs using fluorescent labeled cell sorting (FACS) using protein L-biotin-streptavidin-allophycocyanin (ThermoFisher Scientific, Waltham, MA) that binds to the kappa light chain of CAR. It was measured. Cells were analyzed with anti-CD4, anti-CD8 antibodies and protein L to determine the percentage of CD4 and CD8 subpopulations of CAR T cells. As shown in FIG. 24A, 67.3% of the obtained CAR positive cells were CD4 positive, while only 14.2% of the cells were CD8 positive.

  To test the ability of CD19 CAR cells to kill target cells, OT-CD19N-001 or OT-CD19N-017 transduced primary T cell populations were treated with CD562-expressing K562 cells (target cells) 5: Co-cultured at a ratio of 1. An additional control combination of T cells and target cells was also set up. These included CAR expressing T cells co-cultured with K562 cells, T cells co-cultured with K562 cells expressing CD19, and K562 cells expressing CD19 without co-culture with T cells. K562 cells were fluorescently labeled with NucLight Red and co-cultured with T cells for 30 hours. Cell death was monitored by labeling cells with Annexin V and K562 target cell death was measured by assessing Annexin V staining on NucLight Red positive cells. The ratio of Annexin V staining per target cell area was calculated. As shown in FIG. 24B, T cell expressing OT-CD19N-001 or OT-CD19N-017 was effective in killing target K562 cells expressing CD19. When non-transduced T cells were co-cultured with CD19-expressing target cells, low levels of target cell killing were observed. As expected, co-culture of T562 cells expressing OT-CD19N-001 with K562 cells (no expression of CD19) resulted in minimal cell death. These data indicate that CD19 CAR cells are effective in killing the corresponding target cells.

Example 18. IL15-IL15Ra regulated expression in T cells A DD regulated IL15-IL15Ra construct such as OT-IL15-009 or a constitutively expressed construct such as OT-IL15-008 was added to T cells such as primary T cells or SupT1 cells. Transduced. The Lentiboost ™ (Sirion Biotech, Germany) was used to transduce DD-regulated constructs at two different lentivirus concentrations of 5 μl and 20 μl. Four days after transduction, cells were treated with 10 μM TMP or DMSO control for 24 and 48 hours. Samples were analyzed with anti-IL15Ra antibody using FACS. Additional control samples such as cells treated with Lentiboost alone, non-transduced cells treated with DMSO or TMP, and isotype controls were included in the FACS analysis. The FACS results are shown in Figure 25A for the 24 hour TMP treatment and in Figure 25B for the 48 hour TMP treatment. In both figures DMSO-A and TMP-A represent cells treated with 5 μl of lentivirus and DMSO-B and TMP-B represent cells treated with 20 μl of lentivirus. Treatment of T cells expressing OT-IL15-009 with TMP for 24 hours increased the expression of IL15Ra in T cells at both doses of lentivirus used. Moreover, very low levels of IL15Ra were detected in DMSO treated samples and non-transduced T cells under the same conditions. As expected, the constitutively expressed construct OT-IL15-008 showed high expression of IL15Ra. No TMP-dependent expression of OT-IL15-009 was observed in SupT1 cells (FIG. 25A). Similar results were observed at 48 hours with both T cells and SupT1 cells (FIG. 25B). These results indicate that tight regulation of the IL15-IL15Ra construct can be achieved in primary T cells.

Surface expression of IL15 and IL15Ra was measured for OT-IL15-008 and OT-IL15-009. Table 27 shows the percentage of cells expressing IL15, IL15Ra or both on the cell surface.

  As shown in Table 27, the percentage of cells with detectable surface expression of IL15 and IL15Ra was less than 5% for both constructs. Furthermore, the percentage of cells with surface expression of IL15Ra was much higher than the percentage of cells with detectable surface expression of IL15.

  The OT-IL15-009 construct was used to measure the effect of increasing doses of TMP on IL15Ra expression in T cells. T cells were treated with a dose of TMP ranging from 0.156 μM to 160 μM for 24 hours. IL15Ra expression was measured using FACS. As shown in FIG. 25C, the proportion of IL15Ra-expressing T cells including OT-IL15-009 cells was also detected at the lowest concentration of TMP, and the proportion of IL15Ra-positive cells at the lowest concentration of TMP was higher than that of the untreated control. It was The percentage of IL15Ra cells increased with increasing dose of TMP.

Example 19. IL-15-IL15Ra TMP Dose-Responsive Expression IL15-IL15Ra fusion constructs OT-IL15-008, OT-IL15-009 in HCT116 cells treated with increasing doses of TMP ranging from 10 μM, 33 μM, and 100 μM TMP for 24 hours. , And OT-IL15-010 were stably expressed. Cell lysates were immunoblotted with anti-IL15Ra antibody. As shown in FIG. 26, IL15Ra expression of OT-IL15-009 was virtually undetectable in the absence of TMP, and addition of increasing doses of TMP increased IL15Ra levels. A moderate increase in IL15Ra expression was observed in the OT-IL15-010 construct supplemented with TMP. As expected, the constitutive construct, OT-IL15-008, showed strong expression of IL15Ra both in the presence and absence of ligand.

Example 20. Effect of IL15-IL15Ra on T cell persistence and T cell memory phenotype The effect of the constitutively expressed IL15-IL15Ra fusion construct, OT-IL15-008, on T cell persistence was measured in NSG mice. T cells were transduced with OT-IL15-008 and 4 million T cells were injected intravenously into NSG mice (number of mice = 3). As a control, additional mice were injected with non-transduced T cells. Blood samples were taken from mice at 2, 3, 4, 5 and 6 weeks post injection and analyzed by FACS for the presence of CD8 and / or CD4 positive human T cells expressing IL15 and IL15Ra. Percentage of human T cells in blood as a percentage of total T cells, ie human T cells (measured using anti-human CD45 antibody) and mouse T cells and endothelial cells (measured using anti-mouse CD45 antibody) I calculated. As shown in FIG. 27A, in the mice injected with T cells transduced with OT-IL15-008, the proportion of T cells in blood at 2 weeks was higher than that in control mice injected with non-transduced T cells. It was great. This observed increase in T cells decreased over 3, 4, and 5 weeks, and the proportion of T cells was comparable between the two cohorts. At 6 weeks, one of the mice injected with OT-IL15-008 transduced T cells had a high percentage of human T cells in the blood. Thus, at week 2, the frequency of human T cells in the blood increases in the blood of mice injected with T cells transduced with OT-IL15-008.

  By comparing the number of human T cells in 50 uL of mouse blood using anti-human CD45 antibody as a marker for human T cells and anti-mouse CD3 antibody as a marker for mouse endothelial cells The number was measured. As shown in FIG. 27B, the number of human T cells in blood was higher at 2 weeks in mice injected with T cells transduced with OT-IL15-008 than in mice injected with non-transduced T cells. Increased. The difference between the two cohorts decreased at 3 and 4 weeks. At 6 weeks, one of the mice injected with OT-IL15-008 transduced T cells showed more human T cells in the blood. Therefore, at the second week, the frequency and number of human T cells in the blood increases in the blood of mice injected with T cells transduced with OT-IL15-008. These data support a role for the IL15-IL15Ra fusion protein in T cell persistence. The increased frequency and number of T cells observed at 6 weeks in one mouse may be due to graft-versus-host disease.

  The effect of OT-IL15-008 expression on the CD4 and CD8 subsets of T cells was measured before (week 0) and 2 weeks after injection into mice. As shown in Figure 27C, the ratio of CD4 cells to CD8 cells was 1: 1 before injection into mice. However, at 2 weeks, the proportion of CD4-positive cells in transduced cells was much higher than that of CD8-positive cells, indicating that OT-IL15-008 causes preferential proliferation of CD4-positive cells. Expression of the OT-IL15-008 construct within the CD4 and CD8 subsets was measured using an anti-IL15Ra antibody. As shown in FIG. 27D, 25% of OT-IL15-008 transduced CD4 and CD8 T cells expressed IL15Ra prior to injection. At week 2, the proportion of IL15Ra-positive CD4 and CD8 T cells increased to 80%, indicating preferential proliferation of OT-IL15-008 transduced T cells. As expected, non-transduced control T cells were negative for IL15Ra expression.

Example 21. IL12-dependent restimulation-independent Th1 marker T cells require T cell receptor restimulation with CD3 / CD28 in vivo or in vitro stimulation to produce IFNγ. To study the effect of IL12 activity on T cells in the absence of restimulation, several T cell markers were investigated. T cells were expanded using any of the following four expansion strategies (i) cytokine switching from IL2 to IL12 on day 10, CD3 / CD28 stimulation from day 0 to day 10, no restimulation (Ii) Cytokine switching from IL2 to IL12 on day 10, CD3 / CD28 stimulation from day 0 to day 10 and restimulation with CD3 / CD28 from day 12 to day 14 (iii) day 10 Cytokine switching from IL2 to IL12, CD3 / CD28 stimulation from day 0 to day 3, no restimulation (iv) IL2 to IL12 cytokine switching on day 10, CD3 / from day 0 to day 3 CD28 stimulation, and restimulation with CD3 / CD28 from day 12 to day 14. Markers tested included CD69, IFNg, perforin, CXCR3, granzyme B, CCR5, CXCR6, Ki-67 and T-bet. IFNg appears to be the most robust and consistent marker of IL12 activity on human T cells, but T cell restimulation is required to induce production. Th1 markers that increase in response to IL12 in the absence of restimulation and IL2 (probably in vivo conditions) include Ki-67, T-bet, perforin, CXCR3, and CCR5.

