JP2021088598A - Compositions and methods for immunotherapy - Google Patents

Abstract

To provide compositions and methods for immunotherapy.SOLUTION: The invention provides biocircuit systems, effector modules and compositions for cancer immunotherapy. A method for inducing an anti-cancer immune response in a subject is also provided. What provided by the invention includes polypeptides of the biocircuit systems, effector modules, stimulus-response elements (SRE) and immunotherapeutic agents, polynucleotides encoding the polypeptides, vectors and cells containing the polypeptides and/or polynucleotides for cancer immunotherapy. In an embodiment, the composition comprises a destabilizing domain (DD) that modulates protein stability.SELECTED DRAWING: Figure 19

Description

Mutual reference to related applications This application is entitled US Provisional Patent Application No. 62 / 466,601, entitled "Composions and Methods for Immunotherapy," filed March 3, 2017, and is entitled "Composions and Methods for Immunotherapy." Priority to US Provisional Patent Application No. 62 / 484,063 filed in Japan and US Provisional Patent Application No. 62 / 542,402 filed on August 8, 2017, entitled Compositions and Methods for Immunotherapy. Allegedly, the contents of each of these are incorporated herein by reference in their entirety.

Sequence Listing This application is submitted with an electronic sequence listing. The sequence listing was created on March 2, 2018 and has a file size of 1,566,189 bytes, 2095_1207PCT_SL. It is provided as a file named txt. The information in electronic form of the sequence listing is incorporated herein by reference in its entirety.

The present invention relates to compositions and methods for immunotherapy. Provided in the present invention include biocircuit systems, effector modules, stimulus response elements (SREs) and polypeptides of immunotherapeutic agents for use in cancer immunotherapy, polynucleotides encoding them, and their polys. Vectors and cells containing peptides and / or polynucleotides are included. In one embodiment, the composition comprises a destabilizing domain (DD) that regulates the stability of the protein.

Cancer immunotherapy aims to eradicate cancer cells by rejuvenating the tumor-killing function of tumor-reactive immune cells, mainly T cells. Cancer immunotherapy strategies, including checkpoint blocking, adoptive cell transfer (ACT), and recent developments of cancer vaccines that can increase antitumor immune effector cells, have produced prominent results in some tumors. There is.

The effects of host anti-tumor immunity and cancer immunotherapy are hampered by three major hurdles: 1) low numbers of tumor antigen-specific T cells due to clonal deletion; 2) innate in the tumor microenvironment Insufficient activation of immune cells and accumulation of immunotolerant antigen-presenting cells; and 3) formation of immunosuppressive tumor microenvironment. Especially in solid tumors, the therapeutic effect of immunotherapy regimens remains inadequate due to the lack of effective antitumor responses in immunosuppressive tumor microenvironments. Such immunotolerance is often acquired because tumor cells induce immune tolerance or immunosuppression, and even truly exogenous tumor antigens become immune tolerant. Such immune tolerance is also active and dominant, as cancer vaccines and adoptive transplantation of pre-activated immune effector cells (such as T cells) are suppressed by inhibitors of the tumor microenvironment (TME).

In addition, administration of modified T cells can lead to on-target toxicity / off-target toxicity and cytokine release syndrome (outlined in Tey Clin. Transl. Immunol., 2014, 3: e17 10.1038).

In the case of adverse events, it is necessary to develop an adjustable switch that can turn on or off the expression of transgenic immunotherapeutic agents. For example, the half-life of adoptive cell therapy can be very long and uncertain. Since toxicity can be progressive, a safety switch that removes injected cells is desired. Systems and methods that allow highly flexible regulation of transgenic protein levels and expression windows can enhance therapeutic efficacy and reduce potential side effects.

To develop a controllable therapeutic agent for disease treatment, particularly cancer immunotherapy, the present invention provides a biological circuit system that controls the expression of an immunotherapeutic agent. The biological circuit system includes a stimulus and at least one effector module that responds to the stimulus. Effector modules may include stimulus response elements (SREs) that bind and respond to stimuli, and immunotherapeutic agents operably linked to SREs. In one example, an SRE is a destabilizing domain (DD) that is destabilized in the absence of its specific ligand and can be stabilized by binding to that specific ligand.

The present invention provides compositions and methods for immunotherapy. The composition relates to a tunable system and agent that induces an anti-cancer immune response intracellularly or within a subject. The tunable system and agent may be a biological circuit system that includes at least one effector module that responds to at least one stimulus. The biological circuit system may be, but is not limited to, a destabilizing domain (DD) biological circuit system, a dimerized biological circuit system, a receptor biological circuit system, and a cell biological circuit system. These systems include Shared US Provisional Patent Application No. 62 / 320,864 filed on April 11, 2016, No. 62 / 466,596 filed on March 3, 2017, and WO 2017 /. It is further taught in 180587 (the content of each of these is incorporated herein by reference in its entirety).

In some embodiments, the composition for inducing an immune response may include a first effector module. In some embodiments, the effector module may include a first stimulus response element (SRE) operably linked to at least one payload. In one aspect, the payload may be an immunotherapeutic agent.

In some embodiments, the immunotherapeutic agent may be selected from, but not limited to, cytokines, safety switches, regulatory switches, chimeric antigen receptors and combinations thereof.

In one aspect, the first SRE of the composition may respond to or interact with at least one stimulus.

In some embodiments, the first SRE may include a destabilizing domain (DD). The DD can be derived from the parent protein, or a mutant protein that has one, two, three, or more amino acid mutations compared to the parent protein. In some embodiments, the parent protein is the human protein FKBP having the amino acid sequence of SEQ ID NO: 3; human DHFR (hDHFR) having the amino acid sequence of SEQ ID NO: 2; E. coli having the amino acid sequence of SEQ ID NO: 1. can be selected from COL DHFR; PDE5 having the amino acid sequence of SEQ ID NO: 4; PPARγ having the amino acid sequence of SEQ ID NO: 5; CA2 having the amino acid sequence of SEQ ID NO: 6; or NQO2 having the amino acid sequence of SEQ ID NO: 7. Not limited to.

In one aspect, the parent protein is hDHFR and the DDs are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V W114R, I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135 V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185d Includes mutant proteins with at least one mutation selected from el, K185E, N186S, N186D, D187G, and D187N.

In one aspect, the stimulation of SRE may be trimethoprim or methotrexate.

In some embodiments, the immunotherapeutic agent may be a cytokine. In one aspect, the cytokine may be interleukin, interferon, tumor necrosis factor, transforming growth factor B, CC chemokine, CXC chemokine, CX3C chemokine or growth factor. In some embodiments, the cytokine is interleukin. In some embodiments, the interleukins are IL1, IL1-α, IL1-β, IL1-δ, IL1-ε, IL1-η, IL1-ζ, IL-RA, IL2, IL3, IL4, IL5, IL6. , IL7, IL8, IL9, IL10, IL10C, IL10D, IL11a, IL11b, IL13, IL14, IL16, IL17, IL-17A, IL17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20L, IL21, IL22, IL23 , IL23A, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL34, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, Il37d, IL37e, and IL38. Is selected from.

In one aspect, the interleukin may be IL2 having the amino acid sequence of SEQ ID NO: 51.

In one aspect, the immunotherapeutic agent may be a safety switch. In some embodiments, the safety switch is a caspase-9, inducible FAS (iFAS), inducible caspase-9 (icasp9), CD20 / anti-CD20 antibody pair, protein tag / anti-tag antibody, and small suicide gene (RQR8). Can be selected from. In one aspect, the safety switch may be a caspase-9 having the amino acid sequence of SEQ ID NO: 65.

In one aspect, the immunotherapeutic agent may encode a regulatory switch. In some embodiments, the control switch may be selected from FOXP3, Nr4a, FOXO, and NF-κB. In one aspect, the control switch may be FOXP3 having the amino acid sequence of SEQ ID NOs: 103-106.

In one aspect, the immunotherapeutic agent may be a chimeric antigen receptor (CAR). In some embodiments, the CAR can be selected from GD2 CAR, Her2 CAR, BCMA CAR, CD33 CAR, ALK CAR, CD22 CAR, and CD276 CAR. The CARs described herein can include extracellular parts, transmembrane domains, intracellular signaling domains, and optionally one or more costimulatory domains.

In one aspect, the CAR may be selected from, but limited to, standard CAR, split CAR, off-switch CAR, on-switch CAR, 1st generation CAR, 2nd generation CAR, 3rd generation CAR, or 4th generation CAR. Not done.

In some embodiments, the extracellular target portion of CAR is Ig NAR, Fab fragment, Fab'fragment, F (ab) '2 fragment, F (ab) '3 fragment, Fv, single chain variable fragment (scFv). , Bis-scFv, (scFv) 2, minibody, diabodies, triabodies, tetrabodies, intracellular antibodies, disulfide-stabilized Fv proteins (dsFv), unibody, nanobodies, and proteins of interest, ligands, receptors, receptors It can be selected from, but is not limited to, an antigen-binding region derived from an antibody that can specifically bind to either a body fragment or a peptide aptamer.

In some embodiments, the extracellular target moiety is an ALK target moiety having the amino acid sequences of SEQ ID NOs: 242-257 and 422-429, a CD22 target moiety having the amino acid sequences of SEQ ID NOs: 258-262 and 430-432, the sequence. CD276 target moiety having the amino acid sequences of Nos. 263 to 270 and 433 to 436, GD2 target moiety having the amino acid sequences of SEQ ID NOs: 271 to 349 and 437 to 465, CD33 target moiety having the amino acid sequences of SEQ ID NOs: 350 to 357, sequence. It can be selected from the BCMA target moiety having the amino acid sequences of Nos. 358-365 and the Her2 target moiety having the amino acid sequences of SEQ ID NOs: 366-421 and 466-473.

In some embodiments, the intracellular signaling domain of CAR is selected from the T cell receptor CD3ζ or the group consisting of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. Can be derived from cell surface molecules that are

In some embodiments, the CAR may include a co-stimulating domain. The co-stimulatory domains are 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor. It can be selected from the group consisting of (GITR), lymphocyte function-related antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

In one embodiment, the transmembrane domain of CAR can be derived from the transmembrane domain. In one aspect, the transmembrane domain may have an amino acid sequence selected from the group consisting of SEQ ID NOs: 527-624, but is not limited thereto.

In some embodiments, the CAR of the effector module may further include a hinge region near the transmembrane domain. In one aspect, the hinge region may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 628-694.

In one aspect, the first effector module may comprise IL2-DD having the amino acid sequence of any of SEQ ID NOs: 52-54.

In one aspect, the first effector module may comprise a caspase-9-DD having the amino acid sequence of any of SEQ ID NOs: 72-80.

In one aspect, the first effector module may include a FOXP3-DD having the amino acid sequence of any of SEQ ID NOs: 107-116.

In one aspect, the first effector module may include BCMA CAR-DD having the amino acid sequence of any of SEQ ID NOs: 775-777.

In one aspect, the first effector module may include HER2-DD having any of the amino acid sequences of SEQ ID NO: 906.

The present invention also provides polynucleotides encoding the compositions of the present invention.

In one aspect, the polynucleotide may be a DNA or RNA molecule. In one aspect, the polynucleotide may contain spatiotemporally selected codons. In some embodiments, the polynucleotide may be an RNA molecule. In one aspect, the RNA molecule may be a messenger molecule. In some embodiments, the RNA molecule may be chemically modified. In some embodiments, the polynucleotide may contain spatiotemporally selected codons.

In some embodiments, the polynucleotide may further comprise at least one additional feature selected from, but not limited to, promoters, linkers, signal peptides, tags, cleavage sites, and targeting peptides.

The present invention also provides vectors containing the polynucleotides described herein. In one aspect, the vector may be a viral vector. In some embodiments, the viral vector may be a retroviral vector, a lentiviral vector, a gamma retroviral vector, a recombinant AAV vector, an adenoviral vector, and an oncolytic viral vector.

The invention also provides immune cells for adoptive cell transfer (ACT) capable of expressing the compositions of the invention, the polynucleotides described herein. In one aspect, immune cells may be infected or transfected with the vectors described herein. Immune cells for ACT are CD8 + T cells, CD4 + T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTL), tumor infiltrating lymphocytes (TIL), memory T cells, and regulatory. It can be selected from, but not limited to, sex T (Treg) cells, cytokine-induced killer (CIK) cells, dendritic cells, human embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, or mixtures thereof.

In one aspect, the immune cells may have the destabilizing domain DD, in which case the DD is the human protein FKBP having the amino acid sequence of SEQ ID NO: 3, DHFR having the amino acid sequence of SEQ ID NO: 1-2, It is derived from PDE5 having the amino acid sequence of SEQ ID NO: 4, PPARγ having the amino acid sequence of SEQ ID NO: 5, CA2 having the amino acid sequence of SEQ ID NO: 6, and NQO2 having the amino acid sequence of SEQ ID NO: 7.

In one aspect, the DD may be derived from the parent protein, the parent protein is hDHFR, and the DDs are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E. , N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40 , K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74 , R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109 , V110A, D111N, M112T, M112V, V113A, W114R, I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R , L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148 , I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G , K177E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R , E184G, K185R, K185del, K185E, N186S, N186D, D187G, and a mutant protein having at least one mutation selected from D187N.

In some embodiments, immune cells may be self, allogeneic, syngeneic, or heterologous with respect to a particular individual subject.

The present invention provides methods of reducing a subject's tumor volume or volume, including contacting the subject with the immune cells of the invention. Also provided herein are methods of inducing an antitumor immune response in a subject, including administration of immune cells of the system to the subject.

Also provided herein are methods of inducing an immune response in a subject and administering to the subject the compositions of the invention, the polynucleotides of the invention, and / or the immune cells of the invention.

The present invention also provides a method of preventing or reversing T cell depletion in a subject in need thereof. Such methods may include administering to a subject a therapeutically effective amount of the composition described herein, the polynucleotide of the invention, the vector of the invention, or the immune cells described herein. Such methods may include SREs that respond to stimuli and regulate the expression and / or function of immunotherapeutic agents, thereby preventing or reversing T cell depletion.

In some embodiments, the immunotherapeutic agent is a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor may be GD2 CAR, BCMA CAR, CD33 CAR, Her2 CAR, ALK CAR, CD22 CAR, or CD276 CAR.

In addition, in the present specification, (a) a sample containing one or more cells derived from mammals is brought into contact with the composition, polynucleotide, vector or immune cell of the present invention, and (b) a step of detecting a complex is performed. Provided are methods for detecting cancer in mammals, including, detection of complexes may indicate the presence of cancer in mammals.

In some embodiments, the effector module comprises a stimulus response element (SRE) and at least one payload containing a protein of interest (POI).

In some embodiments, the SRE may be a destabilizing domain (DD). In some examples, DD is a protein such as FKBP (FK506 binding protein), E. coli. It is a mutant domain derived from colli DHFR (dihydrofolate reductase) (ecDHFR), human DHFR (hDHFR), or any protein of interest. In this connection, the biological circuit system is a DD biological circuit system.

The payload is an immunotherapeutic agent used for cancer immunotherapy, such as cytokines such as IL2, safety switches such as caspase-9, regulatory switches encoding FOXP3, BCMA.
It may be a chimeric antigen receptor such as CAR, CD33 CAR, GD2 CAR, Her2 CAR, ALK CAR, CD22 CAR, CD276 CAR, or any agent capable of inducing an immune response. The SRE and payload may be operably linked via one or more linkers, and the location of the components may vary within the effector module.

In some embodiments, the effector module expresses one or more additional features, such as a linker sequence (having a specific sequence and length), a cleavage site, a regulatory element (a microRNA target site, etc.). It may further include a signal sequence, a penetrating sequence, or a tag and biomarker for tracking the effector module, which directs the effector module to a specific cell or intracellular position.

The present invention relates to isolated biocircuit polypeptides, effector modules, stimulus response elements (SREs) and payloads, and polynucleotides encoding any of the above; vectors containing the polynucleotides of the invention; and polys of the invention. Cells expressing peptides, polynucleotides and vectors are provided. Polypeptides, polynucleotides, viral vectors and cells are useful in inducing an antitumor immune response in a subject.

In some embodiments, the vector of the invention is a viral vector. Viral vectors can include, but are not limited to, retroviral vectors, adenoviral vectors, adeno-associated virus vectors, or lentiviral vectors.

In some embodiments, the vector of the invention may be a non-viral vector such as nanoparticles and liposomes.

The invention also provides immune cells modified to contain one or more polypeptides, polynucleotides, or vectors of the invention. The cells are cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CIK) cells, and cytotoxic T lymphocytes (CTL). ), And immune effector cells containing T cells such as tumor infiltrating lymphocytes (TIL). The modified cells may be used for adoptive cell transfer to treat a disease (eg, cancer).

The present invention also provides a method of inducing an immune response in a subject using the compositions of the present invention. Also provided are methods of reducing the tumor mass of a subject using the compositions of the present invention and methods of preventing or reversing T cell depletion.

The schematic diagram of the biological circuit system of this invention is shown. The biological circuit comprises a stimulus and at least one effector module that responds to the stimulus, and the response to the stimulus produces a signal or result. The effector module contains at least one stimulus response element (SRE) and one payload. A typical effector module having one payload is shown. The signal sequences (SS), SREs, and payloads may be located or placed in various configurations with no cleavage sites (AF) or with cleavage sites (G-Z, and AA-DD). An optional linker may be inserted between each component of the effector module. A typical effector module having two payloads and no cutting site is shown. The two payloads may be directly linked or separated from each other. A typical effector module having two payloads and a cutting site is shown. In one embodiment, the SS is located at the N-terminus of the construct, while the other components: SRE, the two payloads and the cutting site may be located at different positions (AL). In another embodiment, a cleavage site is placed at the N-terminus of the construct (MX). An optional linker may be inserted between each component of the effector module. The effector module of the present invention having two payloads is shown, and the SRE is placed at the N-terminus of the structure (AL), while the SS, the two payloads and the cutting site can be of any configuration. it can. An optional linker may be inserted between each component of the effector module. The effector module of the present invention having two payloads is shown, and either two payloads (AF) or one of the two payloads (GX) is placed at the N-terminus of the structure (A). ~ L), on the other hand, the SS, SRE, and cutting site can have any configuration. An optional linker may be inserted between each component of the effector module. A typical configuration of a stimulus and effector module in a biological circuit system is shown. A transmembrane effector module is activated by a free stimulus that binds to SRE (FIG. 7A) or a membrane-bound stimulus (FIG. 7B). The response to the stimulus cleaves the intracellular signal / payload and activates the downstream effector / payload. Dual Stimulation-Indicating a dual presenter type biological circuit system, two binding stimuli (A and B) from two different presenters (eg, different cells) are in a single receiver (eg, another single). It binds to two different effector modules (cells) at the same time and produces a double signal to the downstream payload. Dual Stimulation-Two different effector modules of two different binding stimuli (A and B) from the same presenter (eg, a single cell), showing a single presenter type biological circuit system Simultaneously bind to and generate a double signal. A single stimulus-bridged receiver type biological circuit system is shown. In this configuration, the binding stimulus (A) binds to the effector module of the bridge cell, generating a signal and activating the payload, which with the stimulus (B) to another effector module of the final receiver (eg, another cell). Become. Single Stimulus-Represents a single receiver type biological circuit system, where a single receiver contains two effector modules, which are continuously activated by a single stimulus. A biological circuit system that requires double activation is shown. In this embodiment, one stimulus must first bind to the transmembrane effector module and pre-stimulate the receiver cells activated by the other stimulus. The receiver is activated only when both stimuli are detected (B). FIG. 5 is a line graph showing the effect of Shield-1 on DD-IL2 levels. The frequency of appearance of IFNγ-positive T cells is shown. It shows IFNγ production in T cells. It shows IFNγ production in T cells. Shows T cell proliferation in the presence of IL15 / IL15Ra treatment. It is a dot plot showing the ratio of human cells after in vivo cell transplantation. It is a scatter plot which shows CD4 + / CD8 + T cells. 6 is a Western blot showing luciferase levels in DD-luciferase expressing cells. Shows luciferase activity. FIG. 17A is a Western blot showing DD-regulated expression of FOXP3. FIG. 17B is a Western blot showing DD-regulated expression of FOXP3. It is a bar graph which shows the effect of a promoter on the expression of a transgene. Represents the Shield-1 regulation of DD-IL2 secretion from HCT116 cells in vivo. The viability of T cells cultured with different ratios of CD3 / CD8 beads is shown. The percentage of BCMA CAR positive T cells treated with ligand is shown.

Details of one or more embodiments of the invention are described in the accompanying description below. Any material and method similar to or equivalent to the materials and methods described herein can be used in the practice or testing of the present invention, but preferred materials and methods are described herein. Other features, objectives and advantages of the present invention will become apparent from the description. In the description, the singular also includes the plural, unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. In case of conflict, this description takes precedence.

I. Introduction Cancer immunotherapy aims to induce or restore the responsiveness of the immune system to cancer. Significant advances in immunotherapy research have led to the development of various strategies that can be broadly categorized into active and passive immunotherapy. In general, these strategies can be used to kill cancer cells directly or to combat immunosuppressive tumor microenvironments. Active immunotherapy aims to induce an endogenous long-term tumor antigen-specific immune response. Non-specific stimulation of immune response modifiers such as cytokines can further enhance the response. In contrast, passive immunotherapy involves administering to the host an immune effector molecule such as a tumor antigen-specific cytotoxic T cell or antibody. This approach is temporary and requires several treatments.

Despite significant advances, the effectiveness of current immunotherapy strategies is limited by the associated toxicity. These are often associated with narrow treatment periods associated with immunotherapy, and in part, therapeutic doses to the limit of toxicity that are potentially fatal to a clinically meaningful therapeutic effect. It arises from the need to push up. In addition, adopted immune cells often continue to proliferate in patients unpredictably, resulting in increased doses in vivo.

A major risk involved in immunotherapy is the on-target but off-tumor side effect due to T cell activation in response to normal tissue expression of tumor-related antigen (TAA). In clinical trials using T cells that express T cell receptors for specific TAAs, immunotherapy-responsive skin rashes, colitis, and deafness were reported.

Immunotherapy can also result in on-target, on-tumor toxicity that appears when tumor cells are killed in response to immunotherapy. Adverse effects include tumor lysis syndrome, cytokine release syndrome, and related macrophage activation syndrome. Importantly, these adverse effects can occur during tumor destruction and therefore toxicity can occur even with successful on-tumor immunotherapy. Therefore, an approach that regulates immunotherapy is highly desirable as it may reduce toxicity and maximize efficacy.

The present invention provides systems, compositions, immunotherapeutic agents and methods for cancer immunotherapy. These compositions provide tunable regulation of gene expression and function in immunotherapy. The present invention also provides biocircuit systems, effector modules, stimulus response elements (SREs) and payloads, and polynucleotides encoding any of the aforementioned. In one aspect, the systems, compositions, immunotherapeutic agents and other components of the invention can be controlled by separately applied stimuli, which gives them a great deal of freedom to regulate cancer immunotherapy. provide. In addition, the systems, compositions and methods of the invention may be combined with therapeutic agents such as chemotherapeutic agents, small molecules, gene therapy, and antibodies.

The adjustable properties of the systems and compositions of the present invention have the potential to improve the efficacy and duration of efficacy of immunotherapy. Maximize the potential for cell therapy without irreparably killing and terminating treatment by reversibly silencing the biological activity of adopted cells using the compositions of the invention. can do.

The present invention provides a method of fine-tuning immunotherapy after administration to a patient. This will improve the safety and efficacy of immunotherapy and increase the target population that can benefit from immunotherapy.

II. Compositions of the Present Invention According to the present invention, a biological circuit system including at least one effector module system in a core is provided. Such effector module systems include at least one effector module associated with or integrated with one or more stimulus response elements (SREs). The overall architecture of the biological circuit system of the present invention is shown in FIG. In general, stimulus response elements (SREs) may be operably linked to payload constructs that can be any protein of interest (POI) (eg, immunotherapeutic agents) to form effector modules. SREs are linked by producing a signal or result when activated by a particular stimulus, such as a small molecule, and perpetuating a stabilizing or destabilizing signal, or any other type of regulation. The transcription level and / or protein level of the payload can be adjusted up or down. A detailed description of the biological circuit system can be found in the shared US provisional patent application No. 62 / 320,864 filed April 11, 2016, file No. 62 / 466,596 filed March 3, 2017, and WO 2017 / 180587 (each content is incorporated herein by reference in its entirety). The present invention provides biological circuitry, effector modules, SREs, and components that regulate expression levels and activity of any drug used in immunotherapy.

As used herein, a "biological circuit" or "biological circuit system" is defined as a circuit within a biological system or a useful circuit within a biological system that includes a stimulus and at least one effector module that responds to the stimulus. As defined, the response to a stimulus produces at least one signal or result within or between organisms, as an indicator of the organism, or on the organism. A biological system is generally understood to be any cell, tissue, organ, organ system, or organism such as an animal, plant, fungus, bacterium, or virus. The biological circuit may also be an artificial circuit that gives a signal or result in a cell-free environment such as a diagnostic, reporter system, device, assay or kit using the stimulus or effector modules presented by the present invention. Understood. Artificial circuits may be associated with one or more electronic, magnetic, or radioactive components or components.

According to the present invention, the biological circuit system may be a destabilizing domain (DD) biological circuit system, a dimerized biological circuit system, a receptor biological circuit system, and a cell biological circuit system. Any of these systems can act as a signal to any other of these biological circuit systems.

Effector module and SRE for immunotherapy
According to the present invention, there are provided biological circuit systems, effector modules, SREs, and components that regulate the expression level and activity of any drug used in immunotherapy. As a non-limiting example, immunotherapeutic agents include antibodies and fragments and variants thereof, cancer-specific T cell receptors (TCRs) and variants thereof, antitumor-specific chimeric antigen receptors (CARs), chimeric switch receptors. , Inhibitors of co-inhibiting receptors or ligands, agonists of co-stimulating receptors and ligands, cytokines, chemokines, cytokine receptors, chemokine receptors, soluble growth factors, metabolic factors, suicide genes, homing receptors, or cells and subjects It may be any drug that elicits an immune response.

As described above, the biological circuit of the present invention includes at least one effector module as a component of the effector module system. As used herein, an "effector module" is a single or multi-component construct or complex containing at least (a) one or more stimulus response elements (ie, protein of interest (POI)). is there. As used herein, a "stimulus response element (SRE)" is a component of an effector module that binds, connects, connects, or associates with one or more payloads of an effector module, and in some cases. Then, it is responsible for the responsiveness of the effector module to one or more stimuli. As used herein, the "responsive" nature of SREs to stimuli can be characterized by shared or non-shared interactions, direct or indirect associations, or structural or chemical responses to stimuli. Moreover, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response can ultimately result in a tuned signal or output. Such output signals are relative to the stimulus, eg, a modulation effect between 1% and 100%, or in multiples such as 2x, 3x, 4x, 5x, 10x or more. It may be an increase or a decrease.

In some embodiments, the invention provides a method of regulating protein expression, function or level. In some embodiments, regulation of protein expression, function or level is at least about 20%, eg, at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%. , 95%, 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20 ~ 100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40 -60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50 ~ 95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70 -100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% regulation of expression, function or level.

In some embodiments, the invention provides a method of regulating protein, expression, function or level by measuring stabilization and destabilization ratios. As used herein, the stabilization ratio is the expression, function, or level of the protein of interest in response to the stimulus to the expression, function, or level of the protein of interest in the absence of an SRE-specific stimulus. Can be defined as a ratio of. In some embodiments, the stabilization ratio is at least 1, eg, at least 1-10, 1-20, 1-30, 1-40, 1-50, 1-60, 1-70, 1-80, 1. ~ 90, 1-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-95, 20-100, 30-40, 30-50 , 30-60, 30-70, 30-80, 30-90, 30-95, 30-100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-95, 40 ~ 100, 50-60, 50-70, 50-80, 50-90, 50-95, 50-100, 60-70, 60-80, 60-90, 60-95, 60-100, 70-80 , 70-90, 70-95, 70-100, 80-90, 80-95, 80-100, 90-95, 90-100 or 95-100. As used herein, the destabilization ratio is constitutively expressed and is specific to the effector module for expression, function, or level of the protein of interest in the absence of SRE-specific stimuli. It can be defined as a ratio of expression, function, or level of the protein of interest in the absence of stimuli. As used herein, "constructively" refers to the expression, function or level of a protein of interest that is not linked to SREs and is therefore expressed both in the presence and absence of stimuli. In some embodiments, the destabilization rate is at least 0, eg at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0. .9, or at least 0-0.1, 0-0.2, 0-0.3, 0-0.4, 0-0.5, 0-0.6, 0-0.7, 0-0 .8, 0-0.9, 0.1-0.2, 0.1-0.3, 0.1-0.4, 0.1-0.5, 0.1-0.6, 0 .1-0.7, 0.1-0.8, 0.1-0.9, 0.2-0.3, 0.2-0.4, 0.2-0.5, 0.2 ~ 0.6, 0.2 ~ 0.7, 0.2 ~ 0.8, 0.2 ~ 0.9, 0.3 ~ 0.4, 0.3 ~ 0.5, 0.3 ~ 0 6.6, 0.3-0.7, 0.3-0.8, 0.3-0.9, 0.4-0.5, 0.4-0.6, 0.4-0.7 , 0.4-0.8, 0.4-0.9, 0.5-0.6, 0.5-0.7, 0.5-0.8, 0.5-0.9, 0 It is 0.6 to 0.7, 0.6 to 0.8, 0.6 to 0.9, 0.7 to 0.8, 0.7 to 0.9 or 0.8 to 0.9.

The SRE of the effector module can be selected from, but is not limited to, peptides, peptide complexes, peptide-protein complexes, proteins, fusion proteins, protein complexes, and protein-protein complexes. SREs can include one or more regions derived from any natural or mutant protein, or antibody. In this aspect, SREs are elements in response to stimuli and can coordinate intracellular localization, intramolecular activation, and / or payload degradation.

In some embodiments, the effector modules of the invention have one or more signal sequences (SS), one or more cleavage and / or processing sites, one or more targeting and / or penetrating peptides, and one or more. It may contain additional properties that facilitate expression and regulation of the effector module, such as tags and / or one or more linkers. In addition, the effector modules of the invention may further comprise other regulatory moieties such as inducible promoters, enhancer sequences, microRNA sites, and / or microRNA targeting sites. Each aspect or tuned modality can result in differentially tuned properties in the effector module or biocircuit. For example, SRE can represent a destabilizing domain, while mutations in the protein payload can alter its cleavage site or dimerization properties or half-life, and one or more microRNAs or microRNA binding sites. Inclusion may confer cell detargeting or transport properties. As a result, the present invention includes multifactorial biological circuits in their sustainability. Such biocircuits may be designed to include one, two, three, four, or more tuned properties.

In some embodiments, the effector modules of the invention may include one or more degrons for regulating expression. As used herein, "degron" refers to the smallest sequence within a protein that is sufficient for recognition and degradation by a proteolytic system. An important property of degron is that it can be translocated, that is, when degron is added to a sequence, the sequence deteriorates. In some embodiments, degron may be added to the destabilizing domain, payload, or both. Incorporation of degron into the effector module of the present invention may confer additional protein instability to the effector module, which may be used to minimize basal expression. In some embodiments, the degron may be N degron, phosphodegron, heat-inducible degron, photosensitive degron, oxygen-dependent degron. As a non-limiting example, DeGron is described by Takeuchi et al. Ornithine decarboxylase degron described by (Takeuchi J et al. (2008). Biochem J. 2008 Mar 1; 410 (2): 401-7; the content of which is incorporated by reference in its entirety. ). Other examples of degrons useful in the present invention include degrons described in International Patent Publication Nos. WO2017004022, WO201210343, and WO2011062962; the respective contents are incorporated by reference in their entirety.

As shown in FIG. 2, an embodiment of a typical effector module containing one payload, i.e. one immunotherapeutic agent, is shown. Each component of the effector module may be positioned or placed in various configurations with no cuts (AF) or with cuts (G-Z, and AA-DD). An optional linker may be inserted between each component of the effector module.

Figures 3-6 show embodiments of typical effector modules that include two payloads, i.e. two immunotherapeutic agents. In some embodiments, the effector module may include three or more immunotherapeutic agents (payloads) under the same SRE (eg, same DD) regulation. The two or more agents may be linked directly to each other or separated from each other (Fig. 3). The SRE may be located at the N-terminus of the structure, the C-terminus of the structure, or at an internal position.

In some embodiments, the two or more immunotherapeutic agents may be of the same type, eg, two antibodies, or different types, eg, CAR construct and cytokine IL12. Biological circuits and components that utilize such effector molecules are shown in FIGS. 7-12.

In some embodiments, the biological circuits of the invention may be modified to reduce their immunogenicity. Immunogenicity is the result of a series of complex reactions to substances that are perceived as foreign, including the production of neutralizing and non-neutralizing antibodies, the formation of immune complexes, complement activation, mast cells. Activation, inflammation, hypersensitivity reactions, and anaphylaxis can be included. Several factors, including but not limited to protein sequences, routes of administration and frequency of administration, and patient populations, can contribute to the immunogenicity of the protein. In a preferred embodiment, the composition of the invention may be modified to reduce the immunogenicity of the composition of the invention. In some embodiments, modifications to reduce immunogenicity may include modifications to reduce the binding of processed peptides derived from the parent sequence to major histocompatibility complex (MHC) proteins. For example, amino acid modifications may be designed such that a minimal number of immune epitopes are available for high affinity binding to any of the common MHC alleles. Several methods for identifying MHC-binding epitopes of known protein sequences are known in the art and may be useful in the present invention. Such methods are disclosed in US Patent Publications US20020119492, US200402030380, and US20060148009; the respective contents are incorporated by reference in their entirety.

Epitope identification and subsequent sequence modification may be applied to reduce immunogenicity. Identification of immunogenic epitopes may be achieved using physical or electronic computational methods. Physical methods for epitope identification may include, for example, mass spectrometry and tissue culture / cell techniques. An electronic computational approach uses antigen processing, antigen loading and presentation information, structural and / or proteomics data to identify non-self peptides produced by antigen processing and having good binding properties to the groove of MHC. To do. One or more mutations that direct protein expression may be introduced into the biological circuits of the invention to maintain their function while at the same time further reducing or abolishing the immunogenicity of the identified epitope.

Protein modifications may also be used to interfere with antigen processing and peptide loading, such as glycosylation and PEGylation. In addition, the composition of the present invention may be designed to contain a non-classical amino acid side chain to design a composition having low immunogenicity. Any of the methods discussed in International Patent Publication No. WO2005051975 for reducing immunogenicity may be useful in the present invention (the contents of which are incorporated by reference in their entirety).

In one embodiment, patients may be stratified according to immunogenic peptides presented by immune cells, utilized as parameters to determine an appropriate patient cohort of potential therapeutic benefit for the compositions of the invention. May be good.

In some embodiments, reduced immunogenicity can be achieved by limiting immunoproteasome processing. The proteasome is an important cellular protease and two forms have been found: expressed in all cell types and in active forms, eg, constitutive proteasomes containing catalytic subunits, as well as hematopoietic cells. , A low molecular weight protein (LMP), an immunoproteasome containing different active subunits called LMP-2, LMP-7 and LMP-10. The immune proteasome exhibits altered peptidase activity and cleavage site preference, leading to more efficient release of many MHC class I epitopes. A well-described function of the immune proteasome is to produce peptides with a hydrophobic C-terminus that can be processed to fit the groove of MHC class I molecules. Deol P et al. Showed that the immune proteasome results in frequent cleavage of specific peptide bonds, thereby allowing specific peptides to appear faster on the surface of antigen-presenting cells; and to increase peptide levels (Deol P et.). al. (2007) J Immunol 178 (12) 7557-7562; the contents of which are incorporated herein by reference in their entirety). This study shows that reduced immunoproteasome processing may be accompanied by reduced immunogenicity. In some embodiments, the sequences encoding the compositions of the invention may be modified to reduce the immunogenicity of the compositions of the invention and prevent immunoproteasome processing. In addition, the biological circuit of the present invention may be used in combination with an immunoproteasome selective inhibitor to achieve the same effect. Examples of inhibitors useful in the present invention include UK-101 (Bli-selective compound), IPSI-001, ONX0914 (PR-957), and PR-924 (IPSI).

Another embodiment of the invention is: (a) a sample containing one or more cells from a mammal with any of the CARs, nucleic acids, recombinant expression vectors, host cells, cell populations, or pharmaceutical compositions of the invention. It provides a method of detecting the presence of a cancer in a mammal, including contacting, thereby forming a complex, (b) detecting the complex, in which case the detection of the complex is that of the cancer in the mammal. Show existence. Samples may be obtained by any suitable method, eg biopsy or necropsy. A biopsy is the removal of tissue and / or cells from an individual. Such removal may be the removal of tissue and / or cells from an individual to perform an experiment on the removed tissue and / or cells. This experiment may also be used to determine if an individual has and / or has cancer.

For embodiments of the method of the invention for detecting the presence of cancer in mammals, the sample containing mammalian cells is a fraction of whole cells, their lysates, or whole cell lysates, eg, a nuclear or cytoplasmic fraction. It can be a sample containing the total protein fraction or the nucleic acid fraction. If the sample contains whole cells, the cells can be any mammalian cell, eg, a cell of any organ or tissue, including tumor cells. Contact can occur in vitro or in vivo with respect to mammals. Preferably, the contact is in vitro. In addition, the complex can be detected by many methods known in the art. For example, the CARs, nucleic acids, recombinant expression vectors, host cells, cell populations, or pharmaceutical compositions of the invention described herein can be labeled with detectable labels, such as radioisotopes, fluorophores (eg, fluorescein isos). It can be labeled with thiocyanate (FITC), phycoerythrin (PE), enzymes (eg, alkaline phosphatase, western wasabi peroxidase), and elemental particles (eg, gold particles). Methods of testing the compositions of the invention for their ability to recognize target cells and antigen specificity are known in the art. For example, Clay et al, J. et al. Immunol, 163: 507-513 (1999), is a cytokine (eg, interferon-γ, granulocyte / monocytic colony stimulator (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL2). )) Is shown how to measure the release. In addition, Zhao et al. , J. As described in Immunol, 174: 44) 5.4423 (2005), the function of anti-CD276 material can be evaluated by measuring cytotoxicity.

In some embodiments, the stimulus of the present invention may be an ultrasonic stimulus. In some embodiments, the SREs of the invention may be derived from machine sensitive proteins. In one embodiment, the SRE of the invention may be a mechanically sensitive ion channel, Piezo 1.

The expression of the target payload in such cases is regulated by providing focused ultrasonic stimulation. In other embodiments, the SREs of the invention may be derived from calcium biosensors and the stimuli of the invention may be calcium. Calcium may be produced by ultrasonic-induced mechanical stimulation of mechanically sensitive ion channels. Ultrasound activation of ion channels causes an influx of calcium, which produces stimuli. In one embodiment, the mechanically sensitive ion channel is Piezo 1. Mechanical sensors can be advantageous to use because they provide spatial control at specific locations within the body.

1. 1. Destabilization domain (DD)
In some embodiments, the biological circuitry, effector modules, and compositions of the present invention relate to the post-translational regulation of protein (pauge) function of an immunotherapeutic agent's anti-tumor immune response. In one embodiment, the SRE is a stabilizing / destabilizing domain (DD). The presence, absence, or amount of small molecule ligands that bind or interact with DD can regulate the stability of the payload (s) and thus the function of the payload by such binding or interaction. Depending on the degree of binding and / or interaction, the modified functionality of the payload will differ and may therefore provide a "tuning" of the payload functionality.

In some embodiments, the biocircuits of the invention are associated with destabilizing domains described herein or known in the art in association with any of the immunotherapeutic agents (payloads) set forth herein. It may be used as an SRE of the system. A destabilizing domain (DD) is a small protein domain that can be added to a target protein of interest. DD destabilizes the attached protein of interest in the absence of a DD-binding ligand so that the protein is rapidly degraded by the cellular ubiquitin-proteasome system (Stankunas, K., et al., Mol. Cell, 2003, 12: 1615-1624; Banaszynski, et al., Cell; 2006, 126 (5): 995-1004; Banaszynski, LA, and Wandless, TJ Chem. Biol .; 2006, 13: 11-21 and Rakhit R et al., Chem Biol. 2014; 21 (9): 1238-1252). However, when a particular small molecule ligand binds to DD intended as a ligand binding partner, instability is reversed and protein function is restored. The conditional nature of DD stability allows for a rapid, non-perturbative switch from a stable protein to a substrate that is unstable to degradation. In addition, its ligand concentration dependence provides additional control over the rate of degradation.

In some embodiments, the desired properties of DD are low protein levels (ie, low basal stability) in the absence of a ligand for DD, large dynamic range, robust and predictable dose-response behavior, and rapid. Decomposition rate can be mentioned, but is not limited to these. DDs that bind to the desired ligand may be preferred rather than endogenous molecules.

FKBP / shield-1 system (Egeler et al., J Biol. Protein. 2011, 286 (36): 32328-31336; the contents of which are incorporated herein by reference in its entirety), ecDHFR and its ligand trimetoprim ( TMP); Estrogen receptor domain that can be regulated by several estrogen receptor antagonists (Miyazaki et al., JAm Chem. Soc., 2012, 134 (9): 3942-3945; (Incorporated herein by reference); and the fluorescence destabilizing domain (FDD) (Navarro et al., ACS Chem Biol., 2016) derived from the bilirubin-inducible fluorescent protein UnaG and its cognate ligand bilirubin (BR). Several protein domains with destabilizing properties and their paired small molecules have been identified and used to regulate protein expression, including June 6; the content of which is incorporated herein by reference in its entirety). ing.

Known DDs also include those described in US Pat. No. 8,173,792 and US Pat. No. 8,530,636, the contents of which are incorporated herein by reference in their entirety. ..

In some embodiments, the DDs of the invention can be derived from several known sequences that have been approved for post-translational regulation of proteins. For example, Xiong et al. GUS when the non-catalytic N-terminal domain (54 residues) of Arabidopsis ACS7 (1-aminocyclopropan-1-carboxylic acid synthase) was fused with a β-glucuronidase (GUS) reporter. It has been shown that the accumulation of fusion proteins can be significantly reduced (Xiong et al., J. Exp. Bot., 2014, 65 (15): 4397-4408). Xiong et al. Further showed that both exogenous 1-aminocyclopropane-1-carboxylic acid (ACC) treatment and salts can rescue the N-terminus of ACS and the accumulation level of the GUS fusion protein. The N-terminus of ACS mediates the regulation of the stability of ACS7 via the ubiquitin-26S proteasome pathway.

