JP2020156354A - Nucleic acid-capturing sensor, nucleic acid detection cartridge, and nucleic acid detection kit - Google Patents

Abstract

To provide a nucleic acid-capturing sensor that has high reliability of measurement result in detection of double stranded nucleic acid, and is capable of detecting a measurement error.SOLUTION: A nucleic acid-capturing sensor 100 comprises: a first sensor element 1 and a second sensor element 2; a first capturing probe 4 which is arranged on the first sensor element 1, and has a first sequence complementary to at least a part of a base sequence of first single stranded nucleic acid constituting target double stranded nucleic acid; and a second capturing probe 5 which is arranged on the second sensor element, and has a second sequence complementary to at least a part of a base sequence of second single stranded nucleic acid constituting the target double stranded nucleic acid.SELECTED DRAWING: Figure 2

Description

The present invention relates to a nucleic acid capture sensor, and a nucleic acid detection cartridge and a nucleic acid detection kit including the nucleic acid capture sensor.

In recent years, a substrate for nucleic acid detection for measuring the presence / absence, concentration, base sequence, etc. of double-stranded nucleic acid present in body fluid such as blood has been developed for the purpose of diagnosing a disease.

Patent Document 1 describes a step of modifying a double-stranded nucleic acid into a single-stranded nucleic acid by using a substrate provided with a capture probe nucleic acid as a method for detecting the double-stranded nucleic acid. A method including a step of hybridizing a capture probe nucleic acid, a step of adding a labeling substance such as fluorescence to a single-stranded nucleic acid, and a step of obtaining a detection signal from the labeling substance are disclosed. According to this, it is possible to obtain information such as the presence / absence, concentration, and base sequence of double-stranded nucleic acid by obtaining a detection signal from the labeling substance. Further, in Patent Document 1, as a method for detecting a double-stranded nucleic acid, a method for hybridizing a double-stranded nucleic acid and a capture probe nucleic acid with high efficiency by using a substrate provided with two types of capture probe nucleic acids. Has been proposed. According to this, one of the two types of capture probe nucleic acids on the substrate is complementary to one of the two types of single-stranded nucleic acids contained in the double-stranded nucleic acid, and is provided on the chip2. The other of the types of capture probe nucleic acids is complementary to the other of the two types of single-stranded nucleic acids contained in the double-stranded nucleic acids. Therefore, both of the two types of single-stranded nucleic acids contained in the double-stranded nucleic acid are provided with an opportunity to hybridize with the capture probe nucleic acid. Therefore, it is possible to hybridize with the capture probe nucleic acid with high efficiency.

Japanese Unexamined Patent Publication No. 2003-159058

In the method described in Patent Document 1, it is expected that a large detection signal can be obtained due to the high hybridization efficiency between the double-stranded nucleic acid and the capture probe nucleic acid, but the obtained detection signal is one type of two. It is one type for main-stranded nucleic acids. In terms of the reliability of the diagnosis, it is statistically advantageous to obtain as much information as possible in one measurement. In general, diagnosis by measuring double-stranded nucleic acids contained in body fluids such as blood is still in the research stage, and is used for biopsy diagnosis in which materials are collected from living tissues and organs for inspection. By comparison, it is less reliable and has room for improvement.

The present invention has been made in view of the above circumstances, and a nucleic acid capture sensor capable of detecting abnormalities in measurement with high reliability of measurement results in detection of double-stranded nucleic acid, and the nucleic acid capture sensor. A nucleic acid detection cartridge and a nucleic acid detection kit are provided.