Example 22. Effect of Cytokines on Proliferation and Activation of NK Cells Immune cells such as natural killer cells are dependent on cytokines such as IL15 for proliferation and survival. This dependence on cytokines can be used to test the function of DD-regulated or constitutively expressed cytokines and cytokine fusion proteins.

The dependence of NK-92 cells on cytokines for activation was tested. After first culturing the cells with IL2 for 3 days, the cells were washed twice and cultured in IL2 free medium for 7 hours. Cells were treated with IL12 (10 ng / ml) or various concentrations of IL15 (100 ng / ml, 20 ng / ml, 4 ng / ml, 0.8 ng / ml, 0.16 ng / ml, 0.032 ng / ml, 0.0064 ng / ml , And 0.00128 ng / ml) for 18 hours. Activation of NK-92 cells in response to IL15 and IL12 treatment was assessed by FACS analysis using a panel of such markers, where increased expression of markers is associated with activation of NK cells. These markers include NKG2D, CD71, CD69; chemokine receptors such as CCR5, CXCR4, and CXCR3, perforin, granzyme B, and interferon gamma (IFNg). Cells were cultured in the presence of Brefeldin A for 4 hours prior to FACS analysis of IFNg. NK cells respond to external stimuli such as cytokines in the environment through phosphorylation of the JAK / STAT, ERK, and p38 / MAPK pathways, proteins that are important for cell activation, signaling and differentiation pathways. Phosphorylation of AKT, STAT3 and STAT5 depending on the addition of cytokine was measured by FACS. Since phosphorylation events are transient, NK-92 cells were treated with cytokines for 15 or 60 minutes prior to analysis. Table 28 shows the fold change in average fluorescence intensity of IL15 treatment compared to untreated.

  Treatment with IL15 resulted in increased expression of CD69, CXCR4, perforin, granzyme B, and IFNg. The effect of IL15 on these markers was dose dependent, with higher doses of IL15 resulting in upregulation of the corresponding markers. Phosphorylation of STAT5 was increased 15 and 60 minutes after addition of IL2 or IL15. Taken together, these results indicate that cytokines can activate NK cells.

The fold changes in activation marker observed with IL12 treatment are shown in Table 29.

  Treatment with IL12 resulted in increased expression of the markers CD69, CCR5, perforin, granzyme B, and IFNγ. Furthermore, the levels of IFNg secreted from NK-92 cells into the medium were higher when treated with IL12 than in untreated controls. Treatment with IL2 resulted in increased expression of CXCR4, perforin, granzyme B, and IFNg. Moreover, IFNg levels secreted into the supernatant by NK-92 cells were higher when treated with IL2 than in untreated controls.

Example 23. Effect of Cytokines on T Cell Proliferation and Activation To test the need for IL2 and IL12 on T cell proliferation and activation, T cells were stimulated with soluble CD3 / CD28, CD3 / CD28 Dynabeads for 2 days. Or left unstimulated. Each of these groups was further divided into two subgroups. One subgroup was treated with IL2 and 100 ng / ml IL12, and the second subgroup was treated with IL2 only during stimulation. For soluble CD3 / CD28 stimulated cells, a third subgroup treated only with 100 ng / ml was also included. T cell proliferation was measured for 14 days, and the fold change in T cell proliferation is shown in FIG. 28A. CD3 / CD28 dynabeads + IL2 in the presence or absence of IL12 had the greatest effect on T cell proliferation, with T cells treated with soluble CD3 / CD28 + IL2 in the presence or absence of IL12 Followed by. Unstimulated cells, and IL2-treated cells treated with soluble CD3 / CD28 cells were unable to grow during the course of the experiment. These results indicate that IL2 is required for T cell proliferation, but IL12 may not be required.

  The effect of IL12 on T cell activation was measured by measuring the frequency of appearance of IFNγ positive CD4 + and CD8 + T cells. IFNg is produced by activated T cells. Three different stimulation protocols were used. In the first protocol, cells were stimulated with CD3 / CD28 Dynabeads for 2 days, then the beads were washed off and cells were treated with various concentrations of IL12 for 7 days (Days 2-9). On day 9, cells were restimulated with soluble CD3 / CD28 and the frequency of IFNγ positive cells was measured by FACS. The results are shown in Figure 28B as a percentage of cells. In the second protocol, T cells after 2 days of CD3 / CD28 Dynabeads stimulation were maintained in culture for a longer period of 14 days, from day 2 to day 16. On day 16, cells were restimulated with soluble CD3 / CD28. On day 16, the appearance frequency of IFNγ-positive cells was measured. The results are shown as percentage of cells in Figure 28C. In the third protocol, T cells were first stimulated with CD3 / CD28 Dynabeads and IL2 for 2 days, then treated with IL2 for only 9 days (ie, days 2-11), and IL12 for 2-5 days. Processed in. Cells were also restimulated with soluble CD3 / CD28 during the last two days of the experiment. IFNγ positive CD4 and CD8 cells were measured using FACS. The third protocol mimics transduction and T cell proliferation in vitro, and the environment presented to T cells in adoptive cell therapy in vivo. The results are shown in Figure 28D as a percentage of cells. Restimulation with CD3 / CD28 cells at the end of the experiment increased the proportion of IFNγ-positive cells in both 7-day treatment with IL28 and 14-day treatment with IL28, shown in FIGS. 28B and 28C, respectively. The half maximal effective concentration of IL12 (EC50) observed in the first protocol for CD8 cells was 50 pg / ml. The EC50 of IL12 observed in the second protocol was 12 pg / ml for CD4 cells and 65 pg / ml for CD8 cells. Long-term culture with CD3 / CD28 further increased restimulation of IFNg production and dependence on IL12.

  The results obtained with the third stimulation protocol are shown in Figure 28D. IL12 treated immune cells during the last 5 days of the experiment combined with CD3 / CD28 restimulation showed the highest proportion of IFNγ positive cells (EC50 = 24 pg / ml for CD4 cells and 40 pg / ml for CD8 cells), This was followed by cells treated with IL12 for 2 days. Thus, T cells expanded in vitro can later be differentiated in response to IL12, but restimulation may be required for IFNg production.

  Taken together, these results show that IL12 can stimulate T cell IFN production when restimulated with CD3 / CD28.

Example 24. Promoter Selection for SRE Expression in T Cells Expression of the SRE in the vector can be driven by the retroviral terminal repeats (LTRs) or by cellular or viral promoters located upstream of the SRE. Since the activity of a promoter may vary depending on the cell type, the choice of promoter should be optimized for each cell type. To identify the optimal promoter, AcGFP (SEQ ID NO: 870) was cloned into pLVX. It was cloned into the IRES Puro construct. T-cells and Sup T1 cells from patients were transduced with the constructs and GFP expression was measured using FACS 3 and 5 days post transduction. As shown in FIG. 29, both the CMV promoter and EF1a can drive the expression of GFP in SupT1 cells and T cells. The percentage of GFP-positive T cells was higher when the GFP expression was promoted by the CMV promoter as compared to the EF1a promoter both on day 3 and day 6 after transduction. In contrast, the percentage of GFP positive cells was much higher when driving GFP expression with the EF1a promoter compared to the CMV promoter. Therefore, the optimal promoter suitable for expression depends on the cell type.

Example 25. Effect of Ligand on T Cell Proliferation The effect of the SRE-specific ligands of the invention on immune cell proliferation was measured to identify the concentration of ligand that did not inhibit T cell proliferation or survival. T cells from two different donors were stimulated with CD3 / CD28 and treated with doses of ligand TMP or DMSO ranging from 0.04 μM to 160 μM. The percentage of dividing cells within the CD4 and CD8 population of T cells was measured using FACS. TMP concentrations ranging from 0.04 μM to 40 μM did not affect the percentage of dividing cells within the CD8 and CD4 populations, whereas TMP at a concentration of 160 μM reduced the percentage of dividing cells by 70-90%. Therefore, the optimal concentration of TMP for T cell-based experiments was determined to be less than 160 μM.

Example 26. Effect of DD-regulated CD19 CAR on persistent signaling Chronic antigen activation can lead to T cell depletion. To test whether the DD-regulated CD19 CAR construct induces persistent signaling, seeded irradiated K562 cells expressing CD19 in culture plates and after 12 hours T cells expressing the DD-regulated CD19 CAR construct. Is added in the presence of interleukin 2. Count cells every 2 days and change medium. If stimulation is repeated, cells are transferred to fresh plates containing K562-CD19 cells after 24 hours (for 2 stimulations) or every 12 hours (for 4 stimulations). For each condition, T cells are counted every 12 hours and analyzed by FACS for CAR, phenotype, and depletion markers. DD regulated constructs were analyzed in the presence or absence of ligand. Markers analyzed included CD25 and CD69 for activation status; CD62 and CD45RA for memory status; and depletion markers PD1, TIM3 and LAG3. The DD-regulated CD19 CAR construct is expected to have a low rate of inducing cells positive for all three depletion markers, PD1, TIM3, and LAG3, and a high rate of inducing CD45A + / CD62L + cells. , Which shows undifferentiated T cells. A constitutively expressed CD19CAR construct may induce expression of all three depletion markers and may have a more differentiated phenotype with a high proportion of CD45- / CD62L- and CD45 + / CD62L- cells. There is.