Another non-limiting example is the stability control region of tropomyosin (Tm) (SCR, residues 97-118), which controls protein stability. The destabilizing mutation L110A and the stabilizing mutation A109L dramatically affect the dynamics of the tropomyosin protein (Kirwan and Hodges, J. Biol. Chem., 2014, 289: 4356-4366). Such sequences can be screened for ligands that bind to them and regulate their stability. The identified sequence and ligand pair may be used as a component of the present invention.

In some embodiments, the DDs of the invention may be developed from known proteins. Regions or parts or domains of wild-type proteins may be utilized in whole or in part as SRE / DD. They may be combined and rearranged to create novel peptides, proteins, regions or domains, any of which may be used as SRE / DD or as a starting point for the design of additional SRE and / or DD. ..

Ligands such as small molecules known to bind to candidate proteins can be tested for their regulation in protein response. Small molecules have been approved to be clinically safe and may have adequate pharmacokinetics and distribution. In some embodiments, the stimulus is a ligand for the destabilizing domain (DD), eg, a small molecule that binds to the destabilizing domain and stabilizes the POI fused to the destabilizing domain. In some embodiments, the ligands, DDs and SREs of the invention are, but are not limited to, co-pending US Provisional Application Nos. 62/320,864 filed on April 11, 2016. Including any of those shown in Tables 2-4 or US Provisional Application No. 62 / 466,596 filed on March 3, 2017 and WO 2017/180587, the content of each of which is in its entirety. Incorporated herein by. Table 1 shows some examples of proteins that can be used in the development of DD and its ligands.

In some embodiments, the DD of the present invention can be an FKBP DD or an ecDHFR DD as listed in Table 2. The positions of the mutant amino acids listed in Table 2 are for ecDHFR (Uniprot ID: P0ABQ4) of SEQ ID NO: 1 in the case of ecDHFR DD, and for FKBP (Uniprot ID: P62942) of SEQ ID NO: 3 in the case of FKBP DD. is there.

The inventors of the present invention have tested and identified several candidate human proteins that can be used to develop destabilizing domains. As shown in Table 2, these candidates include human DHFR (hDHFR), PDE5 (phosphodiesterase 5), PPARγ (peroxisome proliferator-activated receptor γ), CA2 (carbohydrate anhydrase II) and NQO2 (NRH: quinone oxidation). Reductase 2) is included. Mutations may be introduced into the destabilizing domain sequence candidates (as templates) identified from the protein domains of these proteins to generate a variant library based on the template candidate domain sequences. Mutagenesis strategies used to generate DD libraries can include, for example, site-directed mutagenesis using structural guide information; or random mutagenesis using, for example, error-prone PCR, or a combination of both. In some embodiments, the destabilizing domains identified using random mutagenesis are used to identify the structural properties of candidate DDs that may be required for destabilization, which are then used to be site-directed. Mutation induction may be used to generate additional mutagens.

In some embodiments, E.I. A novel DD derived from colli DHFR (ecDHFR) may contain amino acids 2-159 of the wild-type ecDHFR sequence. This is sometimes referred to as the M1del mutation.

In some embodiments, novel DDs derived from ecDHFR may contain amino acids 2-159 of the wild-type ecDHFR sequence (also referred to as M1del mutations), including M1del, R12Y, R12H, Y100I, and E129K. It may include 1, 2, 3, 4, 5 or more mutations, not limited to.

In some embodiments, the FKBP-derived novel DD may have amino acids 2-107 of the wild-type FKBP sequence. This is sometimes referred to as the M1del mutation.

In some embodiments, the FKBP-derived novel DD may have amino acids 2-107 of the wild-type FBKP sequence (also referred to as M1del mutations), M1del, E31G, F36V, R71G, K105E, and L106P. It may include 1, 2, 3, 4, 5 or more mutations, including but not limited to these.

In some embodiments, the DD variant library may be screened for mutations that have altered, preferably higher binding affinity for ligands compared to wild-type proteins. The DD library may be screened using two or more ligands, and DD mutations that are stabilized by some ligands but not by others may be preferentially selected. You may also choose a DD mutation that preferentially binds to the ligand as compared to the native protein. Such methods may be used to optimize DD ligand selection and ligand binding affinity. In addition, such an approach can be used to minimize the harmful effects caused by off-target ligand binding.

In some embodiments, barcodes may be used to screen for mutant libraries to identify suitable DDs. Such methods may be used to detect, identify, and quantify individual mutant clones within a heterologous mutant library. Each DD variant in the library may have a different barcode sequence (relative to each other). In another example, the polynucleotide may also have different barcode sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleobases. Each DD variant in the library can have multiple barcode sequences. When a plurality of barcodes are used, each barcode may be used so as to be unique to any other barcode. Alternatively, each barcode used does not have to be unique, but the combination of barcodes used may create a unique array that can be individually traced. Barcode sequences may be located upstream of the SRE, downstream of the SRE, or in some cases within the SRE. The DD mutant may be identified by barcode using a sequencing approach such as the Sanger method or next-generation sequencing, or by a polymerase chain reaction or a quantitative polymerase chain reaction. In some embodiments, each barcode on an agarose gel may be identified using polymerase chain reaction primers that amplify products of different sizes for each barcode. In another example, each barcode may have a unique quantitative polymerase chain reaction probe sequence that allows targeted amplification of each barcode.

In some embodiments, the DDs of the invention can be derived from human dihydrofolate reductase (hDHFR). hDHFR is a low molecular weight (18 kDa) enzyme that catalyzes the reduction of dihydrofolate and plays an important role in various assimilation pathways. Dihydrofolate reductase (DHFR) is an essential enzyme that converts 7,8-dihydrofolic acid (DHF) to 5,6,7,8 tetrahydrofolic acid (THF) in the presence of nicotinamide adenine dihydrogen phosphate (NADPH). Is. Antifolates such as methotrexate (MTX), a structural analog of folic acid, bind more strongly to DHFR than the natural substrate DHF, interfere with folic acid metabolism primarily by inhibiting dihydrofolate reductase, and are purine and pyrimidine precursors. Suppress synthesis. Other hDHFR inhibitors such as folic acid, TQD, trimethoprim (TMP), epigallocatechin gallate (EGCG) and ECG (epigallocatechin gallate) can also bind to hDHFR variants and regulate their stability. it can.

In one aspect of the invention, the DHFR DD of the invention is V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135L, F135 T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G, I15R, P150L, E151G Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E , N186S, N186D, D187G, and D187N, but are not limited thereto.

In one embodiment, the stimulus is a small molecule that binds to SRE to regulate post-translational protein levels. In one aspect, DHFR ligands: trimethoprim (TMP) and methotrexate (MTX) are used to stabilize the hDHFR variant. Table 3 lists the destabilizing domains based on hDHFR. The positions of the mutant amino acids listed in Table 3 are for human DHFR (Uniprot ID: P00374) of SEQ ID NO: 2. Mutations are shown underlined and in bold in Table 3. In Table 3, "del" means that the mutation at that position compared to the wild-type sequence is an amino acid deletion.

In some embodiments, DD mutations that do not inhibit ligand binding may be preferentially selected. In some embodiments, mutations in DHFR residues may improve ligand binding. Aspartic acid at position 22 of SEQ ID NO: 2, glutamic acid at position 31 of SEQ ID NO: 2; phenylalanine at position 32 of SEQ ID NO: 2; arginine at position 33 of SEQ ID NO: 2; 36-position glutamine; 65-position aspartic acid of SEQ ID NO: 2; and 115-position valine of SEQ ID NO: 2. In some embodiments, the DD of the present invention utilizes one or more mutations, including, but not limited to, D22S, E31D, F32M, R33S, Q36S, N65S, and V116I to improve TMP binding. You may let me. The location of the mutant amino acid is relative to wild-type human DHFR (Uniprot ID: P00374) of SEQ ID NO: 2.

In some embodiments, the novel DDs derived from human DHFR are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S. , P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53 , K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82 , F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112 , W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, 135P , F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L , K156R, Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A , F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185 It may include 1, 2, 3, 4, 5 or more mutations including, but not limited to, R, K185del, K185E, N186S, N186D, D187G, and D187N.

In some embodiments, the novel DD from human DHFR may comprise amino acids 2-187 of the wild-type human DHFR sequence. This is sometimes referred to as the M1del mutation.

In some embodiments, the novel DD derived from human DHFR may have amino acids 2-187 (also referred to as M1del reduct) of the wild-type human DHFR sequence, M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123 M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K158R, Y157C, K158E, K158R, L159P V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H, 1, 2, 3, 4, 5 or more, including but not limited to F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N. May include mutations.

2. Stimulation The biological circuit of the present invention is evoked by one or more stimuli. Stimulation can be ligands, externally added or endogenous metabolites, presence or absence of defined ligands, pH, temperature, light, ionic strength, radioactivity, cell location, site of interest, microenvironment, presence of one or more metal ions or It can be selected from the concentration.

In some embodiments, the stimulus is a ligand. The ligand may be nucleic acid based, protein based, lipid based, organic, inorganic, or any combination of those described above. In some embodiments, the ligand is selected from the group consisting of proteins, peptides, nucleic acids, lipids, lipid derivatives, sterols, steroids, metabolite derivatives and small molecules. In some embodiments, the stimulus is a small molecule. In some embodiments, the small molecule is cell permeable. Table 2 of co-pending US No. 62 / 320,684 filed April 11, 2016, or US Provisional Application No. 3 filed March 3, 2017, as a ligand useful in the present invention. Examples include, but are not limited to, the ligands shown in No. 62 / 466,596 and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the small molecule is FDA approved, safe and orally administered.

In some embodiments, the ligand binds to dihydrofolate reductase. In some embodiments, the ligand binds to dihydrofolate reductase and also inhibits its function, which is referred to herein as a dihydrofolate inhibitor.

In some embodiments, the ligand may be a selective inhibitor of human DHFR. The ligands of the present invention may also be selective inhibitors of dihydrofolate reductase in bacteria and parasites such as Pneumocystis, Toxoplasma, Trypanosoma, Mycobacterium, and Streptococcus. Other DHFR-specific ligands may be modified to improve binding to human dihydrofolate reductase.

Examples of dihydrofolate inhibitors include trimethoprim (TMP), methotrexate (MTX), pralatrexate, pyritrexim pyrimethamine, tarotrexin, clologanide, pentamidine, trimetrexate, aminopterin, C1 898 trichloride, pemetrexed disodium, Examples include, but are not limited to, raltitrexed, sulfaguanidine, forotin, icraplim, and diaveridine. As another example of a DHFR inhibitor, BAL0030543, BAL0030544 and BAL0030545 developed by Basillea Pharmaceuticals; and WR99210, and P218, Zhang Q et al. (2015) Int J Antimiclob Agents. Included are any of the inhibitors described by 2015 Aug; 46 (2): 174-182, the contents of which are hereby incorporated by reference in their entirety. Some inhibitors include bulky benzyl groups that dramatically reduce binding to human DHFR. In some embodiments, the inhibitor may be designed to be free of bulky benzyl groups to improve TMP binding.

In some embodiments, the ligands of the invention may be polyglutamates or may not be polyglutamylated. Like natural folic acid, polyglutamylated folic acid is subject to intracellular polyglutamylation because it contains glutamate residues. In contrast, non-polyglutamylated antifolates lack glutamate residues and therefore cannot be used for polyglutamylation. In some embodiments, polyglutamylation ligands can no longer be transported extracellularly, so it may be preferable to increase intracellular retention. In other embodiments, non-polyglutamylated ligands may be preferred to reduce intracellular retention.

In some embodiments, the ligands of the invention may include either dihydrofolic acid or a derivative thereof that may bind to human DHFR. In some embodiments, the ligand of the invention may be a 2,4, diamino heterocyclic compound. In some embodiments, the 4-oxo group of dihydrofolic acid may be modified to produce a DHFR inhibitor. In one embodiment, the 4-oxo group may be replaced with a 4-amino group. Various diamino heterocycles, including pteridine, quinazoline, pyridopyrimidine, pyrimidine, and triazine, may also be used as backbones for developing DHFR inhibitors and may be used in the present invention. The crystal structure of DHFR complexed with known DHFR inhibitors may be utilized in the rational design of more suitable DHFR ligands. Ligands used herein include a 2,4-diaminopyrimidine ring having a propargyl group linked to an arbitrarily substituted aryl or heteroaryl ring (US Pat. No. 8,426,432). As; its contents are incorporated herein by reference in its entirety).

In some embodiments, the ligand comprises a TMP-derived ligand comprising a portion of the ligand known to mediate binding to DHFR. The ligand may also be modified to reduce off-target binding to other folate-metabolizing enzymes and increase specific binding to DHFR.

3. 3. Payload: Immunotherapeutic Agent In some embodiments, the payload of the present invention may be an immunotherapeutic agent that induces an immune response in an organism. Immunotherapeutic agents can be, but are not limited to, cytokines, safety switches (eg, suicide genes), regulatory switches, chimeric antigen receptors, or any agent that induces an immune response. In one embodiment, the immunotherapeutic agent induces an anti-cancer immune response in a cell or subject.

In some embodiments, the payload of the invention may be any of the costimulatory molecules and / or intracellular domains described herein. In some embodiments, one or more co-stimulatory molecules, each under the control of a different SRE, may be used in the present invention. SRE-regulated co-stimulatory molecules may also be expressed with first-generation CAR, second-generation CAR, third-generation CAR, fourth-generation, or other CAR designs described herein.

Cytokines, chemokines, and other soluble factors According to the invention, the CARs of the invention may be utilized with other payloads of the invention, which include cytokines, chemokines, growth factors, and immune cells, cancer cells. And may be soluble proteins produced by other cell types, which function as chemical mediators between cells and tissues in the body. These proteins mediate a wide range of physiological functions, from effects on cell proliferation, differentiation, migration, and survival to several effector activities. For example, activated T cells produce various cytokines for cytotoxic function and eliminate tumor cells.

In some embodiments, the payloads of the invention include, but are not limited to, interleukins, tumor necrosis factor (TNF), interferon (IFN), TGFβ and chemokines, as well as fragments, variants, analogs thereof. And derivatives. It is understood in the art that specific gene and / or protein nomenclature for the same gene or protein may or may not include punctuation marks such as the dash "-" or symbols such as the Greek letter. Whether these are included or not included herein, it does not imply that their meaning is altered, as will be understood by those skilled in the art. For example, IL2, IL2, IL2 refer to the same interleukin. Similarly, TNF alpha, TNFα, TNF-alpha, TNF-α, TNFalpha and TNFα all refer to the same protein. In some embodiments, the payload of the invention may be a cytokine that stimulates an immune response. In other embodiments, the payload of the invention may be a cytokine antagonist that negatively affects the anti-cancer immune response.

In some embodiments, the payload of the invention may be a cytokine receptor, a recombinant receptor, a variant thereof, an analog, and a derivative; or a signaling component of a cytokine.

In some embodiments, the cytokines of the invention are utilized to _{proliferate, survive, persist, and proliferate immune cells such as CD8 + TEM} , natural killer cells and tumor infiltrating lymphocytes (TIL) cells used in immunotherapy. The efficacy may be improved. In other embodiments, T cells modified with two or more DD regulatory cytokines are utilized to provide rate control of T cell activation and tumor microenvironmental remodeling. In one aspect, the invention provides biological circuits and compositions for minimizing toxicity associated with cytokine therapy. Despite successful reduction of tumor mass, systemic cytokine therapy often causes serious dose-limiting side effects. Two factors contribute to the observed toxicity: (a) Pleiotropy, in which case cytokines affect different cell types and, in some circumstances, have the opposite effect on the same cells ( b) Cytokines have a short serum half-life and must be administered in high doses to achieve therapeutic effects, which exacerbates the pleiotropy effect. In one aspect, the cytokines of the invention may be utilized to regulate cytokine expression in events of adverse effects. In some embodiments, the cytokines of the invention may be designed to prolong lifespan or enhance specificity to minimize toxicity.

In some embodiments, the payload of the invention may be an interleukin (IL) cytokine. Interleukins (ILs) are a class of glycoproteins produced by white blood cells to regulate the immune response. As used herein, the term "interleukin (IL)" refers to an interleukin polypeptide derived from any species or source, including full-length proteins as well as fragments or portions of proteins. In some embodiments, the interleukin payload is IL1, IL1α (also called hematopoetin-1), IL1β (cataboline), IL1δ, IL1ε, IL1η, IL1ζ, interleukin-1 family members 1-11 (IL1F1 to IL1F11). , Interleukin-1 homologues 1 to 4 (IL1H1 to IL1H4), IL1-related proteins 1 to 3 (IL1RP1 to IL1RP3), IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11, IL11a, IL11b, IL12, IL13, IL14, IL15, IL16, IL17, IL17A, Il17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20-like (IL20L), Il21, IL22, IL23, IL23A, IL23- p19, IL23-p40, IL24, Il25, IL26, IL27, IL28A, IL28B, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, IL37d, It is selected from IL37e and IL38. In another aspect, the payload of the present invention is CD121a, CDw121b, IL2Rα / CD25, IL2Rβ / CD122, IL2Rγ / CD132, CDw131, CD124, CD131, CDw125, CD126, CD130, CD127, CDw210, IL8RA, IL11Rα, CD212, CD213α1. , CD213α2, IL14R, IL15Rα, CDw217, IL18Rα, IL18Rβ, IL20Rα, and IL20Rβ may be interleukin receptors selected from.

In one embodiment, the payload of the present invention may include IL2. In one aspect, the effector module of the present invention may be a DD-IL2 fusion polypeptide. The amino acid sequences corresponding to DD-IL2 and its components are shown in Table 4. The amino acid sequence in Table 4 may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

In some aspects of the invention, IL2 mutane may be used as the payload. As used herein, the term "mutain" is a construct, molecule or sequence that has a mutation, change or modification in a protein and is therefore also known as a variant, such as a protein variant, mutein. Therefore, "IL2 mutane" is an IL2 mutant. In some embodiments, IL2 mutane is a variant of the wild-type IL2 protein, which consists of the amino acid sequence of SEQ ID NO: 51. In some embodiments, it refers to an IL2 variant that binds and activates only cells expressing IL2Rαβγ, but not significantly to cells expressing only IL2Rβγ. In some examples, IL2 mutane may be an IL2 protein in which the IL2 residue responsible for binding to either IL2Rβ or IL2Rγ is replaced to negate the interaction of IL2Rβ or IL2Rγ with IL2 Good. In another example, IL2 mutane may be an IL2 protein containing a mutation that imparts a high affinity for IL2Rα. _{IL2 mutane is an IL2-selective agonist (IL2 SA} ) capable of preferentially activating the high-affinity IL2 receptor (ie, IL2Rαβγ) required to selectively activate T cells against NK cells. ) May be. In some embodiments, the IL2 mutane may be an IL2 protein that preferentially binds to the low affinity IL2Rβγ but has a reduced affinity for CD25.

In some embodiments, IL2 mutane may be used to preferentially proliferate or stimulate Treg cells. As used herein, "preferred proliferation or stimulation of Treg cells" means that IL2 muthein promotes the proliferation, survival, activation and / or function of regulatory T cells. ..

As exemplary IL2 mutane, IL2 with N88R substitution (Shanafeld et al., Nature Biotech., 2000, 18: 1197-1202), V91K substitution (eg, US Patent Publication No. US20140286898); V91K substitution, C125A substitution, IL2 with three mutations: V69A, N71R, Q74P; IL2 mutane with high affinity for IL2Rα (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P); high affinity for IL2Rα and signal IL2 muthein with reduced transduction activity (N29S, Y31H, K35R, T37A, K48E, V69A, N71R, Q74P, N88D) and D20H, D20I, N88G, N88I, N88R, and Q126L described in PCT application No. 1999060128. Substitutions may be mentioned, but not limited to these; their respective contents are incorporated herein by reference in their entirety. In another aspect, as IL2 mutane, US Pat. Nos. 4,518,584; 5,116,943; 5,206,344; 6,955,807; 7,105,653. No. 7,371,371; No. 7,803,361; No. 8,124,066; No. 8,349,311; No. 8,759,486; and No. 9,206,243; PCT Patent Publication Nos. WO2005086751 and WO20120884446; European Patents EP0234599 and EP0200280 and Sim, G. et al. C. et al. (2016) Cancer Immunol Res; 4 (11): 983-994 may be mentioned; the contents of each of them are incorporated herein by reference in their entirety.

In some embodiments, IL2 muthein may be fused to a polypeptide that prolongs the serum half-life of IL2 mutein, such as an IgG Fc fragment. Preferred Fc regions are derived from human IgG, including IgG1, IgG2, IgG3, and IgG4. In another aspect, the payload of the invention may be an IL2 fusion protein comparing a second functional polypeptide. In a non-limiting example, the IL2 fusion protein is an IL2 or IL2 matein fused to an apoptosis-promoting Bcl-2 family polypeptide (such as Bad, Bik / Nbk, Bid, Bim / Bod, Hrk, Bak or Bax). Polypeptides may be included; such fusion proteins may be capable of inhibiting cell survival, inhibiting cell proliferation, or promoting cell death or apoptosis of target cells expressing the IL2 receptor. Alternatively, IL2 or IL2 mutane polypeptides may be fused with anti-apoptotic Bcl-2 family polypeptides ( _{such as Bcl-XL} , Bcl-w or Bcl-2). The fusion protein may enhance cell survival, cell proliferation, or suppress cell death or apoptosis of target cells expressing the IL2 receptor. See, for example, US Patent Publication No. US2016 / 0229901.

In addition, the IL2 fusion protein can promote cell-cell interactions; therefore, it may be an IL2-GMCSF fusion protein that promotes an anti-cancer immune response (Wen et al., J. Transnational Med., 2016, 14:41).

Safety Switch In some embodiments, the payload of the present invention provides an SRE-regulated safety switch that can eliminate adopted cells when severely injured, thereby reducing the adverse effects of T cell therapy. Can include. Adopted T cells in immunotherapy may attack normal cells in response to normal tissue expression of TAA. Even the on-tumor targeting activity of adopted T cells can result in damaging factors such as tumor lysis syndrome, cytokine release syndrome, and associated macrophage activation syndrome. A safety switch may be utilized to eliminate adopted cells that have been improperly activated by apoptosis induction or immune surveillance.

In some embodiments, the payload of the invention may include an inducible killer / suicide gene that acts as a safety switch. When introduced into adoptive transplant immune cells, the killer / suicide gene can control their alloreactivity. The killer / suicide gene may be an apoptotic gene (eg, any caspase gene) that allows conditional apoptosis of transduced cells by administration of a non-therapeutic ligand for SRE (eg, DD).

In some embodiments, the payload of the invention may be a caspase-9. In some examples, caspase-9 may be modified to reduce basal expression and lack the caspase recruitment domain (CARD) (SEQ ID NO: 26 and SEQ ID NO: 28 of US Pat. No. US9434935B2; Incorporated by reference).

In one embodiment, the payload of the invention is the suicide gene system iCasp9 / chemoinduced dimerization (CID) system, which is a caspase-9 gene fused to a drug binding domain derived from the human FK506 protein. Consists of the derived polypeptide. Administration of the biologically inert small molecule AP1903 (rimiducid) induces cross-linking of the drug binding domain and dimerization of the fusion protein, as well as dimerization of caspase-9. This results in activation of the downstream effector caspase 3 and induction of cell apoptosis (Stratathof et al., Blood, 2005.105: 4247-4254; which is incorporated herein by reference in its entirety). Preclinical studies using CART containing the iCasp9 gene have shown effective elimination of CAR T cells in vivo in mouse models, demonstrating the potential effectiveness of this approach (Budde et al). , Plos One, 2013, 8: e82742.10.1371; Hoyos et al., Leukemia, 2010; 24 (6): 1160-1170). In one embodiment, the payload of the present invention may include a caspase-9. In one aspect, the effector module of the present invention may be a DD-caspase-9 fusion polypeptide. DD-caspase-9 may have the amino acid sequences shown in Table 5. The amino acid sequence in Table 5 may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

In some examples, the iCasp9 / CID system has been shown to exhibit basal dimerization rates in the absence of rimiducid, leading to unintended cell death. Regulation of the expression level of iCasp9 / CID is important for maximizing the efficacy of the iCasp9 / CID system. Any of the biological circuits and / or components thereof of the present invention may be utilized to optimize the usefulness of the iCasp9 / CID system for regulation or adjustment. Other examples of proteins used in the dimerization-induced apoptosis paradigm may include Fas receptors, the death effector domain of Fas-related proteins, FADD, caspase 1, caspase 3, caspase 7 and caspase 8. Not limited (Belshaw P. J. et al, Chem Biol., 996, 3: 731-738; MacColkle RA et al, Proc Natl Acad Sci, 1998, 95: 3655-3660; Speaker, DM. et al., Curr Biol. 1996; 6: 839-847; the respective contents are incorporated herein by reference in their entirety).

In some embodiments, the safety switch of the invention may include metabolic enzymes such as herpes simplex virus thymidine kinase (HSV-TK) and cytosine deaminase (CD). HSV-TK phosphorylates nucleoside analogs, including acyclovir and ganciclovir (GCV), to produce triphosphate-type nucleosides. It causes linkage arrest and cell death when incorporated into DNA. Unlike mammalian thymidine kinase, HSV-TK is characterized by a 1000-fold higher affinity for nucleoside analogs such as GCV and is suitable for use as a suicide gene in mammalian cells. Cytosine deaminase (CD) can convert 5-fluorocytosine (5-FC) to cytotoxic 5-fluorouracil (5-FU) (Tiraby et al., FEMS Lett., 1998, 167: 41- 49).

In some embodiments, the safety switch of the invention may include a CYP4B1 variant (as a suicide gene) that can be co-expressed in CAR-modified T cells (Roellecker et al., Gen Ther., 2016, May 19, doi: 10.1038 / gt. 2016.38).

In some embodiments, the payload of the invention may include a fusion construct capable of inducing cell death, eg, a polypeptide having the formula St-R1-S1-Q-S2-R2, in the formula. , St is a stalk sequence, R1 / 2 and Q are different epitopes; and S1 / 2 is an arbitrary spacer sequence (see International Patent Publication No. WO2013153391; its contents are described herein by reference in its entirety. Incorporate into the book).

In some embodiments, the safety switch can be mediated by a therapeutic antibody that specifically binds to an antigen expressed on the plasma membrane of the adopted cell. Antigen-antibody interaction allows cells to be abolished after administration of a particular monoclonal antibody against the antigen. As a non-limiting example, the payloads of the invention are a pair of antigens and antibodies used to mediate a safety switch, such as CD20 and anti-CD20 antibodies (Griffioen et al., Haematologica, 2009, 94: 1316-1320). ), Protein tag and anti-tag antibody (Kieback et al., Natl. Acad. Sci. USA, 2008, 105: 623-628), CD34 selection after administration of anti-CD20 monoclonal antibody, cell tracking , And a small suicide gene (RQR8) complex epitope derived from CD34 (as a marker moiety) and CD20 (as a suicide moiety) that allows cell deletion (Philip et al., Blood, 2014, 124: 1277-1287); Transected human EGFR polypeptides and anti-EGFR monoclonal antibodies (Wang et al., Blood, 2011, 118: 1255-1263); and small polys having structural formulas as described in US Patent Application Publication No. US20150930401. May include peptide safety switches; their respective contents are incorporated herein by reference in their entirety.

Regulatory switch The usefulness of adoptive cell therapy (ACT) has been limited by the high incidence of graft-versus-host disease (GVHD). GVHD develops when adopted T cells elicit an immune response, resulting in damage to the host tissue. Recognition of the host antigen by the transplanted cells triggers an pro-inflammatory cytokine storm cascade, which means acute GVHD. GVHD is characterized as an imbalance between effectors and the regulatory arms of the immune system. In some embodiments, the payload of the invention may be used as an adjustment switch. As used herein, "regulatory switch" refers to a protein that, when expressed in a target cell, enhances resistance to a graft by strengthening the regulatory arm of the immune system.

In one embodiment, the regulatory switch may include a payload that preferentially promotes the proliferation of regulatory T (Treg cells). Tregs are a distinct cell population that is actively selected on thymic high-affinity ligands and plays an important role in tolerance to self-antigens. In addition, Tregs have been shown to play a role in peripheral tolerance to foreign antigens. Since Tregs promote immune tolerance, proliferation of Tregs with the compositions of the invention may be desirable to limit GVHD.

In some embodiments, regulatory switches may include, but are not limited to, Treg activators such as, but not limited to, NFκβ, FOXO, nuclear receptor Nr4a, retinoic acid receptor α, NFAT, AP-1 and SMAD. .. Such factors result in the expression of Forkheadbox P3 (FOXP3) in T cells, resulting in activation of regulatory T cell programs and T cell proliferation.

In one embodiment, the regulatory switch may be FOXP3, which is a transcriptional regulator of T cells. The function of FOXP3 is to suppress the function of NFAT, which induces suppression of the expression of many genes including IL2 and effector T cell cytokines. FOXP3 is a transcriptional activity of genes such as CD2S, cytotoxic T lymphocyte antigen 4 (CTLA4), glucocorticoid-induced TNF receptor family gene (GITR), and folic acid receptor 4. It also functions as a chemical factor. FOXP3 suppresses the differentiation of IL17-producing helper T cells (Th17) by antagonizing RORC (RAR-related orphan receptor C). An isoform of FOXP3 lacking exon 2 (FOXP3δ2) or exon 7 (FOXP3δ7) may also be used as an adjustment switch. In one aspect, the effector module of the present invention may be a DD-FOXP3 fusion polypeptide. DD-FOXP3 may comprise the amino acid sequence shown in Table 6. The amino acid sequence in Table 6 may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

Antibodies In some embodiments, antibodies, fragments and variants thereof are payloads of the invention.

In some embodiments, the antibodies of the invention are, but are not limited to, Table 5 of co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, Alternatively, it may include any of those set forth in U.S. Patent Application No. 62 / 466,596 filed on March 3, 2017 and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety. ..

Antibody Fragments and Variants In some embodiments, antibody fragments and variants may include antigen-binding regions from intact antibodies. Examples of antibody fragments and variants are Fab, Fab', F (ab') 2, and Fv fragments; bispecific antibodies; linear antibodies; single chain antibody molecules such as single chain variable fragments (scFv); and antibodies. Multispecific antibodies formed from fragments can be, but are not limited to. Papain digestion of an antibody produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site. The remaining "Fc" fragments were also generated, and the names of these fragments reflect their ability to crystallize easily. Pepsin treatment produces an F (ab') 2 fragment that has two antigen binding sites and is still capable of cross-linking with the antigen. An effector module comprising a pharmaceutical composition, a biological circuit, a biological circuit component, an SRE or a payload of the present invention may contain one or more of these fragments.

For the purposes herein, an "antibody" may include heavy and light chain variable domains as well as Fc regions. As used herein, the term "natural antibody" is usually a heterotetramer of approximately 150,000 daltons consisting of two identical light (L) chains and two identical heavy (H) chains. Refers to glycoprotein. The genes encoding the heavy and light chains of an antibody are known, and the segments that make up each are well characterized and described (Matsuda et al., The Journal of Experimental Medicine. 1998, 188 (11)). : 2151-62 and Li et al., Blood, 2004, 103 (12): 4602-4609; the respective contents are incorporated herein by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes. In addition, each heavy chain and light chain has an intrachain disulfide bridge at regular intervals. At one end of each heavy chain is a variable domain (VH), followed by several constant domains. Each light chain has a variable domain (VL) at one end and a stationary domain at the other end. The constant domain of the light chain aligns with the first constant domain of the heavy chain, and the variable domain of the light chain aligns with the variable domain of the heavy chain.

As used herein, the term "variable domain" refers to antibody heavy and light chains that are significantly different in sequence between antibodies and are used for the binding and specificity of each particular antibody to a particular antigen. Refers to a specific antibody domain found in both. The variable domain includes a hypervariable region. As used herein, the term "hypervariable region" refers to a region within a variable domain that contains amino acid residues involved in antigen binding. Amino acids present within the hypervariable region determine the structure of complementarity determining regions (CDRs) that are part of the antibody's antigen binding site. As used herein, the term "CDR" refers to a region of an antibody that contains a structure complementary to a target antigen or epitope. The other part of the variable domain that does not interact with the antigen is called the framework (FW) region. The antigen binding site (also known as the antigen binding site or paratope) contains the amino acid residues required to interact with a particular antigen. The exact residues that make up the antigen-binding site are usually elucidated by co-crystallography with the bound antigen, but computational evaluation based on comparison with other antibodies can also be used (Strohl, WR. Therapeutic Antibodies Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are incorporated herein by reference in their entirety). The residues constituting the CDR were determined by Kabat (Wu et al., JEM, 1970, 132 (2): 211-250 and Johnson et al., Nucleic Acids Res. 2000, 28 (1): 214-218, The respective contents are incorporated herein by reference in their entirety), Cothia (Chothia and Lesk, J. Mol. Biol. 1987, 196, 901, Chothia et al., Nature, 1989, 342, 877, and Al. -Lazikani et al., J. Mol. Biol. 1997, 273 (4): 927-948, the contents of which are incorporated herein by reference in their entirety), Lefranc (Lefranc et al., Immunome Res. 2005: 1) and Honegger (Honegger and Plugtsun, J. Mol. Biol. 2001,309 (3): 657-70, the contents of which are incorporated herein by reference in their entirety). It may include, but is not limited to, the use of numbering schemes.

The VH and VL domains each have 3 CDRs. In the present specification, VL CDRs are referred to as CDR-L1, CDR-L2 and CDR-L3 in the order of appearance when they move from the N-terminal to the C-terminal along the variable domain polypeptide. In the present specification, VH CDRs are referred to as CDR-H1, CDR-H2 and CDR-H3 in the order of appearance when they move from the N-terminal to the C-terminal along the variable domain polypeptide. Each of the CDRs prioritizes the standard structure except for CDR-H3, which is an amino acid that is highly variable in sequence and length between antibodies and can result in various three-dimensional structures in the antigen-binding domain. It has a sequence (Nikoludis, et al., PeerJ. 2014, 2: e456). In some cases, CDR-H3 may be analyzed between panels of relevant antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, WR Therapeutic Antibodying. Woodhead Publishing, Philadelphia PA. 2012. C. 3, p47-54, the contents of which are incorporated herein by reference in their entirety).

As used herein, the term "Fv" refers to an antibody fragment that contains the smallest fragment on an antibody required to form a complete antigen binding site. These regions consist of a non-covalent, tightly bound dimer of one heavy chain and one light chain variable domain. Fv fragments can be produced by proteolysis, but are mostly unstable. Usually by inserting a flexible linker between the light chain variable domain and the heavy chain variable domain (to form a single chain Fv (scFv)), or by disulfide between the heavy chain and light chain variable domain Recombinant methods for producing stable Fv fragments by introducing crosslinks are known in the art (Strohl, WR Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA.2012.C. P46-47, the contents of which are incorporated herein by reference in their entirety).

As used herein, the term "light chain" is any vertebrate species assigned to one of two distinctly distinct types called κ and λ based on the amino acid sequence of the constant domain. Refers to the components of the derived antibody. Antibodies can be assigned to different classes depending on the amino acid sequence of the constant domain of the heavy chain. Intact antibodies: There are five major classes: IgA, IgD, IgE, IgG, and IgM, some of which are further subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA, and IgA2. Can be classified as.

As used herein, the term "single chain Fv" or "scFv" refers to a fusion protein of VH and VL antibody domains, where these domains are single polypeptides by a flexible peptide linker. Connected to a chain. In some embodiments, the Fv polypeptide linker allows scFv to form the desired structure for antigen binding. In some embodiments, scFv is utilized in combination with a phage display method, yeast display method, or other display method, in which case the scFV is expressed in association with a surface member (eg, a phage coat protein). It may be used to identify a high affinity peptide for a given antigen.

Using molecular genetics, two scFvs can be designed in tandem into a single polypeptide separated by a linker domain called a "tandem scFv" (tascFv). Constructing a tascFv containing two different scFv genes produces a "bispecific single chain variable fragment" (bis-scFv). Only two tascFvs have been clinically developed by commercial companies; both are bispecific agents in the active early stage development by Micromet for oncological indications, "bispecific T". It is described as "Cell Engager (BiTE)". Blinatumomab is an anti-CD19 / anti-CD3 bispecific tascFv that enhances the T cell response to Phase 2 B-cell non-Hodgkin's lymphoma. MT110 is an anti-EP-CAM / anti-CD3 bispecific tascFv that enhances the T cell response to Phase 1 solid tumors. A bispecific, tetravalent "TandAb" has also been studied by Affimed (Nelson, AL, MAbs., 2010, Jan-Feb; 2 (1): 77-83). A maxibody (divalent scFv fused to the amino terminus of the Fc (CH2-CH3 domain) of IgG) may also be included.

As used herein, the term "bispecific antibody" refers to an antibody capable of binding two different antigens. Such antibodies usually include regions derived from at least two different antibodies. As a bispecific antibody, Riethmüller, G. et al. Cancer Immunology. 2012, 12: 12-18, Marvin et al. , 2005. Acta Pharmacologica Sinica. 2005, 26 (6): 649-658 and Schaefer et al. , PNAS. 2011, 108 (27): 11187-11192 may be mentioned, the content of each of which is incorporated herein by reference in its entirety.

As used herein, the term "diabody" refers to a small molecule antibody fragment having two antigen binding sites. Diabody is a functional bispecific single chain antibody (bscAb). The diabody comprises a heavy chain variable domain VH linked to a light chain variable domain VL in the same polypeptide chain. By using a linker that is too short to pair two domains on the same strand, the domain is forced to pair with the complementary domain of another strand, creating two antigen binding sites. Diabodies are described, for example, in EP404,097; WO93 / 11161; and Hollinger et al. (Hollinger, P. et al., "Diabodies": Small biological and bispecific antibodies. PNAS, 1993.90: 6444-6448); the contents of each of which are described in its entirety. Incorporate into the book.

The term "intracellular antibody" refers to the form of an antibody that is not secreted by the cell in which the antibody is produced, but instead targets one or more intracellular proteins. Intracellular antibodies may be used to affect a number of cellular processes including, but not limited to, intracellular transport, transcription, translation, metabolic processes, proliferation signaling and cell division. In some embodiments, the methods of the invention may include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein may be incorporated into one or more constructs for intracellular antibody-based therapy.

As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., a variant that may occur during the production of a monoclonal antibody. Except for (such variants are generally present in small amounts), the individual antibodies contained in the population are identical and / or bind to the same epitope. In contrast to polyclonal antibody preparations, which usually contain different antibodies against different determinants (epitopes), each monoclonal antibody faces a single determinant on the antigen.

The modifier "monoclonal" indicates an antibody characteristic of being obtained from a substantially homogeneous population of antibodies and should not be construed as requiring the production of the antibody by any particular method. Monoclonal antibodies herein have a heavy chain and / or a portion of the light chain that is identical or homologous to the corresponding sequence of an antibody that is derived from a particular species or belongs to a particular antibody class or subclass. However, on the other hand, the remainder of the chain (s) are identical or homologous to antibodies derived from or belonging to another antibody class or subclass, as well as the corresponding sequences of fragments of such antibodies. Includes "chimeric" antibodies (immunoglobulins).

As used herein, the term "humanized antibody" is derived from the smallest portion from one or more non-human (eg, mouse) antibody sources (s) and from one or more human immunoglobulin sources. Refers to a chimeric antibody containing the remainder. In most cases, the humanized antibody is a human immunoglobulin (recipient antibody), where the residues in the hypervariable region from the recipient antibody have the desired specificity, affinity, and / or performance. , Mice, rats, rabbits or non-human primates, etc., are replaced with hypervariable region residues from non-human antibody (donor antibody). In one embodiment, the antibody may be a humanized full-length antibody. As a non-limiting example, the antibody may be humanized using the methods set forth in US Patent Publication No. US201303033399, the contents of which are hereby incorporated by reference in their entirety.

As used herein, the term "antibody variant" refers to a modified antibody (relative to a natural or initiating antibody) or a biomolecule similar in structure and / or function to a natural or initiating antibody (eg, antibody mimicry). (Body). Antibody variants may have altered amino acid sequences, compositions, or structures compared to native antibodies. Antibody variants include isotyped antibodies (eg, IgA, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, and multispecific antibody variants (eg, dual). Specific variants), and antibody fragments, but are not limited to these.

In some embodiments, the effector module comprising the pharmaceutical composition, biological circuit, biological circuit components, SRE or payload of the present invention may be an antibody mimetic. As used herein, the term "antibody mimic" refers to any molecule that mimics the function or effect of an antibody and binds specifically and with high affinity to those molecular targets. In some embodiments, the antibody mimetic may be a monobody designed to incorporate the fibronectin type III domain (Fn3) as a protein backbone (US6,673,901; US6,348,584). In some embodiments, antibody mimetics include, but are not limited to, antibodies known in the art that include, but are not limited to, affibody molecules, affiline, affitin, anticarin, avimer, Centyrin, DARPINSTM, Phynomer and Kunitz and domain peptides. It may be a mimic. In other embodiments, the antibody mimetic can include one or more non-peptide regions.

In one embodiment, the antibody may include a modified Fc region. As a non-limiting example, the modified Fc region may be made by the method described in US Patent Publication No. US20150065690, or may be any region described therein, the contents of which may be. The entire body is incorporated herein by reference.

In some embodiments, the payload of the invention may encode a multispecific antibody that binds to more than one epitope. As used herein, the term "multibody" or "multispecific antibody" refers to an antibody in which two or more variable regions bind to different epitopes. Epitopes may be on the same or different targets. In one embodiment, the multispecific antibody may be produced and optimized by the methods described in International Patent Publication No. WO2011109726 and US Patent Publication No. US201550252119, the contents of which are hereby referenced in their entirety. Invite to. These antibodies can bind to multiple antigens with high specificity and high affinity.