That is, the present invention includes the following aspects.
(1) At least a part of the base sequence of the first single-stranded nucleic acid, which is arranged on the first sensor element and the second sensor element and the first sensor element and constitutes the target double-stranded nucleic acid. A first capture probe having a first sequence complementary to the above, and at least the base sequence of the second single-stranded nucleic acid arranged on the second sensor element and constituting the target double-stranded nucleic acid. A nucleic acid capture sensor comprising a second capture probe having a second sequence that is partially complementary.
(2) The nucleic acid capture sensor according to (1), wherein the first sensor element and the second sensor element are magnetic sensor elements.
(3) A nucleic acid detection cartridge including the nucleic acid capture sensor according to (2) and magnetic beads.
(4) A first labeled probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having the magnetic beads, and the second one. The first sequence and the third sequence include a second labeled probe having a fourth sequence complementary to at least a part of the base sequence of the chain nucleic acid and having the magnetic beads. The nucleic acid detection cartridge according to (3), wherein the second sequence and the fourth sequence are different sequences from each other.
(5) A third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid, and a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid. The first sequence and the third sequence are different sequences from each other, and the second sequence and the fourth sequence are different from each other, and the labeled probe having the magnetic beads is provided. The nucleic acid detection cartridge according to (3), which is a sequence.
(6) The nucleic acid detection cartridge according to (3), wherein the magnetic beads have avidin or streptavidin.
(7) A first probe with biotin having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having biotin, and the second single-stranded nucleic acid. A second biotinated probe having a fourth sequence complementary to at least a part of the base sequence of the nucleic acid and having biotin is further provided, and the first sequence and the third sequence are mutual. The nucleic acid detection cartridge according to (6), wherein the second sequence and the fourth sequence are different sequences from each other.
(8) A nucleic acid detection kit comprising the nucleic acid capture sensor according to (2) and magnetic beads.
(9) A first labeled probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having the magnetic beads, and the second one. The first sequence and the third sequence include a second labeled probe having a fourth sequence complementary to at least a part of the base sequence of the chain nucleic acid and having the magnetic beads. The nucleic acid detection kit according to (8), wherein the second sequence and the fourth sequence are different sequences from each other.
(10) A third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid, and a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid. The first sequence and the third sequence are different sequences from each other, and the second sequence and the fourth sequence are different from each other, and the labeled probe having the magnetic beads is provided. The nucleic acid detection kit according to (8), which is a sequence.
(11) The nucleic acid detection kit according to (8), wherein the magnetic beads have avidin or streptavidin.
(12) A first probe with biotin having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having biotin, and the second single-stranded nucleic acid. A second biotinated probe having a fourth sequence complementary to at least a part of the base sequence of the nucleic acid and having biotin is further provided, and the first sequence and the third sequence are mutual. The nucleic acid detection kit according to (11), wherein the second sequence and the fourth sequence are different sequences from each other.

According to the nucleic acid capture sensor of the above aspect, it is possible to provide a nucleic acid capture sensor capable of detecting an abnormality in the measurement with high reliability of the measurement result in the detection of the double-stranded nucleic acid.

It is a perspective view which shows typically the nucleic acid capture sensor which concerns on one Embodiment of this invention. It is sectional drawing which shows typically the nucleic acid capture sensor which concerns on one Embodiment of this invention. It is a figure which shows the state of dissociation and binding by heating and cooling of a target double-stranded nucleic acid schematically. It is a figure which shows typically the state of binding of the nucleic acid capture sensor which concerns on one Embodiment of this invention, and the target double-stranded nucleic acid. It is a figure which shows typically the labeled probe used for the detection method of the target double-stranded nucleic acid which concerns on 1st Embodiment of this invention. It is a figure which shows the state of binding of the labeled probe, the target double-stranded nucleic acid, and the capture probe shown in FIG. 5 schematically. It is a figure which shows typically the labeled probe used for the detection method of the target double-stranded nucleic acid which concerns on the 2nd Embodiment of this invention. It is a figure which shows the state of binding of the labeled probe, the target double-stranded nucleic acid, and the capture probe shown in FIG. 7 schematically. It is a figure which shows typically the state of binding of a magnetic bead, a target double-stranded nucleic acid, and a capture probe in the method for detecting a target double-stranded nucleic acid which concerns on the third embodiment of this invention. It is a figure which shows typically the probe with biotin used for the detection method of the target double-stranded nucleic acid which concerns on 4th Embodiment of this invention. It is a figure which shows the state of binding of the probe with biotin, the target double-stranded nucleic acid, and a capture probe shown in FIG. 10 schematically. It is a figure which shows typically the appearance that the magnetic bead further bound to the complex of the probe with biotin, the target double-stranded nucleic acid, and the capture probe shown in FIG. It is a top view which shows typically the nucleic acid detection cartridge which concerns on one Embodiment of this invention. It is an exploded perspective view of the nucleic acid detection cartridge shown in FIG. It is a figure which shows typically the binding region of two kinds of capture probes and a probe with biotin to the target double-stranded nucleic acid in an Example. It is a figure which shows typically the flow of binding of the target double-stranded nucleic acid, each probe, and a magnetic bead on the nucleic acid capture sensor in an Example. It is a figure which shows typically the binding region of one kind of capture probe and the probe with biotin to the target double-stranded nucleic acid in the comparative example. It is a figure which shows typically the flow of binding of a target double-stranded nucleic acid, each probe, and a magnetic bead on a nucleic acid capture sensor in a comparative example.