Example 27. Functional analysis of DD-regulated CD19 CAR To test the ability of DD-regulated CD19 CAR cells to kill target cells, primary T cell populations transduced with DD-regulated CD19 CAR constructs were treated with a DD-specific ligand. Co-culture with K562 cells expressing CD19 (target cells) in the presence or absence of certain Shield-1, TMP or MTX at a 5: 1 ratio. Additional control combinations of T cells and target cells are also set up. These include DD-regulated CAR expressing T cells co-cultured with K562 cells (in the presence or absence of ligand), T cells co-cultured with K562 cells expressing CD19, and no co-culture with T cells. And K562 cells expressing CD19. K562 cells are fluorescently labeled with NucLight Red and co-cultured with T cells for 30 hours. Cell death is monitored by labeling the cells with Annexin V and target K562 cells by monitoring cells positive for both Annexin V and NucLight Red. The ratio of Annexin V staining per target cell area is calculated. DD-CD19CAR expressing T cells are expected to be effective in killing target K562 cells expressing CD19 only in the presence of DD specific ligands. Minimal target cell death when non-transduced T cells are co-cultured with CD19 expressing target cells; and DD-CAR T cells (with or without ligand treatment) + K562 cells (no CD19 expression). Is expected to occur.

Example 28. Generation of CD19 scFv using large phage antibody library Construction of primary phagemid library Total RNA is prepared from 40 different samples of human peripheral blood lymphocytes and cDNA is synthesized using random primers. The IgM variable region is amplified using the IgM 3'primer and 5'VH primer. Pooled primers are also used for Vk and VL amplification. An additional PCR step is added to introduce a restriction enzyme site and an overlapping region containing the scFv loxP linker. The scFv is obtained by mixing equimolar amounts of VH and VL genes and performing the assembly. The scFv is then cloned into the pDAN5 vector to obtain approximately 10 ⁸ primary library.

To induce recombination and secondary recombination of the secondary library, bacterial strain BS1365, which constitutively expresses Cre recombinase, is infected with the primary phagemid library at a MOI of 20: 1. This results in bacteria containing multiple phagemids, each encoding different VH and VL genes, which can be recombined by Cre recombinase. Phagemids are not phenotypically linked to genotype because phagemids originate from bacteria that contain many different scFvs. The phagemid from this bacterium is used to infect a bacterium that does not express Cre with a low MOI of 0.1 or less (eg, DH5a) to link genotype and phenotype.

CD9 Expression Constructs and Cell Lines The human CD19 isoforms listed in Table 14 are cloned into a suitable vector and transfected into cell lines with low endogenous CD19 expression, such as the K562 and 3T3 cell lines. The CD19 expressing strain, K562-CD19 or 3T3-CD19 cells, is used for positive selection of scFv in the phage display library. Parental K562 and 3T3 are used for negative selection.

Selection of Antibodies Recognizing Cell Surface CD19 The secondary phage display library is precleared by screening with parental cells to remove non-specifically bound phage. Precleared phage are incubated with K562-CD19 or 3T3-CD19 cells and bound phage are harvested and amplified for the next round of selection. Three rounds of selection are performed to enrich for CD19 binding agent. By blocking the FMC63 epitope with excess FMC63 antibody, scFvs distinct from FMC63, ie scFvs that bind to an epitope distinct from FMC63, are selected in a parallel selection process.

  The affinity of scFv for CD19 is an important aspect that determines the performance of antibodies in pharmacokinetic and immune response assays. Affinity measurements of 96 scFv clones are performed using techniques such as ELISA and surface plasma resonance that provide the binding rate (Ka), dissociation rate (Kd), and affinity constant (KD).

  The scFv clones with the desired dissociation rate are subjected to Sanger sequencing to identify unique clones that bind to CD19-expressing cells but not parental cells. The identified clones are then subjected to epitope binning using a competitive immunoassay used to characterize and classify a library of scFvs against a target protein, eg CD19. ScFvs against CD19 are tested in pairs against all other CD19 scFvs identified from the library to identify scFvs that prevent the other scFvs from binding to the epitope of the CD19 antigen. After creating the properties for each CD19 scFv, the competitive blocking properties of each scFv for other scFvs are created. The closely related binning properties indicate that antibodies with the same or closely related epitopes are binned together.

  The scFv obtained at each step of the selection process is subjected to a deep sequencing method such as Ion Torrent / MiSeq. Heavy chain CDR3 sequences, including those that do not bind to FMC63, were identified using the Abminging ToolBox (D'Angelo S et al. (2014) MAbs.6 (1): 160-172) to identify the top HCDR3. . Then, the scFv clone is amplified by inverse PCR using HCDR3 specific primers designed from the DNA sequences of the higher rank sequences, and the PCR product is cloned into an expression vector.

Example 29. CD19 scFv Affinity The affinity of scFv for the CD19 antigen is an important aspect in determining antibody performance in pharmacokinetic and immune response assays. Affinity measurements are made using techniques such as ELISA and surface plasma resonance, which provide the binding rate (Ka), dissociation rate (Kd), affinity constant (KD).

  Cells with high or low ectopic expression of CD19 are used to identify antibodies with varying affinities. K562-CD19 cells with low CD19 expression and parental K562 cells are sorted by FACS using a CD19 antibody, eg FMC63, and CD19 surface expression is measured. The cells are sorted into the lower 5% (ie, cells with low CD19 expression) and the upper 5% (cells with high CD19 expression), and the rest of the cell population is classified as intermediate CD19-expressing cells.

Example 30. Screening strategy to identify CD19 scFv distinct from FMC63 CD19 / Fc fusion protein FMC63 binds to human CD19 at the region encoded by exon 2. To identify CD19 scFvs distinct from FMC63, human CD19 (exons 1-4) or human CD19 (exons 1, 3, 4) were fused to IgG to form CD19-IgG fusion proteins, CD19sIgG1-4 and CD19sIgG1 respectively. Generate 3, 4. The CD19-IgG fusion protein is used for antibody screening. 96-well plates are coated with capture antibody and incubated with CD19sIgG1-4 or CD19sIgG1,3,4 fusion proteins. The plates are washed and incubated with the candidate CD19 scFv identified in Example 28. The plate is washed again, re-incubated with a detection antibody conjugated to a reporter (eg alkaline phosphatase) and detected using a reporter compatible detection method. The capture antibody may be anti-human IgG Fc antibody, or FMC63 antibody (as a control). The detection antibody may be an anti-human IgM antibody. The CD19 scFv, distinct from FMC63, is expected to bind (CD19sIgG1,3,4) and (CD19sIgG1-4). In contrast, a candidate CD19 scFv that binds to an epitope that is the same as or overlaps with the epitope of FMC63 is expected to bind only (CD19sIgG1-4).

Competitive Assay K562 cells expressing CD19 are incubated with a nanomolar concentration of tagged candidate CD19 scFv identified in Example 28 and a fixed concentration of tagged FMC63 scFv, for example, for competitive binding assays. Cells are washed and stained with a secondary antibody corresponding to the tag used on the candidate CD19 scFv. Average fluorescence intensity is measured using flow cytometry. As a negative control, CD19 K562 expressing cells are incubated with various concentrations of tagged candidate CD19 scFv alone or FMC63 alone. In the case of a CD19 scFv that is distinct from FMC63, it is expected that there is no competition for binding to CD19 between the candidate CD19 scFv and FMC63. Therefore, the mean fluorescence intensity of the tagged candidate CD19 scFv is expected to increase with increasing concentration of the candidate CD19 scFv, while the mean fluorescence intensity of tagged FMC63 antibody does not decrease with increasing concentration of the candidate CD19 scFv. It is expected to be. This indicates that FMC63 is not displaced from its epitope by the addition of the candidate CD19 scFv, suggesting that it is a distinct binding epitope. For candidate CD19 scFv that binds to the same epitope as FMC63, it is expected that the fluorescence intensity of FMC63 will decrease with increasing concentration of candidate CD19 scFv.

Example 31. Functional analysis of a CD19 CAR construct distinct from FMC63 A CD19 scFv distinct from FMC63 modified to produce a CD19 CAR construct distinct from FMC63 with destabilizing domains, linkers, transmembrane and intracellular domains, It is described in Table 1 and Tables 6, 7, 8A or 8B. The ability of CD19 CAR independent of FMC63 to induce cell activation, cytotoxicity, proliferation is compared to the FMC63-CD19-based CAR construct of Jurkat cells. The constructs are also analyzed for their ability to induce upregulation of the depletion markers PD1, TIM3 and LAG3, constructs positive for multiple depletion markers are excluded from the analysis. T cells are transduced with a construct capable of inducing Jurkat cell activation and cytotoxicity but not a depletion marker and comparing its potency with a constitutively expressed FMC63-based CD19 CAR construct. The CD19 CAR construct that is distinct from the DD-regulated FMC63 is expected to exert superior cytotoxic potency with minimal sustained signaling compared to the FMC63 CD19 CAR construct.

Example 32. Ligand-Dependent Target Cell Death Induced by DD-Regulated CD19 CAR To test the antigen specificity of cell killing by T cells designed to express constitutive or DD-containing CAR constructs, CD19 was tested against antigen-negative K562 cells. Ectopically expressed in the strain. CD19 expression was measured using anti-CD19 antibody conjugated to phycoerythrin (PE). FIG. 30A shows expression of CD19 in parental K562 and K562-CD19 cells, with CD19 being ectopically expressed.