In certain embodiments, the multispecific antibody is a "bispecific antibody" that recognizes two different epitopes on the same or different antigens. In one aspect, the bispecific antibody can bind to two different antigens. Such antibodies usually contain antigen binding regions from at least two different antibodies. For example, bispecific monoclonal antibodies (BsMAb, BsAb) are artificial proteins consisting of fragments of two different monoclonal antibodies, so BsAb can bind to two different types of antigens. Bispecific antibody frameworks include Riethmüller, G. et al. , 2012. Cancer Immunology, 2012, 12: 12-18; Marvin et al. , Acta Pharmacologica Sinica. 2005, 26 (6): 649-658; and Schaefer et al. , PNAS. 2011, 108 (27): 11187-11192 may be included, the content of each of which is incorporated herein by reference in its entirety. A new generation of BsMAbs called "trifunctional bispecific" antibodies has been developed. They consist of two heavy chains and two light chains, each derived from two different antibodies, with two Fab regions (arms) facing the two antigens and two Fc regions (legs). It contains heavy chains and forms a third binding site.

In some embodiments, the payload may encode an antibody that contains a single antigen binding domain. These molecules are very small, about one-tenth the molecular weight observed at full size mAbs. Further antibodies may include "Nanobodies" derived from the antigen-binding variable heavy chain region (VHH) of heavy chain antibodies found in camels and llamas that lack the light chain (Nelson, AL, MAbs. 2010. Jan). -Feb; 2 (1): 77-83).

In some embodiments, the antibody may be "miniaturized". The best example of mAb miniaturization is the Trubion Pharmaceuticals Small Modular Immunopharmaceutical (SMIP). These molecules can be monovalent or divalent and contain one VL, one VH antigen binding domain, and one or two constant "effector" domains, all of which are recombinant units linked by a linker domain. It is a chain molecule. Presumably, such molecules may offer the benefit of increased tissue or tumor permeability acquired by the fragment, while retaining the immune effector function conferred by the constant domain. At least three "miniaturized" SMIPs have entered the clinical development phase. TRU-015, an anti-CD20 SMIP co-developed with Wyeth, is the most advanced project and is in Phase 2 of rheumatoid arthritis (RA). Previous attempts at systemic lupus erythematosus (SLE) and B-cell lymphoma were finally discontinued. Trubion and Facet Biotechnology are collaborating on the development of TRU-016, an anti-CD37 SMIP for the treatment of CLL and other lymphoid tumors, a project that has reached Phase 2. Wyeth has licensed the anti-CD20 SMIP SBI-087 for the treatment of autoimmune diseases such as RA, SLE, and possibly multiple sclerosis, but these projects remain in the early stages of clinical trials. (Nelson, AL, MAbs, 2010. Jan-Feb; 2 (1): 77-83).

One example of a miniaturized antibody is called a "unibody", where the hinge region has been removed from the IgG4 molecule. IgG4 molecules are unstable and can exchange light-heavy chain heterodimers with each other, but removal of the hinge region completely prevents heavy and heavy chain pairing and is highly specific monovalent. While maintaining the light chain / heavy chain heterodimer, it retains the Fc region to ensure in vivo stability and half-life. This configuration can minimize the risk of immune activation or carcinogenic growth (eg, Nelson) due to inadequate interaction between IgG4 and FcR and the inability of monovalent unibodies to promote the formation of intracellular signaling complexes , AL, MAbs, 2010. Jan-Feb; 2 (1): 77-83).

In some embodiments, the payload of the invention may encode a single domain antibody (sdAb, or Nanobody) that is an antibody fragment consisting of a single monomeric variable antibody domain. It can selectively bind to a particular antigen, as well as the entire antibody. In one aspect, the sdAb may be "camel Ig" or "camelid VHH". As used herein, the term "camel Ig" refers to the smallest known antigen-binding unit of a heavy chain antibody (Koch-Nolte, et al, FASEB J., 2007, 21: 3490-3298). ). "Heavy chain antibody" or "camelid antibody" refers to an antibody that contains two VH domains and does not contain a light chain (Riechmann L. et al, J. Immunol. Patents, 1999, 231: 25-38; International Patent Publication Nos. WO1994 / 04678 and WO1994 / 025591; and US Pat. No. 6,005,079). In another aspect, the sdAb may be an "immunoglobulin novel antigen receptor" (Ig NAR). As used herein, the term "immunoglobulin novel antigen receptor" is a shark immunization consisting of homodimers of one variable novel antigen receptor (VNAR) domain and five constant novel antigen receptor (CNAR) domains. Refers to the class of antibodies derived from the repertoire. Ig NAR represents some of the smallest known protein scaffolds based on immunoglobulins, is very stable and has efficient binding properties. Inherent stability is (i) the underlying Ig scaffold that presents a significant number of charged and hydrophilic surface-exposed residues compared to the conventional antibody VH and VL domains found in mouse antibodies; and ( ii) Due to both inter-loop disulfide bridges and stabilized structural features of complementary determination region (CDR) loops, including intra-loop hydrogen bond patterns.

In some embodiments, the payload of the invention may encode an intracellular antibody. An intracellular antibody is a type of antibody that targets one or more intracellular proteins rather than being secreted by the cells that produce the antibody. Intracellular antibodies are used to express and function intracellularly and to affect a number of cellular processes including, but not limited to, intracellular transport, transcription, translation, metabolic processes, proliferation signaling, and cell division. You may. In some embodiments, the methods described herein include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein are incorporated into one or more constructs for intracellular antibody-based therapy. For example, intracellular antibodies can target one or more glycated intracellular proteins or regulate the interaction between one or more glycated intracellular proteins and alternative proteins.

By intracellular expression of intracellular antibodies in different compartments of mammalian cells, it is possible to block or regulate the function of endogenous molecules (Biocca, et al., EMBO J. 1990, 9: 101-108; Colby). et al., Proc. Natl. Acad. Sci. USA 2004, 101: 17616-17621). Intracellular antibodies can alter protein folding, protein-protein interactions, protein-DNA interactions, protein-RNA interactions, and protein modifications. Intracellular antibodies can induce phenotypic knockout and act as neutralizers by direct binding to the target antigen, bypassing intracellular transport, or inhibition of binding to a binding partner. Due to its high specificity and affinity for the target antigen, intracellular antibodies have the advantage of blocking certain binding interactions of a particular target molecule while not affecting other molecules.

The intracellular antibody may be developed using the sequence derived from the donor antibody. Intracellular antibodies are often recombinantly expressed as single domain fragments such as isolated VH and VL domains, or as intracellular single chain variable fragment (scFv) antibodies. For example, intracellular antibodies are often expressed as a single polypeptide to form a single chain antibody that contains the variable domains of heavy and light chains bound by a flexible linker polypeptide. Usually, intracellular antibodies lack disulfide bonds and can regulate the expression or activity of target genes by specific binding activity. Single-chain intracellular antibodies are often expressed from recombinant nucleic acid molecules and designed to be retained intracellularly (eg, retained in the cytoplasm, endoplasmic reticulum, or periplasm). Intracellular antibodies include: (Marasco et al., PNAS, 1993, 90: 7889-7893; Chen et al., Hum. Gene Ther. 1994, 5: 595-601; Chen et al., 1994, PNAS, 91: 5932-5936; Maciejewski et al., 1995, Nature Med., 1: 667-673; Marasco, 1995, Immunotech, 1: 1-19; Mahsilkar, et al., 1995, EMBO J. 14: 1542-51; Chen et al., 1996, Hum. Gene Therap., 7: 1515-1525; Marasco, Gene Ther. 4: 11-15, 1997; Rondon and Marasco, 1997, Annu. Rev. Microbiol. 51: 257-283; Cohen, et al., 1998, Oncogene 17: 2445-56; Proba et al., 1998, J. Mol. Biol. 275: 245-253; Cohen et al., 1998, Oncogene 17: 2445-2456; Hassanzadeh, et al., 1998, FEBS Lett. 437: 81-6; Richardson et al., 1998, Gene The 5: 635-44; Ohage and Steipe, 1999, J. Mol. Biol. 291: 1119-1128; Ohage et al., 1999, J. Mol. Biol. 291: 1129-1134; Wirtz and Steipe, 1999, Protein Sci. 8: 2245-2250; Zhu et al., 1999, J. Immunol. Methods 231: 207-222. Arafat et al., 2000, Cancer Gene Ther. 7: 1250-6; der Mar et al., 2002, J. Biol. Chem. 277: 45075-85; Mahilkar et al., 2002 Gene Ther. 9 :. 307-19; and Wheeler et al., 2003, FASEB J. 17: 1733-5; and references cited therein. ) May be generated using methods known in the art as disclosed and outlined in the art.

In some embodiments, the payload of the invention may encode the biosynthetic antibody described in US Pat. No. 5,091,513, the contents of which are hereby incorporated by reference in its entirety. .. Such antibodies may comprise one or more sequences of amino acids that make up a region that behaves as a biosynthetic antibody binding site (BABS). This site is 1) a non-covalent or disulfide-bonded synthetic VH and VL dimer, 2) a VH-VL or VL-VH single chain in which VH and VL are bound by a polypeptide linker, or 3) an individual VH or VL. Includes domain. The binding domain comprises linked CDR and FR regions that can be derived from distinct immunoglobulins. Biosynthetic antibodies may also contain, for example, enzymes, toxins, binding sites, or other polypeptide sequences that function as sites of attachment to immobilization media or radioactive atoms. A method for producing a biosynthetic antibody, a method for designing a BABS having an arbitrary specificity that can be induced by in vivo production of an antibody, and a method for producing an analog thereof are disclosed.

In some embodiments, the payload may encode an antibody with the antibody acceptor framework set forth in US Pat. No. 8,399,625. Such an antibody acceptor framework may be particularly suitable for receiving CDRs from the antibody of interest.

In one embodiment, the antibody may be a conditionally active biological protein. Antibodies are used to produce conditionally active biological proteins that are reversibly or irreversibly inactivated under normal wild-type physiological conditions, and such conditionally active biological proteins. The use of proteins and such conditional active biological proteins may be provided. Such methods and conditionally active proteins are set forth, for example, in WO2015175375 and WO2016036916 and US Patent Publication US201404378660, the contents of each of which are hereby referred to in their entirety. Invite to.

Preparation of Antibodies The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. The technique for producing an antibody is well known in the art, for example, Harlow and Line “Antibodies, A Laboratory Manual”, Cold Spring Harbor Laboratory Press, 1988; Press, 1999 and "Therapeutic Antibodies Engineering: Currant and Future Advances Driving the Strongest Growth Area in the Pharmaceutical"

The antibodies described herein and fragments and variants thereof can be produced using recombinant polynucleotides. In one embodiment, the polynucleotide has a modular design that encodes at least one of an antibody, fragment or variant thereof. As a non-limiting example, a polynucleotide construct may encode any of the following designs: (1) antibody heavy chain, (2) antibody light chain, (3) antibody heavy chain and light. Chains, (4) heavy and light chains separated by linkers, (5) VH1, CH1, CH2, CH3 domains, linkers and light chains, or (6) VH1, CH1, CH2, CH3 domains, VL regions, and Light chain. Each of these designs may include an optional linker between any domain and / or region. The polynucleotides of the invention may be designed to produce standard class immunoglobulins using any of the antibodies described herein or components thereof as starting molecules.

Also well known in the art, for example, Clackson et al. , 1991, Nature 352: 624-628; Marks et al. , 1991, J.M. Mol. Biol. Recombinant antibody fragments may be isolated from the phage antibody library using the techniques described in 222: 581-597. Recombinant antibody fragments may be derived from a large-scale phage antibody library produced by recombination in bacteria (Sblattero and Bradbury, 2000, Nature Biotechnology 18: 75-80; its contents are in its entirety. Incorporated herein by reference).

Antibodies for Immunotherapy In some embodiments, the payload of the invention may be an antibody specific for a tumor-specific antigen (TSA) and a tumor-related antigen (TAA), fragments and variants thereof. Antibodies circulate in the body until they discover and bind to TSA / TAA. Once bound, the antibody mobilizes other parts of the immune system, increasing ADCC (Antibody-Dependent Cell Damage) and ADCP (Antibody-Dependent Cell Phagocytosis) and destroying tumor cells. As used herein, the term "tumor-specific antigen (TSA)" means an antigenic substance produced by a tumor cell and can elicit an antitumor immune response within the host organism. In one embodiment, the TSA may be a neoplastic antigen. Tumor antigen-specific antibodies mediate a complement-dependent cytotoxic response to tumor cells expressing the same antigen.

In some embodiments, the tumor-specific antigen (TSA), tumor-related antigen (TAA), pathogen-related antigen, or fragment thereof can be expressed as a peptide or intact protein or part thereof. Intact proteins or parts thereof can be natural or mutagenic. The cancer or virus-induced cancer-related antigens described herein are well known in the art. Such TSA or TAA may already be associated with cancer or may be identified by any method known in the art.

In one embodiment, the antibody may be a GD2 ganglioside. In one embodiment, the payload of the invention may be an antibody specific for the GD2 antigen, fragments and variants thereof. Gangliosides expressed on the surface of tumor cells can be targeted for cancer immunotherapy. GD2 is a disialoganglioside of the molecular formula C74H134N4032. Gangliosides are acidic glycosphingolipids found on the outer surface of most cell membranes. These are ideal targets for immunotherapy due to their high antigen concentration, lack of regulation, relative homogeneity in many tumors, and the potential for upregulation by cytokines. Many tumors have abnormal glycolipid composition and structure. GD2 has been found in a wide range of human tumors, including tumors of neuroectoderm or epithelial origin, virtually all melanomas, and approximately 50% of tumor samples from osteosarcoma and soft tissue sarcoma. Antibodies with high affinity for GD2 include 1B7, 2H12, 1G2, 1E9, 1H3, 2F5, 2F7, 31F9, 31F9V2, 32E2, chl4.18, bul4.18, 3F8, 8B6, 4B5, 1A7, A1G4, GD2 mimotope. , Hul 4.18K322A, 5F11, 3G6, 14g2a, and 14.18, but are not limited thereto. In one embodiment, the GD antibody is a 14 g2a antibody (Mujoo K., et al. (1989) Cancer Res. 1; 49 (11): 2857-61; the content of which is incorporated herein by reference in its entirety. To do). One of these GD2 antibodies is described in Long A. et al. H. et al. (2015) Nat Med. 21 (6): 581-90; the content of which is incorporated by reference in its entirety).

In one embodiment, the antigen is a HER2 antigen. In one embodiment, the payload of the invention may be an antibody specific for the HER2 antigen, fragments and variants thereof. HER2 is an oncogene product of a human epidermal growth factor receptor 2-related oncogene, and is a transmembrane receptor protein having a molecular weight of 185 kDa and a tyrosine kinase domain. HER2 is a member of the EGFR family consisting of HER1 (EGFR, ERBB1), HER2 (neu, ERBB-2), HER2 (ErbB-3), and Her4 (ErbB-4), and is a member of the EGFR family of intracellular tyrosine residues. It is known to be autophosphorylated by homodimer formation or heterodimer formation with other EGFR receptors HER1, HER3, HER4 and is activated in this way. Thereby, it plays an important role in cell proliferation, differentiation, and survival of normal and tumor cells. In some embodiments, the HER2 antibodies useful in the present invention include 3B5 (from Oncogene Science / BAYER), 2C4 (ATCC HB-12679), 7C2 (ATCC HB-12215), ApoB17F / ocHER2, 8A4 (ATCC PTA) -4565), A10A12 (ATCC PTA-4566), 9G6, 7H4, AlOE9, A12D6, A6B12, A10E11, B3G4, A5C7, 13A11, 11C11, 13E11, Her2Bi (OKT3 x 9184), Her2Bi (OK3 x 9184), Her2Bi (OK3) ATCC HB-12216), huMAb4D5-1, huMAb4D5-2, huMAb4D5-3, huMAb4D5-4, huMAb4D5-6, huMAb4D5-7,520C9, CB-11 (Novocastra Laboratories), NCLBor 2C4 variant 560, humanized 2C4 variant 561, humanized 2C4 variant 562, humanized 2C4 variant 568, humanized 2C4 variant 569, humanized 2C4 variant 570, humanized 2C4 variant 571, humanized 2C4 Variants 56869, 3E8, 3H4, Cl 11 (NeoMarkers), HER-81, 452F2 736G9, 741F8, 758G5, 761B10, anti-p185HER2 / FcγRIII (CD16), anti-CD3 / anti-p185HER2, Hu4D5-8 and variants, 4D5- , CB11 (manufactured by Ventana Medical Scientific Instruments), 6E9, 2H11, 5B8, 7D3, HER50, HER66, HER70, scFv C6.5, scFv C6ML3-9 (ML3.9 or C6ML3.9), scFv C C6MH3.B1), scFv C6-B1D2 (B1D2 or C6MH3-B1D2), ALM, L87, N28, N12, MGr6, 9GG. 10 (Neomarkers), MGFc-5 (V379M), MGFc-9 (F243I, V379L), MGFc-10 (K288N, A330S, P396L), MGFc-13 (K334E, T359N, T366S), MGFc-27 (G316D) , D399E), MGFc-37 (K248M), MGFc-39 (E293V, Q295E, A327T), MGFc-38 (K392T, P396L), MGFc-41 (H268N, P396L), MGFc-23 (K334E, R292L), MGFc -44, MGFc-45, MDX-210, 17.6.4, HER2-PY1248, MAb74, FRP5, TAb250, HER-81, PN2A, mAb191924 (R & D systems), IDMl, scFv23, Ab-3, Ab-5 , 2502A, Rexomun, MAB-1129 (R & D systems), and MM-111. In one embodiment, the antibody having high affinity can be derived from any of the heavy and light chain variable regions of the HER2 antibody listed in Table 7.

In one embodiment of the invention, the antigen is CD33. In one embodiment, the payload of the invention may be an antibody specific for the CD33 antigen, fragments and variants thereof. Acute myeloid leukemia (AML) is the second most common acute leukemia in the United States. Commonly applied treatments for leukemia disease include irradiation and / or chemotherapy. However, very often, the cells that survived chemotherapy are rich in AML leukemia stem cells (AML-LSC), forming a reservoir of cells that can repopulate and cause recurrence, so 65 of the treated patients. ~ 80% relapse. AML-LSC expresses a characteristic set of cell surface antigens, including other CD33s. CD33 (sialic acid-bound Ig-like lectin 3) or SIGLEC3 (UNIPROT ID: P20138) is a transmembrane receptor expressed on myeloid cells. It is usually considered bone marrow-specific, but is also found in some lymphoid cells. CD33 is a member of the SIGLEC family of lectins because it binds to sialic acid. Exemplary antibodies targeting CD33 include, but are not limited to, M195, M2H12, DRB2, My9-6. In one embodiment, the antibody is derived from My9.6. In some embodiments, the antibody having high affinity can be derived from any of the heavy and light chain variable regions of the CD33 antibody listed in Table 7.

In one embodiment, the antigen of the invention is BCMA (B cell maturation antigen), also referred to as CD269. In one embodiment, the payload of the invention may be an antibody specific for the BCMA antigen, fragments and variants thereof. The BCMA antigen (UNIPROT ID: Q02223) is encoded by the gene TNFRS17. BCMA is a member of the TNF receptor superfamily. BCMA binds to B cell activating factor (BAFF) and growth-inducing ligand (APRIL). Among non-malignant cells, BCMA has been reported to be expressed predominantly in plasma cells and a subset of mature B cells, but not in T cells and NK cells. Therefore, BCMA is a suitable therapeutic drug candidate for the treatment of multiple myeloma. Exemplary antibodies that target BCMA include, but are not limited to, BCMA50, BCMA30, C11D5.3 and C13F12.1. In one embodiment, the antibody is derived from C11D5.3. In some embodiments, the antibody having high affinity can be derived from any of the heavy and light chain variable regions of the BCMA antibody listed in Table 7.

In one embodiment, the antigen of the invention is CD276 (also known as B7-H3). In one embodiment, the payload of the invention may be an antibody specific for CD276, a fragment thereof, and a variant thereof. CD276 is expressed in a variety of human tumors, including pediatric solid tumors and adult carcinomas. Any of the CD276 antibodies set forth in International Patent Publication WO2017044699 and WO2014160627, the contents of which are incorporated herein by reference in their entirety, may be useful in the present invention. In some embodiments, the antibody having high affinity can be derived from any of the heavy and light chain variable regions of the CD276 antibody listed in Table 7.

In one embodiment, the antigen of the invention is an ALK protein. ALK, a developmentally regulated cell surface receptor tyrosine kinase, is known to be expressed as a tumor-related antigen as a fusion protein resulting from a chromosomal translocation. Cancer-related ALK was first described as a 2; 5 translocation associated with nucleophosphomin (NPM) in anaplastic large cell leukemia. The fusion protein consists of the intracellular components of NPM fused to ALK. In some embodiments, the ALK antigen may be the extracellular portion of the protein. Any of the ALK-specific antibodies, fragments and variants can be useful in the present invention. In one embodiment, the ALK antibody described in International Patent Publication WO 2015069922 (whose content is incorporated herein by reference in its entirety). In some embodiments, the antibody having high affinity can be derived from any of the heavy and light chain variable regions of the ALK antibody listed in Table 7.

In one embodiment, the antigen of the invention is a CD22 antigen. In one embodiment, the payload of the invention may be an antibody specific for CD22, a fragment thereof, and a variant thereof. CD22 is a strain-restricted B cell antigen belonging to the immunoglobulin (Ig) superfamily. CD22 is expressed in 60-70% of B-cell lymphoma and leukemia (eg, B-cell chronic lymphocytic leukemia, hairy cell leukemia, acute lymphocytic leukemia (ALL) and Burkitt lymphoma) and is in the early stages of B cell development. Not present on the cell surface or stem cells of. In some embodiments, the antibody, fragment, and variant thereof may be any of those shown in International Patent Publication WO2016149578, WO2014056961, and WO2013059593A1 (each content is hereby incorporated by reference in its entirety). ). In some embodiments, the high affinity antibody can be derived from any of the heavy and light chain variable regions of the CD22 antibody listed in Table 7.

In some embodiments, the payload of the invention may include an antigen binding region comprising a variable heavy chain and a variable light chain having an amino acid sequence selected from the amino acid sequences of Table 7.

Chimeric antigen receptor (CAR)
In some embodiments, the payload of the invention may be a chimeric antigen receptor (CAR), which is an extracellular target of CAR when transfected into immune cells (eg, T cells and NK cells). Immune cells can be redirected to a target (eg, a tumor cell) that expresses a molecule recognized by the moiety.

As used herein, the term "chimeric antigen receptor (CAR)" refers to a synthetic receptor that mimics TCR on the surface of T cells. In general, CAR consists of an extracellular targeting domain, a transmembrane domain / region and an intracellular signaling / activation domain. In a standard CAR receptor, the components: extracellular targeting domain, transmembrane domain and intracellular signaling / activation domain are constructed linearly as a single fusion protein. The extracellular space comprises a targeting domain / part (eg, scFv) that recognizes a particular tumor antigen or other tumor cell surface molecule. The intracellular region is the signaling domain of the TCR complex (eg, the signaling domain of CD3ζ) and / or one or more co-stimulating signaling domains, such as CD28, 4-1BB (CD137) and OX-40 (CD134). ) Can include the domain of origin. For example, the "first generation CAR" has only the CD3ζ signaling domain. In order to enhance the persistence and proliferation of T cells, a co-stimulating intracellular domain was added, a second-generation CAR with one co-stimulating signaling domain in addition to the CD3ζ signaling domain, and 2 in addition to the CD3ζ signaling domain. A third generation CAR with one or more co-stimulation signaling domains is produced. When expressed on T cells, CAR provides T cells with antigen specificity determined by the extracellular targeting portion of CAR. Recently, it has also been desired to add one or more elements such as homing genes and suicide genes to develop a more qualified and safe CAR architecture called 4th generation CAR.

In some embodiments, the extracellular targeting domain is attached to the intracellular signaling domain via a hinge (also called a interstitial domain or spacer) and a transmembrane domain. The hinge connects the extracellular targeting domain to a transmembrane domain that traverses the cell membrane and connects to the intracellular signaling domain. Due to the size of the target protein to which the targeting moiety binds, and the size and affinity of the targeting domain itself, it may be necessary to change the hinge to optimize the efficacy of CAR transformed cells against cancer cells. is there. Upon recognition and binding of the targeting moiety to the target cell, the intracellular signaling domain directs the activation signal to the CAR T cell, which is further amplified by the "second signal" from one or more intracellular co-stimulation domains. To. CAR T cells can destroy target cells when activated.

In some embodiments, the CAR of the invention may be split into two parts, each part linked to a dimerization domain, resulting in an intact functional due to the input causing dimerization. Receptor assembly is facilitated. Wu and Lim recently separated the extracellular CD19 binding domain from the intracellular signaling element and linked them to the FKBP domain and the FRB ^* (T2089L variant of FKBP-rapamycin binding) domains, which in the presence of the rapamycin analog AP21967. We have reported split CAR, which is heterodimerized. The split receptor is assembled in the presence of AP21967 and activates T cells with specific antigen binding (Wu et al ,, Science, 2015, 625 (6258): aab4077).

In some embodiments, the CAR of the present invention may be designed as an inductive CAR. Sakemura et al. Recently reported the incorporation of a Tet-On induction system into a CD19 CAR construct. CD19 CAR is activated only in the presence of doxycycline (Dox). Sakemura shows that Tet-CD19CAR T cells in the presence of Dox are ^{equally cytotoxic to CD19 +} cell lines and have similar cytokine production and proliferation upon CD19 stimulation compared to conventional CD19CAR T cells. (Sakemura et al., Cancer Immuno. Res., 2016, June 21, electronic version). In one embodiment, the Tet-CAR may be the payload of an effector module under the control of the SRE (eg, DD) of the invention. The dual system provides more flexibility in turning CAR expression on and off of transduced T cells.

According to the present invention, the payload of the present invention may be a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR. Embodiments of typical effector modules including CAR constructs are shown in FIGS. 13-18. In some embodiments, the payload of the invention may be a complete CAR construct consisting of an extracellular domain, a hinge and transmembrane domain, and an intracellular signaling region. In other embodiments, the payload of the invention includes, but is not limited to, a leader sequence, a homing element and a safety switch, or a combination of such components, an extracellular targeting moiety that enhances the CAR architecture and functionality. It may be a component of a complete CAR construct, including a hinge region, a transmembrane domain, an intracellular signaling domain, one or more co-stimulation domains, and other additional elements.

The CARs regulated by the biological circuits and compositions of the present invention are adjustable, thereby providing some advantages. A reversible on / off switch mechanism allows control of acute toxicity caused by excessive proliferation of CAR-T cells. Pulsed CAR expression using the SREs of the invention can be achieved by cycling ligand levels. Modulation of CAR by ligand offsets tumor escape induced by antigen loss, avoids functional depletion caused by persistent signaling due to chronic antigen exposure, and persists CAR-expressing cells in vivo. May be effective in improving.

In some embodiments, the biological circuits and compositions of the present invention may be utilized to down-regulate CAR expression to limit on-target, on-tissue damage caused by tumor lysis syndrome. Downregulation of CAR expression of the invention following antitumor effect results in (1) on-target, off-tumor damaging caused by antigen expression in normal tissues, and (2) antigen-independent activation in vivo. Can be prevented.

Extracellular targeting domain / part According to the present invention, the extracellular target portion of CAR is any agent that recognizes and binds to a given target molecule, eg, a nascent antigen on a tumor cell, with high specificity and affinity. May be good. The target moiety is an antibody and variant thereof that specifically binds to the target molecule on the tumor cell, or a peptide aptamer selected from a random sequence pool based on its ability to bind to the target molecule on the tumor cell, or on the tumor cell. A variant or fragment thereof capable of binding to a target molecule, or an antigen recognition domain derived from a native T cell receptor (TCR) (eg, a CD4 extracellular domain that recognizes HIV-infected cells), or a target cell having a cytokine receptor. It may be a foreign recognition component such as a binding cytokine that induces recognition of the receptor, or a natural ligand of the receptor.

In some embodiments, the targeting domain of CAR is derived from an antibody that specifically recognizes a target molecule, such as a tumor-specific antigen (TSA), Ig NAR, Fab Fragment, Fab'Fragment, F (ab)'. 2 Fragments, F (ab) '3 Fragments, Fv, Single Chain Variable Fragments (scFv), bis-scFv, (scFv) 2, Minibodies, Diabodys, Triabodies, Tetrabodies, Disulfide Stabilized Fv Proteins (dsFv) , Unit body, nanobody, or antigen binding region. In one embodiment, the targeting moiety is a scFv antibody. When the scFv domain is expressed on the surface of CAR T cells and then binds to a target protein on the cancer cells, it can keep the CAR T cells close to the cancer cells and trigger activation of the T cells. scFv can be generated using conventional recombinant DNA techniques, which will be discussed in the present invention.

In some embodiments, a natural ligand may be used as the targeting portion of the CAR of the present invention. Such native ligands may be capable of binding to the antigen with an affinity within the scFv range and can redirect T cell specificity and effector function to target cells expressing complementary receptors. In some embodiments, the targeting moiety of CAR is neuregulin-1 (NRG1), the natural ligand for HER3 and HER4; VEGF, the natural ligand for VEGFR; IL13 wild-type protein or IL13 mutane that binds to IL13Ra2, eg. E13Y; NKG2D ligand, the natural ligand for the NKG2D receptor; CD70, the ligand for CD27; and growth-inducing ligand (APRIL), the natural high-affinity ligand for BCMA8 and the transmembrane activator and CAML interacting factor (TACI). It may be. All of the ligand-based BCMA CARs shown in US Patent Publication No. US20160362467A1 are incorporated by reference in their entirety.

In one embodiment, the targeting portion of CAR may recognize, but is not limited to, antigens such as gangliosides, growth factor receptors, lectins or any other cell surface antigen. In some embodiments, any of the sequences listed in Table 7 or Table 8 may be useful in the present invention.

In some embodiments, the targeting portion of the CAR is due to a gene mutation or transcriptional alteration that alters a tumor-specific antigen (TSA), eg, a protein coding sequence, thus creating a novel foreign antigen. Can recognize oncogenic antigens expressed only in. Genetic alterations result from genetic substitutions, insertions, deletions, or any other genetic alterations in naturally occurring homologous proteins (ie, molecules expressed in normal cells).

In some embodiments, the targeting moiety of the invention may be a scFv having the amino acid sequence of Table 8.

Intracellular signal transduction domain The intracellular domain of a CAR fusion polypeptide, after binding to its target molecule, transmits a signal to an immune effector cell and comprises cytolytic activity (eg, cytokine secretion) or helper activity, an immune effector cell. Activates at least one of the normal effector functions of. Thus, the intracellular domain comprises the "intracellular signaling domain" of the T cell receptor (TCR).

In some embodiments, the entire intracellular signaling domain can be used. In other embodiments, if the domain transmits an effector function signal, a shortened portion of the intracellular signaling domain may be used instead of the intact strand.

In some embodiments, the intracellular signaling domain of the invention may comprise a signaling motif known as an immunoreceptor activated tyrosine motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include ITAMs derived from TCR CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one example, the intracellular signaling domain is the CD3 zeta (CD3ζ) signaling domain.

In some embodiments, the intracellular region of the invention further comprises one or more co-stimulating signaling domains that provide additional signals to immune effector cells. These costimulatory signaling domains can be used in combination with signaling domains to further improve the proliferation, activation, memory, persistence, and tumor eradication efficiency of CAR-modified immune cells (such as CAR T cells). .. In some cases, the co-stimulating signaling region comprises one or more intracellular signaling molecules and / or one, two, three, or four cytoplasmic domains of the co-stimulating molecule. The co-stimulation signaling domains are CD2, CD7, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), GITR (glucocorticoid-induced tumor necrosis factor receptor), LFA- It may be the intracellular / cytoplasmic domain of a costimulatory molecule including, but not limited to, 1 (lymphocyte function-related antigen-1), LIGHT, NKG2C, B7-H3. In one example, the co-stimulation signaling domain is derived from the cytoplasmic domain of CD28. In another example, the co-stimulation signaling domain is derived from the cytoplasmic domain of 4-1BB (CD137). In another embodiment, the co-stimulation signaling domain may be the intracellular domain of GITR as set forth in US Pat. No. 9,175,308; its contents are herein by reference in its entirety. Incorporate into the book.

In some embodiments, the intracellular regions of the invention are MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrin, signaling lymphocyte activating proteins (SLAMs), such as CD48. , CD229, 2B4, CD84, NTB-A, CRACC, BLAME, CD2F-10, SLAMF6, SLAMF7, activated NK cell receptor, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40. , CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), SLAMF7 , NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, IL15Ra, ITGA4, VLA1, CD49a, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49a 6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, NKD2C SLP76 , TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NT. -A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, CD270 (HVEM), GADS, SLP-76, PAG / Cbp, CD19a, CD83 Specific binding ligands, DAP10, TRIM, ZAP70, killer cell immunoglobulin receptors (KIR), such as KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5. It may include a functional signaling domain derived from a protein selected from the group consisting of R3DL1 / S1, KIR3DL2, KIR3DL3, and KIR2DP1; lectin-related NK cell receptors, such as Ly49, Ly49A, and Ly49C.

In some embodiments, the intracellular signaling domain of the invention may comprise a signaling domain derived from JAK-STAT. In other embodiments, the intracellular signaling domains of the invention may comprise a signaling domain derived from DAP-12 (cell death-related protein 12) (Topfer et al., Immunol., 2015, 194: 3201-3212). And Wang et al., Cancer Immunol., 2015, 3: 815-826). DAP-12 is an important signaling receptor for NK cells. The activation signal mediated by DAP-12 plays an important role in inducing a cytotoxic response of NK cells to specific tumor cells and virus-infected cells. The cytoplasmic domain of DAP12 contains an immunoreceptor-activated tyrosine motif (ITAM). Therefore, CARs containing DAP12-derived signaling domains may be used for adoption of NK cells.

In some embodiments, T cells modified with two or more CARs incorporating separate co-stimulating domains and regulated by separate DDs may be used to provide rate control of downstream signaling. Good.

In some embodiments, the intracellular domain of the invention may comprise the amino acid sequence of Table 9.

Transmembrane Domain In some embodiments, the CAR of the present invention may include a transmembrane domain. As used herein, the term "transmembrane domain (TM)" broadly refers to an amino acid sequence of approximately 15 residues in length that spans the plasma membrane. More preferably, the transmembrane domain is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, It contains 40, 41, 42, 43, 44, or 45 amino acid residues and spans the plasma membrane. In some embodiments, the transmembrane domain of the invention may be derived from either a natural or synthetic source. The transmembrane domain of CAR may be derived from any natural transmembrane protein or transmembrane protein. For example, the transmembrane region is a T cell receptor, CD3ε, CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, or CD154. It may be derived from the α, β or ζ chain of (ie, including at least its transmembrane region (s)).

Alternatively, the transmembrane domain of the present invention may be synthetic. In some embodiments, the synthetic sequence may contain predominantly hydrophobic residues such as leucine and valine.

In some embodiments, the transmembrane domains of the invention are a CD8α transmembrane domain, a CD4 transmembrane domain, a CD28 transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, and a human Ig _G4 Fc region. It can be selected from the group consisting of. As a non-limiting example, the transmembrane domain is a CTLA-4 transmembrane domain having the amino acid sequences of SEQ ID NOs: 1-5 of International Patent Publication No. WO2014 / 120835; and SEQ ID NOs: 6-of International Patent Publication No. WO2014100285. It may be a PD-1 transmembrane domain having an amino acid sequence of 8; the contents of each of them are incorporated herein by reference in their entirety.

In some embodiments, the CAR of the present invention may include any hinge region (also referred to as a spacer). The hinge sequence is a short amino acid sequence that promotes flexibility of the extracellular targeting region, keeping the target binding domain away from the effector cell surface, allowing for proper cell / cell contact, target binding, and effector cell activation. (Patel et al., Gene Therapy, 1999; 6: 412-419). The hinge arrangement may be placed between the targeting portion and the transmembrane domain. The hinge sequence can be any suitable sequence derived from or derived from any suitable molecule. The hinge sequence is all or part of the hinge region of an immunoglobulin (eg IgG1, IgG2, IgG3, IgG4), i.e. a sequence between the CH1 and CH2 domains of an immunoglobulin, eg, IgG4 Fc hinge, type 1. It may be derived from the extracellular region of the membrane protein, eg, CD8α CD4, CD28 and CD7, which may be a wild-type sequence or derivative. Some hinge regions include immunoglobulin CH3 domains or both CH3 and CH2 domains. In certain embodiments, the hinge region may be modified from IgG1, IgG2, IgG3, or IgG4 and is at least one residue substituted with an amino acid residue that is different from the amino acid residue present in the unmodified hinge. For example, it contains 1, 2, 3, 4 or 5 amino acid residues. Table 10 shows the various transmembrane regions that can be used in the CARs described herein.

Table 11 provides hinge region sequences useful in the present invention.

In some embodiments, the CAR of the present invention may include one or more linkers between any domains of the CAR. The linker may be 1 to 30 amino acids long. In this regard, the linkers are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. , 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length. In other embodiments, the linker may be flexible.

In some embodiments, CH2CH3 is preferentially excluded from the structure of the chimeric antigen to induce a higher TNFa response, as disclosed in WO2016149578, the contents of which are incorporated herein by reference. May be good. Some constructs include the CH2CH3 structural domain. This domain stretches scFV away from the extracellular surface of the plasma membrane, allowing efficient detection of transduced T cells with anti-IgG Fc-specific antibodies. CAR constructs containing the CH2CH3 domain are disclosed in WO 20150609922A3 (the contents of which are incorporated herein by reference in their entirety).

In some embodiments, components including the targeting moiety, transmembrane domain and intracellular signaling domain of the invention may be constructed as a single fusion polypeptide. The fusion polypeptide may be the payload of the effector module of the present invention. In some embodiments, two or more CAR fusion polypeptides may be included in the effector module, eg, two, three or more CARs under the control of a single SRE (eg, DD). May be included in the effector module. Representative effector modules including the CAR payload are shown in Figures 2-6.

In some embodiments, the CAR sequence can be selected from Table 12.

In one embodiment of the invention, the payload of the invention is a CD33 specific CAR. The heavy and light chains of CD33 may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.

In one embodiment of the invention, the payload of the invention is a GD2-specific CAR. The heavy and light chains of GD2 may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein.

In one embodiment of the invention, the payload of the invention is a Her2-specific CAR. Her2 heavy and light chains may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein. An exemplary BCMA CAR sequence and its components are shown in Table 13A. The amino acid sequence in Table 13A may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

In one embodiment, the CAR of the present invention is a BCMA (B cell maturation antigen) CAR, also referred to as CD269. BCMA heavy and light chains may be combined with any of the signal peptides, transmembrane domains, costimulatory domains, intracellular domains and destabilizing domains described herein. An exemplary BCMA CAR sequence and its components are shown in Table 13B. The amino acid sequence in Table 13B may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

Tandem CAR (TanCAR)
In some embodiments, the CAR of the invention may be a tandem chimeric antigen receptor (TanCAR) capable of targeting two, three, four, or more tumor-specific antigens. .. In some embodiments, the CAR is a bispecific TanCAR that contains two targeting domains that recognize two different TSAs on tumor cells. The bispecific CAR comprises an extracellular region containing a targeting domain specific for a first tumor antigen (eg, an antigen recognition domain) and a targeting domain specific for a second tumor antigen (eg, an antigen recognition domain). Can be further defined as having. In another aspect, the CAR is a multispecific TanCAR containing three or more targeting domains configured in a tandem arrangement. The space between the targeting domains of TanCAR is between about 5 to about 30 amino acids in length, for example 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids.

Split CAR
In some embodiments, the components including the targeting moiety, transmembrane domain and intracellular signaling domain of the invention are divided into two or more moieties to facilitate the assembly of intact functional receptors. It may depend on. In one embodiment, it is possible to construct a split synthetic CAR system in which the assembly of the activated CAR receptor depends on the binding of a ligand to an SRE (eg, a small molecule) and the binding of a specific antigen to a targeting moiety. As a non-limiting example, a split CAR consists of two parts assembled in a small molecule-dependent manner, one part of the receptor characterized by an extracellular antigen-binding domain (eg, scFv) and the other. The moiety has an intracellular signaling domain such as CD3ζ intracellular domain.

In another aspect, the split portion of the CAR system can be further modified to increase the signal. In one example, the second portion of the cytoplasmic fragment may be immobilized on the plasma membrane by incorporating a transmembrane domain (eg, a CD8α transmembrane domain) into the construct. Further, an additional extracellular domain, for example, an extracellular domain that mediates homodimerization, may be added to the second part of the CAR system. These modifications can enhance receptor output activity, i.e. T cell activation.

In some embodiments, the two parts of the split CAR system contain a heterodimerized domain that interacts conditionally upon binding of the heterodimerized small molecule. Thus, the components of the receptor are assembled in the presence of small molecules to form an intact system, which is then activated by the involvement of the antigen. Any known heterodimerization component can be incorporated into the split CAR system. Gibberellin-induced dimerization system (GID1-GAI), trimetoprim-SLF-induced ecDHFR and FKBP dimerization (Czlapinski et al., JAm Chem Soc., 2008, 130 (40): 13186-13187) and PP2C and Other small molecule-dependent heterodimers including, but not limited to, ABA (abscisic acid) -induced dimerization of the PYL domain (Cutler et al., Annu Rev Plant Biol. 2010, 61: 651-679). Domains may also be used. Double regulation using inducible assembly (eg, ligand-gated dimerization) and degradation (eg, destabilizing domain-induced CAR degradation) of the split CAR system to more flexibly control the activity of CAR-modified T cells. Can be done.

Switchable CAR
In some embodiments, the CAR of the present invention may be a switchable CAR. Julerat et al. (Julierat et al., Sci. Rep., 2016, 6: 18,950; the contents of which are incorporated herein by reference in its entirety) temporarily switch in response to a stimulus (eg, a small molecule). We recently reported a controllable CAR that can be turned on. In this CAR design, the system is incorporated directly into the hinge domain, which separates the scFv domain from the cell membrane domain of the CAR. Such systems can divide or combine different important functions of CAR, such as activation and co-stimulation within different strands of receptor complexes that mimic the complexity of TCR's natural architecture. This integrated system can switch the interaction of scFv and antigen between on / off states controlled by the presence or absence of stimulation.