≪Nucleic acid capture sensor≫
The nucleic acid capture sensor according to one embodiment of the present invention (hereinafter, may be abbreviated as "the present embodiment") includes two types of sensor elements including a first sensor element and a second sensor element, and a first. It is provided with two types of capture probes consisting of a capture probe of the above and a second capture probe. The first capture probe is placed on the first sensor element and has a first sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid constituting the target double-stranded nucleic acid. .. The second capture probe is placed on the second sensor element and has a second sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid constituting the target double-stranded nucleic acid. Have.

By having the above configuration, the nucleic acid capture sensor of the present embodiment can obtain two types of detection signals for one type of target double-stranded nucleic acid in the sample in detecting the target double-stranded nucleic acid in the sample. Therefore, the reliability of the measurement result is improved. Further, as shown in Examples described later, for example, by using the ratio of two types of detection signals, it is possible to detect an abnormality in measurement.

The "target double-stranded nucleic acid" to be detected is not particularly limited, and examples thereof include genomic DNA, cell-free DNA, double-stranded RNA, and DNA-RNA hybrid strand. Further, the target double-stranded nucleic acid may be fragmented using ultrasonic waves, restriction enzymes, or the like, or may be an amplification product by PCR or the like. Further, the target double-stranded nucleic acid may be one in which biotin or the like is added to the 5'end or the 3'end. Further, the target double-stranded nucleic acid may be composed of only an artificial nucleic acid, or may be a naturally-derived nucleic acid or a chimeric nucleic acid of a synthesized nucleic acid and an artificial nucleic acid. Examples of the artificial nucleic acid include LNA (Locked Nucleic Acid), BNA (Bridged Nucleic Acid) and the like.
The sample containing the target double-stranded nucleic acid may be a body fluid sample or a solution (buffer solution or the like) in which the target double-stranded nucleic acid is dissolved. Examples of body fluid samples include blood, serum, plasma, urine, puffy coat, saliva, semen, chest exudate, cerebrospinal fluid, tears, sputum, mucus, lymph, ascites, pleural effusion, sheep water, bladder lavage fluid, and bronchial lung. Examples thereof include plasma lavage fluid, cell extract, and cell culture supernatant. As the sample containing the target double-stranded nucleic acid, these body fluid samples may be used as they are, or a nucleic acid extract obtained by extracting nucleic acid from the body fluid sample may be used.

<Structure of nucleic acid capture sensor>
The structure of the nucleic acid capture sensor of the present embodiment will be described below with reference to the drawings. In addition, in the figure used in the following description, in order to make it easy to understand the features of the present invention, the main part may be enlarged for convenience, and the dimensional ratio and the like of each component are the same as the actual ones. Is not always the case.

FIG. 1 is a perspective view schematically showing a nucleic acid capture sensor according to an embodiment of the present invention.
As shown in FIG. 1, the nucleic acid capture sensor 100 of the present embodiment has a substrate 3, and the first sensor element 1 and the second sensor element 2 are arranged apart from each other in the in-plane direction of the substrate. The first sensor element 1 and the second sensor element 2 are configured to be connectable to the outside via wiring 51 and wiring 52, respectively.