  To test the ability of DD regulated CD19 CAR cells to kill target cells, primary T cell populations were transduced with the DD regulated CD19 CAR construct, the human DHFR DD and OT-CD19-024 with the EF1a promoter. Transduced T cells were co-cultured at a 5: 1 ratio with CD562 expressing K562 cells (target cells) in the presence or absence of TMP (100 μM). An additional control combination of T cells and target cells was also set up. These include DD-regulated CAR expressing T cells co-cultured with antigen negative K562 cells (in the presence or absence of ligand), non-transformed T cells co-cultured with K562 cells expressing CD19, and T cell co-cultures. K562 cells expressing CD19 without culture were included. The T cells utilized in this experiment were transduced (or untransduced) with the OT-CD19-024 construct and grown for 11 days using the protocol described in the above example, frozen, thawed and co-cultured with target cells. Cultured. Target cells were treated with mitomycin C to prevent proliferation. K562 or K562-CD19 target cells stably expressing the fluorescent protein NucLight Red were co-cultured with T cells for 300 hours. Cell death was monitored by labeling the cells with Annexin V and the cell death of target K562 and K562-CD19 cells was monitored using the IncuCyte® Live Cell Analysis System (Essen Biosciences, Ann Arbor, MI). Monitoring was performed by assessing cells that were positive for both Annexin V and NucLight Red. The results are shown in FIG. 30B and the dead target cells displayed on the y-axis are based on target cells positive for both NucLight Red and Annexin V. FIG. 30C shows the size of killed target measured at day 5 (μM / well). Killing of target cells was observed with the OT-CD19-024 construct only in co-cultures of TMP-treated T cells with K562 target cells ectopically expressing CD19. No cell killing was observed when T cells were co-cultured with untreated controls in the same co-culture setting and parental K562 cells that did not express CD19 in the presence or absence of ligand. These data indicate that regulated CAR exhibits ligand- and target-dependent cell killing with minimal basal off-state.

Example 33. In Vitro CAR-T Cell Functional Assays Efficacy of T cells expressing the DD regulated CD19 CAR construct in functional interaction with target cells is evaluated. To interact with CD19CAR T cells, the selected target cells naturally or ectopically express CD19. In this regard, target cells such as Nalm6, Raji, Reh, Sem, Kopn8, and Daudi cells have high endogenous expression of CD19. Alternatively, the target cell line may be modified by ectopic expression of CD19 in cell lines such as K562, which has low endogenous expression of CD19. Functionality is measured using multiple assays. Prior to co-culture, the target cells are optionally cultured in the presence of mitomycin C to prevent growth of the target cells. This ensures that the proliferation of target cells does not exceed that of T cells. A cytotoxicity assay is used to measure the ability of T cells to induce target cell death. Target cells are modified to express Renilla or firefly luciferase and are co-cultured with T cells expressing the DD-regulated CD19 CAR construct for 18-24 hours in the presence of a ligand related to DD or vehicle control. At the end of co-culture, cells are lysed and luciferase activity is measured using the appropriate substrate. When DD-regulated CD19 CAR expressing T cells are co-cultured with CD19 expressing target cells in the presence of ligand, luciferase activity is expected to increase. No cytotoxicity is expected when utilizing vehicle control cells or target cells that do not express CD19.

  Engagement of the CD19 CAR with the CD19 antigen results in activation of T cells, which is measured 24 hours after co-culture of CAR expressing T cells with target cells. T cell activation is assessed by measuring IFNg, IL2, and CD69 levels. T cell proliferation in response to antigen-mediated T cell activation is measured by labeling T cells with carboxyfluorescein succinimidyl ester, which is used to track cells over multiple generations. Labeled T cells are cultured with mitomycin-treated target cells and cell proliferation is followed for 3-5 days. T cell proliferation and activation is expected to be increased when DD-regulated CD19 CAR expressing T cells are co-cultured with CD19 expressing target cells in the presence of ligand. Both parameters are expected to be absent when using vehicle control cells or target cells that do not express CD19.

  Activation of T cells results in degranulation, a process of exocytosis in which cytotoxic T cells release molecules such as perforin and granzymes that enable the killing of target cells. Degranulation is measured by analyzing the medium for signs of exocytosis, eg by FACS for CD107, and by markers of degranulation such as perforin and granzyme using immunoassays.

Example 34. Ligand-Dependent Target Cell Death Induced by DD-Regulated CD19 CAR To test the ability of DD-regulated CD19 CAR cells to kill target cells, a primary T-cell population was transduced with a DD-regulated CD19 CAR construct, Co-culture with CD562-expressing K562 cells (target cells) in the presence or absence of DD-specific ligands such as Shield-1 (1 μM), TMP (100 μM) or MTX at 5: 1 ratio. . Constructs containing FKBP, ecDHFR, or human DHFR DD may be utilized. Also, constructs containing either CMV, EF1a, or PGK promoters may be used. Set up multiple combinations of T cells and target cells. These include DD-regulated CAR expressing T cells (in the presence or absence of ligand) co-cultured with K562 cells, T cells co-cultured with K562 cells expressing CD19, and CD19 without T cell co-culture. K562 cells that express Additional controls include target cells only, untransduced T cells, T cells transduced with empty vector. The T cells utilized in this experiment are expanded for 11 days using the protocol described in the Example above, frozen, thawed and transduced with the CD19 CAR construct. Target cells are treated with mitomycin C to prevent proliferation. K562 cells are fluorescently labeled with NucLight Red and co-cultured with T cells for 300 hours. Cell death was monitored by labeling cells with Annexin V and cells that were positive for both Annexin V and NucLight Red were used using the IncuCyte® Live Cell Analysis System (Essen Biosciences, Ann Arbor, MI). Cell death of target K562 cells is monitored by assessing. Target cell killing is expected with the DD-regulated CAR construct only in the presence of ligand and utilizing K562 target cells ectopically expressing CD19. Cell death is not expected when T cells are co-cultured with untreated controls in the same co-culture setting and parental K562 cells that do not express CD19 in the presence or absence of ligand. The constitutive construct is expected to show cell killing in the presence of ligand. Also, cell killing is not expected in co-cultures with untransduced T cells, T cells transduced with empty vector; and only target cells.

Example 35. Effect of Ligand on Cytokine Expression To study the effect of ligand on cytokine expression in regulated CD19 CAR constructs, empty vector, OT-CD19-017, OT-CD19-023, OT-CD19-024, or OT-. The T cell population was transduced with CD19-025. 5 × 10 ⁴ transduced T cells were co-cultured in the presence or absence of TMP or Shield-1 for 48 hours at an E: T (effector to target cell) ratio of 5: 1. Target cells were treated with 50 ug / ml mitomycin C to prevent proliferation. IFNγ and IL2 cytokine concentrations in the culture supernatant were measured for each construct using the MSD V-PLEX Proinflammatory Panel 1 Human kit. Readings were taken using a MESO QuickPlex SQ120. As shown in FIG. 31A, a 6-fold increase in the IFNγ concentration was observed by the addition of the OT-CD19-024 ligand, and a 2-fold increase in the IFNγ concentration was observed by the addition of the OT-CD19-025 ligand. As shown in FIG. 31B, a 6-fold increase in IL2 was observed in OT-CD19-024 to which a ligand was added, and a 9-fold increase in OT-CD19-025 was observed in TMP.

Example 36. Study of IL12 levels in mice in vivo over time Transduced with HCT116 parental cells or IL12 constructs (OT-IL12-020, OT-IL12-026, or OT-IL12-029) according to the study design in Table 30 below. Cells were injected into immunodeficient CD1 nude mice (n = 4 / group).

Mice were bled (blood plasma PK and IL12 MSD) 14 days (0 days) after subcutaneous injection of 5 × 10 ⁶ cells and 6, 10, and 24 hours after administration on day 15. At the end of the study, tumors and kidneys were minced with a razor in 500 ul of PBS, centrifuged and the supernatant was isolated for the IL12 Meso Scale Diagnostic (MSD) assay.

  As shown in FIG. 32A, the basal plasma IL12 levels of the DD constructs were high, but the OT-IL12-026 and OT-IL12-029 constructs were still 100-fold lower than the constitutive (OT-IL12-020) constructs. . When FIG. 32A is shown as fold change from pre-dose plasma, OT-IL12-026 shows modulation at 6 and 10 hours. 32B and 32C show that IL12 is detectable in kidney (FIG. 32B) and tumor (FIG. 32C) and its levels are consistent with plasma levels.

Example 37. In Vivo Time Course Study of IL12 Levels in Mice HCT116 parental cells or cells transduced with IL12 constructs (OT-IL12-020, OT-IL12-026) were applied to Matrigel plus female NSG mice according to the study design in Table 31 below. Subcutaneous injection (Implant 200 ul Matrigel plug of 1x10 ⁷ cells) (n = 4).

  Plasma (for IL12 MSD), plug supernatant and final kidney collection were collected. As shown in FIG. 33A, modulation of IL12 was achieved in vivo by high dose Aquashield. Less regulation was observed in plasma (FIG. 33B) and some flexi-IL12 was detected in kidney (FIG. 33C).