Reversible CAR
In other embodiments, the CAR of the present invention may be a reversible CAR system. In this CAR architecture, the LID domain (ligand-induced degradation) is incorporated into the CAR system. CAR can be temporarily down-regulated by adding a ligand for the LID domain. The combination of LID and DD-mediated regulation provides regulated control of continuously activated CAR T cells, thereby reducing CAR-mediated tissue damage.

Activation conditional CAR
In some embodiments, the payload of the invention may be an activated conditional chimeric antigen receptor expressed only in activated immune cells. The expression of CAR may be combined with an activation conditional control region, which means one or more nucleic acid sequences that induce transcription and / or expression of a sequence such as CAR under its control. Such activation conditional control regions may be promoters of genes that are upregulated during activation of immune effector cells, such as the IL2 promoter or NFAT binding site. In some embodiments, activation of immune cells may be achieved by constitutively expressed CAR (International Publication No. WO2016126608; the content of which is incorporated herein by reference in its entirety).

4. Additional Effector Module Functions The effector modules of the present invention regulate signal sequences that regulate the distribution of target payloads, cleavage and / or processing functions that facilitate cleavage of payloads from effector module constructs, and cell localization of effector modules. It may contain one or more linker sequences that link different components of the targeting and / or permeation signal, tag, and / or effector module that can be.

In addition to the signal sequence SRE (eg DD) and payload region, the effector modules of the invention may further include one or more signal sequences. The signal sequence (sometimes referred to as a signal peptide, targeting signal, target peptide, localized sequence, transport peptide, leader sequence or leader peptide) is a protein (eg, the effector module of the invention) designated cells and / or Direct to the extracellular position. The protein signal sequence plays a central role in the targeting and translocation of almost all secretory proteins and many integral membrane proteins.

The signal sequence is a short (5-30 amino acid long) peptide present at the N-terminus of most of the novel synthetic proteins destined for a particular position. The signal sequence is recognized by signal recognition particles (SRPs) and can be cleaved with type I and type II signal peptide peptidases. A signal sequence derived from a human protein can be incorporated as a regulatory module of the effector module to direct the effector module to specific cell and / or extracellular positions. These signal sequences have been experimentally validated and can be cleaved (Zhang et al., Protein Sci. 2004, 13: 2819-2824).

In some embodiments, the signal sequence may be located at the N-terminus or C-terminus of the effector module, but not necessarily, by cutting the desired effector module into a "mature" payload. That is, the immunotherapeutic agent discussed herein may be obtained.

In some examples, the signal sequence may be a secretory signal sequence derived from a naturally occurring secreted protein and its variants. In some examples, the secretory signal sequence is a cytokine signal sequence, eg, an IL2 signal sequence (amino acid of SEQ ID NO: 49 encoded by the nucleic acid sequence of SEQ ID NOs: 55-56 and / or 117-118), p40 signal sequence ( It may be the amino acid sequence of SEQ ID NO: 119 encoded by the nucleic acid sequence of SEQ ID NOs: 120-128, or the GMCSF reader sequence (SEQ ID NO: 778 (encoded by SEQ ID NO: 922), 779, 780), but these. Not limited to.

In some examples, a signal sequence may be used that directs the payload of interest to the surface membrane of the target cell. Expression of the payload on the surface of the target cell is useful in limiting the spread of the payload into a non-target in vivo environment, which may potentially improve the safety properties of the payload. In addition, membrane presentation of the payload may enable physiological and qualitative signaling, as well as stabilization and recycling of the payload for a longer half-life. The membrane sequence may be the endogenous signal sequence of the N-terminal component of the target payload. In some cases, it may be desirable to exchange this sequence for a different signal sequence. The signal sequence may be selected based on its compatibility with the secretory pathway of the cell type of interest so that the payload is presented on the surface of the T cell. In some embodiments, the signal sequence is the IgE signal sequence (amino acid of SEQ ID NO: 129 and nucleotide sequence of SEQ ID NO: 130), CD8a signal sequence (also referred to as CD8a reader) (amino acids SEQ ID NO: 131 and SEQ ID NOs: 132-136, And / or the nucleic acid sequence of 915) or the IL15Ra signal sequence (amino acid SEQ ID NO: 781 encoded by SEQ ID NO: 782).

Other examples of signal sequences, including variants, include US Pat. Nos. 8,148,494; 8,258,102; 9,133,265; 9,279,007; and US Pat. It may be a modified signal sequence described in Application Publication No. 20070114666; and International Patent Application Publication No. WO 19930181881, the contents of each of which is incorporated herein by reference in its entirety.

In other examples, the signal sequence may be a heterologous signal sequence from other organisms such as viruses, yeasts, and bacteria that can direct the effector module to a specific cell site such as the nucleus (eg,). , EP1209450). As another example, a Trichoderma-derived aspartic protease (NSP24) signal sequence capable of increasing the secretion of fusion proteins such as enzymes (eg, US Pat. No. 8,093,016 for Cervin and Kim), a bacterial lipoprotein. Signal Sequences (eg, PCT Application Publication No. WO199109952 for Lau and Rioux), E. coli. coli Enterotoxin II Signal Peptide (eg, US Pat. No. 6,605,697 to Kwon et al.), E.I. A coli-secreting signal sequence (eg, US Patent Publication No. US2016090404 for Malley et al.), A lipase signal sequence derived from methylotrophic yeast (eg, US Pat. No. 8,975,041), and a DNase signal peptide derived from Coryneform bacteria (eg, US Pat. No. 8,975,041). , U.S. Pat. No. 4,965,197), the contents of which are incorporated herein by reference in their entirety.

The signal sequences also include nuclear localization signals (NLS), extranuclear translocation signals (NES), polarized cell tubular endoplasmic reticulum localization signals (eg, US Pat. No. 8,993,742; Cour et al. , Nuclear Acids Res. 2003, 31 (1): 393-396; the contents of each of them are incorporated herein by reference in their entirety), an extracellular localization signal, a signal to an intracellular position (eg, the signal to an intracellular position). , Lysosomes, endoplasmic reticulum, Gordi, mitochondria, plasma membranes and peroxisomes, etc. (see, eg, US Pat. No. 7,396,811; and Negi et al., Database, 2015, 1-7; these. The contents of each of these are incorporated herein by reference in their entirety).

In some embodiments, the signal sequences of the invention are, but are not limited to, the table of co-pending US Provisional Patent Application Nos. 62/320,864 filed on April 11, 2016. 7. Or any of the sequences shown in US Provisional Application No. 62 / 466,596 filed on March 3, 2017 and WO 2017/180587, the contents of which are hereby referred to in their entirety. Incorporate in the book.

Cutting Site In some embodiments, the effector module has cutting and / or processing capabilities. The effector module of the present invention may contain at least one protein cleavage signal / site. The protein cleavage signal / site can be any space between the N-terminus, C-terminus, N-terminus and C-terminus, eg, but not limited to, between the N-terminus and the C-terminus, between the N-terminus and the midpoint, and It may be placed between the C-terminus and in combination thereof.

The effector module may include one or more cleavage signals (s) / sites (s) of any proteinase. The proteinase may be serine proteinase, cysteine proteinase, endopeptidase, dipeptidase, metalloproteinase, glutamate proteinase, threonine proteinase and aspartic acid proteinase. In some embodiments, the cleavage site is furin, actinidyne, carpine-1, carboxypeptidase A, carboxypeptidase P, carboxypeptidase Y, caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, Caspase-6, Caspase-7, Caspase-8, Caspase-9, Caspase-10, Cathepsin B, Cathepsin C, Cathepsin G, Cathepsin H, Cathepsin K, Cathepsin L, Cathepsin S, Cathepsin V, Crostripine, Kimase, Chimotrypsin, elastase, endoproteinase, enterokinase, factor Xa, formic acid, granzyme B, matrix metallopeptidase-2, matrix metallopeptidase-3, pepsin, proteinase K, SUMO protease, subtilicin, TEV protease, thermolysin, thrombin, trypsin and It may be a signal sequence of TAGZyme.

In one embodiment, the cleavage site is a furin cleavage site having the amino acid sequence SARNRQKRS (SEQ ID NO: 137) encoded by the nucleotide sequence of SEQ ID NO: 138; or the amino acid sequence ARNRQKRS (SEQ ID NO: 137) encoded by the nucleotide sequence of SEQ ID NO: 140. Modified furin site having 139); or modified furin site having the amino acid sequence ESRRVRRNKRSK (SEQ ID NO: 141) encoded by the nucleotide sequence of SEQ ID NOs: 142-144; or SGESRRRVRNKRSK encoded by the nucleotide sequence of SEQ ID NO: 784. (SEQ ID NO: 785). In some examples, the cleavage site is the P2A cleavage site encoded by SEQ ID NO: 786 (ATNFSLLKQAGDVEENPGP (SEQ ID NO: 783), or GATNFSLLLKQAGDVEENPGP (SEQ ID NO: 864) encoded by SEQ ID NO: 865, and NPGP (SEQ ID NO: 866). ) Is the P2A site.

In some embodiments, the cleavage sites of the invention are, but are not limited to, Table 7 or 2017 of the co-pending US Provisional Patent Application No. 62 / 320,864 filed April 11, 2016. Including any of those set forth in US Provisional Application No. 62 / 466,596 filed on March 3, 2014 and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety.

Protein Tag In some embodiments, the effector module of the invention may include a protein tag. Protein tags may be used to detect and monitor the process of the effector module. The effector module may include one or more tags such as an epitope tag (eg, FLAG or hemagglutinin (HA) tag). A large number of protein tags may be used in this effector module. They include self-labeled polypeptide tags (eg, haloalcan dehalogenase (halo tag 2 or halo tag 7), ACP tags, clip tags, MCP tags, snap tags), epitope tags (eg, FLAG, HA, His, and Myc). ), Fluorescent tag (eg, green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), and variants thereof), bioluminescent tag (eg, luciferase and variants thereof), affinity tag (eg, eg. , Martose binding protein (MBP) tag, glutathione-S-transferase (GST) tag), immunogenic affinity tag (eg, protein A / G, IRS, AU1, AU5, glu-glu, KT3, S-tag, HSV, VSV-G, Xpress and V5), as well as other tags (eg, biotin (small molecule), Strep tag (StrepII), SBP, biotin carboxyl carrier protein (BCCP), eXact, CBP, CYD, HPC, CBD intain. -Includes, but is not limited to, the chitin binding domain, Trx, NorpA, and NusA.

In other embodiments, the tags are also U.S. Pat. Nos. 8,999,897; 8,357,511; 7,094,568; 5,011,912; 4,851,341. No.; and No. 4,703,004; U.S. Patent Application Publication Nos. US2013115635 and US20130125687; Is incorporated herein by reference.

In some embodiments, multiple protein tags, either the same or different tags, may be used, each tag may be located at the same N-terminus or C-terminus, while in other cases these Tags may be placed at each end.

In one embodiment, the protein tag is an HA tag. A non-limiting example of a HA tag is YPYDVPDYA (SEQ ID NO: 852 encoded by SEQ ID NOs: 853, 867, and / or 868).

In some embodiments, the protein tags of the invention are not limited to, but are limited to, Table 8 of co-pending US Provisional Patent Application No. 62/320,864, filed April 11, 2016, or Includes any of the tags shown in US Provisional Application No. 62 / 466,596 filed on March 3, 2017 and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety. To do.

Targeting Peptides In some embodiments, the effector modules of the invention may further comprise targeting and / or permeable peptides. Using small targeting and / or penetrating peptides that selectively recognize cell surface markers (eg, receptors, transmembrane proteins, extracellular matrix molecules), the effector module can be used in the desired organ, tissue, or cell. Can be targeted to. Short peptides (5-50 amino acid residues) and native peptides synthesized in vitro to home effector modules to desired organs, tissues and cells, and / or intracellular locations, or analogs and variants thereof. The derivative may be incorporated into the effector module.

In some embodiments, targeting sequences and / or permeable peptides may be included in the effector module to drive the effector module into a target organ, or tissue, or cell (eg, cancer cell). In other embodiments, the targeting peptide and / or permeable peptide may direct the effector module to a specific intracellular location within the cell.

The targeting peptide has any number of amino acids from about 6 to about 30. Peptides are 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29. Or it may have 30 amino acids. In general, a targeting peptide can have 25 or less amino acids, such as 20 or less, such as 15 or less amino acids.

Exemplary targeting peptides include, but are not limited to, those disclosed in the art, such as US Pat. Nos. 9,206,231; 9,110,059; 8,706,219; And 8,772,449; and U.S. Application Publication No. 2016089447; No. 2016060296; No. 2016060314; No. 2016060312; No. 201660311; No. 2016007772; No. 2016002613; It may include those disclosed in International Application Publication Nos. WO2015179691 and WO2015183044, the contents of each of which are incorporated herein by reference in their entirety.

In some embodiments, the targeting peptides of the invention are shown in Table 9 of co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016. Any of these are included, the contents of which are incorporated herein by reference in their entirety.

Linker In some embodiments, the effector module of the present invention may further comprise a linker sequence. The linker region primarily functions as a spacer between two or more polypeptides within the effector module. As used herein, "linker" or "spacer" refers to a molecule or group of molecules that connects two molecules, or two parts of a molecule, eg, two domains of a recombinant protein.

In some embodiments, the term "linker" (L) or "linker domain" or "linker region" or "linker module" or "peptide linker" as used herein refers to the domain / region of an effector module. It refers to an oligo or polypeptide region of about 1-100 amino acids in length that links either (also called a peptide linker). The peptide linker may be 1-40 amino acids long, 2-30 amino acids long, or 20-80 amino acids long, or 50-100 amino acids long. The length of the linker may be optimized based on the type of payload used and the crystal structure of the payload. In some examples, a shorter linker may be preferably selected. In some embodiments, the peptide linker is composed of amino acids linked together by peptide binding, preferably 1 to 20 amino acids linked by peptide binding, the amino acid being selected from 20 naturally occurring amino acids: glycine ( G), alanine (A), valine (V), leucine (L), isoleucine (I), serine (S), cysteine (C), threonine (T), methionine (M), proline (P), phenylalanine ( F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), aspartic acid (D), glutamic acid (E), asparagine (N), and glutamine (Q). As one of ordinary skill in the art will understand, one or more of these amino acids may be glycosylated. In some embodiments, the amino acid of the peptide linker is selected from alanine (A), glycine (G), proline (P), asparagine (R), serine (S), glutamine (Q) and lysine (K). May be good.

In one example, the artificially designed peptide linker preferably has flexible residues such as glycine (G) and serine (S) so that adjacent protein domains can move freely with respect to each other. Consists of a polymer of. Longer linkers may be used if it is desirable to prevent two adjacent domains from interfering with each other. The choice of a particular linker sequence may be related to whether it affects the biological activity, stability, folding, targeting, and / or pharmacokinetic properties of the fusion construct. Examples of peptide linkers: MH, SG, GGSG (encoded by the nucleotide sequence of SEQ ID NO: 145; SEQ ID NO: 146), GGSGG (encoded by any of the nucleotide sequences of SEQ ID NOs: 147; SEQ ID NOs: 148-152). , GGSGGG (SEQ ID NO: 153; encoded by any of the nucleotide sequences of SEQ ID NOs: 154 to 155), SGGGS (SEQ ID NO: 68; encoded by the nucleotide sequences of SEQ ID NOs: 85, 69, 86), GGSGGGGSGG (SEQ ID NO:). 156; encoded by the nucleotide sequence of SEQ ID NO: 157), GGGGG (SEQ ID NO: 158), GGGGS (SEQ ID NO: 159) or (GGGGS) n (n = 1 (SEQ ID NO: 159), 2 (SEQ ID NO: 160), 3 (Divided by the nucleotide sequences of SEQ ID NO: 161 and SEQ ID NOs: 174, 175, 171, 219, 774, 837), 4 (SEQ ID NO: 162), 5 (SEQ ID NO: 163), or 6 (SEQ ID NO: 164)). SSSSG (SEQ ID NO: 165) or (SSSSG) n (n = 1 (SEQ ID NO: 165), 2 (SEQ ID NO: 166), 3 (SEQ ID NO: 167), 4 (SEQ ID NO: 168), 5 (SEQ ID NO: 169), or 6 (SEQ ID NO: 170)), SGGGGSGGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 171; encoded by the nucleotide sequences of SEQ ID NOs: 172, 838-843), EFSTEF (SEQ ID NO: 50; encoded by the nucleotide sequences of SEQ ID NOs: 57, 173), GKSSGSGSESKS (SEQ ID NO: 176), GGSTSGSGKSSGKG (SEQ ID NO: 177), GSTSGSGKSSSEGSTKG (SEQ ID NO: 178), GSTSGSGKPGSGGSTGSTKG (SEQ ID NO: 179), VDYPYDVPDYALD (SEQ ID NO: 179) 180), SG3- (SG4) 3-SG3-SLQ-YPYDVPDYA (SEQ ID NO: 787), encoded by the nucleotide sequence of SEQ ID NO: 788; DYKDDDDK encoded by the nucleotide sequence of SEQ ID NO: 790 (SEQ ID NO: 789); SG3- (SG4) 5-SG3-S (SEQ ID NO: 791) encoded by number 792; SGGGSGGGGGGGSGGGGGSGGGGGSYPYDVP encoded by SEQ ID NO: 794 DYASGGGS (SEQ ID NO: 793); GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 795) encoded by SEQ ID NO: 796; SGGGGSGGGGSGSGGGGSGGGGGS (SEQ ID NO: 844) encoded by SEQ ID NO: 845, QLMRIGLQ ); ASFE encoded by SEQ ID NO: 921 (SEQ ID NO: 920); GS (encoded by GGTTCC), SG (encoded by AGCGGC), EF (encoded by GAGTTC), TS (encoded by ACTAGT). ), HM (coded by CACATG), MH (coded by ATGCAC) or GSG (coded by GGATCCGGA or GGATCCGGT), but not limited to these.

In another example, the peptide linker may be composed of the majority of non-sterically hindered amino acids such as glycine (G) and alanine (A). Exemplary linkers are polyglycine ((G) 4 (SEQ ID NO: 929), (G) 5 (SEQ ID NO: 930), (G) 8 (SEQ ID NO: 931), etc.), poly (GA), and polyalanine. is there. The linkers described herein are exemplary, and linkers that are much longer and contain other residues are contemplated by the present invention.

The linker sequence may be a natural linker derived from a multidomain protein. A native linker is a short peptide sequence that separates two different domains or motifs within a protein.

In some embodiments, the linker may be flexible or rigid. In other embodiments, the linker may be cleaveable or non-cleaveable. As used herein, the terms "cleavable linker domain or region" or "cleavable peptide linker" are used interchangeably. In some embodiments, the linker sequence may be enzymatically and / or chemically cleaved. Examples of enzymes useful for cleavage of peptide linkers (eg, proteinase / peptidase) include Arg-C proteinase, Asp-N endopeptidase, chymotrypsin, crosstripine, enterokinase, factor Xa, glutamilendopeptidase, granzyme B, Achromobacter proteinase I, pepsin, proline endopeptidase, proteinase K, Staphylococcal peptidase I, thermolysin, thrombin, trypsin, and members of the caspase family of proteolytic enzymes (eg, caspase 1-10), but are limited thereto Not done. Chemical sensitive cleavage sites can also be included in the linker sequence. Examples of chemical cleavage reagents are cyanide bromide, which cleaves methionine residues; N-chlorosuccinimide, iodobenzoic acid, or BNPS-skatole (2- (2-nitrophenylsulphenyl) -3-, which cleaves tryptophan residues. Methylindole); a dilute acid that cleaves at the aspartyl-prolyl bond; and an aspartic acid-prophosphate cleavable recognition site (ie, a cleavable peptide linker containing one or more DP dipeptide moieties). Not limited. The fusion module may include multiple regions encoding the peptide of interest separated by one or more cleaving peptide linkers.

In other embodiments, the cleavable linker may be a "self-cleaving" linker peptide, such as a 2A linker (eg T2A), a 2A-like linker or a functional equivalent thereof, and combinations thereof. In some embodiments, the linker comprises a picornavirus 2A-like linker, a porcine virus (P2A), a CHYSEL sequence of the Thosea asigna virus (T2A) or a combination thereof, variants and functional equivalents. Other linkers will be apparent to those of skill in the art and may be used in connection with alternative embodiments of the present invention.

In some embodiments, the biological circuits of the invention may comprise a 2A peptide. The 2A peptide is a sequence of about 20 amino acid residues derived from a virus that is recognized by a protease (2A peptidase) that is endogenous to the cell. The 2A peptide has been identified among picornaviruses, a typical example of which is foot-and-mouth disease virus (Robertson BH, et. Al., J Virus 1985, 54: 651-660). 2A-like sequences have also been found in picornaviruses such as horse rhinitis A virus, as well as unrelated viruses such as butatescovirus-1 and the insect Thosea asigna virus (TaV). In such viruses, multiple proteins are derived from large polyproteins encoded by open reading frames. The 2A peptide mediates the simultaneous translational cleavage of this polyprotein at a single site that forms the junction between the viral capsid and the replication polyprotein domain. The 2A sequence comprises the consensus motif DV / IEX-N-P-GP (SEQ ID NO: 932). These sequences are thought to act co-translating, interfering with the formation of normal peptide bonds between glycine and the last proline, leading to ribosome skipping of subsequent codons (Donnelly ML et al. (2001)). J Gen Virol, 82: 1013-1025). After cleavage, the short peptide remains fused to the C-terminus of the protein upstream of the cleavage site, while proline is added to the N-terminus of the protein downstream of the cleavage site. Of the 2A peptides identified so far, four, namely FMDV 2A (abbreviated F2A herein), horse rhinitis virus (ERAV) 2A (E2A); butatescovirus-12A (P2A) and Thosea signa. Virus 2A (T2A) is widely used. In some embodiments, the 2A peptide sequences useful in the present invention are selected from SEQ ID NOs: 8-11 of International Patent Publication WO2010042490, the contents of which are incorporated by reference in their entirety.

The linker of the present invention may be a non-peptide linker. For example, _{an alkyl linker such as -NH- (CH 2} ) a-C (O)-(in the formula, a = 2 to 20) can be used. These alkyl linkers, lower alkyl _(e.g., C 1 _-C 6), lower acyl, halogen (e.g., Cl, Br), CN, NH 2, further substituted with any of the groups that are sterically unhindered, such as phenyl You may.

In some embodiments, the linker is an artificial linker of US Pat. No. 4,946,778; 5,525,491; 5,856,456; and International Patent Publication No. WO2012 / 083424. Often; the contents of each of them are incorporated herein by reference in their entirety.

In some embodiments, the linkers of the invention are limited to, but not limited to, Table 11 of co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or 2017. Includes any of those set forth in US Provisional Application No. 62 / 466,596 filed on March 3, and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety. ..

In some embodiments, the compositions of the invention may comprise any proteasome adapter. As used herein, the term "proteasome adapter" refers to any nucleotide / amino acid sequence that targets the added payload for degradation. In some embodiments, the adapter directly targets the payload for degradation, thereby avoiding the need for a ubiquitination reaction. The proteasome adapter may be used in combination with the destabilizing domain to reduce basal expression of the payload. As an exemplary proteasome adapter, HPV that binds with high affinity to both the UbL domain of Rad23 or hHR23b, the target protein Rb and the S4 subunit of the proteasome, enabling direct proteasome targeting and bypassing the ubiquitination mechanism. E7; protein ganquilin that binds to Rb and the proteasome subunit S6.

In one embodiment, the linker may be a spacer region of one or more nucleotides. Non-limiting examples of spacers are TCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 846), TATGGCCACAACCATG (SEQ ID NO: 847), AATCTAGATATACGACTCACTAGAGATCC (SEQ ID NO: 848), TCGCGAATG, TCGGCGA, GCTGCACGACTA. The number is 850).

In one embodiment, the linker may be a BamHI site. As a non-limiting example, the BamHI site has the amino acid sequence GS and / or the DNA sequence GGATCC.

Implantation Stimulation, Signals, and Other Regulatory Properties In some embodiments, the effector modules of the invention may further comprise one or more microRNAs, microRNA binding sites, promoters and tunable elements. In one embodiment, microRNAs may be used to assist in the creation of tunable biocircuits. Each aspect or tuned modality can result in differentially tuned properties in the effector module or biocircuit. For example, the destabilizing domain may alter the cleavage site or dimerization properties or half-life of the payload and detargeting or transporting cells by including one or more microRNAs or microRNA binding sites. Properties can be imparted. As a result, the present invention includes biological circuits that are multifactorial in their sustainability. Such biocircuit and effector modules may be designed to include one, two, three, four, or more tuned properties. In some embodiments, the microRNA sequences of the invention are not limited to, but are limited to, Table 13, co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016. Alternatively, it may include any of the sequences shown in US Provisional Application No. 62 / 466,596 and WO 2017/180587 filed March 3, 2017, the contents of which are incorporated herein by reference in their entirety. Invite.

Polynucleotide The term "polynucleotide" or "nucleic acid molecule", in its broadest sense, includes any compound and / or substance, including polymers of nucleotides, such as linked nucleosides. These polymers are often referred to as polynucleotides. Illustrative nucleic acids or polynucleotides of the invention include ribonucleic acids (RNA), deoxyribonucleic acids (DNA), threose nucleic acids (TNA), glycol nucleic acids (GNA), peptide nucleic acids (PNA), locked nucleic acids (LNA, β-). LNA with D-ribo configuration, α-LNA with α-L-ribo configuration (diastereomer of LNA), 2'-amino-LNA with 2'-amino functionalization, and 2'-amino functionalization Includes, but is not limited to, 2'-amino-α-LNA) or hybrids thereof.

In some embodiments, the polynucleotides of the invention may be messenger RNA (mRNA) or any nucleic acid molecule and may or may not be chemically modified. In one aspect, the nucleic acid molecule is mRNA. As used herein, the term "messenger RNA (mRNA)" encodes a polypeptide of interest and is translated to produce the polypeptide of interest encoded in vitro, in vivo, in situ or ex vivo. Refers to any polynucleotide that can be.

Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5'UTR, a 3'UTR, a 5'cap, and a poly A tail. Based on this wild-type modular structure, the invention maintains one or more structural and / or chemical modifications or alterations that confer useful properties on the polynucleotide, such as persistence of function. Expanding the range of functionality of conventional mRNA molecules by providing a payload construct containing them. As used herein, a "structural" property or modification is the insertion, deletion, replication, inversion, or insertion of two or more ligated nucleosides into a polynucleotide without significant chemical modification to the nucleoside itself. Randomizing properties or modifications. Structural modifications are of chemical nature and are therefore chemical modifications because they inevitably break and reconstitute chemical bonds to modify the structure. However, structural modifications give different nucleotide sequences. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". In this case, the dinucleotide "CC" has been inserted and structural alterations have occurred in the polynucleotide.

In some embodiments, the polynucleotides of the invention may carry a 5'UTR sequence that plays a role in initiating translation. The 5'UTR sequence may contain features such as the Kozak sequence, which is generally known to be involved in the process by which ribosomes initiate gene translation, and the Kozak sequence is the Consensus XCCR (A / G). It has CCAUG, and in the formula, R 3 bases upstream of the start codon (AUG) is a purine (adenine or guanine), and X is an arbitrary nucleotide. In one embodiment, the Kozak sequence is ACCGCC. The stability and protein production of the polynucleotides of the invention can be enhanced by modifying the commonly found characteristics of genes that are abundantly expressed in target cells or tissues.

In addition, the polynucleotide provides a polynucleotide that may contain an internal ribosome entry site (IRES) that plays an important role in initiating protein synthesis in the absence of a 5'cap structure. The IRES can function as the sole ribosome binding site or as one of multiple binding sites. Polynucleotides of the invention containing two or more functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by the ribosome to give rise to dicistron and / or multicistron nucleic acid molecules. ..

In some embodiments, the biological circuit, effector module, SRE, and target payload, eg, a polynucleotide encoding an immunotherapeutic agent, is about 30 to about 100,000 nucleotides (eg, 30 to 50, 30 to 100, 30). ~ 250, 30 ~ 500, 30 ~ 1,000, 30 ~ 1,500, 30 ~ 3,000, 30 ~ 5,000, 30 ~ 7,000, 30 ~ 10,000, 30 ~ 25,000, 30 ~ 50,000, 30 ~ 70,000, 100 ~ 250, 100 ~ 500, 100 ~ 1,000, 100 ~ 1,500, 100 ~ 3,000, 100 ~ 5,000, 100 ~ 7,000, 100 ~ 10,000, 100 ~ 25,000, 100 ~ 50,000, 100 ~ 70,000, 100-100,000, 500 ~ 1,000, 500 ~ 1,500, 500 ~ 2,000, 500 ~ 3 000, 500 to 5,000, 500 to 7,000, 500 to 10,000, 500 to 25,000, 500 to 50,000, 500 to 70,000, 500 to 100,000, 1,000 to 1 , 500, 1,000-2,000, 1,000-3,000, 1,000-5,000, 1,000-7,000, 1,000-10,000, 1,000-25,000 , 1,000-50,000, 1,000-70,000, 1,000-100,000, 1,500-3,000, 1,500-5,000, 1,500-7,000, 1 , 500 to 10,000, 1,500 to 25,000, 1,500 to 50,000, 1,500 to 70,000, 1,500 to 100,000, 2,000 to 3,000, 2,000 ~ 5,000, 2,000 to 7,000, 2,000 to 10,000, 2,000 to 25,000, 2,000 to 50,000, 2,000 to 70,000, and 2,000 to 100,000 nucleotides) can be included. In some embodiments, the polynucleotides of the invention may contain more than 10,000 residues of nucleotides.

Regions of polynucleotides encoding specific features, such as cleavage sites, linkers, transport signals, tags or other features, are independently 10 to 1,000 nucleotides in length (eg, 20, 30, 40, 45, 50). , 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and more than 900 nucleotides, or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, It may be in the range of 600, 700, 800, 900, and 1,000 nucleotides).

In some embodiments, the polynucleotides of the invention may further comprise an implantable regulatory moiety, such as a microRNA binding site, within the 3'UTR of the nucleic acid molecule, which regulatory moiety upon binding to the microRNA molecule. It down-regulates gene expression by reducing the stability of nucleic acid molecules or by inhibiting translation. Conversely, for the purposes of the polynucleotides of the invention, microRNA binding sites can be modified (ie removed) from their natural sequences to increase protein expression in specific tissues. For example, the miR-142 and miR-146 binding sites may be removed to improve protein expression in immune cells. In some embodiments, any of the encoded payloads may be adjusted by SRE and then combined with one or more regulatory sequences to produce dual or multi-regulated effector modules or biocircuit systems.

In some embodiments, the polynucleotides of the invention may encode fragments, variants, derivatives of the polypeptides of the invention. In some embodiments, the sequences of the variants may retain the same or similar activity. Alternatively, the variant may have altered (eg, increased or decreased) activity with respect to the starting sequence. In general, a variant of a particular polynucleotide or polypeptide of the invention will be a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters known to those of skill in the art described herein. With respect to at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%. , 95%, 96%, 97%, 98%, 99%, but with less than 100% sequence identity. Tools for such alignment include tools from the BLAST suite (Stephen et al., Gapped BLAST and PSI-BLAST: a new generation of protein databases, Nucleic Acids, 33. ).

In some embodiments, the polynucleotides of the invention may be modified. As used herein, the term "modified" or, where appropriate, "modified" refers to a chemical modification to an A, G, U (T in DNA) or C nucleotide. The modification may be on the nucleoside base and / or the sugar moiety of the nucleoside contained in the polynucleotide. In some embodiments, the nucleic acid to be modified or one or more individual nucleosides or nucleotides comprises multiple modifications. For example, modifications to nucleosides can include one or more modifications to nucleobases and sugars. Modifications to the polynucleotides of the present invention may include, for example, any of the modifications shown in WO 2013052523, the contents of which are incorporated herein by reference in their entirety.

As used herein, "nucleoside" is defined as a compound comprising an organic base (eg, purine or pyrimidine) or a sugar molecule in combination with a derivative thereof (eg, pentose or ribose) or a derivative thereof (eg, pentose or ribose). Also referred to herein as a "nucleobase"). As used herein, a "nucleotide" is defined as a nucleoside containing a phosphate group.

In some embodiments, the modification may be on a nucleoside-to-nucleoside bond (eg, a phosphate skeleton). As used herein, the terms "phosphoric acid" and "phosphodiester" are used interchangeably with respect to the polynucleotide backbone. The skeletal phosphate group can be modified by substituting one or more oxygen atoms with another substituent. In addition, modified nucleosides and nucleotides can include large-scale substitutions of unmodified phosphate moieties by another internucleoside bond. Examples of modified phosphate groups include phosphorothioates, phosphorocelenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or arylphosphonates, and phosphotriesters. However, it is not limited to these. In phosphorodithioates, both unbound oxygens are replaced by sulfur. Phosphate linkers can also be modified by replacing bound oxygen with nitrogen (crosslinked phosphoramidate), sulfur (crosslinked phosphorothioate), and carbon (crosslinked methylene-phosphonate). Other modifications that may be used are set forth, for example, in International Application No. WO201305523, the contents of which are incorporated herein by reference in their entirety.

Any modification known in the art, such as (±) 1- (2-hydroxypropyl) psoid uridine TP, as a chemical modification and / or substitution of the nucleotide or nucleic acid base of the polynucleotide of the invention useful in the present invention , (2R) -1- (2-hydroxypropyl) psoid uridine TP, 1- (4-methoxy-phenyl) psoid-UTP, 2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1, 2'-O-dimethylinosine, 1-hexyl-psoid-UTP, 1-homoallyl pseudouridine TP, 1-hydroxymethylpsoid uridine TP, 1-iso-propyl-psoid-UTP, 1-Me-2- Thio-psoid-UTP, 1-Me-4-thio-psoid-UTP, 1-Me-α-thio-psoid-UTP, 1-Me-GTP, 2'-amino-2'-deoxy-ATP, 2' -Amino-2'-deoxy-CTP, 2'-amino-2'-deoxy-GTP, 2'-amino-2'-deoxy-UTP, 2'-azido-2'-deoxy-ATP, tubersidine, incomplete Modified hydroxywibtocin, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, wibutocin, waiosin, xanthin, xanthosine-5'-TP, xyloadenosine, zebraline, α-thio-adenosine, α-thio-citidine , Α-thio-guanosine, and / or α-thio-uridine.

The polynucleotides of the invention may include one or more modifications shown herein. Different sugar modifications, base modifications, nucleotide modifications, and / or nucleoside interlinks (eg, skeletal structures) may be present at various positions in the polynucleotides of the invention. Those skilled in the art will understand that nucleotide analogs or other modifications (s) may be placed at any position (s) of the polynucleotide so that the function of the polynucleotide is not substantially reduced. There will be. The modification may be a 5'or 3'end modification. Polynucleotides are about 1% to about 100% (with respect to the overall nucleotide content, or with respect to one or more types of nucleotides, i.e. one or more of A, G, U or C) or any intermediate. Percentages (eg 1% -20%, 1% -25%, 1% -50%, 1% -60%, 1% -70%, 1% -80%, 1% -90%, 1% -95 %, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% ~ 100%, 50% -60%, 50% -70%, 50% -80%, 50% -90%, 50% -95%, 50% -100%, 70% -80%, 70% -90 %, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%. ) May include modified nucleotides.

In some embodiments, one or more codons of the polynucleotides of the invention may be replaced with other codons encoding the natural amino acid sequence to regulate SRE expression through a process called codon selection. The codon selection described herein is spatiotemporal (ST) codon selection because mRNA codons and tRNA anticodon pools tend to differ over time by organism, cell type, intracellular location, and over time.

In some embodiments of the invention, the characteristics of a particular polynucleotide may be codon-optimized. Codon optimization is the maintenance of a natural amino acid sequence in order to enhance its expression in a host cell, while at least 1, 2, 3, 4, 5, 10, 15, 20, 25, of the natural sequence. Refers to the process of modifying a nucleic acid sequence by replacing 50 or more codons with the most frequently used codons in the gene of the host cell. Codon usage may be measured using the Codon Adaptation Index (CAI), which measures the deviation of the coding polynucleotide sequence from the reference gene set. The codon usage table is available on the Codon Usage Database (http://www.kazusa.or.jp/codon/) and the CAI can be calculated on the EMBOSS CAI program (http://emboss.sourceforge.net/). it can. Codon optimization methods are known in the art and can be useful in attempts to achieve one or more of several goals. These goals include matching the codon frequencies of the target and host organisms to ensure proper folding, biasing nucleotide content to alter stability, or reducing secondary structures, gene construction and Minimize tandem repeat codons and nucleotide runs that can impair gene expression, customize transcription and translation control regions, insert or remove protein signal sequences, and post-translational modification sites of encoded proteins (eg, glycosylation) Sites) are removed / added, protein domains are added, removed or shuffled, restriction enzyme sites are inserted or removed, ribosome binding sites and degradation sites are modified, translation rates are adjusted to suit different domains of the protein. Includes being able to fold into or reduce or eliminate problematic secondary structures within a polynucleotide. Codon optimization tools, algorithms, and services are known in the art and, as non-limiting examples, GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), OptimumGene (GenScript, Piscataway, NJ),. DNA Works v3.2.3, Mr. Algorithms such as Gene (GmBH, Regensburg, Germany) and / or patented methods can be mentioned. In one embodiment, the polynucleotide sequence or a portion thereof is codon-optimized using an optimization algorithm. The choice of codons for each amino acid is well known in the art, as is a table of various species for optimizing expression in that particular species.

In some embodiments of the invention, the characteristics of a particular polynucleotide may be codon-optimized. For example, the preferred region for codon optimization may be upstream (5') or downstream (3') of the region encoding the polypeptide. These regions may be incorporated into the polynucleotide before and / or after codon optimization of the region encoding the payload or the open reading frame (ORF).

After optimization (if desired), the components of the polynucleotide are reconstituted and converted into vectors containing, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.

Spatiotemporal codon selection can affect the expression of the polynucleotides of the invention, as codon composition determines the translation rate of mRNA species and their stability. For example, tRNA anticodons for optimized codons are abundant and therefore translation can be enhanced. In contrast, tRNA anticodons for less common codons are small, so translation can proceed at a slower rate. Presnyak et al. Show that the stability of mRNA species depends on the content of codons, and that by utilizing optimized codons, higher stability and thus higher protein expression can be achieved (Presnyak et. al. (2015) Cell 160, 1111-1124; the contents of which are incorporated herein by reference in their entirety). Thus, in some embodiments, ST codon selection comprises optimized codon selection and may enhance expression of the SRESs, effector modules, and biological circuits of the invention. In other embodiments, spatiotemporal codon selection is less commonly used in host cell genes and may include codon selection that reduces expression of the compositions of the invention. The ratio of optimized codons to codons that are less commonly used in host cell genes may also be varied to regulate expression.

In some embodiments, certain regions of the polynucleotide may be preferred for codon selection. For example, the preferred region for codon selection may be upstream (5') or downstream (3') of the region encoding the polypeptide. These regions may be incorporated into the polynucleotide before and / or after codon selection in the region encoding the payload or in the open reading frame (ORF).

The stop codons of the polynucleotides of the invention may be modified to include sequences and motifs for altering the expression levels of the SREs, payloads and effector modules of the invention. Such sequences may be incorporated to induce a stop codon read-through, which may identify the amino acid to, for example, selenocysteine or pyrrolidine. In another example, the stop codon may be skipped altogether and translation resumed via an alternative open reading frame. The read-through of the stop codon may be utilized to regulate the expression of the components of the effector module in a particular ratio (eg, as defined by the context of the stop codon). Examples of preferred stop codon motifs include UGAN, UAAN, and UAGN, where N is either C or U. Modification and manipulation of polynucleotides can be achieved by methods known in the art, such as, but not limited to, site-directed mutagenesis and recombination techniques. The resulting modified molecule is then tested for activity using an in vitro or in vivo assay, eg, an assay described herein or any other suitable screening assay known in the art. May be good.

In some embodiments, the polynucleotides of the invention are two or more effector module sequences, or 2 or more effector module sequences that are patterns such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof, which are repeated once, twice, or more than three times. It may contain one or more target payload arrays. In these patterns, the letters A, B, or C represent different effector module components.

In yet another embodiment, the polynucleotide of the invention comprises a sequence of two or more effector module components, each component having one or more SRE sequences (DD sequences), or two or more payload sequences. Can include. As a non-limiting example, the sequence may be a pattern such as ABABAB or AABBAABBAABB or ABCABCABC or a variant thereof, which is repeated once, twice, or more than three times in each region. As another non-limiting example, the sequence may be a pattern such as ABABAB or AABBAABBAABB or ABCABCABC or a variant thereof, which is repeated once, twice, or more than three times throughout the polynucleotide. In these patterns, each letter A, B, or C represents a different array or component.

According to the present invention, polynucleotides encoding separate biocircuits, effector modules, SREs and payload constructs may be linked together via the 3'end with nucleotides modified at the 3'end. Chemical bonds may be used to control the stoichiometry of delivery to cells. Polynucleotides include other polypeptides, dyes, inserts (aclysin, etc.), cross-linking agents (solarene, mitomycin C, etc.), porphyrin (TPPC4, texaphyllin, sapphirine), polycyclic aromatic hydrocarbons (phenazine, dihydrophenazine, etc.) , Artificial endonucleases (EDTA, etc.), alkylating agents, phosphates, amino, mercapto, PEG (PEG-40K, etc.), MPEG, (MPEG) ₂ , polyamino, alkyl, substituted alkyl, radiolabeling markers, enzymes, hapten ( Molecules or antibodies that have specific affinity for transport / absorption enhancers (eg, aspirin, vitamin E, folic acid), synthetic ribonucleases, proteins such as glycoproteins, or peptides, such as co-ligants. , For example, antibodies, hormones and hormone receptors that bind to specific cell types such as cancer cells, endothelial cells, bone cells, non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or drugs. Can be designed to. As a non-limiting example, they may be complexes with other immune complexes.