FIG. 2 is a cross-sectional view schematically showing a nucleic acid capture sensor according to an embodiment of the present invention, and is a cross-sectional view of II-II'of the nucleic acid capture sensor shown in FIG.
The nucleic acid capture sensor 100 is used to capture the first single-stranded nucleic acid and the second single-stranded nucleic acid constituting the target double-stranded nucleic acid.
As shown in FIG. 2, in the nucleic acid capture sensor 100, the first sensor element 1 and the second sensor element 2 are arranged in the substrate 3, and the first capture probe is placed on the first sensor element 1. 4 is arranged, and the second capture probe 5 is arranged on the second sensor element 2. The first capture probe 4 contains a nucleic acid 4a consisting of a first sequence complementary to at least a part of the first single-stranded nucleic acid constituting the target double-stranded nucleic acid. The second capture probe 5 contains a nucleic acid 5a consisting of a second sequence complementary to at least a part of the second single-stranded nucleic acid constituting the target double-stranded nucleic acid. Further, in the substrate 3 shown in FIG. 2, the support 3a and the protective film 3b are laminated in this order.

Next, a method for capturing the target double-stranded nucleic acid using the nucleic acid capture sensor 100 will be described below.
FIG. 3 is a diagram schematically showing the state of dissociation and binding of the target double-stranded nucleic acid by heating and cooling. As shown in FIG. 3, the target double-stranded nucleic acid 6 is dissociated into the first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b by heating, and reassociates by cooling. (Annealing) to return to double-stranded nucleic acid.

FIG. 4 is a diagram schematically showing a state of binding between the nucleic acid capture sensor and the target double-stranded nucleic acid according to the embodiment of the present invention.
As shown in FIG. 4, a sample solution containing the target double-stranded nucleic acid immediately after heating (dissociated into the first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b) is applied to the nucleic acid capture sensor 100. Upon contact, the first single-stranded nucleic acid 6a binds to the first capture probe 4 via the nucleic acid 4a consisting of the first sequence, and the second single-stranded nucleic acid 6b consists of the second sequence. It binds to the second capture probe 5 via nucleic acid 5a.

The nucleic acid capture sensor according to the present embodiment is not limited to the one shown in FIGS. 1 and 2, and the nucleic acid capture sensor shown in FIGS. 1 and 2 is partially modified or deleted within a range that does not impair its effect. , Other configurations may be added to those described so far.
For example, in the nucleic acid capture sensor shown in FIGS. 1 and 2, the first sensor element 1 and the second sensor element 2 are arranged on the substrate, but the first sensor element 1 and the second sensor element 1 and the second sensor element 2 are illustrated. Depending on the type of the sensor element 2, it may be arranged on the surface of the substrate.
For example, in the nucleic acid capture sensor shown in FIGS. 1 and 2, the case where the first sensor element and the second sensor element are provided one by one is illustrated, but the nucleic acid capture sensor includes the first sensor element and the second sensor element. Two or more sensor elements may be provided for each.
Further, for example, the nucleic acid capture sensor shown in FIGS. 1 and 2 illustrates the case of capturing one type of target double-stranded nucleic acid, but the nucleic acid capture sensor captures two or more types of target double-stranded nucleic acids. May be provided with a set of a plurality of types of first capture probe and second capture probe corresponding to the base sequence of the target double-stranded nucleic acid.