Example 38. Shield-1 can induce an approximately 40-50-fold increase in IL12 production by primary human T cells transduced with the IL12-026 construct. On day 0, primary human T cells were 3: 1 beads: The cell ratio was stimulated with Dynabeads (T expander CD3 / CD28). The next day, lentivirus (empty vector (pLVX-EF1a-IRES-Puro), OT-IL12-020 (constitutive), or OT-IL12-026 (regulated)) was added in the presence of LentiBOOST and 5% FBS. A multiplicity of infection (MOI) of 10 was added. On day two, cells were washed to remove LentiBOOST, the bead: cell ratio was reduced to 1: 3 and fresh 10% medium and IL2 were added. At days 6, 9, and 13 cells were counted for equal cell number plating, medium was changed, ligands were added, cells were left unstimulated or soluble ImmunoCult ™ Human CD3. / CD28 T Cell Activator (StemCell Technologies). After overnight incubation (Days 7, 10, and 14), supernatants were collected for IL12p40 and p70 MSD assays and transduction efficiency analyzed by FACS. On day 7, OT-IL12-026 T cells were found to be 7% transduced and OT-IL12-020 (constitutive) T cells were 13% transduced. Restimulation was shown to increase IL12 expression (FIG. 34A). Ligand increased IL12 production by 40-50 fold by OT-IL12-026 expressing T cells grown for 10 days (FIGS. 34B and 34C).

Example 39. Shield-1 dose response to transduced T cells Human T cells were activated with CD3 / CD28 Dynabeads (Life Technologies) one day prior to transduction with lentivirus (OT-IL12-026 or vector control), then The cells were grown for 12 to 13 days in culture. T cells transduced with different amounts of virus (4-40 MOI) were subjected to Shield-1 dose response for 24 hours (left panel). T cells that had been transduced with a MOI of 14 were treated with 1 uM Shield-1 or vehicle control over time (right panel). The level of IL12 accumulated in the supernatant (from 100,000 cells per 200 uL medium) was measured using the human IL12p40 MSD V-plex assay kit (Meso Scale Discovery).

  Analysis showed that increased IL12 production by T cells expressing OT-IL12-026 was dose-responsive to the ligand Shield-1 (Figure 35A) and accumulated over time (Figure 35B).

Example 40. Repeated Administration of AquaShield in NSG Mice Transplanted with In Vivo Dose Response and T Cells Expressing OT-IL12-026 Primary Human T Cells Dynabeads (T Expander CD3 / CD28) at a 3: 1 Bead: Cell Ratio I was stimulated by. The next day, lentivirus (OT-IL12-020 (constitutive), OT-IL12-026 (regulated), or vector control) was added at a multiplicity of infection (MOI) of 10 in the presence of LentiBOOST and 5% FBS. added. The next day, T cells were washed to remove LentiBOOST, the bead: cell ratio was reduced to 1: 3, and fresh 10% medium and IL2 were added. After the T cells were grown total of 10 days, transplanted T cells transduced with constitutive OT-IL12-020 of T cells or 10x10 ⁶ transduced with the vector control or OT-IL12-026 of 25 × 10 ⁶ to NSG mice Yes (study day 0). Three days after cell transplantation, animals received either vehicle or AquaShield (10, 50 or 100 mg / kg). Blood was collected for plasma analysis of IL12p70 by MSD assay at 0, 4, 8 and 24 hours post dose (FIG. 36A). A clear dose-response increase in plasma IL12 was observed.

  Five days after T cell transplantation, the animals received a second dose of AquaShield (Figure 36B). Upon repeated administration of AquaShield, a second increase in plasma IL12 was observed.

Example 41. In Vivo Modulation of DD-12 Expressed on T Cells To determine whether a ligand can stabilize DD-IL12 in vivo upon continuous administration of AquaShield, as outlined in the study design below, T cells are transduced with a DD-IL12 expression construct (OT-IL12-020 or OT-IL12-026) and transplanted into mice (n = 4 / group) (day 0).

  For each group, pre-bleed samples and 4 and 24 hour samples after each dose are collected. At the end of the study, tissue and organ samples will be collected. FACS analysis is performed to determine cell number and Th1 markers.

  On day 0, primary human T cells were stimulated with Dynabeads (T expander CD3 / CD28) at a bead: cell ratio of 3: 1. The next day, lentivirus (empty vector (pLVX-EF1a-IRES-Puro), OT-IL12-020 (constitutive), or OT-IL12-026 (regulated)) was added to LentiBOOST and 10% of 5% FBS in the presence of 10. Multiplicity of infection (MOI) was added. On day 2, cells were washed to remove LentiBOOST, the bead: cell ratio was reduced to 1: 3 and fresh 10% medium and IL2 were added.

  The in vitro evaluation of these cells is shown in Figures 37A-37C.

After 10 days of expansion, T cells were injected into NSG mice (12 × 10 ⁶ cells injected, 15% (constitutive) and 7.5% (regulated) IL12 positive by FACS). For each group, pre-bleed samples and plasma samples were collected 4 and 24 hours after each dose. At the end of the study, tissue and organ samples will be collected. FACS analysis was performed to measure T cell numbers in the blood and assess Th1 phenotypic markers.

  As shown in FIG. 37A, IL12 expression in response to continuous pulse administration of ligand (50 mg / kg Aquashield (50 mpk Aquashield every 48 hours) administered orally on days 4 and 6) was OT-expressed compared to vehicle-treated controls. Elevated in plasma of mice with T cells expressing IL12-026. T cells expressing the empty vector control did not produce IL12. T cells transduced with the constitutive control OT-IL12-020 (IL12-020) produced IL12 over time.

  In FIG. 37B, continuous pulse administration of ligand (50 mg / kg Aquashield for 4 days (3-6 days) orally in mice with T cells expressing OT-IL12-026 compared to vehicle-treated controls. Elevated plasma IL12 expression was observed in response to 50 mpk Aquashield daily x4)). Cells transduced with the constitutive control OT-IL12-020 (IL12-020) produced IL12 over time.

  Figure 37C shows IL12 expression for the constitutive construct OT-IL12-020 (IL12-020) over 11 days. IL12 from T cells expressing DD-IL12 from the construct OT-IL12-026 in mice treated with 50 mg / kg Aquashield (50 mpk Aquashield days 5/10) administered orally on days 5 and 10. Ligand regulated expression was observed. T cells expressing the empty vector control did not produce IL12.

  FIG. 37D shows T-cells expressing DD-IL12 from construct OT-IL12-026 when mice were treated orally with 50 mg / kg Aquashield (50 mpk Aquashield day 10) on day 10. 3 shows ligand-induced regulation of plasma IL12 expression. The single ligand pulse increased plasma IL12 levels more than that detected in vehicle-treated control mice with T cells expressing OT-IL12-026.

  Modulation of IL12 for all constructs shown in Figures 37A-37D did not affect IFNγ levels, instead IFNγ levels gradually increased over time. This is probably because T cells in culture were exposed to IL12 during the in vitro growth phase. However, ligand-induced regulation of IL12 increased granzyme B (GrB) (FIG. 37E) and perforin expression (FIG. 29F) in vivo by CD8 + T cells 7 days after T cell transplantation in vivo. .

Example 42. Effect of PGK promoter and N-terminal FKBP In HEK293T cells, Lipofectamine 3000 and the following: OT-IL12-019 (PGK promoter), OT-IL12-020 (EF1α promoter), OT-IL12-025 (PGK promoter, C-terminal FKBP domain). ), OT-IL12-026 (EF1α promoter, C-terminal FKBP domain), and OT-IL12-046 (N-terminal FKBP) each were transiently transfected with 2 ug of plasmid DNA. The ligand (1 uM Shield-1) was added 1 day after transfection and the cells were cultured for a further 2 days. IL12 secretion into the supernatant was quantified by the IL12p40 MSD assay. Genomic DNA (gDNA) and messenger RNA (mRNA) were purified from cells. The level of integration of the construct DNA into the cell genome and the level of IL12 mRNA expression were quantified by qPCR using primers specific for the WPRE element and IL12 within each construct.

  gDNA qPCR analysis showed that the FKBP DD containing construct was integrated into the cell genome at similar levels, and, as expected, the PGK promoter produced lower IL12 mRNA expression than the EF1α promoter (FIG. 38A). ).

  Due to the low level of mRNA transcription induced by the PGK promoter, the IL12p40 MSD assay also showed that the PGK promoter reduced both basal and peak IL12 secretion levels compared to constructs using the EF1α promoter. Lower basal levels of IL12 production downstream of the PGK promoter resulted in approximately a 2-fold improvement in ligand-induced IL12 regulation compared to constructs containing the EF1α promoter (FIG. 38B). More specifically, with the change from the EF1α to the PGK promoter, the ligand-induced regulation of IL12 expression increased 6- to 13-fold, respectively.

  Constructs containing FKBP at either the N-terminus or C-terminus of IL12 were similarly integrated into the cell genome, producing similar levels of mRNA (FIG. 38A). However, the construct containing FKBP at the C-terminus regulates the expression of IL12, whereas the construct containing FKBP at the N-terminus fails to regulate the expression of IL12 (FIG. 38B).