In some embodiments, the composition of the polynucleotide of the invention may be produced by combining various components of the effector module using the Gibson assembly method. The Gibson assembly reaction consists of three isothermal reactions, each containing a 5'exonuclease that produces a long overhang, a polymerase that fills the gap in the annealed single-stranded region, and a nick in the annealed and filled gap. Depends on different enzymatic activities, including blocking DNA ligase. A polymerase chain reaction is performed prior to the Gibson assembly, which is used to produce PCR products with overlapping sequences. These methods can be repeated in sequence to assemble larger molecules. For example, in this method, the above steps are repeated to bind a second set of two or more target DNA molecules to each other, and then this method is repeated again to bind the first and second sets of target DNA molecules. Can include things such as. At any stage during these multiple assemblys, the assembled DNA can be amplified by transforming it into the appropriate microorganism, or the DNA can be amplified in vitro (eg, using PCR). ..

In some embodiments, the polynucleotide of the invention may encode a fusion polypeptide comprising a destabilizing domain (DD) and at least one immunotherapeutic agent set forth herein. The DD domain is an FKBP variant encoded by the nucleotide sequence of SEQ ID NOs: 60, 87-88 and / or 878-889, an ecDHFR variant encoded by the nucleotide sequence of SEQ ID NOs: 61, 89, 90 and / or 869-877. It may be an hDHFR variant encoded by the nucleotide sequence of the body, SEQ ID NOs: 91-93, 182-192, SEQ ID NO: 797-832, and / or 890-905.

In some embodiments, the polynucleotides of the invention are IL2 as a payload having the nucleotide sequence of SEQ ID NOs: 62-64, or Caspase 9 as a payload having the nucleotide sequence of SEQ ID NOs: 94-102, or SEQ ID NO: 193. FOXP3 as a payload with a nucleotide sequence of ~ 202, or Luciferase as a payload with a nucleotide sequence of SEQ ID NOs: 203-208, or BCMA CAR as a payload with a nucleotide sequence of SEQ ID NOs: 833 to 835, or SEQ ID NO: 907. It can encode an effector module that includes Her2 as a payload with a nucleotide sequence.

Cells According to the present invention, there are provided cells genetically modified to express at least one biological circuit, SRE (eg, DD), effector module and immunotherapeutic agent of the present invention. The cells of the present invention include, but are not limited to, immune cells, stem cells and tumor cells. In some embodiments, the immune cells are ^{T cells such as CD8 +} T cells and CD4 ⁺ T cells (eg, Th1, Th2, Th17, Foxp3 + cells), memory T cells, eg, T memory stem cells, central memory T. Cells and effector memory T cells, final differentiation effector T cells, natural killer (NK) cells, NK T cells, tumor infiltrating lymphocytes (TIL), cytotoxic T lymphocytes (CTL), regulatory T cells (Treg) , As well as dendritic cells (DCs), other immune cells capable of eliciting effector function, or immune effector cells including, but not limited to, mixtures thereof. The T cells may be Tαβ cells and Tγδ cells. In some embodiments, the stem cells may be derived from human embryonic stem cells, mesenchymal stem cells, and neural stem cells. In some embodiments, the T cells may be depleted endogenous T cell receptors (US Pat. Nos. 9,273,283; 9,181,527; and 9,028,812). Reference; the contents of each of these are incorporated herein by reference in their entirety).

In some embodiments, the cells of the invention may be self, allogeneic, syngeneic, or heterologous with respect to a particular individual subject.

In some embodiments, the cells of the invention may be mammalian cells, especially human cells. The cells of the invention may be primary cells or immortalized cell lines.

In some embodiments, the cells of the invention may be proliferated with growth factors that induce cell proliferation and proliferation. Illustrative growth factors include RAS such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS, DIRAS such as DIRAS1, DIRAS2, and DIRAS3, NKIRAS1, NKIRAS1, and RALB such as NKIRAS2. , RAP1A, RAP1B, RAP2A, RAP2B, and RAP such as RAP2C, RASD such as RASD1, RASD2, RASL10A, RASL10B, RASL11A, RASL11B, and RASL such as RASL12, REM1, and REM2. And RRAD.

Artificial immune cells characterize a cell composition with a polypeptide of a biological circuit, an effector module, an SRE and / or a target payload (ie, an immunotherapeutic agent), or a polynucleotide encoding the polypeptide, or a vector containing the polynucleotide. It can be achieved by introducing it. The vector may be a viral vector such as a lentiviral vector, a gamma retroviral vector, a recombinant AAV, an adenoviral vector, and an oncolytic viral vector. In other embodiments, non-viral vectors such as nanoparticles and liposomes may also be used. In some embodiments, the immune cells of the invention may be genetically modified to express at least one immunotherapeutic agent of the invention that can be tuned using stimuli. In some embodiments, cells are introduced with two, three or more immunotherapeutic agents constructed in the same biological circuit and effector module. In other embodiments, cells may be introduced with two, three, or more biological circuits, effector modules, each containing an immunotherapeutic agent.

In some embodiments, T cells expressing a chimeric antigen receptor or T cell receptor are further modified to express another one, two, three or more immunotherapeutic agents of the invention. You may. Immunotherapeutic agents are other cytokines such as IL2, IL12, IL15 and IL18; regulatory switches; or when serious events are observed after adoptive cell transfer or when the transferred immune cells are no longer needed. It may be a safety switch gene (eg, a suicide gene) that kills activated T cells. These molecules may be included in the same effector module or separate effector modules.

In some embodiments, the immune cells of the invention may be NK cells modified to express the payload of the invention.

Natural killer (NK) cells are members of the innate lymphoid cell family and are characterized in humans by the expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T cell co-receptor). .. NK cells are powerful effector cells of the innate immune system that mediate cytotoxic attacks without the need for prior antigen priming and form the forefront of defense against diseases such as cancer malignancies and viral infections.

Several preclinical and clinical trials have shown that adoptive NK cells are a promising therapeutic approach for cancers such as acute myeloid leukemia (Ruggeri et al., Science; 2002, 295: 2097-2100; and Geller et al., Immunotherapy, 2011, 3: 1445-1459).

NK cell activation is characterized by a set of receptors that have activating and inhibitory functions. Important activating receptors on NK cells include CD94 / NKG2C and NKG2D (C-type lectin-like receptors), and natural killer cell damaging receptors (NCR) NKp30, which recognize ligands on tumor cells or virus-infected cells. NKp44 and NKp46 are included. Inhibition of NK cells is via the α-1 helix of the HLA molecule by the interaction of polymorphic inhibitory killer cell immunoglobulin-like receptors (KIRs) with their cognate human-leukocyte-antigen (HLA) ligands. In essence mediated. The balance of signals generated from activating and inhibitory receptors primarily determines immediate cytotoxic activation.

NK cells may be isolated from peripheral blood mononuclear cells (PBMC) or derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSC). Primary NK cells isolated from PBMCs may be further proliferated for adoption immunotherapy. Strategies and protocols that help NK cell proliferation may include interleukin 2 (IL2) stimulation and the use of autologous feeder cells, or the use of recombinant allogeneic feeder cells. In some embodiments, NK cells can be selectively grown with a combination of stimulating ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1 / SLAMF2. (For example, US Patent Publication No. US201501090471).

In some embodiments, the cells of the invention may be dendritic cells genetically modified to express the compositions of the invention.

In some embodiments, the cells of the invention may be Treg cells. The payloads of the invention may be used to promote the proliferation, survival, activation and / or function of regulatory T cells. Tregs are a distinct cell population that is actively selected on thymic high-affinity ligands and plays an important role in tolerance to self-antigens. In addition, Tregs have been shown to play a role in peripheral tolerance to foreign antigens. The tolerance-inducing ability of Tregs may be utilized to regulate the immune response to the immunotherapeutic agents described herein. Methods for Treg growth for immunotherapy are described in Tang et al. , 2004, J. et al. Exp. Med. 199: 1455-65; Battaglia et al. , 2005, Blood 105: 4743-48; Earle et al. , 2005, Clin. Immunol. 115: 3-9; Godfree et al. , 2004, Blood 104: 453-61; Hoffmann et al. , 2004, Blood 104: 895-903.

III. Pharmaceutical Compositions and Formulations The present invention further comprises one or more biological circuits, effector modules, SREs (eg, DDs), stimuli and target payloads (ie, immunotherapeutic agents), vectors, cells and other components of the invention. , And optionally, a pharmaceutical composition comprising at least one pharmaceutically acceptable excipient or inert ingredient.

As used herein, the term "pharmaceutical composition" refers to biological circuits, SREs, stimuli and target payloads (ie, immunotherapeutic agents), other components, vectors, cells, as described herein. Alternatively, it refers to a preparation containing a pharmaceutically acceptable salt thereof, and optionally other chemical components such as physiologically suitable carriers and excipients. The pharmaceutical composition of the present invention comprises an effective amount of one or more active compositions of the present invention. Preparations of pharmaceutical compositions containing at least one composition and / or additional active ingredient of the invention are described in Remington's Pharmaceutical Sciences, 18th Ed. As exemplified by Mack Printing Company, 1990, those known to those of skill in the art in the light of the present disclosure are incorporated herein by reference.

The term "excipient" or "inactive ingredient" refers to an inert substance added to a pharmaceutical composition and formulation to further facilitate the administration of the active ingredient. For the purposes of the present disclosure, the term "active ingredient" generally refers to any one or more biological circuits, effector modules, SREs, stimuli and target payloads (ie, immunotherapy), as described herein. Therapeutic agent), other components, vectors, and delivered cells. The phrase "pharmaceutically acceptable" refers to a molecular entity and composition that, when properly administered to an animal, such as a human, does not cause an adverse reaction, an allergic reaction, or any other adverse reaction.

In some embodiments, the pharmaceutical compositions and formulations are administered to a human, human patient or subject. The description of the pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, but those skilled in the art will generally find such compositions. It will be appreciated that it is suitable for administration to any other animal, such as non-human animals, such as non-human mammals. Agricultural animals such as cattle, horses, chickens and pigs, domestic animals such as cats and dogs, or research animals such as mice, rats, rabbits, dogs, and non-human primates are intended for administration of the pharmaceutical composition. Non-human mammals, including, but not limited to. For human administration, it will be appreciated that the preparation must meet the criteria of sterility, exothermic properties, general safety and purity required by the FDA Office of Biological Standards.

The pharmaceutical compositions and formulations according to the invention may be prepared, packaged, and / or sold in large quantities as a single unit dose and / or as multiple single unit doses. As used herein, a "unit dose" is an individual amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of active ingredient is generally equal to the dose of active ingredient that will be administered to the subject and / or a convenient fraction of such dose, eg, half or one-third of such dose.

The composition of the present invention may be formulated by any method suitable for delivery. The formulation may be nanoparticles, poly (lactic acid-glycolic acid copolymer) (PLGA) microspheres, lipidoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids and combinations thereof. Good, but not limited to these.

In one embodiment, the pharmaceutical product is nanoparticles that may contain at least one lipid. Lipids are selected from DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODA, PLGA, PEG, PEG-DMG and PEGylated lipids. It may be, but it is not limited to these. In another aspect, the lipid may be, but is not limited to, cationic lipids such as DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA and DODA.

For the polynucleotide of the present invention, the formulation may be selected from, for example, any of the formulations shown in the international application PCT / US2012 / 069610, the contents of which are incorporated herein by reference in their entirety.

The relative amount of the active ingredient, pharmaceutically acceptable excipient or inert ingredient, and / or any additional ingredient in the pharmaceutical composition according to the invention is the identity, size, and / or of the subject to be treated. It is changed according to the pathological condition and further according to the route of administration of the composition. As an example, the composition may contain 0.1 to 100, for example 0.5 to 50, 1 to 30, 5 to 80, at least 80 (w / w) of active ingredients.

The effectiveness of treatment or improvement of the disease is, for example, disease progression, disease remission, symptom severity, pain relief, quality of life, dose of drug required to maintain therapeutic effect, level of disease marker. , Or any other measurable parameter suitable for the disease to be treated or prevented. It is well within the ability of one of ordinary skill in the art to monitor the effectiveness of treatment or prevention by measuring any such parameter, or any combination of parameters. With respect to the administration of the compositions of the invention, eg, "effective" for cancer is a beneficial effect, eg, on symptoms, on at least a statistically significant proportion of patients when administered in a clinically appropriate manner. Improvement, cure, reduction of disease burden, reduction of tumor volume or cell count, prolongation of lifespan, improvement of quality of life, or others generally accepted by doctors familiar with the treatment of certain types of cancer It means that the effect of.

The therapeutic or prophylactic effect is evident if there is a statistically significant improvement in one or more parameters of the disease state, or otherwise expected exacerbation or onset of symptoms. As an example, at least 10, preferably at least 20, 30, 40, 50 or more favorable changes in the measurable parameters of the disease can be indicators of effective treatment. The effectiveness of a given composition or formulation of the present invention can also be determined using laboratory animal models of a given disease known in the art. When using an experimental animal model, the effectiveness of treatment is demonstrated when statistically significant changes are observed.

Preferably, the compositions of the invention are administered by injection, eg, intravenously. When the CAR substance of the present invention is a host cell (or a population thereof) expressing the CAR of the present invention, any isotonic carrier, for example, physiology, as a pharmaceutically acceptable carrier for cells for injection. Saline (about 0.90% w / v NaCl in water, about 300 mOsm / L NaCl in water, or about 9.0 g NaCl per liter of water), NORMOSOL R electrolyte solution (Abbott, Chicago, IL) , PLASMA-LYTE A (Baxter, Cellfield, IL), about 5% dextrose in water, or Ringer's lactate solution. In one embodiment, the pharmaceutically acceptable carrier may be supplemented with human serum albumin. Any of the carriers shown in WO2016149579A1 can be useful in the present invention.

IV. Application One aspect of the present invention provides a method of reducing tumor volume or tumor volume. This method uses a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or target payload (ie, immunotherapeutic agent), at least one vector, or cells to tumor a tumor. Includes administration to subjects who have. Biological circuit systems and effector modules with any of the immunotherapeutic agents described herein are polynucleotides, or polynucleotides such as mRNA, or viral vectors containing polynucleotides, or biological circuits, effector modules, DDs, and objectives. It may be in the form of cells modified to express a payload (ie, an immunotherapeutic agent).

Another aspect of the invention provides a method of inducing an anti-tumor immune response in a subject. This method uses a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or target payload (ie, immunotherapeutic agent), at least one vector, or cells to tumor a tumor. Includes administration to subjects who have. Biological circuits and effector modules having any of the immunotherapeutic agents described herein are polynucleotides, or polynucleotides such as mRNA, or viral vectors containing polynucleotides, or biological circuits, effector modules, DDs, and objectives. It may be in the form of cells modified to express a payload (such as an immunotherapeutic agent).

The method according to the invention is a genetically modified cell such as the immune effector cell of the present invention, a cancer vaccine containing a biological circuit system, an effector module, a DD, a target payload of the present invention (ie, an immunotherapeutic agent), or tumor immunosuppressiveness. It may be an adopted cell transfer (ACT) using a composition that manipulates the microenvironment, or a combination thereof. These therapies may also be used in conjunction with other cancer treatments such as chemotherapy and radiation therapy.

In some embodiments, the safety switches described herein may be useful in treating protein proliferation and / or protein aggregation, such as neurological and / or pre-diseases such as renal disease and / or Alzheimer's disease. .. In one embodiment, the safety switch of the invention may be expressed in phagocytic cells designed to target aggregated proteins such as amyloid proteins, utilizing the safety switches described herein to utilize aggregated proteins. Phagocytes may be removed after clearance.

1. 1. Adoptive cell transfer (adoptive immunotherapy)
In some embodiments, cells genetically modified to express at least one biological circuit system, effector module, DD, and / or target payload (immunotherapeutic agent) may also be used for adoptive cell therapy (ACT). Good. As used herein, adoptive cell transfer refers to the administration of immune cells (self, allogeneic or genetically modified host) with direct anti-cancer activity. ACT is promising in clinical applications for malignant diseases and infectious diseases. For example, T cells genetically modified to recognize CD19 have been used in the treatment of follicular B-cell lymphocytes (Kochenderfer et al., Blood, 2010, 116: 4099-4102; and Kochender and Rosenberg, Nat Rev. Clin Oncol., 2013, 10 (5): 267-276), ACT using autologous lymphocytes genetically modified to express antitumor T cell receptors has been used to treat metastatic melanoma. (Rosenberg and Dudley, Curr. Opin. Immunol. 2009, 21: 233-240).

According to the present invention, biological circuits and systems may be used in the development and implementation of cell therapies such as adopted cell therapies. Specific effector modules useful for cell therapy are shown in Figures 7-12. Enhancing APC stimulation ex vivo on the APC platform for stimulating T cells in cell therapy to regulate epitope-labeled receptors, biological circuits, their components, effector modules and their SREs, and payloads. As a tool, to improve the method of T cell proliferation, in ex vivo stimulation with antigens, in combination with TCR / CAR, in manipulation or regulation of TIL, in allogeneic cell therapy, other treatment lines (eg, radiation, cytokines). ) May be used in combination T cell therapy.

Provided herein are methods of use in adoptive cell therapy. The method preconditions a subject in need thereof, regulates immune cells using the SRE, biological circuit and composition of the invention, and administers a modified immune cell expressing the composition of the invention to the subject. Includes successful engraftment of modified cells within the subject.

In some embodiments, the SREs, biological circuits and compositions of the present invention may be used to minimize pre-adjusted regimens associated with adoptive cell therapy. As used herein, "pre-adjustment" refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy. Pre-adjustment strategies include, but are not limited to, total body irradiation and / or lymphopenia chemotherapy. The importance of pre-adjustment in ACT is shown by the fact that clinical trials of adoption therapy without pre-adjustment failed to show clinical usefulness. However, pre-adjustment is highly toxic and limits the target cohort suitable for ACT. In some examples, ACT immune cells may be modified to express cytokines such as IL2 as payloads using the SREs of the invention, reducing the need for preconditioning.

In some embodiments, the immune cells of the ACT are dendritic cells, ^{T cells such as CD8 +} T cells and CD4 ⁺ T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTL). ), Tumor infiltrating lymphocytes (TIL), lymphokine activation killer (LAK) cells, memory T cells, regulatory T cells (Treg), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof It may be. In other embodiments, immunostimulatory cells of ACT may be generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). In some embodiments, autologous or allogeneic immune cells are used for ACT.

In some embodiments, NK cells modified to express the composition may be used for ACT. Activation of NK cells induces perforin / granzyme-dependent apoptosis in target cells. Activation of NK cells also induces cytokine secretion such as IFN-γ, TNF-α and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and enhance the adaptive immune response through the upward control of antigen presentation by antigen-presenting cells such as dendritic cells (DCs) (Vivier et al., Nat). Immunol., 2008, 9 (5): outlined in 503-510).

NK cells may also be genetically reprogrammed to evade NK cell inhibitory signals when interacting with tumor cells. For example, CRISPR, ZFN, or TALEN may be used to genetically modify NK cells to silence inhibitory receptors to enhance the antitumor capacity of NK cells.

Immune cells can be isolated and proliferated ex vivo using various methods known in the art. For example, methods for isolating and proliferating cytotoxic T cells are described in US Pat. Nos. 6,805,861 and 6,531,451; US Patent Publication No. US20160348072A1 and International Patent Publication No. WO2016168595A1. The contents of each of them are incorporated herein by reference in their entirety. Isolation and proliferation of NK cells is described in US Patent Publication No. US201501552387A1, US Pat. No. 7,435,596; and Oyer, J. et al. L. (2016). Cytotherapy. 18 (5): 653-63; the contents of each of them are incorporated herein by reference in their entirety. Specifically, human primary NK cells may be grown in the presence of feeder cells, such as bone marrow cell lines genetically modified to express membrane-bound IL15, IL21, IL12 and 4-1BBL.

In some examples, a subpopulation of immune cells may be enriched for ACT. A method for concentrating immune cells is shown in International Patent Publication No. WO2015039100A1. In another example, B and T lymphocyte attenuator marker (BTLA) -positive T cells are used to anti-cancer reactive T cells as described in US Pat. No. 9,512,401. May be enriched (each content is incorporated herein by reference in its entirety).

In some embodiments, selected subpopulations may be depleted from immune cells for ACT to enhance T cell proliferation. For example, the method presented in US Patent Publication No. US20160298081A1 may be used to deplete Foxp3 + T lymphocytes from immune cells to minimize the antitumor immune response; its contents are hereby referred to in its entirety. Incorporate into the book.

In some embodiments, the immune cells may be enriched for FOXP3 + cells to reduce graft-versus-host disease in order to enrich the T cells that are important for immune tolerance.

In some embodiments, activation and proliferation of T cells for ACT is achieved by antigen stimulation of a chimeric antigen receptor (CAR) that is transiently expressed on the cell surface. Such activation methods are set forth in International Patent No. WO20170151427, the contents of which are incorporated herein by reference in their entirety.

In some embodiments, immune cells may be activated by antigens associated with antigen presenting cells (APCs). In some embodiments, the APC may be an antigen-specific or non-specific dendritic cell, macrophage or B cell. APCs may be self or homologous in organs. In some embodiments, the APC may be an artificial antigen presenting cell (aAPC) such as a cell-based aAPC or a cell-free aAPC. The cell-based aAPC may be selected from either genetically modified allogeneic cells such as human red leukemia cells or heterologous cells such as mouse fibroblasts and Drosophila cells. Alternatively, the APC may be cell-free, in which case the antigen or costimulatory domain is presented on a synthetic surface such as latex beads, polystyrene beads, lipid vesicles or exosomes.

In some embodiments, the cells of the invention, especially T cells, may be grown using an artificial cell platform. In one embodiment, mature T cells are subjected to Seet CS et al. 2017. Nat Methods. It may be produced using the artificial thymic organoids (ATOs) described by 14,521-530 (the contents of which are incorporated herein by reference in their entirety). ATO is based on a stromal cell line that expresses a delta-like canonical Notch ligand (DLL1). In this method, stromal cells, hematopoietic stem cells, and progenitor cells are aggregated by centrifugation and placed in a cell culture insert at the gas-liquid interface to generate an organoid culture. ATO-derived T cells exhibit a naive phenotype, a diverse T cell receptor (TCR) repertoire, and TCR-dependent function.

In some embodiments, the T cells of the invention may be isolated from peripheral blood by a process known as apheresis, which separates lymphocytes from plasma, platelets and RBC, and granulocytes. A semi-automatic eltriation device may be used to further separate lymphocytes from peripheral blood cells from monocytes. In addition, T cells may be concentrated by magnetic selection using anti-CD3 / CD28 beads. In one embodiment, an additional step of using a plastic-bonded surface to deplete monocytes from PBMCs may be utilized. Methods for T cell enrichment are described in Strongek DF et al. (2017) Journal of Transitional Medicine. It is disclosed at 15:59; its contents are incorporated by reference in its entirety.

In some embodiments, adoptive cell therapy is performed by autotransplantation, where the cells are derived from a subject in need of treatment and are administered to the same subject after isolation and processing. In other examples, the ACT may involve an allogeneic transplant, in which case cells are isolated and / or prepared from a donor subject other than the recipient subject who will ultimately receive cell therapy. Donor and recipient subjects may be genetically identical or similar, or express the same HLA class or subtype.

In some embodiments, the plurality of immunotherapeutic agents introduced into immune cells for ACT (eg, T cells and NK cells) may be controlled by the same biological circuit system. In one example, cytokines such as IL2 and caspase-9 are linked to the same hDHFR destabilizing domain. The expression of IL2 and caspase-9 is regulated using TMP simultaneously. In other embodiments, the plurality of immunotherapeutic agents introduced into immune cells for ACT (eg, T cells and NK cells) may be controlled by different biological circuitry. In one example, cytokines such as IL2 and caspase-9 constructs can be linked to different DDs of two separate effector modules and adjusted separately using different stimuli. In another embodiment, the suicide gene and CAR construct may be linked into two separate effector modules.

Following gene regulation using the SREs, biological circuits and compositions of the present invention, cells are administered to a subject in need thereof. Methods of administering cells for adoptive cell therapy are known and may be used with respect to the methods and compositions provided. For example, methods of adoptive T cell therapy include, for example, U.S. Patent Application Publication No. 2003/0170238 of Gruenberg et al.; U.S. Pat. No. 4,690,915 of Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8 (10): 577-85). For example, Themelli et al. (2013) Nat Biotechnology. 31 (10): 928-933; Tsukahara et al. (2013) Biochem Biophyss Res Commun 438 (1): 84-9; Davila et al. (2013) PLos ONE 8 (4): e61338; the contents of each of them are incorporated herein by reference in their entirety.

In some embodiments, immune cells for ACT may be modified to express one or more immunotherapeutic agents that promote immune cell activation, infiltration, proliferation, survival, and antitumor function. ..

In some embodiments, the immune cells used for adoptive cell transfer are genetically engineered in vivo for the overall purpose of further improving the ability of the cancer patient to kill the tumor. Can improve persistence, cytotoxicity, tumor targeting ability, and homing ability to diseased sites. One example is to introduce an effector module of the present invention containing a cytokine such as γ cytokine (IL2) into an immune cell to promote proliferation and survival of the immune cell. Transfection of cytokine genes (eg, γ-cytokine IL2) into cells allowed immune cells to proliferate without the addition of exogenous cytokines, and cytokine-expressing NK cells enhanced tumor cytotoxicity.

In some embodiments, biological circuits, their components, SREs, or effector modules can be utilized to prevent T cell depletion. As used herein, "T cell depletion" refers to the gradual and progressive loss of T cell function caused by chronic T cell activation. T cell depletion is a major factor limiting the efficacy of antiviral and antitumor immunotherapy. Depleted T cells have a low proliferation rate and cytokine production capacity, a high rate of apoptosis, and a high surface expression of multiple inhibitory receptors. Activation of T cells leading to depletion can occur in the presence or absence of antigen.

In some embodiments, the effector modules of the invention useful for immunotherapy may be placed under transcriptional control of the T cell receptor α locus constant (TRAC) locus on T cells. Eyquem et al. Showed that expression of CAR from the TRAC locus prevents T cell depletion and accelerated T cell differentiation caused by excessive activation of T cells (Eyquem J. et al (2017). ) Nature. 543 (7643): 113-117; the content of which is incorporated herein by reference in its entirety).

In some embodiments, the payloads of the invention may be used with antibodies or fragments that target T cell surface markers associated with T cell depletion. T cell surface markers associated with T cell depletion that may be used include, but are limited to, CTLA-1, PD-1, TGIT, LAG-3, 2B4, BTLA, TIM3, VISTA, and CD96. Not done.

T cells specific for a particular tumor antigen may be exposed to chronic antigen exposure. Persistent antigen expression leads to the expression of immune checkpoints, resulting in the depletion of allogeneic antigen-specific T cells. Constant expression of the chimeric antigen receptor of the invention can lead to chronic interactions with the antigen, which results in depletion. T cell depletion may be prevented by using the compositions disclosed herein to regulate surface CAR expression with stimuli specific to the present invention. In one embodiment, the SREs of the invention may be used to achieve pulsatile expression of the compositions of the invention. As used herein, "pulsatile" refers to the expression of multiple payloads at spaced time intervals. In general, administration of a stimulus increases payload expression and produces a first pulse; following stimulus withdrawal, payload expression decreases, which is the first exposure to the stimulus and then Represents the interval time between exposures to the stimulus, after which a second exposure to the stimulus begins.

Also provided herein are methods of preventing or reversing T cell depletion in a subject in need thereof, including administering to the subject a therapeutically effective amount of a composition comprising at least one effector module. In some embodiments, the effector module comprises a stimulus response element (SRE) operably linked to at least one immunotherapeutic agent so that the SRE responds to the stimulus and expresses the immunotherapeutic agent and /. Or regulate function, thereby preventing or reversing T cell depletion. In some embodiments, the immunotherapeutic agent may be a chimeric antigen receptor. Examples of chimeric antigen receptors include, but are not limited to, GD2 CAR, BCMA CAR, CD33 CAR, Her2 CAR, ALK CAR, CD22 CAR, or CD276 CAR. In some embodiments, the CAR may be a bispecific CAR comprising an extracellular domain that recognizes at least one antigen, such as GD2, BCMA, CD33, Her2, ALK, CD22 or CD276. In some embodiments, the methods described herein may include pulsatile expression of the compositions of the invention to prevent T cell depletion. In some cases, the addition of stimuli can reverse T cell depletion. In another example, T cell depletion can be reversed by stimulus retraction.

In some embodiments, the compositions of the invention may be utilized to alter the TIL (tumor infiltrating lymphocyte) population of interest. In one embodiment, any of the payloads described herein may be utilized to alter the ratio of CD4 positive cells to the CD8 positive population. In some embodiments, the TIL may be sorted ex vivo and modified to express any of the cytokines described herein. The payloads of the invention may be used to proliferate CD4 and / or CD8 populations of TIL to enhance the TIL-mediated immune response.

2. Cancer Vaccines In some embodiments, the biological circuits, effector modules, target payloads (immunotherapeutic agents), vectors, cells and compositions of the invention may be used in combination with cancer vaccines. In one aspect, dendritic cells are modified to express the compositions of the invention and used as a cancer vaccine.

In some embodiments, the cancer vaccine may comprise a peptide and / or protein derived from a tumor-related antigen (TAA). Such a strategy may be utilized to induce an immune response in a subject, which in some cases may be a cytotoxic T lymphocyte (CTL) response. In addition, the peptide used in the cancer vaccine may be modified to match the mutational properties of the subject. For example, an EGFR-derived peptide having a mutation that matches the mutation found in a subject in need of treatment has been successfully used in patients with lung cancer (Li F et al. (2016) Oncoimmunology.Oct 7; 5 (12): e1238539; the content of which is incorporated herein by reference in its entirety).

In one embodiment, the cancer vaccine of the present invention may be a superagonist TAA-derived modified peptide ligand (APL). These are mutant peptide ligands in which one or more amino acids deviate from the native peptide sequence and activate certain CTL clones more effectively than the native epitope. These changes allow the peptide to bind better to restricted class I MHC molecules or better interact with the TCR of a given tumor-specific CTL subset. APL may be selected using the method set forth in US Patent Publication No. US20160137633A1, the contents of which are incorporated herein by reference in their entirety.

Recurrence of hematopoietic malignancies is a major cause of treatment failure after allogeneic hematopoietic stem cell transplantation (HCT). The Wilms tumor (WT1) gene product is a tumor-related antigen expressed in acute leukemia and other hematological malignancies, with limited expression in normal tissues. The compositions of the present invention may be co-administered with a donor-derived WT1 peptide-loaded dendritic cell vaccine to prevent recurrence of disease after immunotherapy (Shah NN et al. (2016) Biol Blood Marlow Transplant). .22 (12): 2149-215; the contents of which are incorporated herein by reference in their entirety.

3. 3. Combination Therapies In some embodiments, it is desirable to combine the compositions, vectors and cells of the invention for administration to a subject. To enhance immunotherapy, the compositions of the invention comprising different immunotherapeutic agents may be combined or combined with known immunotherapeutic agents.

In some embodiments, it is desirable that the compositions of the invention can be combined with an adjuvant to enhance the efficacy and longevity of an antigen-specific immune response. The adjuvant used as an immunostimulant in the combination therapy includes a biomolecule or a delivery carrier that delivers the antigen. As a non-limiting example, the compositions of the invention may be used in combination with biological adjuvants such as cytokines, Toll-like receptors, bacterial toxins, and / or saponins. In other embodiments, the compositions of the invention may be combined with a delivery carrier. Exemplary delivery carriers include polymeric microspheres, immunostimulatory complexes, emulsions (oil in oil or water in oil), aluminum salts, liposomes and virosomes.

In some embodiments, immune effector cells modified to express the biological circuits, effector modules, DDs and payloads of the invention may be used in combination with the biological adjuvants described herein.

In some embodiments, immune effector cells modified to express the biological circuits, effector modules, DDs and payloads of the invention may be used in combination with a cancer vaccine.

In some embodiments, effector modules containing cytokines may be used in combination with effector modules that encode safety or regulatory switches.

In some embodiments, the methods of the invention combine the compositions of the invention with other agents effective in treating cancer, infections, and other immunodeficiency disorders, such as anti-cancer agents. Can include. As used herein, the term "anticancer agent" means, for example, whether it kills cancer cells, induces cancer cell apoptosis, slows the growth rate of cancer cells, or Reduces the incidence or number of metastases, reduces tumor size, inhibits tumor growth, reduces the blood supply to the tumor or cancer cells, or promotes the immune response to the cancer cells or cancer cells Or, any drug that can have a negative effect on a subject's cancer by preventing or inhibiting the progression of the cancer, or by prolonging the lifespan of a subject with the cancer.

In some embodiments, the anti-cancer agent or anti-cancer therapy is a chemotherapeutic agent, or any other therapeutic agent, radiotherapy, immunotherapeutic agent, surgery, or any other that enhances the therapeutic effect of the treatment in combination with the present invention. It may be a therapeutic agent.

In some embodiments, the compositions of the invention are combined with immunotherapeutic agents other than the therapies of the invention described herein, eg, antibodies specific for some target molecule on the surface of tumor cells. You may.

Exemplary chemotherapeutic agents include ashibicin; acralbisin; acodazole hydrochloride; acronin; adzelesin; aldesroykin; altretamine; ambomycin; amethanetron acetate; amsacrine; anastrosol; anthramycin; asparaginase; asparaginase, slindac, curcumin, Alkylating agents: nitrogen mustards such as mechlorethamine, cyclophosphamide, iphosphamide, melphalan, and chlorambusyl; nitrosurenes such as vinblastine (BC U), lomustine (CCNU), and semstin (methyl CCU); triethylene melamine (TEM), triethylene, thiophosphoramide (thiotepa), thyrenimine / methylmelamine such as hexamethylmelamine (HMM, altretamine); alkylsulfonates such as vinblastine; triazines such as dacarbazine (DTIC); metabolic antagonists, For example, folic acid analogs such as methotrexate and trimetrexate, pyrrolidine analogs such as 5-fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), 5-azacitidine, 2,2'-difluorodeoxycitidine. , 6-Mercaptopurine, 6-thioguanine, azathiopurine, 2'-deoxycoformycin (pentostatin), erythrohydroxynonyladenin (EHNA), fludalabine phosphate, and 2-chlorodeoxyadenosin (cladribin, 2-CdA), etc. Purine analogs; natural products including paclitaxel, vinca alkaloids such as vinblastine (VLB), vinblastine, and vinolerubine, and anti-thread fission agents such as taxotere, estramustine, and estramustine phosphate; Epipodophylrotoxins such as teniposide; antibiotics such as actimomycin D, daunomycin (rubidomycin), doxorubicin, mitoxanthrone, idarubicin, bleomycin, plicamycin (mitramycin), mitomycin C, and actinomycin; L-asparaginase Enzymes such as, cytokines such as interferon (IFN) -γ, tumor necrosis factors (TNF) -α, TNF-β and GM-CSF, antiangiogenic factors such as angiostatin and endostatin, inhibitors of FGF or VEGF, For example, including soluble VGF / VEGF receptors, Soluble forms of angiogenic factor receptors, platinum coordination complexes such as cisplatin and carboplatin, anthracendiones such as mitoxanthrone, substituted ureas such as hydroxyurea, methylhydrazine derivatives such as N-methylhydrazine (MIFf) and procarbazine, mitotan Adrenal cortex inhibitors such as (o, p'-DDD) and aminoglutetimid; hormones and antagonists including prednison and equivalents, corticosteroid antagonists such as dexamethasone and aminoglutetimide; hydroxyprogesterone caproate, Progestins such as medroxyprogesterone acetate and megestrol acetate; estrogen such as diethylstilvestrol and ethynyl estradiol equivalents; anti-estrogens such as tamoxyphene; androgens containing testosterone propionate and fluorimesterone / equivalents; flutamide , Gonadotropin-releasing hormone analogs, and anti-androgen agents such as leuprolide; non-steroidal anti-androgen agents such as flutamide; kinase inhibitors, histone deacetylase inhibitors, methylation inhibitors, proteasome inhibitors, monoclonal antibodies, oxidants , Antioxidants, telomerase inhibitors, BH3 mimetics, ubiquitin ligase inhibitors, stat inhibitors, and imatinib mesylate (sold as Gleevac or Grivac) and errotinib (EGF receptor inhibitor) currently sold as Tarveca. Receptor tyrosine kinase inhibitor; antiviral agents such as oseltamivir phosphate, amphotelicin B, and paribismab; Sdi1 mimetic; semstin; aging-derived inhibitor 1; sparphosic acid; spicamycin D; spiromustin; sprenopentin; spongistatin 1; Squalamine; Stipamide; Stromelysin inhibitor; Sulfinocin; Superactive vasoactive intestinal peptide antagonist; Veraresol; Veramine; Verdins; Verteporfin; Vinorelvin; Vinxartin; Vitaxin; Borozole; Zanoteron; Xeniplatin; Dilascorb; PI3Kβ small molecule inhibitor, GSK2636771; pan PI3K inhibitor (BKM120); BRAF inhibitor, vemurafenib (Zelboraf) and dabrafenib (Tafinlar); or any of the analogs or derivatives and variants described above, but limited to these. Not done.

Radiation therapies and factors include, for example, radiation and waves that induce DNA damage such as gamma irradiation, X-rays, UV irradiation, microwaves, electron emission, and radioisotopes. Therapy may be achieved by irradiating the localized tumor site with radiation of the above forms. All of these factors are most likely to result in widespread damaged DNA in DNA precursors, DNA replication and repair, and chromosomal assembly and maintenance. The X-ray dose range ranges from a daily dose of 50 to 200 X-rays for a long period of time (3 to 4 weeks) to a single line dose of 2000 to 6000 X-rays. The dose range of radioisotopes varies widely and depends on the half-life of the isotope, the intensity and type of radiation emitted, and the uptake by tumor cells.

In some embodiments, the chemotherapeutic agent may be an immunomodulatory agent such as lenalidomide (LEN). Recent studies have shown that lenalidomide can enhance the antitumor function of CAR-modified T cells (Otahal et al., Oncoimmunology, 2015, 5 (4): e1115940). Some examples of anti-tumor antibodies include tocilizumab, siltuximab.

Other agents that may be used in combination with the compositions of the invention include cell surface receptors and their ligands (eg, Fas / Fas ligands, DR4 or DR5 / TRAIL) and agents that affect the upregulation of GAP junctions. , Cell proliferation inhibitors and differentiation agents, cell adhesion inhibitors such as focal adhesion kinase (FAK) inhibitors and robastatin, or agents that increase the sensitivity of hyperproliferative cells to apoptosis-inducing substances such as antibody C225. Not limited to.

The combination may include administering the compositions of the invention and other agents simultaneously or separately. Alternatively, the immunotherapy may be given before or after other agents / therapies at intervals ranging from minutes, days, weeks to months.

In some embodiments, CAR-T cells of the invention may be co-administered with retinoids to eradicate bone marrow-derived suppressor cells. Bone marrow-derived suppressor cells (MDSCs) are an heterogeneous population of early bone marrow progenitor cells, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. MDSCs have the ability to suppress both the cytotoxic activity of natural killer (NK) and NKT cells and the adaptive immune response mediated by CD4 + and CD8 + T cells. Long AH et al. (2016) Cancer Immunol Res. 4 (10): 869-880 describes co-treatment with CAR and all transretinoic acid (ATRA) for successful treatment of solid tumors (the content of which is incorporated by reference in its entirety). ).

Adjuvant therapy as used herein refers to treatment that is given in addition to first-line therapy to kill cancer cells even if standard laboratory tests cannot detect the cancer. Experimental data show that lymphocyte depletion induced by cytotoxic regimens for the treatment of cancer can contribute to recurrence. Adjuvant immunotherapy can minimize recurrence to cancer immunotherapy. In some embodiments, adjuvant therapy may include co-administration of recombinant human interleukin 2 in combination with dendritic cells pulsed with a peptide derived from tumor cells. In some embodiments, dendritic cells are pulsed with autologous tumor cell lysates and keyhole limpet hemocyanin (KLH). In immune cells, CD25-positive T cells may be further depleted. Interleukin 7 may be co-administered as immunotherapy. In some embodiments, the monoclonal antibody 8H9, which interacts with the tumor cell surface antigen, may be used to eliminate the risk of reinjecting donor-derived tumor cells. Merchant et al. (2016), Clin Cancer Res. 1; 22 (13): Any of the adjuvant therapies shown in 3182-91 may be utilized (the content of which is incorporated by reference in its entirety).

In some embodiments, the compositions of the invention can be used in combination with CXCR2 inhibitors or anti-CXCR2 antibodies. Highfil SL et al. (2014) found that CXCR2-positive MDSC cells limit the efficacy of immunotherapy through local immunosuppression (Highfil SL, et al. Sci Transl Med. 2014 May 21; 6 (237): 237ra67; The contents are incorporated herein by reference in their entirety).

4. Diseases In the present invention, a method for reducing a tumor volume or a tumor amount of a required subject is provided, and this method includes introducing the composition of the present invention into a subject.

The present invention also provides a method of treating a subject's cancer, comprising administering to the subject an effective amount of immune effector cells genetically modified to express at least one effector module of the invention.

Cancer Various cancers can be treated with effector modules that include the pharmaceutical compositions, biocircuits, biocircuit components, SREs or payloads of the present invention. As used herein, the term "cancer" is any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body parts. Also refers to the pathological condition characterized by the growth of such malignant neoplasms. The cancer may be a tumor or a hematological malignancies, including all types of lymphoma / leukemia, carcinoma and sarcoma, such as anus, bladder, bile duct, bone, brain, breast, cervix, colon. / Rectal, endometrial, esophagus, eyes, gallbladder, head and neck, liver, kidney, laryngeal, lung, mediastinal (chest), mouth, ovary, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, tailbone Includes, but is not limited to, cancers or tumors found in the testicles, esophagus, and ovaries.

Types of carcinomas that can be treated with the compositions of the invention include papilloma / carcinoma, choriocarcinoma, oval sac tumor, teratoma, adenocarcinoma / adenocarcinoma, melanoma, fibroma, lipoma, smooth myoma, rhombic myoma. Includes, mesopharyngeal carcinoma, hemangiomas, osteomas, carcinomas, gliomas, lymphomas / leukemias, squamous cell carcinomas, small cell carcinomas, undifferentiated large cell carcinomas, basal cell carcinomas, undifferentiated sinus cancers, Not limited to these.