<First sensor element and second sensor element>
The first sensor element 1 and the second sensor element 2 are configured to output as independent sensor elements. That is, the output of the first sensor element 1 and the output of the second sensor element 2 are independent of each other.
The first sensor element and the second sensor element are not particularly limited as long as they can detect the binding of the first single-stranded nucleic acid and the second double-stranded nucleic acid, respectively. For example, a nucleic acid capture sensor. When a magnetic sensor is used, a magnetic sensor element can be used as the first sensor element and the second sensor element. Further, for example, when the nucleic acid capture sensor uses a surface charge detection type sensor, a field effect transistor (FET) can be used as the first sensor element and the second sensor element. For example, when the nucleic acid capture sensor utilizes a surface plasmon resonance (SPR) sensor, a light receiving element can be used as the first sensor element and the second sensor element. For example, when the nucleic acid capture sensor utilizes a current detection type sensor, electrodes can be used as the first sensor element and the second sensor element. Among them, as the first sensor element and the second sensor element, the detection signal increases according to the number of bound magnetic beads, and the concentration of the target double-stranded nucleic acid can be quantified with high accuracy. Is preferable.
As the magnetic sensor element, for example, a magnetoresistive effect element can be used. The magnetoresistive element is not particularly limited as long as it is an element that utilizes the phenomenon that the electric resistance value changes under the influence of a magnetic field, and the magnetization fixing layer having a magnetization direction fixed in a certain direction in the laminated surface and the outside It is preferable that the element is provided with a magnetization free layer whose magnetization direction changes according to a magnetic field. Further, in the magnetoresistive sensor, the magnetization fixing direction of the magnetization fixing layer is substantially parallel or substantially antiparallel to the magnetic field applied for exciting the magnetic beads, and is in the film surface direction of the magnetic resistance effect element. It is preferable to have.
In the present specification, "substantially parallel or substantially antiparallel" may be approximately parallel or antiparallel, and may be deviated within a range of 0.1 ° or more and 10 ° or less.
Further, the magnetoresistive sensor includes a magnetization fixing layer, an intermediate layer made of a non-magnetic conductor or an insulator, and a magnetization free layer, and is a laminate in which the intermediate layer is sandwiched between the magnetization fixing layer and the magnetization free layer. It is more preferable to have.
When the intermediate layer is a non-magnetic conductor, the magnetoresistive element is generally called a GMR element (giant magnetoresistive element), and when the intermediate layer is a non-magnetic insulator, a TMR element (tunnel-type magnetoresistive effect). It is called an element). The electrical resistance value of the magnetoresistive sensor changes according to the angle between the magnetization direction of the magnetization fixed layer and the average magnetization direction of the magnetization free layer.
The shape of the magnetoresistive element is not particularly limited, but it preferably has a meander structure.

The magnetization free layer is composed of, for example, a soft magnetic film such as a NiFe alloy. The intermediate layer is composed of, for example, a conductor film such as Cu or an insulator film such as aluminum oxide or magnesium oxide.
One surface of the magnetized fixed layer is in contact with the antiferromagnetic film, and the other surface is in contact with the mesosphere. The antiferromagnetic film is composed of, for example, an antiferromagnetic Mn alloy such as IrMn or PtMn. The magnetization fixing layer may be composed of, for example, a ferromagnet such as a CoFe alloy or a NiFe alloy, or may have a structure in which a thin film layer of Ru is sandwiched between ferromagnets such as a CoFe alloy or a NiFe alloy.

<First capture probe and second capture probe>
The first capture probe has a first sequence complementary to at least a portion of the base sequence of the first single-stranded nucleic acid.
The second capture probe has a second sequence that is complementary to at least a portion of the base sequence of the second single-stranded nucleic acid.
The lower limit of the number of bases in the first sequence and the second sequence is, for example, 10 bases, preferably 15 bases, and more preferably 20 bases. On the other hand, the upper limit of the number of bases in the first sequence and the second sequence is, for example, 150 bases, preferably 100 bases, more preferably 50 bases.
As shown in FIG. 2, it is preferable that the first capture probe and the second capture probe are respectively immobilized on the substrate. These capture probes may have an immobilized 3'end or an immobilized 5'end. Further, from the viewpoint of ensuring a molecular degree of freedom for each capture probe to bind to each single-stranded nucleic acid, a spacer may be provided at the end on the side immobilized on the substrate. When the spacer is composed of nucleic acid, the lower limit of the number of bases is not particularly limited, but is, for example, 1 base, preferably 3 bases. On the other hand, the upper limit of the number of bases of the spacer is not particularly limited, but is, for example, 50 bases, preferably 30 bases. Further, the spacer may be composed of a linker compound such as polyethylene glycol instead of nucleic acid.