Example 43. Rate of ligand-dependent stabilization of DD-IL15-IL15Ra The on / off rate of ligand-dependent stabilization of DD-IL15-IL15Ra was measured on CD4-positive T cells. CD3 / CD28 beads were used in a 24-well plate at a 3: 1 bead to T cell ratio to activate T cells for 24 hours. Lentivirus was added to the wells in the presence of LentiBoost reagent and cells were incubated for an additional 24 hours to wash. The cells were resuspended in fresh medium and medium was added every 2-3 days to grow and maintain the cells at 0.5-1 × 10 ⁶ / ml. After 7 days of expansion, T cells transduced with the ecDHFR DD-IL15-IL15Ra fusion construct (OT-IL15-009) were treated with 100 μM ecDHFR ligand trimethoprim (TMP) or the vehicle control DMSO. At multiple time points after TMP treatment (ie 1, 2, 4, 6, 8, 15, 22, and 24 hours), transduced T cells were harvested and analyzed by flow cytometry using anti-IL15Ra antibody to IL15Ra. It was analyzed for surface expression. Untransduced T cells were used as a negative control. T cells were sorted into CD4 positive and CD8 positive populations and the percentage of IL15Ra positive CD4 positive T cells was analyzed. FIG. 39 shows the rate of surface expression of IL15Ra on CD4 T cells after TMP treatment. Among CD4-positive T cells transduced with the OT-IL15-009 construct, the percentage of cells with surface expression of IL15Ra was similar in both TMP- and DMSO-treated cells up to 2 hours after TMP treatment, It was also equivalent to non-transduced cells. However, from 4 hours after TMP treatment, cells transduced with the OT-IL15-009 construct and treated with TMP had an increased proportion of cells with surface expression of IL15Ra. This tendency was observed until 22 hours after treatment with TMP. CD4-positive T cells containing IL15Ra-expressing cells constituted approximately 1% of non-transduced cells, indicating a low proportion of cells expressing endogenous IL15Ra.

Example 44. Ligand-Dependent Stabilization of DD-IL15-IL15Ra Fusion Molecules In Vivo To investigate whether ligand treatment induces stabilization of DD-IL15-IL15Ra fusion molecules in vivo, the OT-IL15-009 construct was used. Transduced HCT116 cells were subcutaneously transplanted into BALB / c nude mice and treated with TMP. For 11 days after transplantation, TMP was orally administered to mice at a dose of 100 mg / kg twice a day, and subsequently, TMP was administered at a dose of 300 mg / kg twice a day for 6 days. As a negative control, separate mice transplanted with HCT116 cells transduced with the OT-IL15-009 construct were treated with vehicle twice daily for 17 days. Tumors were harvested from mice 4 hours after the last administration of TMP or vehicle control and analyzed for levels of IL15-IL15Ra fusion molecule by Western blotting. As shown in FIG. 40, HCT116 tumors harvested from TMP-treated mice showed elevated IL15-IL15Ra expression levels compared to vehicle-treated tumors. GAPDH levels were analyzed as a loading control. These data indicate that administration of the ligand allows stabilization of the DD-IL15-IL15Ra fusion molecule in vivo.

  Consistent with the efficacy of TMP-dependent IL15-IL15Ra stabilization in vivo, elevated TMP levels (399.38 ng / g tumor) were observed in HCT116 tumors taken from mice treated with TMP for 17 days. The level of TMP associated with HCT116 tumors was significantly higher than that observed with mouse plasma at day 3 (15.67 ng / ml plasma) and day 17 (99.5 ng / ml plasma), which indicates that It was shown that orally administered TMP was successfully delivered and accumulated in HCT116 tumors implanted in mice.

Example 45. Loss-resistant IL15-IL15Ra constructs In order to maintain the efficiency of IL15 trans-presentation via the IL15-IL15Ra fusion molecule, it is necessary to prevent IL15-IL15Ra shedding. To this end, novel DD-IL15-IL15Ra and constitutive IL15-IL15Ra constructs are designed by various modifications of the IL15-IL15Ra fusion molecule. For example, the IL15 or IL15Ra molecule is cleaved or mutated to remove the putative cleavage site. IL15Ra is described in Bergamaschi C et al. (2008). J Biol Chem; 283 (7): 4189-99; Anthony SM et al. (2015). PLoS One. 10 (3): e0120274, and receptor transmembrane as described by International Patent Application Publication Nos. WO2014066527 and WO2009002562, the contents of each of which are incorporated herein by reference in their entirety. It has a cleavage site (PQGHSDTT at positions 168-175 of SEQ ID NO: 803) in the extracellular domain just distal to the domain. Tumor necrosis factor α-converting enzyme (TACE / ADAM17) is involved as a protease that cleaves between glycine (position 170 of SEQ ID NO: 803) and histidine (position 171 of SEQ ID NO: 803), and the native soluble form of IL15Ra To generate. The same mechanism may be involved in the loss of IL15-IL15Ra. Therefore, a mutation is introduced at the cleavage site of IL15Ra, thereby preventing cleavage by endogenous proteases. Cleavage site mutations are introduced by amino acid residue substitutions, insertions, or deletions. Also, the IL15-IL15Ra fusion molecule is modified, thereby fusing the full-length or truncated IL15-IL15Ra fusion molecule to a heterologous hinge domain and / or a heterologous transmembrane domain. As a non-limiting example, a variant of IL15Ra can be utilized. Furthermore, the length and sequence of the linker connecting IL15 and IL15Ra are changed.

  To confirm that modifications on the IL15-IL15Ra fusion molecule prevent shedding, the novel DD-IL15-IL15Ra or constitutive IL15-IL15Ra construct is introduced into HCT-116 cells. Surface expression of IL15 and IL15Ra on HCT-116 cells is tested by flow cytometry using anti-IL15 and anti-IL15Ra antibodies to assess shedding of surface IL15-IL15Ra. The presence or absence of IL15 in the cell culture supernatant is also analyzed by MSD assay. As a functional assay based on the sensitivity of NK cell activation by shed IL15 in tumor supernatants, a transwell assay was performed on HCT-116 cells transduced with the novel DD-IL15-IL15Ra or constitutive IL15-IL15Ra expression constructs and Perform using NK cells. Novel DD-IL15-IL15Ra expression constructs that do not induce NK cell activation in the presence of ligand and novel constitutive IL15-IL15Ra expression constructs that do not induce NK cell activation are selected for use in future experiments. To do.

Example 46. Modulated Expression of IL15-IL15Ra Fusion Molecules with C-Terminal DD Fusion molecules are generated by fusing membrane-bound IL15, IL15 receptor α subunit (IL15Ra) and human DHFR (DD). These fusion molecules were cloned into the pLVX-EF1a-IRES-Puro vector.

  To test ligand-dependent IL15-IL15Ra production, one million HEK-293T cells were seeded in 6-well plates in growth medium containing DMEM and 10FBS and incubated overnight at 37 ° C, 5% CO2. did. Cells were then transfected with 100 ng of constitutive IL15-IL15Ra (OT-IL15-008) or DD-linked IL15-IL15Ra (OT-IL15-037 or OT-IL15-040) using Lipofectamine 2000, 24 Incubated for hours. After incubation, the medium is replaced with growth medium in the presence or absence of 50 μM trimethoprim (TMP) and incubated for an additional 48 hours. Cells are harvested and analyzed for IL15 levels by Western blotting using human IL15 antibody (Abeam, Cambridge, UK). The molecular weight of IL15Ra in OT-IL15-037 and OT-IL15-040 appeared to be the same as OT-IL15-008.

  To test whether IL15 was shed into the medium, supernatants from HEK293 cells expressing the IL15-IL15Ra fusion construct were subjected to immunoassays such as MSD (Rockville, Maryland). Cells were analyzed 48 hours after transfection and, as expected, the constitutive IL15-IL15Ra construct, OT-IL15-008, showed high surface expression of IL15 in the presence and absence of ligand. OT-IL15-037 and OT-IL15-040 showed ligand (trimethoprim) -dependent surface expression of IL15 and IL15Ra (Figure 41). Detection of the membrane bound IL15-IL15Ra fusion construct in the supernatant suggests that the IL15 construct is likely shed from the cell surface.

Example 47. Effect of TMP exposure to TMP in vitro on membrane bound IL15 expression To determine whether the dose and time of TMP exposure in vitro affects membrane bound IL15 expression, OT-IL15-073. An in vitro dose-response study was performed using T cells that express L. For this purpose, T cells were activated in 24-well plates for 24 hours with CD3 / CD28 beads with a 3: 1 bead to T cell ratio. Lentivirus was added to the wells. After 24 hours, fresh medium was added every 2-3 days and cells were grown while maintaining the cells at 0.5-1 × 10 ⁶ / ml. On day 11 of proliferation, T cells treated with TMP starting at 100 uM, 10 fold dilution and 9 points were cultured for 2 hours (three washes after TMP addition, 22 hours, addition of fresh medium without TMP). ), 6 hours in culture, or 24 hours after culture, and the results are shown in FIG. 42A. As shown in Figure 42B and Table 33, this study showed that TMP ligands regulated membrane-bound IL15 expression, and that the dose and time of in vitro exposure to TMP affected membrane-bound IL15 expression.

Example 48. In Vivo Expression of Regulated Membrane-bound IL15 In order to evaluate the regulation of membrane-bound IL15 in vivo, two constructs were selected for evaluation in vivo. Four groups of T cells were used in this study and are outlined in Table 34. In Table 31, "N" represents the number of mice in each group.