Types of cancer tumors that can be treated with the compositions of the invention include soft tissue sarcomas, such as follicular soft sarcomas, hemangiosarcomas, cutaneous fibrosarcomas, tendonoma, fibrogenic small round cell tumors, extraosseous chondrosarcoma, Extraosseous osteosarcoma, fibrosarcoma, hemangiosarcoma, hemangiosarcoma, caposarcoma, smooth myosarcoma, liposarcoma, lymphangisarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhizome myoma It includes, but is not limited to, synovial sarcoma, and Askin sarcoma, Ewing sarcoma (primitive neuroectodermal tumor), malignant vascular endothelial tumor, malignant Schwan tumor, osteosarcoma, and chondrosarcoma.

As a non-limiting example, treatable cancers include acute granulocytic leukemia, acute lymphocytic leukemia, acute myeloid leukemia, adenocarcinoma, adenomyoma, adrenal cancer, adrenal cortex cancer, anal cancer, and undifferentiated stellate cell tumor. , Hemangiosarcoma, wormdrop cancer, stellate cell tumor, basal cell cancer, B cell lymphoma), bile duct cancer, bladder cancer, bone cancer, intestinal cancer, brain cancer, brain stem glioma, brain tumor, breast cancer, cartinoid tumor, cervix Cancer, bile duct cell cancer, chondrosarcoma, chronic lymphocytic leukemia, chronic myeloid leukemia, colon cancer, colorectal cancer, cranopharyngeal tumor, cutaneous lymphoma, cutaneous melanoma, diffuse stellate cell tumor, mammary duct epithelial cancer , Endometrial cancer, lining tumor, epithelial sarcoma, esophageal cancer, Ewing sarcoma, extrahepatic bile duct cancer, eye cancer, oviduct cancer, fibrosarcoma, bile sac cancer, gastric cancer, gastrointestinal cancer, gastrointestinal cartinoid cancer, general digestion Transluminal tumor, germ cell tumor, polymorphic glioma, glioma, hairy cell leukemia, head and neck cancer, vascular endothelial tumor, Hodgkin lymphoma, Hodgkin's disease, Hodgkin's lymphoma, hypopharyngeal cancer, invasive milk Tube cancer, invasive lobular adenocarcinoma, inflammatory breast cancer, intestinal cancer, intrahepatic bile duct cancer, invasive breast cancer / invasive breast cancer, pancreatic islet cell cancer, jaw cancer, Kaposi sarcoma, kidney cancer, laryngeal cancer, smooth muscle tumor, soft pulp Membrane metastasis, leukemia, lip cancer, liposarcoma, liver cancer, non-invasive lobular cancer, low-grade stellate cell tumor, lung cancer, lymph node cancer, lymphoma, male breast cancer, medullary cancer, myeloma, melanoma, Meningitis, Merkel cell carcinoma, mesenchymal carcinoma, mesenchymous, mesenchoma, metastatic breast cancer, metastatic melanoma, metastatic squamous cervical cancer, mixed glioma, oral cancer, mucus Sexual cancer, mucosal malignant melanoma, multiple myeloma, nasal cavity cancer, nasopharyngeal cancer, cervical cancer, neuroblastoma, neuroendocrine tumor, non-hodgkin lymphoma, non-hodgkin lymphoma, non-small cell lung cancer, swallow cell cancer, Eye cancer, intraocular melanoma, oligodendroglioma, oral cancer, oral cancer cancer, mesopharyngeal cancer, osteogenic sarcoma, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian embryo Cellular tumor, primary peritoneal cancer, ovarian cord interstitial tumor, Paget's disease, pancreatic cancer, papillary cancer, sinus cancer, parathyroid cancer, pelvic cancer, penis cancer, peripheral nerve cancer, peritoneal cancer, pharyngeal cancer, Brown cell tumor, hairy cell stellate cell tumor, pine fruit tumor, pine fruit blastoma, pituitary cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell cancer, renal pelvis cancer, lateral Crest myoma, salivary adenocarcinoma, sarcoma, osteosarcoma, soft tissue sarcoma, uterine sarcoma, sinus cancer, skin cancer, small cell lung cancer, small bowel cancer, soft sarcoma, spinal cancer, spinal column cancer, spinal cord cancer, spinal tumor, squamous epithelium Cancer, gastric cancer, synovial sarcoma, T-cell lymphoma), testicular cancer, Pharyngeal cancer, thymoma / thymoma, thyroid cancer, tongue cancer, tonsillar cancer, transitional cell carcinoma, transitional cell carcinoma, transitional cell carcinoma, three-kind negative breast cancer, oviduct cancer, tubular cancer, urinary tract cancer, urinary tract cancer, urinary tract It may be cancer, uterine adenocarcinoma, uterine cancer, thymoma, vaginal cancer, and urogen cancer.

In some embodiments, the CARs of the invention may be useful CARs for the treatment of multiple myeloma, such as CS1 CAR, CD38 CAR, CD138 CAR, and BCMA CAR. In some embodiments, the CARs of the present invention may be useful CARs for the treatment of acute myeloid leukemia, such as the CD33 CAR, CD123 CAR, and CLL1 CAR. In some embodiments, the CARs of the invention may be useful CARs for the treatment of T-cell leukemia, such as CD5 CAR and CD7 CAR. In some embodiments, the CARs of the invention are mesothelin CARs, GD2 CARs, GPC3 CARs, Her2 CARs, EGFR CARs, Muc1 CARs, EpCAM CARs, PD-L1 CARs, CEA CARs, Muc16 CARs, CD133 CARs, CD171 CARs , CD70 CAR, CLD18 CAR, cMET CAR, EphA2 CAR, FAP CAR, Folic Acid Receptor CAR, IL13Ra2 CAR, MG7 CAR, PSMA CAR, ROR1 CAR, and VEGFR2 CAR. May be good.

Infectious Diseases In some embodiments, the biological circuits of the invention may be used to treat infectious diseases. The biological circuit of the present invention may be introduced into cells suitable for adoptive cell transfer, such as macrophages, dendritic cells, natural killer cells, and / or T cells. The infectious disease treated by the biological circuit of the present invention may be a disease caused by a virus, a bacterium, a fungus, and / or a parasite. The IL15-IL15Ra payload of the present invention may be used to enhance the proliferation and / or persistence of immune cells useful in the treatment of infections.

As used herein, "infectious disease" refers to a disease caused by any pathogen or substance that infects mammalian cells, preferably human cells, and causes a disease state. Examples include bacteria, yeasts, fungi, protozoa, mycoplasmas, viruses, prions, and parasites. Examples include (a) viral diseases such as adenovirus, herpesvirus (eg HSV-I, HSV-II, CMV, or VZV), poxvirus (eg, acne or vaccinia, or infectious ligamentoma). Orthopoxvirus), picornavirus (eg, rhinovirus or enterovirus), orthomixovirus (eg, influenza virus), paramixovirus (eg, parainfluenza virus, mumps virus, measles virus, and RS virus (RSV)) ), Coronavirus (eg SARS), papovavirus (eg genital vulgaris, vulgaris vulgaris, or papillomavirus that causes sole vulgaris), hepadonavirus (eg hepatitis B virus), flavivirus (eg) , Hepatitis C virus or dengue virus), or diseases caused by infection with retroviruses (eg, lentiviruses such as HIV); Genus, Listeria, Aerobacter, Helicobacter, Klebsiella, Proteus, Pseudomonas, Streptococcus, Chlamydia, Mycoplasma, Pneumococcus, Virus Diseases caused by infection with bacteria of the genus Vibrio, Serratia, Providencia, Chromobacterium, Brucella, Yersinia, Haemofilus, or Bordetella; (c) Other infectious diseases such as chlamydia, spergillus Viruses, histoplasmosis, fungal diseases including but not limited to cryptococcus meningitis, malaria, Pneumopathy carnii pneumonia, Leishmania disease, cryptosporidosis, parasitic diseases including but not limited to toxoplasmosis, and Kreuzfeld Jacob's disease (CJD), atypical Kreuzfeld-Jakob's disease (vCJD), Gerstmann-Stroisler -Includes trypanosoma infections and prion-related infections that cause human illnesses such as Shineker's syndrome, fatal familial insomnia, and kuru.

5. Microbiome Changes in the composition of the microbiome can affect the effects of anticancer therapy. A diverse community of mutualistic, commensal and pathogenic microorganisms is present at all environmentally exposed sites in the body and is referred to herein as the "microbiome." Environmentally exposed sites of the body in which the microbiota can live include the skin, nasopharynx, oral cavity, respiratory tract, gastrointestinal tract, and reproductive system.

In some embodiments, microbiota, either natural or modified with immunotherapeutic agents, may be used to enhance the efficacy of anti-cancer immunotherapy. Methods of using the microbiome to improve responsiveness to immunotherapeutic agents have been described by Sivan et al. (Sivan A., et al. 2015. Science; 350: 1084-9; see in its entirety. Incorporated herein by. In other embodiments, the microorganism may be delivered with the immunotherapeutic composition of the invention to enhance the efficacy of the immunotherapy.

6. Tools and Drugs for Making Therapeutic Agents The present invention provides tools and agents that can be used in producing immunotherapeutic agents to reduce the tumor volume or tumor mass of a required subject. A significant number of variables are involved in the manufacture of therapeutic agents, such as payload structure, cell type, method of gene transfer, method and time of ex vivo growth, preconditioning, and amount and type of tumor of interest. .. Such parameters may be optimized using the tools and agents described herein.

Cell Lines The present disclosure provides mammalian cells genetically modified with the compositions of the present invention. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human fetal kidney cell line 293, fibroblast cell line NIH 3T3, human colon-rectal cancer cell line HCT116, ovarian cancer cell line SKOV-3, immortalized T cell line Jurkat cell and SuppT1 cell. , Lymphoma cell line Raji cells, NALM-6 cells, K562 cells, HeLa cells, PC12 cells, HL-60 cells, NK cell lines (eg, NKL, NK92, NK962, and YTS), REH, SEM, KOPN8, Daudi, Raji and the like are included, but are not limited thereto. In some examples, the cell is not an immortalized cell line, but a cell obtained from an individual and is referred to herein as a primary cell. For example, a cell is a T lymphocyte obtained from an individual. Other examples include, but are not limited to, cytotoxic cells, stem cells, peripheral blood mononuclear cells or progenitor cells obtained from an individual.

Tracking SREs, Biological Circuits, Cell Lines In some embodiments, it may be desirable to track the compositions of the invention or cells modified by the compositions of the invention. Tracking may be achieved by using a payload such as a reporter portion, which, as used herein, is any protein that can generate a detectable signal in response to input. Point to. Examples include alkaline phosphatase, β-galactosidase, chloramphenicol acetyltransferase, β-glucuronidase, peroxidase, β-lactamase, catalytic antibodies, bioluminescent proteins such as luciferase, and fluorescent proteins such as green fluorescent protein (GFP). Be done.

The reporter portion may be used to monitor the DD response upon addition of the DD corresponding ligand. In other examples, the reporter portion may be used to track cell survival, persistence, cell proliferation, and / or localization in vitro, in vivo, or ex vivo.

In some embodiments, the preferred reporter moiety may be a luciferase protein. In one embodiment, the reporter moiety is sea shiitake mushroom luciferase or firefly luciferase. Table 14 shows the sequence of the reporter part. The amino acid sequence in Table 14 may contain a stop codon, which is shown in the table with an ^{"*" at the end of the amino acid sequence.}

Animal Models The usefulness and efficacy of the compositions of the present invention may be tested in in vivo animal models, preferably mouse models. The mouse model used may be a syngeneic mouse model in which mouse cells are modified with the composition of the invention and tested in mice of the same genetic background. Examples include pMEL-1 and 4T1 mouse models. Alternatively, a xenograft model that introduces human cells, such as tumor cells and immune cells, into immunodeficient mice may also be utilized in such studies. The immunodeficient mouse used was CByJ. ^{Cg-Foxn1 nu / J, B6} ; 129S7-Rag1 tm1Mom /J,B6.129S7-Rag1 tm1Mom / J, B6. CB17-Prkdc ^scid / SzJ, NOD. 129S7 (B6) -Rag1 ^tm1Mom / J, NOD. Cg-Rag1 ^tm1Mom Prf1 ^tm1Sd z / Sz, NOD. CB17-Prkdc ^scid / SzJ, NOD. Cg-Prkdc ^scid B2m ^tm1Unc / J, NOD-scid IL2Rg ^null , nude (nu) mouse, SCID mouse, NOD mouse, RAG1 / RAG2 mouse, NOD-Scid mouse, IL2rgnull mouse, b2mnull mouse, NOD-scid -Scid-B2 mulll mice and HLA transgenic mice may be used.

Cell Assays In some embodiments, the effectiveness of the compositions of the invention as immunotherapeutic agents may be evaluated using cell assays. The expression level and / or identity of the compositions of the invention may be determined according to any method known in the art for identifying proteins and / or quantifying protein levels. In some embodiments, such methods may include Western blotting, flow cytometry, and immunoassays.

Provided herein are methods of functionally characterizing cells expressing the SREs, biological circuits and compositions of the present invention. In some embodiments, functional characterization may be performed on primary immune cells or immortalized immune cell lines and determined by expression of cell surface markers. Examples of cell surface markers for T cells include CD3, CD4, CD8, CD14, CD20, CD11b, CD16, CD45 and HLA-DR, CD69, CD28, CD44, IFNγ, PD1, TIM3, LAG3. Not limited. Examples of cell surface markers for antigen-presenting cells are MHC class I, MHC class II, CD40, CD45, B7-1, B7-2, IFN-γ receptor and IL2 receptor, ICAM-1 and / or Fcγ receptor. However, it is not limited to these. Examples of cell surface markers for dendritic cells are MHC class I, MHC class II, B7-2, CD18, CD29, CD31, CD43, CD44, CD45, CD54, CD58, CD83, CD86, CMRF-44, CMRF-56. , DCIR and / or Dectin-1, etc .; on the other hand, in some cases, at the same time, CD2, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD20, CD56, And / or CD57 is absent. Examples of cell surface markers for NK cells are CCL3, CCL4, CCL5, CCR4, CXCR4, CXCR3, NKG2D, CD71, CD69, CCR5, phosphoJAK / STAT, phosphoERK, phosphop38 / MAPK, phosphoAKT, phosphoSTAT3, granuricin. , Granzyme B, Granzyme K, IL10, IL22, IFNg, LAP, perforin, and TNFa.

V. Delivery Methods and / or Vector Vectors The present invention also provides vectors that package the polynucleotides of the invention encoding biological circuits, effector modules, SRE (DD) and payload constructs, and combinations thereof. The vectors of the invention may also be used to deliver packaged polynucleotides to cells, local tissue sites or subjects. These vectors may be of any type, including DNA vectors, RNA vectors, plasmids, viral vectors and particles. Viral vector technology is well known and is described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). Viruses useful as vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated virus (AAV) vectors, simple herpesvirus vectors, retroviral vectors, tumor-soluble viruses, and the like.

In general, the vector comprises a functional origin of replication, a promoter sequence and a convenient restriction endonuclease site in at least one organism, as well as one or more selectable markers such as drug resistance genes.

As used herein, a promoter is defined as a DNA sequence recognized by the transcriptional mechanism of a cell that is required to initiate specific transcription of the polynucleotide sequence of the invention. The vector can include a natural or non-natural promoter operably linked to the polynucleotide of the invention. The promoters selected may be strong, weak, constitutive, inducible, tissue-specific, developmental-stage-specific, and / or biological-specific. An example of a suitable promoter is the pre-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a potent constitutive promoter sequence capable of driving high levels of expression of the polynucleotide sequence operably linked to it. Another example of a preferred promoter is elongation growth factor-1. It is an α (EF-1.α) promoter. Simian virus 40 (SV40) promoter, mouse breast cancer virus (MMTV) promoter, human immunodeficiency virus (HIV) promoter, terminal repeat sequence (LTR), promoter, trileukemia virus promoter, Epstein-Barr virus pre-early promoter, Laus sarcoma virus Other constitutive promoters, including but not limited to promoters, as well as the phosphoglycerate kinase (PGK) promoter, actin promoter, myosin promoter, hemoglobin promoter, ubiquitin C (Ubc) promoter, human U6 micronucleus protein promoter and creatin kinase promoter. Human gene promoters, including, but not limited to, may also be used. In some examples, inducible promoters such as, but not limited to, the metallothionin promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter may be used. In some embodiments, the promoter may be selected from SEQ ID NOs: 220-222, SEQ ID NO: 836.

In some embodiments, the optimal promoter is selected based on the ability to achieve minimal expression of the SRE and payload of the invention in the absence of a ligand, and detectable expression in the presence of a ligand. May be good.

Additional promoter elements, such as enhancers, may be used to regulate the frequency of transcription initiation. Such regions may be located 10 to 100 base pairs upstream or downstream of the starting site. In some examples, two or more promoter elements may be used to activate transcription cooperatively or independently.

Suitable vectors include vectors designed for growth and / or expression, such as plasmids and viruses. Vectors include pUC series (Fermentas Life Sciences, Glen Burnie, MD), pBluescript series (Stratagene, La Jolla, CA), pET series (Novagen, Madison, WI), pGEX series (Phax) You can choose from a group consisting of series (Clontech, Palo Alto, CA). Bacteriophage vectors such as λGT10, λGT11, λZapII (Stratagene), λEMBL4, and λΝΜ1149 can also be used. Examples of plant expression vectors include pBI01, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM, and pMAMneo (Clontech). The recombinant expression vector may be a viral vector, such as a retroviral vector or a lentiviral vector. In some embodiments, the vector can be a transposon. Any of the vectors disclosed in International Patent Publication WO2014056961 may be useful in the present invention (the contents of which are incorporated herein by reference in their entirety).

In some embodiments, the recombinant expression vector may contain regulatory sequences such as transcription and translation initiation and termination codons that are specific to the type of host cell into which the vector is introduced.

1. 1. Lentiviral Vector In some embodiments, the lentiviral vector / particle may be used as the vehicle and mode of delivery. Lentivirus is a subgroup of viruses of the retrovirus family, named for the need for reverse transcription from the viral RNA genome to DNA prior to integration into the host genome. Therefore, the most important feature of lentivirus vehicles / particles is the incorporation of genetic material into the genome of the target / host cell. Some examples of lentiviruses are human immunodeficiency viruses: HIV-1 and HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Gembrana disease virus ( JDV), horse-borne anemia virus (EIAV), horse-borne anemia virus, Bisna-maedi virus and goat arthritis encephalitis virus (CAEV).

In general, the lentiviral particles themselves that make up the gene delivery vehicle are deficient in replication (also called "self-inactivation"). Lentiviruses can infect both dividing and non-dividing cells by means of entry through the intact host nuclear envelope (Naldini L et al., Curr. Opin. Biotechnol, 1998, 9: 457-463). ). Recombinant lentiviral vehicles / particles are generated by multiple attenuation of HIV pathogenic genes, eg, the genes for Env, Vif, Vpr, Vpu, Nef, and Tat are deleted to biologicalize the vector. It is safe to use. Similarly, for example, a lentiviral vehicle derived from HIV-1 / HIV-2 can mediate efficient delivery, integration, and long-term expression of a transgene into non-dividing cells. As used herein, the term "recombination" refers to a vector or other nucleic acid that contains both a lentiviral sequence and a non-lentiviral retroviral sequence.

Lentiviral particles may be produced by co-expressing the viral packaging element with the vector genome itself in producer cells such as human HEK293T cells. These elements are usually provided in 3 (2nd generation lentiviral system) or 4 separate plasmids (3rd generation lentiviral system). It encodes a plasmid (called a packaging system) that encodes a lentiviral component containing the viral core (ie, structural protein) and enzyme components, as well as enveloped proteins (s), and a genome containing the foreign transgene to be introduced into the target cell. The plasmid to be used, that is, the vehicle itself (also called the transgene), is co-transfected into the producer cells. Generally, the plasmid or vector is included in the producer cell line. The plasmid / vector is introduced into the producer cell line via transduction, transduction, or infection. Methods of transduction, transduction or infection are well known to those of skill in the art. As a non-limiting example, after introducing the packaging and introduction construct into the producer cell line by calcium phosphate transfection, lipofection or electroporation, a dominant selectable marker such as neo, DHFR, Gln synthetase or ADA is usually used. Can be used to select and isolate clones in the presence of the appropriate drug.

Producer cells produce recombinant viral particles containing foreign genes, such as the effector modules of the invention. Recombinant virus particles are recovered from the medium and titers are measured by standard methods used by those skilled in the art. Recombinant lentivirus vehicles can be used to infect target cells.

Cells used to produce high titer lentivirus particles include HEK293T cells, 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11: 452-459), FreeStyle ™ 293 Expression. System (Thermo Fisher, Waltham, MA) and other HEK293T-based producer cell lines (eg, Stewart et al., Hum Gene Ther. 2011, 22 (3): 357-369; Lee et al., Biotechnol , 10996): 1551-1560; Thermo et al. , Blood. 2009, 113 (21): 5104-5110; the respective contents are incorporated herein by reference in their entirety), but are not limited thereto.

In some embodiments, the enveloped protein may be a heterologous enveloped protein from another virus, such as the vesicular stomatitis virus G protein (VSVG) or the baculovirus gp64 enveloped protein. VSV-G glycoproteins are species that are particularly classified in the genus Becyclovirus: Karajasvirus (CJSV), Chandiplavirus (CHPV), C. bacillus virus (COCV), Isfahan virus (ISFV), Malabavirus (MARAV), Piri Virus (PIRYV), vesicular stomatitis aragoas virus (VSAV), vesicular stomatitis Indiana virus (VSIV) and vesicular stomatitis new jersey virus (VSNJV), and / or sougyo rhabdovirus, BeAn157575 virus (BeAn157575), botechvirus ( BTKV), Calchakivirus (CQIV), Elvirus American (EVA), Gray Lodge Virus (GLOV), Uronavirus (JURY), Kramasvirus (KLAV), Quattavirus (KWAV), Rhabdovirus (LJV), Malpes Spring virus (MSPV), Ergon mountain bat virus (MEBV), Perinetovirus (PERV), Pike fly rhabdovirus (PFRV), Porton virus (PORV), Radi virus (RADIV), Koi spring viralemia virus (SVCV) , Tupaivirus (TUPV), ulcerative disease rhabdovirus (UDRV) and yagbogdanovacvirus (YBV) may be selected from the strains tentatively classified into the genus Becyclovirus. gp64 or other baculovirus env proteins include Autographa californica nuclear polyhedrosis virus (AcMNPV), Anagrapha nuclear polyhedrosis virus, Bombyx mori nuclear polyhedrosis virus, Choristoneura nuclear polyhedrosis virus Nuclear Polyhedrosis Virus, Epiphyas postvittana Nuclear Polyhedrosis Virus, Hyphantria kunea Nuclear Polyhedrosis Virus, Galleria melronella Nuclear Polyhedrosis Virus, Dorivirus, Togotovirus, Antheraea pemyi Nuclear Polyhedrosis Virus or Baculoviridae Can be.

Additional elements provided in the lentivirus particle include a retrovirus LTR (terminal repeat sequence) at either the 5'or 3'end, a retrovirus transport element, and optionally a lentivirus reverse response element (RRE), its promoter or The active moiety and the locus control region (LCR) or the active moiety thereof may be included. Other elements include the central polyprint lacto sequence (cPPT) sequence, which improves transduction efficiency in non-dividing cells, and the Woodchuck hepatitis virus (WHP) posttranscriptional regulator (WPRE), which enhances the expression and titer of transduced genes. Can be mentioned. The effector module is linked to the vector.

Methods of producing recombinant lentivirus particles in the art are described, for example, in US Pat. Nos. 8,846,385; 7,745,179; 7,629,153; 7,575,924. It is discussed in Nos. 7,179,903; and 6,808,905; the contents of each of them are incorporated herein by reference in their entirety.

The lentiviral vectors used are pLVX, pLenti, pLenti6, pLJM1, FUGW, pWPXL, pWPI, pLenti CMV puro DES, pLJM1-EGFP, pULTRA, pInducer20, pHIV-EGFP, pCW57.1, pCW57. Can be selected from, but is not limited to.

Lentivirus vehicles known in the art may also be used (US Pat. Nos. 9,260,725; 9,068,199; 9,023,646; 8,900,858). No. 8,748,169; No. 8,709,799; No. 8,420,104; No. 8,329,462; No. 8,076,106; No. 6,013,516; And Nos. 5,994,136; see International Patent Publication No. WO2011209000; the contents of each of which are incorporated herein by reference in their entirety).

2. Retrovirus vector (γ-retroviral vector)
In some embodiments, retroviral vectors may be used to package and deliver biocircuits, biocircuit components, effector modules, SREs or payload constructs of the invention. The retroviral vector (RV) allows the transgene to be permanently integrated into the target cell. In addition to complex HIV-1 / 2-based lentiviral vectors, simple γ-retrovirus-based retroviral vectors are widely used to deliver therapeutic genes and transduce into a wide range of cell types. It has been clinically demonstrated as one of the most efficient and powerful gene delivery systems that can. Illustrative species of gammaretrovirus include murine leukemia virus (MLV) and feline leukemia virus (FeLV).

In some embodiments, the γ-retroviral vector from a mammalian γ-retrovirus, such as murine leukemia virus (MLV), is a recombinant. The MLV family of gammaretroviruses includes allogeneic, bilateral, xenotropic and multidirectional subfamilies. The allogeneic virus can only infect mouse cells that use the mCAT-1 receptor. Examples of allogeneic viruses are Moloney MLV and AKV. Bidirectional viruses infect mice, humans and other species via the Pit-2 receptor. An example of a bidirectional virus is the 4070A virus. Xenotropic and multidirectional viruses utilize the same (Xpr1) receptor, but differ in the orientation of their species. Xenotropic viruses such as NZB-9-1 infect humans and other species, but not mouse species, while multidirectional viruses such as focus-forming virus (MCF) infect mice and humans. And infects other species.

A plasmid encoding a retrovirus structural and enzymatic (gag-pol) polyprotein, a plasmid encoding an envelope (env) protein, and a plasmid encoding a vector mRNA containing a polynucleotide encoding the composition of the invention. Co-transfection of several plasmids, including, into cells may produce γ-retroviral vectors within the packaging cells, which are packaged into newly formed viral particles.

In some embodiments, the recombinant γ retroviral vector is a pseudotype with enveloped proteins from other viruses. Envelope glycoproteins can be incorporated into the outer lipid layer of viral particles to enhance / alter cell orientation. As exemplary envelope proteins, gibbon ape leukemia virus envelope protein (GALV) or bullous stomatitis virus G protein (VSV-G), or monkey endogenous retrovirus envelope protein, or measles virus H and F proteins, or human immunodeficiency virus. gp120 enveloped protein, or bulbous becyclovirus enveloped protein (see, eg, US Application Publication No. 2012/1641118; the content of which is incorporated herein by reference in its entirety). In other embodiments, the enveloped glycoprotein may be genetically modified to integrate the targeting / binding ligand into the γ retroviral vector, which includes peptide ligands, single chain antibodies and growth factors. (Waehler et al., Nat. Rev. Genet. 2007, 8 (8): 573-587: 573-587; the contents of which are incorporated herein by reference in their entirety). These modified glycoproteins can retarget the vector to cells expressing the corresponding target moiety. In other embodiments, "molecular cross-linking" may be introduced to direct the vector to specific cells. Molecular cross-linking has dual specificity: one end can recognize viral glycoproteins and the other end can bind to the molecular determinants of the target cell. Such molecular cross-linking, such as ligand receptor, avidin-biotin, and chemical conjugation, monoclonal antibodies and modified membrane fusion proteins, can attach the viral vector to target cells for transduction (Yang et. al., Biotechnol. Bioeng., 2008, 101 (2): 357-368; and Maetzig et al., Viruses, 2011, 3, 677-713; the contents of each of these are herein by reference in their entirety. To be used in).

In some embodiments, the recombinant γ retroviral vector is a self-inactivating (SIN) γ retroviral vector. The vector is non-replicatable. The SIN vector may contain a deletion within the 3'U3 region that initially has enhancer / promoter activity. In addition, the 5'U3 region may be replaced with a strong promoter from cytomegalovirus or RSV (required for packaging cell lines), or a selected internal promoter and / or enhancer element. The internal promoter may be selected according to the specific requirements for gene expression required for the particular purpose of the invention.

In some embodiments, biocircuits, components of biocircuits, effector modules, and polynucleotides encoding SRE are inserted into the recombinant viral genome. Insertion or removal of a native sequence (eg, insertion of an IRES, insertion of a heterologous polynucleotide encoding a polypeptide of interest or inhibitory nucleic acid, alternative to a wild promoter) for other components of the viral mRNA of a recombinant γ retroviral vector. May be modified by different retroviruses or more effective promoter shuffling derived from the virus). In some examples, the recombinant γ retroviral vector has a modified packaging signal and / or primer binding site (PBS) and / or 5 in the U3 region of the 5'-terminal repeat sequence (LTR). It may contain a'-enhancer / promoter element and / or a modified 3'-SIN element in the U3 region of the 3'-LTR. These modifications can increase titer and infectivity.

Suitable gamma retroviral vectors for delivering biocircuit components, effector modules, SREs or payload constructs of the invention are US Pat. Nos. 8,828,718; 7,585,676; 7, 351,585; U.S. Application Publication No. 2007/048285; PCT Application Publication No. WO2010 / 113037; WO2014 / 121005; WO2015 / 056014; and EP Patent EP1757702; EP1757703. You may choose from vectors (each content is hereby incorporated by reference in its entirety).

3. 3. Adeno-associated virus vector (AAV)
In some embodiments, the polynucleotides of the invention may be packaged in recombinant adeno-associated virus (rAAV) vectors. Such vectors or viral particles may be designed to utilize any of the known serotype capsids or combinations of serotype capsids. Serotype capsids include any identified AAV serotypes and variants thereof, such as AAV1, AAV2, AAV2G9, AAV3, AAV4, AAV4-4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and Capsids derived from AAVrh10 may be included.

In one embodiment, the AAV serum type is a sequence set forth in US Publication US200301838772, which is incorporated herein by reference in its entirety, eg, but not limited to, AAV1 (SEQ ID NOs: 6 and 64 of US20030138772). , AAV2 (SEQ ID NOs: 7 and 70 of US20030138772), AAV3 (SEQ ID NOs: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NOs: 1 to 3 of US20030138772), AAV8 (SEQ ID NOs: 4 and 95 of US20030138772), AAV9 (SEQ ID NOs: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772) , AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (Amino acids 1-738 of SEQ ID NO: 81 of US20030138772) or variants thereof, or may have a sequence thereof. Non-limiting examples of variants include SEQ ID NOs: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, 101-113 of US20030138772. Is incorporated herein by reference in its entirety.

In one embodiment, the AAV serotype is described by Pulichella et al. (Molecular Therapy, 2011, 19 (6): 1070-1078), US Pat. Nos. 6,156,303; 7,198,951; US Patent Publications US2015 / 0159173 and US2014 / 0359799; and It may have the sequences described in International Patent Publication Nos. WO 1998/011244, WO 2005/033321 and WO 2014/14422; the contents of each of which are incorporated herein by reference in their entirety.

AAV vectors include not only single-stranded vectors but also self-complementary AAV vectors (scAAV). The scAAV vector contains DNA that is annealed together to form a double-stranded vector genome. By skipping the second chain synthesis, scAAV can be rapidly expressed intracellularly.

The rAAV vector may be prepared in sf9 insect cells or in suspension cell cultures of human cells such as HEK293 cells by standard methods in the art such as triple transfection.

Biological circuits, components of biological circuits, effector modules, SREs, or payload constructs may be encoded in one or more viral genomes packaged in the AAV capsids shown herein.

Such a vector or viral genome may include at least one or two ITRs (terminally inverted sequences) as well as specific regulatory elements required for expression from the vector or viral genome. Such regulatory elements are well known in the art and include, for example, promoters, introns, spacers, stuffer sequences and the like.

In some embodiments, more than one effector module or SRE (eg, DD) may be encoded into the viral genome.

4. Oncolytic Viral Vectors In some embodiments, the polynucleotides of the invention may be packaged in an oncolytic virus such as a vaccine virus. Viral particles of a thymidine kinase (TK) -deficient granulocyte macrophage (GM) colony-stimulating factor (CSF) -expressing replicable vaccinia virus vector sufficient to induce oncolytic tumor lysis of tumor cells as an oncolytic vaccine virus (For example, US Pat. No. 9,226,977; the content of which is incorporated by reference in its entirety).

5. Messenger RNA (mRNA)
In some embodiments, the effector modules of the invention may be designed as messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) encodes a polypeptide of interest and is translated and encoded in vitro, in vivo, in situ or ex vivo. Refers to any polynucleotide that can be produced. Such mRNA molecules may have any of the structural components or characteristics of those set forth in International Application No. PCT / US2013 / 030062, the contents of which are incorporated herein by reference in their entirety. ..

U.S. Patent Application No. 03165089.2, filed July 9, 2003, and now abandoned, the polynucleotides of the invention, eg, incorporated herein by reference in their entirety. PCT Application No. PCT / GB2004 / 00281, filed on July 9, 2004 and published as WO2005005622, filed on June 8, 2006, published as US20060247195, and is now abandoned. Stage Registration No. 10 / 563,897, and European Patent Application National Stage Registration EP2004743322, filed on July 9, 2004, published as EP1646714, and now withdrawn; Novozimes, Inc. PCT Application No. PCT / US2007 / 88060 filed on December 19, 2007 and published as WO2008140615, US Patent Application Domestic Stage Registration No. 12 filed on July 2, 2009 and published as US20100028943. / 520,072 and European Patent Application National Stage EP2007874376 filed on July 7, 2009 and published as EP2104739; PCT of the University of Rochester, filed on December 4, 2006 and published as WO200706492. Application Nos. PCT / US2006 / 46120 and US Patent Application No. 11 / 606,995, filed on December 1, 2006 and published as US20070141030, filed on December 14, 2007 by BioNTech AG, and are currently Is abandoned European Patent Application No. EP2007024312, filed on December 12, 2008, and published as WO200907134, PCT Application No. PCT / EP2008 / 01509, filed on June 2, 2010, published as EP2245072. European Patent Application Domestic Stage Registration EP2008861423, filed on November 24, 2010, published as US20110065103 US Patent Application Domestic Stage Registration 12 /, 735,060, filed September 28, 2005 German Patent Application No. DE102005046490, PCT application PCT / EP2006 / 0448, filed September 28, 2006 and published as WO200703366, European Patent Domestic Stage EP193434 and 2009 published March 21, 2012. US Patent Application National Stage 11 / 992,638, filed August 14, published as 2010129877; Immune Device Institute Inc. US Patent Application No. 13 / 088,009 filed on April 15, 2011 and published as US20120046346, PCT application PCT / US2011 / 32679 filed on April 15, 2011 and published as WO20111030624. Shire Human Genetic Therapeutics, US Patent Application No. 12 / 957,340, filed November 20, 2010 and published as US201110244026; Secur Inc. PCT application PCT / US1998 / 019492, filed on September 18, 1998 and published as WO1999014346; PCT application No. PCT / US, filed on February 24, 2010 and published as WO201098861 US 2010/00567, and US Patent Application National Stage Registration Nos. 13 / 203,229 filed on November 3, 2011 and published as US20120053333; filed on July 30, 2010 at Ludwig-Maximimilians University. , WO 20110112316, PCT application No. PCT / EP2010 / 004681; Cellscript Inc. US Patent No. 8,039,214 filed on June 30, 2008 and patented on October 18, 2011, US patent application filed on December 7, 2010 and published as US201101143436. No. 12 / 962,498, filed on December 7, 2010 and published as US201101143397, No. 12 / 962,468, filed on September 20, 2011 and published as US201209649, 13/237. , 451 and PCT applications filed on December 7, 2010 and published as WO2011071931 PCT / US2010 / 59305 and PCT / US2010 / 59317 filed on December 7, 2010 and published as WO201107193; Pennsylvania. PCT application No. PCT / US2006 / 32372 filed on August 21, 2006 and published as WO2007024708, and US patent application filed on March 27, 2009 and published as US20090286852 Stage Registration No. 11 / 990,646; Curevac GMBH, both abandoned, German Patent Application No. DE10200127283.9 filed on June 5, 2001, filed on December 19, 2001. DE102001062480.8, and DE202006051516, filed October 31, 2006, European Patent EP1392341 patented March 30, 2005, and EP1458410 patented January 2, 2008, PCT application No. PCT / EP2002 / 06180 filed on June 5, 2002 and published as WO2002098443, PCT / EP2002 / 14577, filed on December 19, 2002 and published as WO2003051401, 2007. PCT / EP2007 / 09469, filed December 31, 2008 and published as WO2008052770, PCT / EP2008 / 03033, filed April 16, 2008 and published as WO20012127230, May 19, 2005. PCT / EP 2006/004784, filed and published as WO2006122828, PCT / EP2008 / 00081, filed January 9, 2007 and published as WO2008083949, December 5, 2003. US Patent Application No. 10 / 729,830, filed on the same day and published as US20050032730, 10 / 870,110, filed June 18, 2004 and published as US20050059624, July 7, 2008. No. 11 / 914,945 filed and published as US20080267873, filed October 27, 2009, published as US20100047261 and now abandoned No. 12 / 446,912, January 2010 No. 12 / 522,214 filed on the 4th and published as US2011018729, No. 12 / 787,566 filed on May 26, 2010 and published as US20110077287, filed on May 26, 2010. 12 / 787,755, published as US2010029608, filed on July 18, 2011, 13 / 185,119, published as US201101269950, and filed on May 12, 2011, US20110311472. It may be designed as shown in No. 13 / 106,548 published as.

In some embodiments, the effector module may be designed as self-amplifying RNA. As used herein, "self-amplifying RNA" refers to RNA molecules that can replicate in a host and increase the amount of RNA and the protein encoded by the RNA. Such self-amplified RNA may have any of the structural features or components of those set forth in International Patent Application Publication No. WO2011005799, the contents of which are incorporated herein by reference in its entirety. ..

VI. Dosing, Delivery and Administration The compositions of the invention may be delivered to cells or subjects via one or more routes and modes. Viral vectors containing one or more effector modules, SREs, immunotherapeutic agents, and other components described herein may be used to deliver them to cells and / or subjects. Other modes such as mRNA, plasmid, and recombinant protein may also be used.

1. 1. Delivery to Cells In another aspect of the invention, a vector comprising a polynucleotide encoding a biological circuit, effector module, SRE (eg, DD), target payload (immunotherapeutic agent) and composition of the invention and said polynucleotide. May be introduced into cells such as immune effector cells.

In one aspect of the invention, a polynucleotide encoding a biological circuit, effector module, SRE (eg, DD), target payload (immunotherapeutic agent) and composition of the invention is packaged in a viral vector or a virus. It may be integrated into the genome to allow transient or stable expression of the polynucleotide. A preferred viral vector is a retroviral vector containing a lentiviral vector. To construct a retroviral vector, a polynucleotide molecule encoding a biological circuit, effector module, DD or target payload (ie, an immunotherapeutic agent) is inserted at the location of a specific viral sequence in the viral genome and lacks replication ability. Produce the virus. The recombinant viral vector is then introduced into a packaging cell line that contains the gag, pol, and env genes but does not contain the LTR and packaging components. Recombinant retroviral particles are secreted into the medium, collected, concentrated as needed, and used for gene transfer. Lentiviral vectors are particularly preferred as they can infect both dividing and non-dividing cells.

The vector is also non-virused by physical methods such as needles, electroporation, sonoporation, hydroporation; chemical carriers such as inorganic particles (eg, calcium phosphate, silica, gold) and / or chemical methods. It may be transferred to cells by the method. In some embodiments, synthetic or natural biodegradable agents such as cationic lipids, lipid nanoemulsions, nanoparticles, peptide-based vectors, or polymer-based vectors may be used for delivery.

In some embodiments, the polypeptides of the invention may be delivered directly to cells. In one embodiment, the polypeptide of the invention may be delivered using a synthetic peptide comprising an endosomal leaking domain (ELD) fused to a cell permeable domain (CLD). The polypeptide of the invention is co-introduced into cells with an ELD-CLD-synthetic peptide. ELD facilitates the escape of proteins trapped in endosomes to the cytosol. Such domains are proteins of microbial and viral origin and have been described in the art. CPD allows the transport of proteins across the plasma membrane, which is also described in the art. The ELD-CLD fusion protein synergistically enhances transduction efficiency when compared to co-transduction with only one of the domains. In some embodiments, a histidine-rich domain may be added to the shuttle construct as needed as an additional method to allow the escape of cargo from endosomes to the cytosol. The shuttle may also contain a cysteine residue at the N- or C-terminus to generate a multimer of the fusion peptide. The ELD-CLD fusion peptide multimer produced by adding a cysteine residue to the end of the peptide exhibits even higher transduction efficiency when compared to a single fusion peptide construct. The polypeptides of the invention may also be added to the appropriate localization signal to direct the cargo to the appropriate intracellular location, such as the nucleus. In some embodiments, any of the ELD, CLD or fused ELD-CLD synthetic peptides shown in WO2016161516 and WO2017175072 may be useful in the present invention (each content is in its entirety). Incorporated herein by reference).

2. Dosing The present invention provides a method comprising administering any one or more compositions for immunotherapy to a subject in need thereof. These may be administered to a subject using any amount and any route of administration that is effective in preventing or treating clinical conditions such as cancer, infections and other immunodeficiency diseases.

The compositions according to the invention are usually formulated in unit dosage forms for ease of administration and dosage uniformity. However, it will be appreciated that the total daily use of the compositions of the present invention may be determined by the attending physician within sound medical judgment. The particular therapeutically or prophylactically effective dose level for any particular patient depends on a variety of factors, including the disorder being treated and the severity of the disorder. The activity of the specific compound used; the specific composition used; the patient's age, weight, overall health, gender and diet; time of administration, route of administration, previous or contemporaneous therapeutic intervention, and of the specific compound used. It will depend on a variety of factors, including rate of excretion; duration of treatment; drugs used in combination with or in combination with the particular compound used; as well as similar factors well known in the medical field.