  T cells intended to be used as part of the in vivo study were evaluated 6 days after transduction, on the day of transplantation (9 days after transduction) and 13 days after transduction, cells in groups 2-4 were constructed. Showed expression.

T cells outlined in Table 31, were administered to mice by intravenous administration (3.9 × 10 ⁶ cells per transplanted mice). On day 3, mice were dosed with 500 mg / kg of TMP three times (4 hour dosing interval) and blood was collected 2 hours after each dose. On day 4, the mice were bled again 24 hours after the first TMP administration.

  43A-43C show 2, 6, 10, and 24 hours after the first TMP administration using IL15 staining (FIG. 43A), IL15Ra staining (FIG. 43B), and IL15 / IL15Ra dual ++ staining (FIG. 43C). Shown is the subsequent expression of membrane bound IL15. FIG. 43D is a FACS plot of each mouse 10 hours after the first TMP administration. Figure 43E shows the expression of membrane-bound IL15 in blood 2, 6, 10, and 24 hours after the first TMP administration, and Figure 43F shows 2, 6, 10, and 24 hours after the first TMP administration. 2 shows the plasma TMP level of.

Example 49. Effect of long-term intraperitoneal (IP) or oral (PO) TMP administration on T cell function In this study, mice were intravenously administered T cells transduced with OT-IL15-071 or OT-IL15-073 (without lentiBoost). (15 × 10 ⁶ per mouse). In this study, six test groups were evaluated: (1) non-transduced, (2) OT-IL15-071 T cells, (3) OT-IL15-073 PO vehicle, (4) OT-IL15-073 PO. TMP 500 mg / kg), (5) OT-IL15-073 IP vehicle, and (6) OT-IL15-073 IP TMP 300 mg / kg. The study design is shown in Table 35. Oral dose is 500 mg / kg TMP in 0.1 M citrate and intraperitoneal dose is 300 mg / kg TMP lactic acid in water.

  The regulated expression in blood was analyzed 6 and 24 hours after the first administration and 6 hours after the fifth administration.

  OT-IL15-071 showed expression of membrane bound IL15, non-transduced control showed no expression.

  Modulation of membrane bound IL15 was observed with repeated oral and intraperitoneal administration. As can be seen in FIG. 44, the regulated expression of membrane bound IL15 was 6 hours after the first administration on day 0 and 6 hours after administration on day 5 for both oral and intraperitoneal administration (126 hours). Was detected by. There was no increased expression in vehicle-treated mice.

  Although the present invention has been described in some detail in some lengths with respect to some of the described embodiments, it is understood that the invention is in any such detail or embodiment or in any particular embodiment. It is not intended to be limited to, but should be construed with reference to the claims, which, in view of the prior art, give the broadest possible interpretation of such claims. Provided, and thus effectively encompass the intended scope of the invention.

  All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, section headings, materials, methods, and examples are illustrative only and not intended to be limiting.

Claims (51)

  A composition for inducing an immune response in a cell or a subject comprising a first effector module, the effector module comprising a first stimulus response element (SRE) operably linked to at least one immunotherapeutic agent. ).   The composition of claim 1, wherein the at least one immunotherapeutic agent is selected from chimeric antigen receptors (CARs) and antibodies.   The composition of claim 2, wherein the first SRE responds to or interacts with at least one stimulus.   The composition of claim 3, wherein the first SRE is a destabilization domain (DD). The DD is derived from a parent protein or a mutant protein having 1, 2, 3 or more amino acid mutations compared to the parent protein, wherein the parent protein is:
(A) a human protein FKBP having the amino acid sequence of SEQ ID NO: 3,
(B) human DHFR (hDHFR) having the amino acid sequence of SEQ ID NO: 1,
(C) E. coli having the amino acid sequence of SEQ ID NO: 2 coli DHFR (ecDHFR),
(D) PDE5 having the amino acid sequence of SEQ ID NO: 4,
(E) PPARγ having the amino acid sequence of SEQ ID NO: 5,
(F) CA2 having the amino acid sequence of SEQ ID NO: 6, and (g) NQO2 having the amino acid sequence of SEQ ID NO: 7.
The composition of claim 4, selected from: The parent protein is hDHFR and the DD is:
(A) hDHFR (I17V), hDHFR (F59S), hDHFR (N65D), hDHFR (K81R), hDHFR (A107V), hDHFR (Y122I), hDHFR (N127Y), hDHFR (M140I), hDHFR (K185E), hD. N186D), hDHFR (M140I), hDHFR (wild-type amino acids 2-187; N127Y), hDHFR (wild-type amino acids 2-187; I17V), hDHFR (wild-type amino acids 2-187; Y122I), and hDHFR ( A single mutation selected from wild-type amino acids 2-187; K185E);
(B) hDHFR (C7R, Y163C), hDHFR (A10V, H88Y), hDHFR (Q36K, Y122I), hDHFR (M53T, R138I), hDHFR (T57A, I72A), hDHFR (E63G, I176F), hDHFR (G21). ), HDHFR (L74N, Y122I), hDHFR (V75F, Y122I), hDHFR (L94A, T147A), DHFR (V121A, Y22I), hDHFR (Y122I, A125F), hDHFR (H131R, E144G), hDHFR (T137R), and LDHFR (T137R). , HDHFR (Y178H, E18IG), hDHFR (Y183H, K185E), hDHFR (E162G, I176F) hDHFR (wild type amino acids 2-187; I17 V, Y122I), hDHFR (wild-type amino acids 2-187; Y122I, M140I), hDHFR (wild-type amino acids 2-187; N127Y, Y122I), hDHFR (wild-type amino acids 2-187; E162G, I176F), And a double mutation selected from hDHFR (wild type amino acids 2 to 187; H131R, E144G), and hDHFR (wild type amino acids 2 to 187; Y122I, A125F);
(C) hDHFR (V9A, S93R, P150L), hDHFR (I8V, K133E, Y163C), hDHFR (L23S, V121A, Y157C), hDHFR (K19E, F89L, E181G), hDHFR (Q36F, N65F, H122I), Y122I). G54R, M140V, S168C), hDHFR (V110A, V136M, K177R), hDHFR (Q36F, Y122I, A125F), hDHFR (N49D, F59S, D153G), hDHFR (G21E, I72V, I176T), hDH2 wild type (hDHFR). ~ 187; Q36F, Y122I, A125F), hDHFR (wild type amino acids 2-187; Y122I, H131R, E144G), hDHFR (wild type amino acids 2-187). E31D, F32M, V116I), and a triple mutation selected from hDHFR (wild type amino acids 2 to 187; Q36F, N65F, Y122I); or (d) hDHFR (V2A, R33G, Q36R, L100P, K185R), hDHFR ( Wild type amino acids 2-187; D22S, F32M, R33S, Q36S, N65S), hDHFR (I17N, L98S, K99R, M112T, E151G, E162G, E172G), hDHFR (G16S, I17V, F89L, D96G, K123E, M140V, D146G, K156R), hDHFR (K81R, K99R, L100P, E102G, N108D, K123R, H128R, D142G, F180L, K185E), hDHFR (R138G, D142G, 143S, K156R, K158E, E162G, V166A, K177E, Y178C, K185E, N186S, hDHFR (N14S, P24S, F35L, M53T, K56E, R92G, S93G, N127S, H128Y, F135L15F15L, F143L, F143S, H143Y, F135L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F143L, F135L, F143L, F143L, F. ), HDHFR (F35L, R37G, N65A, L68S, K69E, R71G, L80P, K99G, G117D, L132P, I139V, M140I, D142G, D146G, E173G, D187G), hDHFR (L28P, N30H, M38V, S38V, S44V, S38V, S38V, S38V, S38V, S38V, S44V, S44, S44, S44, S44, S44, S44, S44, S44, S44, S44, S44, S44, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, S38, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss, Ss. , R78G, A97T, K99R, A107T, K109R, D111N, L134P, F135V, T147A, I152V, 158R, E172G, V182A, E184R), hDHFR (V2A, I17V, N30D, E31G, Q36R, F59S, K69E, I72T, H88Y, F89L, N108D, K109E, V110A, I115V, Y122D, L132P, F135S, M140V, E144G, T147A , Y157C, V170A, K174R, N186S), hDHFR (L100P, E102G, Q103R, P104S, E105G, N108D, V113A, W114R, Y122C, M126I, N127R, H128Y, L132P, F135P, I139T, F148I, V148D, F148S, F14S, F148S, F14S, F148S, F14S, F14P, I145T, F148I, V148A, F148P, I139T, F148I, V148A, F148A, F148A, F148A, F148A, F148A, F148A, F148A, F148A, F148A, F148A, F148A, F145A, F148A, F145A, F148A, F148A, F148P, I139T, F148A, F148A, F148A, F148A, and F135P D169G, V170A, I176A, K177R, V182A, K185R, N186S), and hDHF R (A10T, Q13R, N14S, N20D, P24S, N30S, M38T, T40A, K47R, N49S, K56R, I61T, K64R, K69R, I72A, R78G, E82G, F89L, D96G, N108D, M112V, W114R, Y122D, K123D. I139V, Q141R, D142G, F148L, E151G, E155G, Y157R, Q171R, Y183C, E184G, K185del, D187N) quadruple or more mutations;
The composition according to claim 5, which comprises a mutant protein having:   7. The composition of claim 6, wherein the stimulus is selected from the group consisting of trimethoprim (TMP) and methotrexate (MTX).   The composition of claim 2, wherein the immunotherapeutic agent is a chimeric antigen receptor (CAR). The chimeric antigen receptor (CAR) is
(A) extracellular targeting moiety;
(B) transmembrane domain;
(C) an intracellular signaling domain; and (d) optionally one or more costimulatory domains.
9. The composition of claim 8, which comprises:   10. The composition of claim 9, wherein the CAR is a standard CAR, a split CAR, an off switch CAR, an on switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.   The extracellular targeting moiety recognizes a target molecule on the surface of a cancer cell, and the target molecule on the surface of the cancer cell is a cancer antigen, a plasma membrane lipid, a receptor or a membrane-bound glycoprotein. The composition of claim 9, which is selected. The extracellular targeting moiety is:
i. Ig NAR,
ii. Fab fragment,
iii. Fab 'fragment,
iv. F (ab) '2 fragment,
v. F (ab) '3 fragment,
vi. Fv,
vii. Single chain variable fragment (scFv),
viii. bis-scFv, (scFv) 2,
ix. Mini body,
x. Diabody,
xi. Trier body,
xii. Tetrabody,
xiii. Intracellular antibody,
xiv. A disulfide-stabilized Fv protein (dsFv),
xv. Unibody,
xvi. A Nanobody, and xvii. 12. The antigen-binding region derived from an antibody that specifically binds to any of a protein of interest, a ligand, a receptor, a receptor fragment, or a peptide aptamer, according to any one of claims 9 to 11. Composition.   13. The composition of claim 12, wherein the extracellular targeting moiety is an scFv derived from an antibody that specifically binds the CD19 antigen. The scFv is CD19 and the scFv is:
(A) a heavy chain variable region having an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 49 to 80, and an amino acid sequence independently selected from the group consisting of any of SEQ ID NOS: 81 to 122 The light chain variable region; or (b) the composition according to claim 13, which is selected from those having an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 123 to 267 and 624. (A) The cell surface molecule wherein the intracellular signaling domain of the CAR is selected from the group consisting of the T cell receptor CD3ζ or FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. Is the signal transduction domain derived from
(B) The costimulatory domain is present and is 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278). , Glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3,
The composition according to claim 9.   16. The composition of claim 15, wherein the intracellular signaling domain of the CAR is the T cell receptor CD3ζ signaling domain having the amino acid sequence of SEQ ID NO: 339.   The intracellular signaling domain of the CAR is a T cell receptor CD3ζ signaling domain having the amino acid sequence of SEQ ID NO: 626, and a costimulatory domain exists, and the costimulatory domain is any of SEQ ID NOs: 268-374. The composition according to claim 9, which is selected from the amino acid sequences of The transmembrane domain is:
(A) a transmembrane region of the α, β or ζ chain of the T cell receptor;
(B) T3 receptor CD3ε chain;
(C) CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD148, DAP10, EpoRI, GITR, LAG3, ICOS, Her2, OX40 (CD134), 4-1BB (CD137), CD152, CD154 , PD-1 or molecule selected from CTLA-4,; and (d) IgG1, IgD, IgG4 , and the group consisting of an immunoglobulin selected from _IgG 4 Fc region 10. The composition of claim 9, derived from any of the members.   10. The composition of claim 9, wherein the transmembrane domain has an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 375-425 and 897-907. The CAR is
(E) A hinge region in the vicinity of the transmembrane domain, wherein the hinge region comprises the hinge region having an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 426 to 504. The composition according to.   The immunotherapeutic agent is an antibody that is specifically immunoreactive with an antigen selected from a tumor-specific antigen (TSA), a tumor-associated antigen (TAA), or an antigenic epitope. Composition.   22. The composition of claim 21, wherein the antigen is an antigenic epitope and the antigenic epitope is CD19. The antibody is
(A) a heavy chain variable region having an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 49 to 80, and an amino acid independently selected from the group consisting of any of SEQ ID NOS: 81 to 122 23. The composition according to claim 22, which is selected from an antibody having an amino acid sequence selected from the group consisting of: a light chain variable region having a sequence; or (b) any of SEQ ID NOs: 123-267.   The composition of claim 1, wherein the first effector module has the amino acid sequence of any of SEQ ID NOs: 635-649, 1005-1010, 1015-1018, and 1215-1231.   The first SRE of the effector module stabilizes the immunotherapeutic agent with a stabilization ratio of 1 or greater, the stabilization ratio being relative to expression, function or level of the immunotherapeutic agent in the absence of stimulation. 25. The composition of claim 24, comprising a ratio of expression, function or level of said immunotherapeutic drug in the presence of stimulation.   The immunotherapy wherein the SRE destabilizes the immunotherapeutic drug with a destabilization ratio of 0-0.09, the destabilization ratio being constitutively expressed in the absence of SRE-specific stimuli. 26. The composition of any of claims 24-25, comprising a ratio of expression, function or level of said immunotherapeutic drug in the absence of SRE-specific stimulation to expression, function or level of drug.   A polynucleotide encoding the composition of any of claims 1-26.   The polynucleotide according to claim 27, wherein the polynucleotide is a DNA molecule or an RNA molecule.   29. The polynucleotide of claim 28, wherein the polynucleotide is an RNA molecule and the RNA molecule is messenger RNA.   30. The polynucleotide of claim 29, which is chemically modified.   29. The polynucleotide of claim 28, which comprises spatiotemporally selected codons.   30. The polynucleotide of claim 29, further encoding a promoter, linker, signal peptide, tag, cleavage site and / or targeting peptide.   A vector comprising the polynucleotide according to any one of claims 27 to 32.   34. The vector according to claim 33, wherein the vector is a viral vector or a plasmid.   The vector according to claim 34, which is a viral vector, and the viral vector is a retroviral vector, a lentiviral vector, a gammaretroviral vector, a recombinant AAV vector, an adenoviral vector, or an oncolytic viral vector.   Adoptives expressing any of the compositions of any of claims 1-26, the polynucleotide of any of claims 27-32, and / or infected or transfected with the vector of any of claims 33-35. Immune cells for cell transfer (ACT).   The immune cells are CD8 + T cells, CD4 + T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTL), tumor infiltrating lymphocytes (TIL), memory T cells, regulatory T cells 37. The immune cell of claim 36, which is a T (Treg) cell, a cytokine-induced killer (CIK) cell, a dendritic cell, a human embryonic stem cell, a mesenchymal stem cell, a hematopoietic stem cell, or a mixture thereof.   Said immune cell further expressing a composition comprising a second effector module, said second effector module comprising a second SRE linked to a second immunotherapeutic agent, said second immunotherapeutic agent 37. The immune cell of claim 36, wherein is selected from cytokines and cytokine-cytokine receptor fusions.   39. The immune cell of claim 38, wherein the second immunotherapeutic agent is a cytokine.   40. The immune cell of claim 39, wherein the cytokine is IL12 or IL15.   39. The immune cell of claim 38, wherein the second immunotherapeutic agent is a cytokine-cytokine receptor fusion polypeptide.   42. The cytokine-cytokine receptor fusion polypeptide is selected from IL12-IL12 receptor fusion polypeptide, IL15-IL15 receptor fusion polypeptide, and IL15-IL15 receptor sushi domain fusion polypeptide. Immune cells.   38. The immune cell of claim 36 or 37, wherein the immune cell is autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.   A method of reducing tumor volume or tumor burden in a subject, wherein the subject is the composition of any of claims 1-26, the polynucleotide of any of claims 27-32, or any of claims 33-35. 44. or the immune cell of any of claims 36 to 43, wherein said SRE responds to a stimulus to regulate expression and function of said immunotherapeutic agent.   A method of inducing an immune response in a subject, wherein the subject is provided with any of the compositions of claims 1-26, the polynucleotide of any of claims 27-32, the vector of any of claims 33-35, or 44. The method of inducing, comprising administering an effective amount of immune cells of any of claims 36-43. A method for identifying a domain of the CD19 antigen that does not bind to the FMC63 antibody (a CD19 binding domain distinct from FMC63), which method comprises:
(A) preparing a composition containing the CD19 antigen,
(B) contacting the composition of (a) with a saturating level of FMC63 antibody,
(C) contacting the composition of step (b) with one or more selected members of a library of potential CD19 binding agents; and (d) said library of said CD19 binding agents for binding FMC63. The identification method comprising identifying a binding domain on the CD19 antigen based on the differential binding of selected members.   47. The method of claim 46, wherein the binding domain of the library is generated using phage display technology using the CD19 antigen as a seed sequence.   The binding domain is Fab fragment, Fab ′ fragment, F (ab) ′ 2 fragment, F (ab) ′ 3 fragment, Fv, single chain variable fragment (scFv), bis-scFv, (scFv) 2, minibody, 48. The method of claim 47, selected from diabodies, triabodies, tetrabodies, disulfide-stabilized Fv proteins (dsFv), unibodies, nanobodies, or antigen binding regions of antibodies, and antibody fragments.   49. The method of claim 48, wherein the CD19 antigen is selected from all or part of the human CD19 antigen and all or part of the rhesus CD19 antigen.   50. A chimeric antigen receptor, comprising a CD19 binding domain distinct from FMC63, obtained according to the method of any of claims 46-49.   51. An effector module comprising a stimulus response element (SRE) operably linked to the chimeric antigen receptor of claim 50.