The compositions of the present invention may be used in various doses to avoid T cell energy, prevent cytokine release syndrome, and minimize immunotherapy-related toxicity. For example, the compositions of the invention may be used at low doses to initially treat patients with high tumor volumes, while patients with low tumor volumes may be treated with high dose and repeat doses of the compositions of the invention. Use to treat and ensure that recognition of tumor antigen loading is minimized. In another example, the compositions of the invention may be delivered in a pulsed fashion to reduce persistent T cell signaling and enhance in vivo persistence. In some embodiments, toxicity may be minimized by initial use of low doses of the compositions of the invention prior to administration of high doses. If serum markers such as ferritin, serum C-reactive protein, IL6, IFN-γ, and TNF-α are elevated, the dosage may be changed.

3. 3. Administration In some embodiments, the composition for immunotherapy may be administered ex vivo to cells followed by administration to the subject. Immune cells may be isolated and proliferated ex vivo using various methods known in the art. For example, methods of isolating cytotoxic T cells are described in US Pat. Nos. 6,805,861 and 6,531,451; the contents of each are described herein by reference in their entirety. Invite to. Isolation of NK cells is described in US Pat. No. 7,435,596; the content of which is incorporated herein by reference in its entirety.

In some embodiments, the compositions of the invention are co-pending US Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or filed March 3, 2017. It may be administered by any of the administration methods set forth in US Provisional Patent Application No. 62 / 466,596 and WO 2017/180587, the contents of which are incorporated herein by reference in their entirety.

In some embodiments, the cells may be introduced into a host organism, such as a mammal, in a variety of ways, including injection, blood transfusion, infusion, topical instillation or transplantation, depending on the nature of the cells. In some embodiments, the cells of the invention may be introduced into the tumor site. The number of cells used will depend on many circumstances, purpose of introduction, cell lifespan, protocol used, such as frequency of administration, ability of cells to proliferate, and the like. The cells may be present in a physiologically acceptable medium.

In some embodiments, the cells of the invention may be administered in multiple doses to a subject having a disease or condition. Administration generally results in amelioration of one or more symptoms of the cancer or clinical condition and / or treatment or prevention of the cancer or clinical condition or its symptoms.

In some embodiments, the composition for immunotherapy may be administered in vivo. In some embodiments, the polypeptide of the invention comprising the biological circuit, effector molecule, SRE, target payload (immunotherapeutic agent) and composition of the invention may be delivered in vivo to the subject. In vivo delivery of immunotherapeutic agents is well described in the art. For example, methods of delivering cytokines are described in European Patent EP0930892A1, the contents of which are incorporated herein by reference.

In one embodiment, the payload of the invention may be administered with an inhibitor of SHP-1 and / or SHP-2. The tyrosine protein phosphatases SHP1 (also known as PTPN6) and SHP2 (also known as PTPN11) are involved in the programmed cell death (PD1) inhibitory signaling pathway. The intracellular domain of PD1 contains an immunoreceptor-suppressing tyrosine motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM). ITSM has been shown to recruit SHP-1 and SHP-2. This produces negative co-stimulating microclusters that induce dephosphorylation of proximal TCR signaling molecules, which can lead to suppression of T cell activation and can lead to T cell depletion. In one embodiment, inhibitors of SHP-1 and SHP-2 may comprise expressing a dominant negative version of the protein in T cells, TIL or other cell types to reduce depletion. Such variants can bind to endogenous catalytically active proteins and inhibit their function. In one embodiment, the dominant negative variants of SHP-1 and / or SHP-2 lack the phosphatase domain required for catalytic activity. In some embodiments, Bergeron S et al. (2011). Endocrinology. 2011 Dec; 152 (12): 4581-8. Dustin JB et al. (1999) J Immunol. Mar 1; 162 (5): 2717-24. Berchold S (1998) Mol Endocrinol. Apr; 12 (4): 556-67 and Schram et al. (2012) Am J Physiol HeartCirc Physiol. 1; 302 (1): Any of the dominant negative SHP-1 variants shown in H231-43 may be useful in the present invention (each content is hereby incorporated by reference in its entirety).

Delivery Routes The pharmaceutical compositions, biological circuits, biological circuit components, effector modules containing SRE (eg, DD), payloads (ie, immunotherapeutic agents), vectors and cells of the invention are administered by any route. , A therapeutically effective result may be achieved.

These include transluminal (intra-dural), gastrointestinal, epidural (intradural), oral (via the mouth), transdermal, epidural, intracerebral (intracranial), lateral ventricle (ventricular), Intradermal (application to the skin), intradermal (to the skin itself), subcutaneous (subcutaneous), intraluminal administration (nasal), intravenous (intravenous), intravenous bolus, intravenous drip, intraarterial (arterial) Intramuscular (intramuscular), intracranial (intracardiac), intraosseous (intramedullary), intrathecal (intrathecal), intraperitoneal, (intraperitoneal or intraperitoneal), sinus injection, Intratheural, (transocular), intravenous injection (intrapathological), intraluminal (intradural), intravaginal, intrauterine, extralamellar, transdermal (via intact skin for systemic distribution) Dura mater (dura mater), transvaginal, blowing method (suction), sublingual, sublip, enema, eye drops (upper dura), ear drops, ear canal (intra-ear or trans-ear), cheeks Side (towards the cheek), dura mater, skin, teeth (teeth or teeth), electrical permeation, intracervical, sinus, intratracheal, extracorporeal, hemodialysis, permeation, interstitial, intraperitoneal, intraperitoneal, intrathecal, joint Inside, inside the bile duct, inside the bronchus, inside the sac, inside the cartilage (inside the cartilage), inside the tail (inside the horse tail), inside the large cistern (inside the cerebral medullary large cistern), inside the dura (inside the dura), inside the crown (dental intracornal), Intracoronary (intracoronary artery), in the cancellous (in the dilatable space of the penile nucleus canal of the penis), in the intervertebral disc (in the intervertebral disc), in the canal (in the gland duct), in the duodenum (in the duodenum), in the dura (dura mater) Intradural or subdural), intraepithelial (intradermal), intraesophageal (intraesophageal), intragastric (intragastric), intradermal (intradermal), intraluminal (intradistal part of small intestine), intralesional (localized) Intrasexual or localized lesions), intraluminal (intraluminal lumen), intralymphatic (intralymphatic), intramedullary (intradural bone), intradural (intradural), Intramycardium (intramycardium), intraocular (intraocular), in ovary (intraovarian), intramater (intradura), intramater (intrathoracic), intraprostatic (intraprostatic), intrapulmonary (lung or its) Intrabronchial), in the sinus (in the nose or in the sinus around the orbit), in the spinal cord (in the spinal column), in the dural sac of the joint (in the dural lumen of the joint), in the tendon (intratenal), in the testis (in the testicle) , In the subdural lumen (in the cerebrospinal fluid of the cerebrospinal axis at any level), in the thoracic lumen (in the chest), in the duct (in the tubules of the organ), in the tumor (intratumor), in the tympanic chamber (in the middle ear), blood vessels Intra (intravascular), intraventricular (ventricular), ion transfer (by current that moves soluble salt ions to body tissue), lavage (immersing or flushing the wound or lumen), throat (directly into the abdominal cavity), Nasal stomach (from the nose to the stomach), sealed dural therapy (after administration by local route, cover the area with a sealing band), eye (to the external eye), mesopharynx (directly to the oral cavity and pharynx) ), Parenteral, percutaneous, periarterial, periduural, perineural, periodontal, rectal, respiratory (intrachea by oral or nasal inhalation for local or systemic effects), postocular (cerebral pons) Behind or behind the eyeball, intramyocardial (entering the myocardium), soft tissue, subdural, subdural, submucosal, topical, transplacemental (via or through the placenta), transtrachea (through the placenta or through the placenta) (Through the wall of the trachea), transdura mater (through or through the tympanic chamber), urinary tract (to the urinary tract), urinary tract (to the urinary tract), vagina, sacral anesthesia, diagnosis, neuroanesthesia, bile perfusion , But not limited to, cardiac perfusion, photoferesis or spinal cord.

VII. Definitions The features or functions of the compositions of the present disclosure are disclosed in groups or ranges at various points herein. The present disclosure is specifically intended to include any individual partial combination of members of such groups and ranges. The following is a non-limiting list of term definitions.

Activity: As used herein, the term "activity" refers to the state in which things are happening or taking place. The compositions of the invention may have activity, which activity may include one or more biological events. In some embodiments, the biological event may include a cellular signaling event. In some embodiments, the biological event is a cellular signal associated with a protein interaction with one or more corresponding proteins, receptors, small molecules or any of the components of the biological circuit described herein. Can include transmission events.

Adoptive Cell Therapy (ACT): As used herein, the term "adoptive cell therapy" or "adoptive cell transplantation" refers to cell therapy that involves the transplantation of cells into a patient, in which case the cells are the patient. Alternatively, it may be of another individual and the cells are modified (modified) before being returned to the patient. The therapeutic cells are derived from the immune system such as immune effector cells: CD4 + T cells; CD8 + T cells, natural killer cells (NK cells); and B cells and tumor infiltrating lymphocytes (TIL) derived from excised tumors. Good. The most commonly transplanted cells are ex
Autologous antitumor T cells after growth or manipulation in vivo. For example, by expressing the T cell receptor (TCR) or chimeric antigen receptor (CAR), autologous peripheral blood lymphocytes can be genetically modified to recognize specific tumor antigens.

Drugs: As used herein, the term "drug" refers to a biological, pharmaceutical, or chemical compound. Non-limiting examples include simple or complex organic or inorganic molecules, peptides, proteins, oligonucleotides, antibodies, antibody derivatives, antibody fragments, receptors, and soluble factors.

Agonist: As used herein, the term "agonist" refers to a compound that can be used in combination with a receptor to generate a cellular response. The agonist may be a ligand that binds directly to the receptor. Alternatively, the agonist may (a) form a complex with another molecule that binds directly to the receptor, or (b) otherwise so that the other compound binds directly to the receptor. It may bind to the receptor indirectly by modifying the compound. Agonists may be referred to as agonists of a particular receptor or family of receptors, eg, agonists of co-stimulatory receptors.

Antagonist: As used herein, the term "antagonist" refers to any agent that inhibits or reduces the biological activity of the target (s) to which it binds.

Antigen: As used herein, the term "antigen" is defined as a molecule that triggers an immune response when introduced into a subject or when produced by a subject, such as a tumor antigen produced by the onset of cancer itself. Will be done. This immune response includes the production of antibodies and / or activation of certain immunologically qualified cells such as cytotoxic T lymphocytes and T helper cells. Antigens can be derived from organisms, protein / antigen subunits, killed or inactivated whole cells or lysates. With respect to the present invention, the term "antigen of interest" or "desired antigen" refers to immunospecific binding or immunospecific binding to or a fragment, variant, variant and / or variant of the antibody and / or fragment thereof, variants, variants and / or variants of the invention described herein. Refers to interacting proteins and / or other biomolecules provided herein. In some embodiments, the antigen of interest may comprise any of the polypeptides or payloads or proteins described herein, or fragments or portions thereof.

Approximately: As used herein, the term "approximately" or "approx." Refers to a value similar to the reference value referred to when applied to one or more values of interest. In certain embodiments, the term "approximately" or "about" is used in any direction (greater than or less than) the reference value referred to, unless otherwise stated or otherwise apparent from the context. 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or less Refers to a range of values (unless such numbers exceed 100 of the possible values).

Meeting: As used herein, the terms "meeting", "conjugated", "connecting", "attaching", and "connecting" are used with respect to more than one part. When they do, they physically associate or connect with each other, either directly or through one or more additional moieties that act as ligators, thereby forming a sufficiently stable structure. It means that those parts remain physically associated under conditions where the structure is used, for example physiological conditions. The "association" does not have to be due to a strictly direct covalent chemical bond. The term may also suggest connectivity based on ionic or hydrogen bonds, or sufficiently stable hybridization, such that the "associative" entities remain physically associated.

Self: As used herein, the term "self" means any substance derived from the same individual when later reintroduced into the individual.

Barcode: As used herein, the term "barcode" refers to a polynucleotide or amino acid sequence that distinguishes one polynucleotide or amino acid from another polynucleotide or amino acid.

Cancer: As used herein, the term "cancer" refers to a broad group of diseases characterized by the uncontrolled growth of abnormal cells in the body. Chaotic cell division and proliferation results in the formation of malignant tumors that invade adjacent tissues and eventually metastasize to the distal parts of the body via the lymphatic system or bloodstream.

Costimulatory molecule: When used herein, of an immune cell surface receptor / ligand that engages between T cells and APCs and produces T cell stimulatory signals, according to its implications for immune T cell activation. Pointing to a group, this stimulus signal is combined with a T cell stimulus signal resulting from T cell receptor (TCR) recognition of the antigen / MHC complex (pMHC) on APC.

Cytokines: As used herein, the term "cytokines" are small molecule soluble factors with pleiotropy that are produced by many cell types that can affect and regulate the functioning of the immune system. Refers to a family.

Service: As used herein, the term "service" refers to the act or mode of service of a compound, substance, entity, part, cargo or payload. A "delivery agent" is at least partially in vivo delivery of one or more substances, including but not limited to the compounds and / or compositions of the invention, to cells, subjects or other biological cells. Refers to any drug that promotes.

Destabilization: As used herein, the terms "destabilized", "destabilized", "destabilized region" or "destabilized domain" are start, reference, wild. A region or molecule that is less stable than the same region or molecule in type or natural form.

Modifications: As used herein, embodiments of the present invention feature variations of them from the starting point, wild-type or natural-type molecules, whether structural or chemical. Or if it is designed to have properties, it is "modified".

Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (eg, by transcription); (2). ) Processing of RNA transcripts (eg, by splicing, editing, 5'cap formation, and / or 3'end processing); (3) translation of RNA into polypeptides or proteins; (4) folding of polypeptides or proteins And (5) post-translational modifications of the polypeptide or protein.

Features: As used herein, "feature" refers to a feature, characteristic, or unique element.

Formulation: As used herein, "formulation" includes at least the compounds and / or compositions of the invention, as well as delivery agents.

Fragment: As used herein, "fragment" refers to a portion. For example, a fragment of a protein may contain a polypeptide obtained by digesting a full-length protein. In some embodiments, the protein fragments are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25. , 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250 or more amino acids. In some embodiments, the antibody fragment comprises a portion of the antibody.

Functional: As used herein, a "functional" biomolecule is a biological entity having a structure and morphology that exhibits the properties and / or activity that characterize the molecule.

Immune cells: As used herein, the term "immune cells" refers to any cell of the immune system derived from hematopoietic stem cells in the bone marrow, that is, two major lineages, namely myeloid progenitor cells (myeloid progenitor cells). Produces myeloid cells such as monospheres, macrophages, dendritic cells, macronuclear cells, and granulocytes) and lymphoid precursor cells (produces lymphoid cells such as T cells, B cells, and natural killer (NK) cells) To cause). Exemplary immune system cells include CD4 + T cells, CD8 + T cells, CD4-CD8-double negative T cells, Tγδ cells, Tαβ cells, regulatory T cells, natural killer cells, and dendritic cells. Macrophages and dendritic cells are sometimes referred to as "antigen-presenting cells" or "APCs," which are major histocompatibility complex (MHC) receptors on the surface of APCs that have complexed with peptides on the surface of T cells. It is a special cell that can activate T cells when interacting with TCR.

Immunotherapy: As used herein, the term "immunotherapy" refers to the type of treatment of a disease by inducing or ameliorating the responsiveness of the immune system to the disease.

Immunotherapeutic agents: As used herein, the term "immunotherapeutic agent" refers to the treatment of a disease by inducing or ameliorating the responsiveness of the immune system to the disease by biological, pharmaceutical, or chemical compounds. ..

In vitro: As used herein, the term "in vitro" is used in an artificial environment, such as a test tube or reaction vessel, cell culture, rather than in an organism (eg, animal, plant, or microorganism). Refers to an event that occurs in a Petri dish.

In vivo: As used herein, the term "in vivo" refers to an event that occurs within an organism (eg, an animal, plant, or microorganism or cell or tissue thereof).

Linker: As used herein, a linker refers to a part that connects two or more domains, parts, or entities. In one embodiment, the linker may contain 10 or more atoms. In a further embodiment, the linker may contain a group of atoms, eg, 10 to 1,000 atoms, which are atoms or groups such as carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. It can consist of, but is not limited to. In some embodiments, the linker may comprise one or more nucleic acids, including one or more nucleotides. In some embodiments, the linker may comprise an amino acid, peptide, polypeptide or protein. In some embodiments, the moieties bound by the linker include atoms, chemical groups, nucleosides, nucleotides, nucleobases, sugars, nucleic acids, amino acids, peptides, polypeptides, proteins, protein complexes, payloads (eg, therapeutics). Drugs), or markers (including, but not limited to, chemical markers, fluorescent markers, radioactive markers, bioluminescent markers), but not limited to these. As described herein, linkers can be used for any useful purpose, such as forming multimers or complexes, and administering payloads. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amide, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl. Each can be substituted as described herein as required. Examples of linkers are unsaturated alkanes, polyethylene glycol (eg, ethylene or propylene glycol monomer units, such as diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers. However, it is not limited to these. Other examples include cleaveable moieties within the linker, such as disulfide bonds (-SS-) or azo bonds (-N = N-) that can be cleaved with a reducing agent or photolysis. , Not limited to these. Non-limiting examples of selectively cleavable bonds include, for example, tris (2-carboxyethyl) phosphine (TCEP), or other reducing agents, and / or amide bonds that can be cleaved by the use of photolysis, and For example, ester bonds that can be cleaved by acidic or basic hydrolysis.

Checkpoint / Factor: As used herein, a checkpoint factor is any part or molecule whose function acts at the junction of a process. For example, checkpoint proteins, ligands or receptors can function to stall or accelerate the cell cycle.

Metabolites: Metabolites are intermediate products of metabolic reactions catalyzed by enzymes that occur naturally in cells. The term is commonly used to describe small molecules, large biomolecular fragments, or processed products.

Modification: As used herein, the term "modification" refers to an altered state or structure of a molecule or entity as compared to a parent or reference molecule or entity. Molecules may be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the compounds and / or compositions of the invention are modified by the introduction of unnatural amino acids.

Mutation: As used herein, the term "mutation" refers to a change and / or a change. In some embodiments, the mutation can be a change and / or modification to a protein (including peptides and polypeptides) and / or a nucleic acid (including a polypeptide). In some embodiments, mutations include changes and / or changes to protein and / or nucleic acid sequences. Such changes and / or alterations include the addition, substitution and / or deletion of one or more amino acids (in the case of proteins and / or peptides) and / or nucleotides (in the case of nucleic acids and / or polynucleotides such as polynucleotides). Can include. In some embodiments where the mutation comprises the addition and / or substitution of an amino acid and / or nucleotide, such addition and / or substitution may include one or more amino acid and / or nucleotide residues and is a modified amino acid. And / or can include nucleotides. The resulting mutations, alterations or alteration constructs, molecules or sequences may be referred to herein as variants.

Neoantigen: As used herein, the term "neoantigen" is present in tumor cells rather than normal cells and does not induce the deletion of cognate antigen-specific T cells in the thymus (ie, central). Immunotolerance) Refers to tumor antigens. These tumor neoantigens provide pathogen-like "foreign" signals and induce the effective immune response required for cancer immunotherapy. Neoantigens may be limited to specific tumors. Neoantigens are peptides / proteins with missense mutations (missense neoantigens) or novel peptides with long chain completely novel amino acid stretches from a novel open reading frame (neoORF). neoORF is an out-of-frame insertion or deletion in some tumors (due to a defect in DNA mismatch repair that causes microsatellite instability), gene fusion, stop codon read-through mutations, or translation of improperly spliced RNA. Can be produced by (eg, Saeterdal et al., Proc Natl Acad Sci USA, 2001, 98: 13255-13260).

Off-target: As used herein, "off-target" refers to an unintended effect on any one or more targets, genes, cell transcripts, cells, and / or tissues.

Operatively linked: As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, parts, and the like.

Payload or Objective Payload (POI): As used herein, the terms "payload" and "objective payload (POI)" are used interchangeably. The point of interest (POI) refers to any protein or compound whose function is to be altered. For the present invention, POI is a component of the immune system, including both the innate and adaptive immune systems. The payload of interest may be a protein, a fusion construct encoding a fusion protein, or a non-coding gene, or variants and fragments thereof. The target payload, if amino acid-based, may be referred to as the target protein.

Pharmaceutically Acceptable Excipients: As used herein, the term "pharmaceutically acceptable excipients" is present in a pharmaceutical composition and is substantially non-toxic and non-toxic within the subject. Refers to any ingredient other than active agents having inflammatory properties (eg, as described herein). In some embodiments, the pharmaceutically acceptable excipient is a vehicle capable of suspending and / or dissolving the active agent. Excipients include, for example: anti-adsorption agents, antioxidants, binders, coating agents, compression aids, disintegrants, dyes (colorants), skin softeners, emulsifiers, fillers (diluting agents), film-forming agents. Alternatively, coating agents, fragrances, fragrances, lubricants (fluid accelerators), lubricants, preservatives, printing inks, adsorbents, suspensions or dispersants, sweeteners, and hydrated waters can be mentioned. As exemplary excipients: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (bibasic), calcium stearate, croscarmellose, crosslinked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxy. Propropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, martitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shelac, dioxide Silicon, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolic acid, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol. Not limited.

Pharmaceutically Acceptable Salts: The pharmaceutically acceptable salts of the compounds described herein are produced by the reaction of an acid or base moiety in its salt form (eg, a free base with a suitable organic acid). ) Is the form of the disclosed compound. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkalis or organic salts of acidic residues such as carboxylic acids. Typical acid addition salts include acetate, adipate, alginate, ascorbate, asparagate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, cypress, Brain sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptone, hexane Acids, hydrobromide, hydrochlorides, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, Maronate, methanesulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropion Acids, phosphates, picphosphates, pivalates, propionates, stearate, succinates, sulfates, tartrates, thiocyanates, toluenesulfonates, undecanoates, valerate, etc. Can be mentioned. Typical alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium and the like, as well as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine and the like. Includes, but are not limited to, non-toxic ammonium, quaternary ammonium, and amine cations. Pharmaceutically acceptable salts include, for example, conventional NOAELs derived from non-toxic inorganic or organic acids. In some embodiments, a pharmaceutically acceptable salt is prepared from the parent compound containing a basic or acidic moiety by conventional chemical methods. In general, such salts require the free acid or free base form of these compounds to react with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or in a mixture of the two. In general, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. A list of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed. , Mack Publishing Company, Easton, Pa. , 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.M. H. Stahl and C.I. G. Vermus (eds.), Wiley-VCH, 2008, and Berge et al. , Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety. Pharmaceutically acceptable solvates: As used herein, the term "pharmaceutically acceptable solvates" refers to the crystalline form of a compound in which a molecule of the appropriate solvent is incorporated into the crystal lattice. Point to. For example, the solvate may be prepared by crystallization, recrystallization, or precipitation from a solution containing an organic solvent, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (eg, monohydrate, dihydrate, and trihydrate), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N, N'-dimethyl. Formamide (DMF), N, N'-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2- ( 1H) -pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate and the like. When water is the solvent, the solvate is called a "hydrate". In some embodiments, the solvent incorporated into the solvate is of a type or level that is physiologically acceptable to the organism to which the solvate is administered (eg, in the unit dosage form of the pharmaceutical composition). is there.

Stable: As used herein, "stable" is a compound or entity that is robust enough to withstand isolation from the reaction mixture to a useful purity and is preferably pharmaceuticalable into an effective therapeutic agent. Point to.

Stabilized: As used herein, the terms "stabilized," "stabilized," and "stabilized region" mean to stabilize or become stable. To do. In some embodiments, stability is measured relative to the absolute value. In some embodiments, stability is measured against a secondary status or condition, or reference compound or reality.

Standard CAR: As used herein, the term "standard CAR" refers to a standard design chimeric antigen receptor. The components of a CAR fusion protein containing an extracellular scFv fragment, a transmembrane domain and one or more intracellular domains are linearly constructed as a single fusion protein.

Stimulus Response Element (SRE): The term "stimulus response element (SRE)" as used herein is the configuration of an effector module that joins, attaches, connects, or associates with one or more payloads of an effector module. It is an element and, in some examples, is responsible for the response of the effector module to one or more stimuli. As used herein, the "responsive" nature of SREs to stimuli can be characterized by shared or non-shared interactions to stimuli, direct or indirect associations, or structural or chemical reactions. Moreover, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response can ultimately lead to a tuned signal or output. Such output signals are of a nature relative to the stimulus, eg, a 1-100 regulatory effect, or an increase of 2x, 3x, 4x, 5x, 10x or more. Alternatively, it may cause a decrease. One non-limiting example of SRE is the destabilizing domain (DD).

Subject: As used herein, the term "subject" or "patient" refers to any organism to which the compositions of the invention can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. .. Common subjects include animals (eg, mice, rats, rabbits, non-human primates, and mammals such as humans) and / or plants.

T cells: T cells are immune cells that produce the T cell receptor (TCR). T cells, naive (not exposed to the _antigen; compared to _{T CM, CD62L, CCR7, CD28} , CD3, CD127, and expression of CD45RA increased expression of CD45RO is decreased), memory T cells ( _TM ) (antigen experience and long-term survival), and effector cells (antigen experience, cytotoxicity). T _M is a subset of central memory T cells _{(T CM,} compared to naive T cells, CD62L, CCR7, CD28, CD127, CD45RO, and expression of CD95 is increased, the expression of CD54RA is decreasing) and effector memory T cells _{(T EM,} compared to naïve T cells or _{T CM,} CD62L, CCR7, CD28, expression of CD45RA decreases, the expression of CD127 is being increased) can be further classified into. The effector T cells _{(T E),} as compared to _{T CM,} CD62L, CCR7, CD28 expression is decreased, a granzyme and perforin-positive refers to a CD8 + cytotoxic T lymphocytes with antigen experience. Other exemplary T cells include regulatory T cells such as CD4 + CD25 + (Foxp3 +) regulatory T cells and Treg17 cells, as well as Tr1, Th3, CD8 + CD28-, and Qa-1 restricted T cells.

T-cell receptor: A T-cell receptor (TCR) has a variable antigen-binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail capable of specifically binding to an antigenic peptide bound to the MHC receptor. Refers to members of the immunoglobulin superfamily. TCRs can be found on the surface of cells or in soluble form and are commonly known as α and β chains (also known as TCRα and TCRβ, respectively), or γ and δ chains (also known as TCRγ and TCRδ, respectively). Consists of a heterodimer with). The extracellular portion of the TCR chain (eg, α chain, β chain) has two immunoglobulin domains, namely a variable domain at the N-terminus (α chain variable domain or V _α , β chain variable domain or V _β ), and a cell membrane. Contains one constant domain (eg, α chain constant domain or C _α and β chain constant domain or C _β ) in the vicinity of. Like immunoglobulins, variable domains include complementarity determining regions (CDRs) separated by framework regions (FRs). The TCR usually associates with the CD3 complex to form the TCR complex. As used herein, the term "TCR complex" refers to a complex formed by the association of CD3 and TCR. For example, the TCR complex can consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of a CD3ζ chain, a TCRα chain, and a TCRβ chain. Alternatively, the TCR complex can consist of a CD3γ chain, a CD3δ chain, two CD3ε chains, a homodimer of a CD3ζ chain, a TCRγ chain, and a TCRδ chain. As used herein, "components of a TCR complex" are TCR chains (ie, TCRα, TCRβ, TCRγ or TCRδ), CD3 chains (ie, CD3γ, CD3δ, CD3ε or CD3ζ), or two or more. (For example, a complex of TCRα and TCRβ, a complex of TCRγ and TCRδ, a complex of CD3ε and CD3δ, a complex of CD3γ and CD3ε, or a complex of TCRα, TCRβ, CD3γ, CD3δ, and a sub-TCR complex of two CD3ε chains).

Therapeutic Effective Amount: As used herein, the term "therapeutically effective amount" is used when administered to a subject suffering from or susceptible to infection, disease, disorder, and / or pathology. , Diseases, disorders, and / or delivery agents sufficient to treat, improve, diagnose, prevent, and / or delay the onset of the condition (eg, nucleic acids, drugs, therapeutic agents, diagnostic agents, prophylactic agents, etc.) ) Means the amount. In some embodiments, a therapeutically effective amount is provided in a single dose. In some embodiments, the therapeutically effective amount is administered in a dosing regimen that includes multiple doses. Those skilled in the art will, in some embodiments, administer a unit dosage form as part of such a dosing regimen, where if it comprises an effective amount, then a therapeutically effective amount of the particular agent or entity. You will understand that it can be considered to contain.

Treating or Treating: As used herein, the term "treatment" or "treating" refers to an approach for obtaining beneficial or desirable outcomes, preferably including beneficial or desirable clinical outcomes. Such beneficial or desirable clinical outcomes include, but are not limited to, reduced growth (or destruction) of cancer cells or other diseased cells, cancer found in cancer. Reduced cell metastasis, reduced tumor size, reduced symptoms caused by the disease, improved quality of life for people with the disease, reduced doses of other drugs needed to treat the disease, of the disease Delayed progression and / or prolongation of individual survival.

Adjustment: As used herein, the term "adjustment" means adjusting, balancing, or adapting one thing in response to a stimulus or towards a particular outcome. In one non-limiting example, the SREs and / or DDs of the invention adjust, balance or adjust the function or structure of the compositions to which they add, attach or associate, depending on the particular stimulus and / or environment. Adapt.

Equivalents and Scope One of ordinary skill in the art will be able to recognize and confirm many equivalents for a particular embodiment of the invention described herein, or using only routine experimentation. .. The scope of the present invention is not limited to the above description, but is described in the appended claims.

In the claims, articles such as "a", "an", and "the" can mean one or more unless there are conflicting instructions or are not clear from the context. Claims or statements that include "or" between one or more members of a group are such that one, more, or all group members are present or used in a given product or process. If they are otherwise relevant, they are considered to be met unless conflicting instructions are given or are not clear from the context. The present invention includes embodiments in which exactly one member of the group is present, used, or otherwise associated with a given product or process. The present invention includes embodiments in which a given product or process has more than one, or all group members, is present, is used, or is otherwise associated.

It should also be noted that the term "contains" is intended to be open and allows for additional elements or processes, but does not necessarily have to be included. Therefore, when the term "including" is used herein, the term "consisting of" is also included and disclosed.

If a range is given, the endpoints are included. In addition, unless otherwise indicated by the context and understanding of one of ordinary skill in the art, or otherwise clear, the value expressed as a range is the lower limit of the range unless explicitly indicated otherwise by the context. It should be understood that up to one tenth of a unit can take any particular value or subrange within the ranges described in different embodiments of the invention.

Further, it should be understood that certain embodiments of the invention included in the prior art may be explicitly excluded from any one or more of the claims. Such embodiments are considered to be known to those of skill in the art and may be excluded even if exclusion is not expressly indicated herein. Whether a particular embodiment of any of the compositions of the invention (eg, any antibiotic, therapeutic or active ingredient; any method of manufacture; any method of use; etc.) is associated with the presence of prior art. Regardless, it may be excluded from any one or more claims for any reason.

The words used are not limited, but are descriptive words, and in a broader manner, modified within the appended claims without departing from the true scope and spirit of the invention. Please understand that it is also good.

Example 1. Generation of novel ligand-responsive SRE or DD by mutagenesis screening Design of study To design a construct showing ligand-dependent stability, candidate ligand binding domain (LBD) was selected and yellow as a reporter of protein stability. Design cell-based screening using fluorescent protein (YFP) with desirable properties: low protein levels in the absence of LBD ligand (ie, low basal stability), large dynamic range, predictable with robustness Variants of candidate LBD carrying a destabilizing domain of dose response behavior and rapid degradation rate (Banaszynski, et al., (2006) Cell; 126 (5): 995-1004) are identified. Candidate LBD binds to the ligand of interest rather than the endogenous signaling molecule.

The candidate LBD sequence (as a template) is first mutated using a combination of nucleotide analog mutagenesis and error-prone PCR to generate a library of variants based on the template candidate domain sequence. The generated library is cloned in-frame to the 5'or 3'end of the YFP gene, and a retrovirus expression system is used to stably transduce the YFP fusion library into NIH3T3 fibroblasts.

Transduced NIH3T3 cells are screened for a library of candidate DDs by screening 3-4 times using fluorescently labeled cell fractionation (FACS). Transduced NIH3T3 cells are cultured in the absence of a high affinity ligand for the ligand binding domain (LBD) and cells exhibiting low levels of YFP expression are selected by FACS.

Screening Strategy I
The selected cell population is cultured for a period of time (eg, 24 hours) in the presence of a high affinity ligand for the ligand binding domain, at which point the cells are reselected by FACS. Cells showing high levels of YFP expression are selected by FACS, the selected cell population is divided into two groups and retreated with high affinity ligands of different concentrations of ligand binding domains. One group is treated with a low concentration of ligand and the other group is treated with a high concentration of ligand for a period of time (eg, 24 hours), at which point cells are reselected by FACS. Isolate cells expressing mutants that respond to low concentrations of ligand.

Isolated cells that respond to lower concentrations of ligand are treated again with ligand and cells exhibiting low fluorescence levels are collected 4 hours after removal of the ligand from the medium. This fourth selection is designed to concentrate cells with fast degradation rates (Iwamoto et al., Chem Biol. 2010 Sep 24; 17 (9): 981-988).

Screening Strategy II
Selected cell populations are subjected to one or more additional selections by FACS in the absence of a high affinity ligand for LBD, and cells exhibiting low levels of YFP expression are selected for further analysis. Cells are treated for a period of time (eg, 24 hours) with a high affinity ligand in the ligand binding domain and re-sorted by FACS. Cells expressing high levels of YFP are selected through FACS. Highly expressed cells of YFP are treated with the ligand again, and 4 hours after removing the ligand from the medium, cells showing low fluorescence levels are collected and cells showing a high degradation rate are concentrated. Any of the sorting steps may be repeated to identify DDs with ligand-gated stability.

After sorting, the cells are collected. The identified candidate cells are collected and genomic DNA is extracted. Candidate DD is amplified and separated by PCR. Candidate DDs are sequenced and compared to LBD templates to identify mutations in candidate DDs.

Example 2. Expression of DD-regulated recombinant IL2 FKBP (L106P) and ecDHFR (R12Y, Y100I) are well-characterized destabilizing domains that can confer instability on fusion partners (such as POI). Instability is reversed by a synthetic ligand named Shield-1 that binds to FKBP DD and TMP or MTX that binds to DHFR DD. The IL2 polypeptide was ligated to either FKBP (F36V; L106P) or ecDHFR (R12Y, Y100I). The IL2 construct was packaged in a pLVX-IRES-Puro wrench viral vector. The IL2 signal sequence was inserted at the N-terminus of the construct and the linker was placed between the signal sequence, DD and IL2.

OT-IL2-001 (FKBP) was transduced into the human colorectal cancer strain HCT-116. To measure the dependence of IL2 levels on the Shield-1 dose, cells were seeded on 96-well plates and treated with various concentrations of Shield-1. Medium was then harvested from the cells and IL2 levels were quantified using IL2 ELISA (FIG. 13). IL2 increased with increasing Shield-1 concentration and reached a plateau at higher Shield-1 dose levels. The half maximum effect concentration of Shield-1, ie EC _50, was measured as 50 nM.

Example 3. In vitro T cell assay development The goal of this study was to determine the dose of T cell stimulation regimen and IL12 required to maximize T cell persistence and T cell differentiation in vitro. This study summarizes the design of an adoptive cell therapy regimen, in which T cells are first exposed to the antigen in vivo, resulting in activation and subsequent resting periods, and finally the T cells are re-encountered with the antigen in It results in in vivo metastasis. T cells were stimulated with CD3 / CD28 beads or soluble CD3 / CD28 on day 0 and the CD3 / CD28 stimulant was washed away at the end of 48 hours. Cells were treated with IL12 at a dose in the range 0.01-1000 ng / mL. On day 9, the Th1 phenotype of the cells was evaluated by examining the frequency of appearance of IFNγ-positive CD4 + and CD8 + cells. On day 14, the cells were divided into two groups, one group was given a second CD3 / CD28 stimulation and the second group was not. On day 16, FACS was used to evaluate the Th1 phenotype in both groups. The result of the 16th day is shown in FIG. IFNγ expression was higher in cells restimulated with CD3 / CD28 on day 14 than in cells not stimulated second. This indicates that the Th1 phenotype requires both antigen restimulation and IL12 exposure. In addition, only 0.1 ng / mL IL12 caused Th1 skewing and IFNγ production from T cells in vitro, and higher doses of IL12 further enhanced this effect.

Example 4. Measurement of human T cell response in vitro and in vivo IL12 promotes the differentiation of naive T cells into Th1 cells, resulting in the secretion of IFNγ from T cells. Human T cells were treated with IL12 or left untreated and the expression of IFNγ and the T cell marker CD3 was analyzed by flow cytometry. Treatment with IL12 resulted in T cell differentiation as measured by an increase in the percentage of IFNγ-positive T cells from 0.21 to 22.3 (see insert in FIG. 15A).

Constructs were transduced into human T cells to test whether the membrane-bound IL15 / IL15Ra fusion protein (OT-IL15-008) could induce human T cell proliferation. T cell proliferation was measured by assessing anterior and lateral scattering of T cell populations using flow cytometry. Transduction with a membrane-bound IL15 / IL15Ra fusion construct increased human T cells (58.9) compared to non-transfected cell controls (37.8) (FIG. 15B).

Tracking T cells after adoption is important for determining distribution at different sites of the host, their identity and persistence over time. Human T cells were stimulated with CD3 / CD28 beads and incubated in the presence of 50 U / ml IL2. Cells were supplemented with IL2 on days 3 and 5 and grown in vitro for 7 days. On day 5, the CD3 / CD28 beads were removed and the cells were cultured for 2 days. On day 7, cells were washed to remove IL2 and 5 million human T cells were immunodeficient NOD. Cg-Prkdc ^scid Il2rg ^tm1Wjl / SzJ mice were injected intravenously. Blood samples were taken 4, 24, 120 and 168 hours after cell transplantation. Mice were euthanized 168 hours after cell transplantation and bone marrow and spleen were harvested. Immune cells were isolated from all samples and the presence of human T cells was analyzed using CD3 and CD45 cell surface markers. As shown in FIG. 15C, in animals injected with human T cells, the proportion of CD3-positive and CD45-positive human T cells in the blood was particularly high at 120 and 168 hours. CD3-positive and CD45-positive human T cells were also detected in the spleen and bone marrow of animals injected with human T cells. As expected, CD3-positive and CD45-positive human T cells were not detected in control animals that were not injected with human T cells.

Blood samples were taken from mice 48 hours after injection to determine T cell identity after adoption. CD4 and CD8 T cells were analyzed for surface expression of CD45RA and CD62L. Both markers are highly expressed in naive T cells, but are lost when T cells are exposed to antigen. As shown in FIG. 15D, human CD4 and CD8 T cells showed high surface expression of both markers prior to injection into mice, but were lost 48 hours after cell transplantation in vivo, leaving human T cells. It has been shown to be exposed to antigen in vivo.

Example 5. DD-regulated luciferase The luciferase polypeptide is ligated to either FKBP (F36V, L106P or F36V, E31G, R71G, K105E) or ecDHFR (R12Y, Y100I) to pLVX. IRES. It was cloned into Puro vector.

DD-regulated luciferase can be used to track cells in vivo, such as T cells. Firefly luciferase or sea shiitake mushroom luciferase may be used as the payload. HCT-116 cells were subjected to constitutive (OT-RLuc-001) or DD-regulated constructs (OT-RLuc-002, OT-RLuc-003, OT-RLuc-004, OT-RLuc-005 and OT-RLuc-006). ) Was stably transduced. Cells were treated with 1 μM Shield-1, 10 μM trimetoprim or vehicle control for 24 hours and luciferase expression was measured by Western blotting using anti-Umi luciferase and anti-firefly luciferase antibodies (Abcam, Cambridge, UK). The blot was also probed with anti-GAPDH antibody to ensure uniform protein loading in all samples. As shown in FIG. 16A, OT-RLuc-003 showed strong Shield-1 dependent stabilization of the sea shiitake luciferase. OT-RLuc-004, 005 and 006 show moderate stabilization of sea shiitake luciferase in the presence of the corresponding ligand, while OT-FLuc-002 shows fireflies with the addition of Shield-1. It showed moderate stabilization of luciferase. As expected, the constitutive luciferase construct (OT-RLuc-001) showed expression of sea shiitake mushrooms in both the presence and absence of the ligand (Fig. 16A).

Ligand-gated activity of sea pansy and firefly luciferase constructs was measured using coelenterazine and luciferin substrates, respectively. Cells were treated with 1 μM Shield-1, 10 μM trimethoprim, or vehicle control for 24 hours, lysed in assay lysis buffer and incubated in the presence of a luciferase substrate. Luciferase activity was measured as a luminescence measurement using a luminometer and the value was compared to a control sample consisting of a lysis buffer and a substrate. All regulatory DDs showed an increased ligand-gated dependence of luciferase activity compared to controls. As expected, the constitutive construct OT-RLuc-001 showed high luciferase activity both in the presence and absence of the ligand (Fig. 16B).

Example 6. Function of DD-regulated IL2 and IL2 mediated The ability of tumor cells to express these constructs to establish tumors and proliferate under treatment with corresponding synthetic ligands such as Sheald-1, trimethoprim or methotrexate. By evaluating, the function of DD-IL2 is characterized in vivo. Two to 10 million HCT-116 cells stably transduced with the construct are subcutaneously xenografted with Matrigel into mice capable of producing functional B cells and NK cells. Approximately 2 weeks after injection, when the tumor reaches a size of approximately 300 cubic mm, the corresponding stabilizing ligand, such as Sheald-1, trimethoprim or methotrexate, is administered to the mice at various concentrations every two days. Shield-1 is injected with a carrier consisting of 10% dimethylacetamide, 10% Solutol HS15, and 80% saline. Tumor volume and body weight are monitored twice a week and the experiment is terminated when the tumor size reaches 1000 cubic mm. Plasma and tumor samples are taken 8 hours after the last dose of ligand and IL2 and the ligand levels are measured.

To assess the tumorigenicity of IL2-expressing cells, HCT-116 cells stably transduced with the DD-IL2 construct were pretreated with the corresponding stabilizing ligands, Shield-1, trimethoprim or methotrexate, followed by mice. Xenograft into. Decreased tumor growth and concomitant increases in IL2 levels in ligand-treated mice compared to untreated controls indicate conditional regulation of IL2 in vivo.

Example 7. DD adjustable caspase-9
A caspase-9 polypeptide was ligated to the N-terminus or C-terminus of FKBP, ecDHFR and hDHFR DD to pLVX. IRES. It was cloned into Puro vector.

To test ligand-gated caspase-9 production, 1 million HEK-293T cells are seeded in 6-well plates in growth medium containing DMEM and 10 FBS and incubated overnight at 37 ° C. and 5% CO2. Using Lipofectamine 2000, cells are transiently transfected with 100 ng of DD-caspase-9 construct and incubated for 48 hours. After incubation, the growth medium is replaced with medium containing the ligand (trimethoprim, methotrexate, or Shield-1, depending on the construct used). After incubation for 24 hours in the presence of ligand, cells are lysed and immunoblotted for caspase-9. Increased caspase-9 levels with increasing ligand concentration indicate DD-mediated regulation of caspase-9.

Example 8. Evaluation of antitumor response of DD-regulated payload in syngeneic mouse models The efficacy of cancer immunotherapy in organisms with intact immune cells is assessed using syngeneic mouse models, such as the pMEL-1 and 4T1 mouse models. Immune cells such as T cells and NK cells are isolated from syngeneic mice and transduced with DD-regulated payloads such as DD-IL2 and DD caspase-9. The cells are then injected into mice with subcutaneous syngeneic tumors and treated with varying concentrations of ligand, Sield-1, trimethoprim or methotrexate, depending on the DD used. Mice treated with immune cells transduced with a DD-regulated payload are expected to have reduced tumor mass when compared to control animals.

Example 9. Co-expression of DD-regulated payload DD-interleukin, such as DD-IL2, and DD-caspase-9 or DDFOXP3 constructs are co-transfected into cells. The transfected cells are treated with a stabilizing ligand according to the DD used. The expression of DD-IL2 in the medium is measured by ELISA. For FOXP3 and caspase-9, the expression of FOXP3 and caspase-9 is evaluated by immunoblotting, respectively.

Example 10. In vivo tracking of DD luciferase cells The DD luciferase construct can be used as an optical reporter to assess whether ligands and / or cells expressing the DD luciferase have reached the target tissue. It can also be used to study the relationship between pharmacokinetics and pharmacodynamics (PK / PD) related to DD. PK / PD depends on (i) the behavior of the stabilizing ligand PK (ii) the behavior of the DD in a particular cell type (iii) the behavior of the cargo protein; some of which are studied using DD-regulated luciferase constructs. Can be done. The DD luciferase construct is expressed or co-expressed in primary T cells, or cell lines of interest such as HCT-116, SKOV-3 cells, and into immunodeficient mice, eg, tail vein, intraperitoneal, or subcutaneous. Inject by injection. Mice are treated with the corresponding ligand or vehicle control. Eight to 24 hours after ligand injection, mice are injected with D-luciferin if the payload is firefly luciferase and coelenterazine if the payload is sea luciferase. Animals are anesthetized and imaged using a bioluminescent imager (PerkinElmer, Massachusetts). The luciferase output of ligand-injected mice is compared to control mice and the signal is quantified using image analysis software (PerkinElmer, Massachusetts). Luciferase signals are expected to be much higher than in the background in ligand-treated mice compared to vehicle-controlled mice.

Example 11. Effects of Cytokines on the Proliferation and Activation of Immune Cells Immune cells such as natural killer cells depend on cytokines such as IL2 for proliferation and survival. This dependence on cytokines can be used to test the function of DD-regulated or constitutively expressed cytokines and cytokine fusion proteins.

The dependence of NK-92 cells on cytokines for activation was tested. The cells were first cultured with IL2 for 3 days, then washed twice and cultured in IL2-free medium for 7 hours. Cells were cultured for 18 hours in the presence of IL2 (100 μg / ml). FACS analysis of a panel of such markers, where increased expression of markers is associated with NK activation, evaluated activation of NK-92 cells in response to cytokine treatment. These include chemokine receptors such as NKG2D, CD71, CD69; CCR5, CXCR4, and CXCR3, perforin, granzyme B, and interferon gamma (IFNg). Cells were cultured for 4 hours in the presence of Breferdin A prior to IFNg FACS. IFNg levels were also measured in the medium. NK cells respond to external stimuli such as cytokines in the environment through phosphorylation of the JAK / STAT, ERK, and p38 / MAPK pathways, which are important proteins for cell activation, signal transduction, and differentiation pathways. Phosphorylation of AKT, STAT3 and STAT5 in response to the addition of cytokines was measured by FACS. Because the phosphorylation event is transient, NK-92 cells were treated with cytokines for 15 or 60 minutes prior to analysis. Table 15 shows the rate of change in the average fluorescence intensity of the IL2 treatment compared to the untreated marker.

Treatment with IL2 resulted in increased expression of CD69, CXCR4, perforin, granzyme B, and IFNg. In addition, treatment with IL2 resulted in higher IFNg levels secreted from NK-92 cells into the medium than in untreated controls. Phosphorylation of STAT5 increased 15 and 60 minutes after the addition of IL2. A moderate increase in phospho AKT and STAT3 was observed. Taken together, these results indicate that cytokines can activate NK cells.

The dependence of immune cells on cytokines for proliferation was tested in NK-92 cells (natural killer cell lines) and T cell lines Jurkat cells and SupT1 cells. Cells were seeded at 40,000 cells per well and cultured in the presence of IL2 or IL15 for 3 days. In untreated cells, the number of NK-92 cells decreased over time. However, treatment with IL2 increased the number of cells. In contrast, in SupT1 and Jurkat cells, the number of cells obtained by cytokine treatment was comparable to that of untreated controls. Therefore, NK-92 cells depend on cytokines for survival.

Example 12. DD-regulated FOXP3 expression A fusion molecule is produced by fusing a full-length or truncated form (FOXP3Δ2) with a DD such as ecDHFR (DD) or FKBP (DD). These fusion molecules were cloned into a pLVX-IRES-Puro vector.

To test ligand-gated FOXP3 production, 1 million HEK-293T cells were seeded in 6-well plates in growth medium containing DMEM and 10% FBS and incubated overnight at 37 ° C. and 5% CO2. .. Cells were transfected with constructs using Lipofectamine 2000 and incubated for 24 hours. After incubation, the medium was replaced with growth medium in the presence or absence of 10 μM trimethoprim or 1 μM Sheld-1 and incubated for an additional 24 hours. Cells were harvested and FOXP3 levels were analyzed by Western blotting using anti-FOXP3 antibodies (Abcam, Cambridge, UK). OT-FOXP3-003 and OT-FOXP3-007 showed the strongest Shield-1 dependent FOXP3 stabilization, and OT-FOXP3-008 showed the strongest trimethoprim dependent FOXP3 stabilization (FIG. 17A). And FIG. 17B). The constructs OT-FOXP3-004 and OT-FOXP3-009 showed moderate TMP and range-1 dependent stabilization.

Example 13. Effect of Ligand on T Cell Proliferation The effect of the SRE-specific ligand of the present invention on immune cell proliferation was measured to determine the concentration of ligand that did not inhibit T cell proliferation or survival. T cells from two different donors were stimulated with CD3 / CD28 and treated with ligand TMP or control vehicle (DMSO) at doses ranging from 0.04 μM to 160 μM. The proportion of dividing cells in the CD4 and CD8 populations of T cells was measured using FACS. TMP concentrations in the range of 0.04 μM to 40 μM did not affect the proportion of dividing cells in the CD8 and CD4 populations, whereas TMP at a concentration of 160 μM reduced the proportion of dividing cells by 70-90%. Therefore, the optimal concentration of TMP for T cell-based experiments was determined to be less than 160 μM.

Example 14. Promoter Selection for SRE Expression in T Cells Expression of SRE in a vector can be driven by the retroviral terminal repeat sequence (LTR) or by a cellular or viral promoter located upstream of the SRE. Promoter activity may vary by cell type, so promoter selection needs to be optimized for each cell type. To identify the optimal promoter, AcGFP (SEQ ID NO: 223) was added to CMV or pLVX. With the EF1a promoter. It was cloned into an IRES Puro construct. The constructs were transduced into patient-derived T cells and Su T1 cells, and GFP expression was measured using FACS 3 and 5 days after transduction. As shown in FIG. 18, both the CMV promoter and the EF1a promoter can drive GFP expression in SupT1 and T cells. The proportion of GFP-positive T cells was higher when GFP expression was driven by the CMV promoter than on the EF1a promoter on both days 3 and 6 after transduction. In contrast, the proportion of GFP-positive cells was much higher when GFP expression was driven by the EF1a promoter compared to the CMV promoter. Therefore, the optimal promoter suitable for expression depends on the cell type.

Example 15. Human T cells designed to express TCR restimulation DD-regulated cytokines in vivo via EBV tumor antigen are not antigen-specific. However, in vivo T cell function requires restimulation that occurs upon binding to the antigen. This antigen-mediated restimulation requirement can be mimicked in vivo in mice and Epstein-Barr virus (EBV) antigens may be utilized. Approximately 90% of adults are currently or previously infected with EBV. In addition, the major histocompatibility complex HLA-A02 is associated with a reduced risk of developing EBV-positive Hodgkin lymphoma, suggesting that HLA-A02 presents a CTL peptide epitope that promotes viral clearance. .. Several HLA-A02-positive tumor cell lines, such as Raji cells, are used for in vivo studies. Primary human T cells obtained from various donors are grown in the presence of CD3 / CD28 dynabeads. EBV antigens, EBV-positive Raji cells, and EBV-negative Ramos cells are used to test the reactivity of T cells. Anti-HLA antibodies are used to test the involvement of HLA-A02 in antigen recognition and test the specificity of the assay. Cell killing assays are performed by incubating T cells with fluorescently labeled Raji or Ramos cells to assess the ability of donor T cells to preferentially kill Raji cells. Activation of T cells in response to interaction with the EBV antigen is measured by culturing mitomycin-treated Raji or Ramos cells with fluorescently labeled T cells. The activation and proliferation status of T cells is examined by measuring the expression of IFNg, CD107a, granzyme, and perforin. In many cases, donor T cells are expected to be immunoreactive to Raji cells rather than Ramos cells, as many humans are exposed to EBV. T cells that react with Raji cells can be positive for T cell activation markers such as granzymes and perforins.

Example 16. Ligand-gated IL2-stabilized IL2 polypeptides in vivo were ligated to either FKBP (F36V; L106P) or ecDHFR (R12Y, Y100I). The IL2 construct was packaged in a pLVX-IRES-Puro wrench viral vector. The IL2 signal sequence was inserted at the N-terminus of the construct and the linker was placed between the signal sequence, DD and IL2.

OT-IL2-001 (FKBP) was transduced into the human colorectal cancer strain HCT-116. IL2 expression in vitro was confirmed by ELISA. To test ligand-mediated regulation in vivo, 5 million HCT116 cells transduced with IL2 constructs were injected subcutaneously into the flank of immunodeficient mice. Approximately 2 weeks after injection, when the tumor reaches a size of approximately 300 cubic mm, the mice are administered with the corresponding stabilizing ligand or corresponding vehicle control. 10% Dimethylacetamide, 10% Solutol
Sheald-1 is injected at a concentration of 10 mg / kg body weight with a carrier consisting of HS15 and 80% saline. Mice were euthanized with tumors and plasma samples were taken for analysis of IL2 levels. Tumor IL2 levels were measured by ELISA as picograms per mg of protein. As shown in FIG. 19, the tumor IL2 levels detected by the Shield-1 treatment were higher than those detected by the vehicle control. These data show dose-dependent IL2 secretion from HCT116 cells that stably express FKP-IL2 in vivo.

Example 17. Optimization of T Cell Transduction and Proliferation The T cell proliferation and transduction protocol consists of stimulating donor-derived human T cells on day 0 with aCD3 / aCD28 bead stimulation to promote T cell proliferation. On day 1, the selected constructs were transduced into T cells, with occasional medium changes and growth for up to 11 days. On day 11, the beads were rinsed and cells were aliquot frozen for use in various functional assays. The process of T cell proliferation and transduction requires optimization to ensure exponential growth of T cells, following a delay of the first 4 days in T cell proliferation caused by viral transduction. The non-optimized proliferation protocol results in static proliferation of up to 10 days, which takes 21 days to achieve similar expected T cell numbers, as well as abnormally reduced viability and abnormal CD4 to CD8 T cell ratios. obtain. The source of αCD3 / αCD28 used for T cell stimulation and the ratio of beads were tested to identify optimal conditions. ΑCD3 / αCD28 beads from various sources were used. These include dynabeads (Thermo Fisher, Waltham, MA), anti-biotin MACSiBead (Miltenyi Biotec, Polymer) with CD3 / CD28 +/- CD2, macrobeads, ie, a complex of αCD3 / αCD28 soluble tetrameric antibodies. Includes 3 μm magnetic polymer beads (StemCell, Canda) coated with αCD3 / αCD28 antibody. The beads and T cells were mixed in a ratio of 3: 1, 1: 1, 1: 3, and 1: 9 to identify the optimal ratio for co-culture. Assays were also performed using two separate donors to illustrate donor-related volatility. Cell viability was measured on days 0, 4, and 7. As shown in FIG. 20, both donors showed improved cell viability at a bead-to-cell ratio of 1: 3 compared to all other conditions, especially day 4. Cell counts were performed using both cellometer and flow cytometric analysis. In this analysis, the virus was infected with MOI 10 and the effect of virus transduction on T cell count was examined compared to sham (Lentiboss (LB) transduced cells. Compared to day 0 proliferation 4 Multiply changes in cell proliferation on days 1 and 7 were analyzed and the results of cellometer counting are shown in Table 16.

As shown in Table 16, the overall proliferation of both donors was greater on day 7 than on day 4. In donor 1, day 4 proliferation of virus transduced cells was highest when using a 3: 1 bead-to-cell ratio in combination with MOI 10, while donor 2 T cells were 1: 9. Proliferated most in the ratio of. On day 7, donor 1 showed the highest cell proliferation in a 1: 1 ratio and donor 2 in a 1: 3 ratio. Based on these results, the optimal bead-to-cell ratio for promoting T cell proliferation was identified as 1: 3.

In addition, T cells transduced at various multiplicity of infections (MOIs) were tested using flow cytometry. The results for donor 1 are shown in Table 17.

As shown in Table 17, a bead ratio of 1: 9 showed the highest cell viability of all the conditions tested for donor 1. Similar results were obtained for donor 2.

The ratio of CD4 to CD8 within a growing T cell population. At the start of the experiment, the ratio of CD4 to CD8 was 3, which was determined to be population distortion. The results are shown in Table 18.

Donor 1 showed a CD4 to CD8 ratio close to 3 when using a 1: 9 bead to cell ratio. Similar results were obtained with donor 2 when the bead-to-cell ratio was 1: 3.

Taken together, these experiments show that activation-induced cell death can occur when T cells are overstimulated with beads, thus requiring an optimal bead-to-T cell ratio. Experimental results suggest that the optimal bead-to-cell ratio for various MOIs was 1: 3.

Example 18. Analysis of BCMA CAR expression The BCMA CAR fusion polypeptide is ligated to either the FKBP-DD, ecDHFR-DD or the N-terminus of human DHFR-DD and the construct is linked to the pLVX-IRES-Puro vector under transcriptional control of the EF1a promoter. Clone to.

To test ligand-gated expression of DD-BCMA CAR construct, 1 million HEK HCT116 cells were cultured in growth medium containing DMEM and 10% FBS and the CAR construct was transfected using Lipofectamine 2000 or LentiBost. did. Forty-eight hours after transfection, cells were treated with 1 μM or 10 μM Sheld-1, 10 μM trimethoprim, 1 μM methotrexate, or vehicle control and incubated for 24 hours. Fluorescently labeled cell fractionation (FACS) using the protein L-biotin-streptavidin-alophycocyanin (Thermo Fisher Scientific, Waltham, MA) that binds surface expression of DD-BCMA CAR constructs in HCT116 cells to the κ light chain of CAR. Was measured using. As shown in FIG. 21, surface expression of OT-BCMA-002 using FKBP-DD was elevated in the presence of Shield-1, while OT-BCMA-003 using ecDHFR-DD was in the presence of trimethoprim. Showed an increase in surface expression. As expected, the constitutively expressed construct OT-BCMA-001 showed high expression even in the absence of ligand.

Example 19. Analysis of expression and function of CAR The expression of chimeric antigen receptors described herein, such as, but not limited to, CD22 CAR, ALK CAR, CD33 CAR, HER2 CAR and GD2 CAR constructs, ecDHFR DD, FKBP DD and hDHFR. Fuse with destabilizing domains such as DD. To test the ligand-gated expression of the construct, immune cells are cultured in DMEM and growth medium containing 10% and the CAR construct is transduced. Forty-eight hours after transduction, cells are treated with a DD-corresponding ligand, such as 1 μM or 10 μM Sheld-1, 10 μM trimethoprim, 1 μM methotrexate, or vehicle control and incubated for 24 hours. The cells are then analyzed by Western blotting using CD3ζ, a component of CAR. Surface expression of CAR is analyzed by FACS using protein L. Intracellular and surface expression of CAR is undetectable in the absence of ligand, but is expected to be strongly induced by the presence of ligand.

Efficacy of T cells expressing DD-regulated CAR constructs in their functional interaction with target cells will be evaluated. To interact with CAR T cells, selected target cells express CAR-related antigens either naturally or ectopically. For example, target cells with high intrinsic expression of BCMA include KMS11, MM-1S, RPMI-8226 cells; target cells expressing CD33 include HL-60, MOLM13, MOLM14 cells. Alternatively, the target cell line may be modified to ectopically express the antigen in a cell line with low endogenous expression of the antigen.

Functionality is measured using multiple assays. Prior to co-culture, target cells are optionally cultured in the presence of mitomycin C to prevent the growth of target cells. This ensures that the proliferation of target cells does not exceed the proliferation of T cells. Cytotoxicity assays are used to measure the ability of T cells to induce target cell death. Target cells are modified to express sea pansy or firefly luciferase and co-cultured with T cells expressing the DD-regulated CAR construct for 18-24 hours in the presence of a DD or vehicle control-related ligand. At the end of co-culture, cells are lysed and luciferase activity is measured using the appropriate substrate. When DD-regulated CAR-expressing T cells are co-cultured with antigen-expressing target cells in the presence of a ligand, luciferase activity is expected to increase. When utilizing vehicle control cells or target cells that do not express antigen, it is not expected to be cytotoxic.

The cytolytic ability of DD CAR-expressing cells is evaluated in primary human T cells or human cell lines (eg, NALM6, K562 and Raji) using a chromium-51 release assay. Load the _Na ² 51 CrO ₄ target cells were washed twice, resuspended in growth medium without phenol red. Untreated or ligand-treated DD CAR and pseudotransduced cells are co-incubated with allogeneic antigen-expressing target cells at various effector: target cell ratios and the release of chromium into the supernatant is measured using a liquid scintillation counter. .. Cells with DD CAR are expected to exhibit specific cytolysis only in the presence of ligand. Cells with DDCAR or pseudotransfected cells in the absence of ligand are expected to exhibit minimal cytolytic activity.

Activation of T cells results in degranulation, an exocytotic process in which cytotoxic T cells release molecules such as perforin and granzyme that allow the killing of target cells. Degranulation is measured by analyzing the medium with signs of exocytosis, eg, with FACS for CD107, and with degranulation markers such as perforin and granzyme using immunoassay.

Engagement of CAR with its relative antigen results in activation of T cells, which is measured 24 hours after co-culture of CAR-expressing T cells and target cells. T cell activation is assessed by measuring IFNg, IL2, and CD69 levels. T cell proliferation in response to antigen-mediated T cell activation is measured by labeling T cells with carboxyfluorescein succinimidyl ester, which is used to track cells across multiple generations. Labeled T cells are cultured with mitomycin-treated target cells and cell proliferation is followed for 3-5 days. T cell proliferation and activation are expected to increase when DD-regulated CAR-expressing T cells are co-cultured with target cells expressing cognate antigens in the presence of ligand. Both parameters are expected to remain unchanged when using vehicle control cells or target cells that do not express the antigen.

To measure the ability of DD-regulated CAR to promote tumor-free survival, mice are injected intravenously with antigen-positive target cells. After injection, mice are treated with non-transduced pseudo-T cells or T cells transduced with an antigen-specific chimeric antigen receptor. Mice are then split into two cohorts; the first cohort is treated with SRE-specific ligands and the second cohort is treated with vehicle controls. Mouse survival is monitored for up to 80 days after administration of target cells. Mice bearing tumors treated with CAR transduced T cells and ligands are expected to survive longer than non-transduced cells; mice treated with vector control transduced T cells or vehicle controls.

Mice are sympatrically injected with antigen-positive target cells on day 0 to measure ligand-induced tumor growth reduction. Then, on the third day, the mice are treated with cyclophosphamide intraperitoneally. The cells are treated with an antigen-specific CAR construct. Mice are treated with recombinant interleukin 7 or interleukin 7 complexed with IL7 antibody 2-3 times a week for 3 weeks to promote T cell persistence. Mice are then split into two cohorts; the first cohort is treated with SRE-specific ligands and the second cohort is treated with vehicle controls. Tumor size is measured at various points in time after inoculation. Mice treated with antigen-specific CAR and ligand are expected to be tumor-free, while mice treated with pseudotransduced cells or vehicle control cells are expected to die from the tumor.

To test whether DD-regulated CAR can cause tumor regression established in a ligand-gated manner, mice are sympatrically inoculated with luciferase-expressing antigen-positive T cells. Tumors are grown for 8 days and growth is monitored using bioluminescence imaging. Eight days after tumor inoculation, CAR transduced cells are injected intravenously in the presence or absence of enhanced cytokine and cytotoxic therapy. Simultaneous treatment with ligand or vehicle control is also initiated. Mice treated with CAR T cells are expected to exhibit tumor regression and long-term disease control in the presence of ligand, while all mice treated with pseudotransduced cells are due to progressive tumor growth. Expected to die.

Example 20. Measurement of T cell depletion phenotype and its inversion Primary T cells are activated using soluble CD3 / CD28 or CD3 / CD28 dynabead. After 24 hours, the DD-regulated CD19 CAR construct is transduced into cells and allowed to rest for 24 hours. Cells are then treated with SRE-specific ligands or vehicle controls. On day 4, the CD3 / CD28 beads are removed and the cells are cultured for an additional 3 days. On day 7, cells are thoroughly washed to remove ligand, reseeded in the absence of ligand and cultured for 3 days. On day 10, cells were washed and reseeded in the absence of ligand. Cell samples are analyzed on day 10 for phenotypic and functional markers associated with depletion. The remaining cells are cultured for 3 days in the absence of ligand and analyzed for phenotypic and functional depletion markers on day 14. T cells cultured during the experiment in the presence or absence of ligand are included as controls. Phenotypic markers of depletion such as PD1, TIM3, LAG3, BTLA, CD160, 2B4, and CD39a are measured in both CD4 and CD8 T cell populations. Chronic T cell activation has been shown to cause T cell depletion, so T cells cultured in the continuous presence of ligand throughout the experiment were positive for multiple markers of depletion. is expected. Since expression of CAR is undetectable / low in the absence of ligand, T cells cultured in the absence of ligand are expected to be negative for multiple markers of depletion throughout the experiment. Cells deliganded on day 7 are expected to have a lower proportion of cells positive for multiple depletion markers on day 10 than cells treated with ligand during the experimental period. This result is expected for both the CD8 and CD4 populations of T cells.

Example 21. Bispecific Chimeric Antigen Receptor Transduce a lentiviral vector encoding the bispecific chimeric antigen receptor into human T cells. Targets for bispecific CAR include, but are not limited to, GD2, CD33, BCMA, Her2, ALK, CD22, and CD276. Cells are cultured for 24-48 hours in the presence of ligand or vehicle control. Includes additional controls such as human T cells that have been pseudotransduced or transduced with a vector that encodes septicity for only one antigen. The expression of CAR is evaluated by flow cytometry using an anti-iditopes CAR antibody. Expression of bispecific CAR is expected only in cells transduced with bispecific CAR constructs in the presence of ligand, whereas controls transduced with monospecific CAR constructs are simple. Expression of one CAR construct is expected to be exhibited in the presence of ligand.

T cells are also analyzed for proliferation, apoptosis markers and memory phenotypes. The cells are cultured by the above method. Ligands are removed on either day 7 or day 10, and on day 14, cells are analyzed using Annexin V staining for apoptosis and CD62L as a marker for memory phenotype. When compared to untreated cells, cells continuously treated with ligand are expected to exhibit increased apoptotic cells, decreased proliferation, and decreased CD62L expression, which indicate T cell depletion. Ligand removal on day 7 or 10 is expected to show low annexin V and high CD62L expression, as well as increased proliferation similar to untreated cells.

Example 22. Measurement of T cell depletion phenotype and its inversion Primary T cells are activated using soluble CD3 / CD28 or CD3 / CD28 dynabead. After 24 hours, the DD-regulated CD19 CAR construct is transduced into cells and allowed to rest for 24 hours. Cells are then treated with SRE-specific ligands or vehicle controls. On day 4, the CD3 / CD28 beads are removed and the cells are cultured for an additional 3 days. On day 7, cells are thoroughly washed to remove ligand, reseeded in the absence of ligand and cultured for 3 days. On day 10, cells were washed and reseeded in the absence of ligand. Cell samples are analyzed on day 10 for phenotypic and functional markers associated with depletion. The remaining cells are cultured for 3 days in the absence of ligand and analyzed for phenotypic and functional depletion markers on day 14. T cells cultured during the experiment in the presence or absence of ligand are included as controls. Phenotypic markers of depletion such as PD1, TIM3, LAG3, BTLA, CD160, 2B4, and CD39a are measured in both CD4 and CD8 T cell populations. Chronic T cell activation has been shown to cause T cell depletion, so T cells cultured in the continuous presence of ligand throughout the experiment were positive for multiple markers of depletion. is expected. Since expression of CAR is undetectable / low in the absence of ligand, T cells cultured in the absence of ligand are expected to be negative for multiple markers of depletion throughout the experiment. Cells deliganded on day 7 are expected to have a lower proportion of cells positive for multiple depletion markers on day 10 than cells treated with ligand during the experimental period. This result is expected for both the CD8 and CD4 populations of T cells.

T cells are also analyzed for proliferation, apoptosis markers and memory phenotypes. The cells are cultured by the above method. Ligands are removed on either day 7 or day 10, and on day 14, cells are analyzed using Annexin V staining for apoptosis and CD62L as a marker for memory phenotype. When compared to untreated cells, cells continuously treated with ligand are expected to exhibit increased apoptotic cells, decreased proliferation, and decreased CD62L expression, which indicate T cell depletion. Ligand removal on day 7 or 10 is expected to show low annexin V and high CD62L expression, as well as increased proliferation similar to untreated cells.

Example 23. Functional analysis of reversal of T cell depletion The functionality of T cells expressing DD-regulated CAR constructs is evaluated by measuring cytokine release. T cells expressing the DD CAR construct are co-cultured with target cells expressing the antigen (endogenously or ectopically). T cells are activated on day 0 using CD3 / CD28 beads. After 24 hours, the DD-regulated CAR construct is transduced into cells and allowed to rest for 24 hours. Cells are then treated with SRE or vehicle control specific ligands. On day 4, the CD3 / CD28 beads are removed and the cells are cultured for an additional 3 days. On day 7, cells are thoroughly washed to remove ligand, reseeded in the absence of ligand and cultured for 3 days. In additional experimental conditions, cells are treated with ligand until day 10 instead of day 7. T cells cultured during the experimental period in the presence or absence of ligand are included as controls. After 24 hours, the supernatant was collected from the cells and IL2 and IFNg levels were measured as readings for T cell function. Compared to untreated cells, cells continuously treated with ligand are expected to show increased expression of IL2 and IFNg, indicators of functional T cells, on day 14. Ligand removal on day 7 or 10 is expected to have minimal effect on IFNg and IL2 levels.

The ability of the biological circuit of the present invention to functionally rescue depleted T cells is also evaluated. T cells treated with ligand up to day 10 are selected and selected for cells positive for chimeric antigen receptor and multiple depletion markers (PD1, TIM3, LAG3, etc.). The cells are divided into two groups, the first group is treated with a ligand and the second group is treated with a vehicle control. T cell functionality is measured using IL2 levels as a substitute. Ligand depletion is expected to reverse T cell depletion, and therefore cells subjected to ligand depletion on day 10 are expected to have higher IL2 levels compared to ligand treated cells.

Example 24. Optimization of Biological Circuit Behavior The biological circuit of the present invention includes a plurality of modules that can be optimized. A library of each component can be generated to quickly generate a new construct with the desired behavior. Ligand pharmacokinetics is a powerful tool for payload-specific tuning in vivo, which can be used to shift the ligand response curve of an effector module left or right depending on the regulator. Several regulators will be tested, including but not limited to ligand dose, concentration, size, duration, and route of administration. The destabilizing domain can also be modified to improve the behavior of biological circuits. The destabilizing domain is a central determinant of the dynamic range of biological circuits. Depending on the DD selected, the ligand response curve of the effector module can be shifted up and down. Modify the nature, location, and number of DDs in the effector module. The selection of DD is also changed according to the desired decomposition rate. Optimize promoters that regulate SRE expression in transcription. Promoter selection affects the basal off state and affects the dynamic range of stabilization. In addition, promoter selection contributes to the range of stabilized payloads produced. Other optimizable factors in biological circuits include vectors, translation elements, leader sequences, component placement within SRE, codon selection, protease sites, linkers, and mRNA stability.

The present invention has been described in some degree of detail with respect to some of the described embodiments, which is one such detail or embodiment of the present invention or any particular embodiment. It is not intended to be limited to, but should be interpreted with reference to the claims, thereby giving the widest possible interpretation of such claims in view of the prior art. Provided and therefore effectively embraces the intended scope of the invention.

All publications, patent applications, patents, and other references referred to herein are hereby incorporated by reference in their entirety. In case of conflict, the specification, including the definitions, will prevail. Moreover, the section headings, materials, methods, and examples are for illustration purposes only and are not intended to be limiting.
In certain embodiments, for example, the following items are provided:
(Item 1)
A composition for inducing an immune response in a cell or subject, comprising a first effector module, wherein the effector module is operably linked to at least one immunotherapeutic agent, a first stimulus response element (SRE). ), The composition, wherein the at least one immunotherapeutic agent is selected from cytokines, safety switches, regulatory switches, chimeric antigen receptors and combinations thereof.
(Item 2)
The composition of item 1, wherein the first SRE responds to or interacts with at least one stimulus.
(Item 3)
The composition according to item 2, wherein the first SRE is a destabilizing domain (DD).
(Item 4)
The DD is derived from the parent protein or a mutant protein having 1, 2, 3 or more amino acid mutations relative to the parent protein, and the parent protein is:
(A) Human protein FKBP having the amino acid sequence of SEQ ID NO: 3
(B) Human DHFR (hDHFR) having the amino acid sequence of SEQ ID NO: 1,
(C) E. cerevisiae having the amino acid sequence of SEQ ID NO: 2. colli DHFR (ecDHFR),
(D) PDE5 having the amino acid sequence of SEQ ID NO: 4,
(E) PPARγ, which has the amino acid sequence of SEQ ID NO: 5.
(F) CA2 having the amino acid sequence of SEQ ID NO: 6
(G) NQO2 having the amino acid sequence of SEQ ID NO: 7, and (h) human DPPIV having the amino acid sequence of SEQ ID NO: 224.
The composition according to item 3, which is selected from.
(Item 5)
The parent protein is hDHFR, and the DDs are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P, F135L, F135S T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149L, P150L, E151G, I15R Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T V182A, Y183C, Y183H, E184R, E184G, K185R, K185del , K185E, N186S, N186D, D187G, and the composition of item 4, comprising a mutant protein having at least one mutation selected from D187N.
(Item 6)
5. The composition of item 5, wherein the stimulus is selected from trimethoprim (TMP) and methotrexate (MTX).
(Item 7)
The composition according to item 1, wherein the immunotherapeutic agent is a cytokine.
(Item 8)
The composition according to item 7, wherein the cytokine is interleukin, interferon, tumor necrosis factor, transforming growth factor B, CC chemokine, CXC chemokine, CX3C chemokine or growth factor.
(Item 9)
The cytokine is interleukin, and the interleukin is IL1, IL1-α, IL1-β, IL1-δ, IL1-ε, IL1-η, IL1-ζ, IL-RA, IL2, IL3, IL4, IL5. , IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11a, IL11b, IL13, IL14, IL16, IL17, IL-17A, IL17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20L, IL21, IL22 , IL23, IL23A, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL34, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, Il37d, IL37e, and IL38. Item 8. The composition according to item 8, which is selected from the group consisting of.
(Item 10)
9. The composition of item 9, wherein the interleukin is IL2 having the amino acid sequence of SEQ ID NO: 51.
(Item 11)
The composition according to item 1, wherein the immunotherapeutic agent is a safety switch.
(Item 12)
The item in which the safety switch is selected from caspase-9, inducible FAS (iFAS), inducible caspase-9 (icasp9), CD20 / anti-CD20 antibody pair, protein tag / anti-tag antibody, and small suicide gene (RQR8). 11. The composition according to 11.
(Item 13)
The composition according to item 12, wherein the safety switch is a caspase-9 having the amino acid sequence of SEQ ID NO: 65.
(Item 14)
The composition of item 1, wherein the immunotherapeutic agent encodes a regulatory switch.
(Item 15)
The composition according to item 14, wherein the control switch is selected from FOXP3, Nr4a, FOXO, and NF-κB.
(Item 16)
15. The composition of item 15, wherein the control switch is FOXP3 having the amino acid sequences of SEQ ID NOs: 103-106.
(Item 17)
The immunotherapeutic agent is a chimeric antigen receptor (CAR) and is selected from GD2 CAR, Her2 CAR, BCMA CAR, CD33 CAR, ALK CAR, CD22 CAR, and CD276 CAR, each of which is an extracellular portion, membrane. The composition of item 1, comprising a transmembrane domain, an intracellular signaling domain, and optionally one or more costimulatory domains.
(Item 18)
The composition according to item 17, wherein the CAR is designed as a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.
(Item 19)
The extracellular target portion is:
i. Ig NAR,
ii. Fab fragment,
iii. Fab'fragment,
iv. F (ab) '2 fragment,
v. F (ab) '3 fragment,
vi. Fv,
vii. Single chain variable fragment (scFv),
viii. bis-scFv, (scFv) 2,
ix. Mini body,
x. Diabody,
xi. Tria body,
xii. Tetra body,
xiii. Intracellular antibody,
xiv. Disulfide Stabilized Fv Protein (dsFv),
xv. Unibody,
xvi. Nanobodies and xvii. The composition of item 18, wherein the composition is selected from any of the antigen-binding regions derived from an antibody that specifically binds to any of the protein of interest, ligand, receptor, receptor fragment, or peptide aptamer.
(Item 20)
The extracellular target moiety is an ALK target moiety having the amino acid sequences of SEQ ID NOs: 242 to 257 and 422 to 429, a CD22 target moiety having the amino acid sequences of SEQ ID NOs: 258 to 262 and 430 to 432, SEQ ID NOs: 263 to 270 and 433. CD276 target moiety having the amino acid sequence of ~ 436, GD2 target moiety having the amino acid sequences of SEQ ID NOs: 271 to 349 and 437 to 465, CD33 target moiety having the amino acid sequence of SEQ ID NO: 350 to 357, amino acids of SEQ ID NO: 358 to 365. The composition according to item 17, which is selected from a BCMA target moiety having a sequence and a Her2 target moiety having the amino acid sequences of SEQ ID NOs: 366 to 421 and 466 to 473.
(Item 21)
(A) A cell surface molecule in which the intracellular signal transduction domain of the CAR is selected from the group consisting of the T cell receptor CD3ζ or FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. Is the signal transduction domain derived from;
(B) The co-stimulation domain exists, which is 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278). , Glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-related antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.
The composition according to item 17.
(Item 22)
The composition of item 17, wherein the transmembrane domain has the amino acid sequence of SEQ ID NOs: 527-624.
(Item 23)
17. The composition of item 17, wherein the transmembrane domain further comprises a hinge region having the amino acid sequence of SEQ ID NOs: 628-694.
(Item 24)
The first effector module is:
(A) IL2-DD having any of the amino acid sequences of SEQ ID NOs: 52 to 54,
(B) Caspase-9-DD having any of the amino acid sequences of SEQ ID NOs: 72-80,
(C) FOXP3-DD having any of the amino acid sequences of SEQ ID NOs: 107-116,
(D) BCMA CAR-DD having the amino acid sequence of any of SEQ ID NOs: 775 to 777, and (e) HER2-DD having the amino acid sequence of SEQ ID NO: 906.
The composition according to any one of items 1 to 23, which comprises one or more of.
(Item 25)
The polynucleotide encoding the composition according to any one of items 1 to 24, wherein the at least one immunotherapeutic agent is selected from cytokines, safety switches, regulatory switches, chimeric antigen receptors and combinations thereof.
(Item 26)
The polynucleotide according to item 25, wherein the polynucleotide is a DNA molecule or an RNA molecule.
(Item 27)
26. The polynucleotide of item 26, wherein the polynucleotide is RNA and the RNA is messenger RNA.
(Item 28)
27. The polynucleotide according to item 27, which is chemically modified.
(Item 29)
26. The polynucleotide of item 26, comprising spatiotemporally selected codons.
(Item 30)
27. The polynucleotide of item 27, wherein said polynucleotide encodes at least one additional feature selected from a promoter, linker, signal peptide, tag, cleavage site and targeting peptide.
(Item 31)
25. The polynucleotide of item 25, wherein the chimeric antigen receptor is selected from GD2 CAR, Her2 CAR, BCMA CAR, CD33 CAR, ALK CAR, CD22 CAR, and CD276 CAR.
(Item 32)
The vector comprising the polynucleotide according to any one of items 25 to 31, wherein the at least one immunotherapeutic agent is selected from cytokines, safety switches, regulatory switches, chimeric antigen receptors and combinations thereof.
(Item 33)
32. The vector according to item 32, wherein the vector is a viral vector or plasmid.
(Item 34)
33. The vector of item 33, wherein the vector is a viral vector, the viral vector being a retroviral vector, a lentiviral vector, a gamma retroviral vector, a recombinant AAV vector, an adenoviral vector, or an oncolytic viral vector.
(Item 35)
34. The vector of item 34, wherein the polynucleotide encodes the composition of any of items 1-24.
(Item 36)
Adoptive cell transfer expressing any of the compositions of items 1 to 24, any of the polynucleotides of items 25 to 31, and / or infected or transfected with the vector of any of items 32 to 35 ( Immune cells for ACT).
(Item 37)
The immune cells are CD8 + T cells, CD4 + T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTL), tumor invasive lymphocytes (TIL), memory T cells, and regulatory. 36. The immune cell according to item 36, which is a T (Treg) cell, a cytokine-induced killer (CIK) cell, a dendritic cell, a human embryonic stem cell, a mesenchymal stem cell, a hematopoietic stem cell, or a mixture thereof.
(Item 38)
The SRE is the destabilizing domain DD, and the DD is the human protein FKBP having the amino acid sequence of SEQ ID NO: 3, the DHFR having the amino acid sequence of SEQ ID NO: 1-2, the PDE5 having the amino acid sequence of SEQ ID NO: 4, the sequence. The immune cell of item 36, which is derived from PPARγ having the amino acid sequence of No. 5, CA2 having the amino acid sequence of SEQ ID NO: 6, and NQO2 having the amino acid sequence of SEQ ID NO: 7.
(Item 39)
The DD is derived from the parent protein, the parent protein is hDHFR, and the DDs are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T. , G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47 , N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78 , K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107V, N108D, K109E, K109R, V110 , M112T, M112V, V113A, W114R, I115V, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K13 , F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F145L , D153G, E155G, K156R, Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E172G, E173G, E173K , Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E18 The immune cell of item 38 comprising a mutant protein having at least one mutation selected from 4G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.
(Item 40)
39. The immune cell of item 39, which is self, allogeneic, syngeneic, or heterologous with respect to a particular individual subject.
(Item 41)
A method for reducing a tumor volume or tumor mass of a subject, the composition of any of items 1 to 24, the polynucleotide of any of items 25 to 31, the vector of any of items 32 to 35, or items 36 to 36. The reduction method comprising contacting the subject with any of the 40 immune cells.
(Item 42)
A method of providing an anti-tumor immune response in a subject, wherein an effective amount of the composition of any of items 1 to 24, the polynucleotide of any of items 25 to 31, the vector or item of any of items 32 to 35. The providing method comprising administering to said subject any immune cell of 36-40.
(Item 43)
A method of inducing an immune response in a subject, in an effective amount, the composition of any of items 1-24, the polynucleotide of any of items 25-31, the vector of any of items 32-35 or 36-35. The induction method comprising administering to the subject any of the 40 immune cells.
(Item 44)
A method of preventing or reversing T cell depletion in a subject in need thereof, wherein the method is a therapeutically effective amount of the composition of any of items 1-24, poly of any of items 25-31. Containing the administration of a nucleotide, any vector of items 32 to 35, or immune cells of any of items 36 to 40 to said subject, said SRE responds to stimuli and expresses and / or functions of an immunotherapeutic agent. The prophylactic or reversal method, wherein T cell depletion is prevented or reversed.
(Item 45)
44. The method of item 44, wherein the immunotherapeutic agent is a chimeric antigen receptor.
(Item 46)
45. The method of item 45, wherein the chimeric antigen receptor is GD2 CAR, BCMA CAR, CD33 CAR, Her2 CAR, ALK CAR, CD22 CAR, or CD276 CAR.
(Item 47)
A method of detecting the presence of cancer in mammals
(A) A sample containing one or more cells derived from the mammal is subjected to the composition of any of items 1 to 24, the polynucleotide of any of items 25 to 31, the vector of any of items 32 to 35, or. A step of contacting with an immune cell according to any one of items 36 to 40, and (b) a step of detecting a complex, wherein the detection of the complex indicates the presence of the cancer in the mammal. The detection method including.

Claims (1)

The invention described in the specification.

Images