The first capture probe and the second capture probe may be composed of DNA, RNA, or a combination thereof. Further, an artificial nucleic acid may be contained from the viewpoint of suppressing degradation by a DNA-degrading enzyme or an RNA-degrading enzyme.

Examples of the method of immobilizing the capture probe on the substrate include a method using photolithography technology and a solid-phase chemical reaction, a method of dropping a solution containing the capture probe onto the substrate, and the like. In the case of a method using a photolithography technique and a solid phase chemical reaction, each capture probe may be synthesized on a substrate. Further, in the case of a method of dropping a solution containing a trapping probe onto the substrate and immobilizing it, a functional group for immobilizing the solution on the substrate at the 3'end or 5'end of the capture probe (hereinafter, "fixation") A functional group capable of reacting with an immobilizing group to form a bond (hereinafter, may be abbreviated as "reactive group") is provided on the substrate (sometimes abbreviated as "chemical group"). It is preferable to provide it. Examples of the combination of such an immobilized group and a reactive group include an immobilized group such as an amino group, a formyl group, a thiol group and a succimidyl ester group, and a carboxy group, an amino group, a formyl group, an epoxy group and a maleimide group. Examples thereof include a combination with a reactive group such as, and a combination using a gold-thiol bond.
Further, as another method of dropping the solution containing the capture probe onto the substrate and immobilizing it, for example, a capture probe having a silanol group at the 3'end or the 5'end is made of silica in the portion on the sensor element. Examples thereof include a method of discharging to a substrate, arranging them, and covalently bonding them by a silane coupling reaction.

<Method for detecting target double-stranded nucleic acid>
The method for detecting the target double-stranded nucleic acid using the nucleic acid capture sensor of the present embodiment will be described in detail below.
When the nucleic acid capture sensor of the present embodiment uses a magnetic sensor, the target nucleic acid can be detected using magnetic beads.

Magnetic beads are, for example, those containing magnetic particles in beads formed of an organic material. As the magnetic particles, those exhibiting ferromagnetism or those exhibiting superparamagnetism can be used, but those exhibiting superparamagnetism are preferable. For example, polystyrene beads containing a plurality of iron oxide particles in the core can be mentioned. Each of the iron oxide particles contained in the core has a particle size of 100 nm or less and exhibits superparamagnetism. The diameter of the magnetic beads depends on the area of the protective film, but is preferably 0.01 μm or more and 1 μm or less, for example.
The surface of the magnetic beads may be coated with a polymer or a silica matrix. Since the nucleic acid is hydrophilic, the surface of the magnetic beads is preferably hydrophilic.

When the nucleic acid capture sensor of the present embodiment utilizes a magnetic sensor, magnetic beads configured to directly or indirectly bind to the single-stranded nucleic acid can be used.

[First Embodiment]
FIG. 5 is a diagram schematically showing a labeled probe used in the method for detecting a target double-stranded nucleic acid according to the first embodiment of the present invention. As shown in FIG. 5, the first labeled probe 10 contains a nucleic acid 10a consisting of a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid, and contains magnetic beads 12. Have. The second labeled probe 11 contains a nucleic acid 11a consisting of a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid, and has magnetic beads 12. The method of binding the magnetic beads 12 to the nucleic acids 10a and 11a is not particularly limited, and examples thereof include known bonds such as coordination bond, covalent bond, hydrogen bond, hydrophobic interaction, physical adsorption, and affinity bond. , It may be indirectly bonded via a linker or the like. Specific binding methods include, for example, binding by covalent bonding between functional groups existing on the surface of magnetic beads and nucleic acids 10a and 11a, magnetic beads 12 having avidin or streptavidin, and nucleic acids 10a and 11a having biotin. Examples thereof include binding due to the interaction between avidin or streptavidin and biotin. When the first labeled probe 10 and the second labeled probe 11 are used, the presence of free single-stranded nucleic acid in the measurement system leads to a decrease in measurement accuracy, and thus captures the single-stranded nucleic acid. After binding to the probe, the free single-stranded nucleic acid is removed by a step such as washing, and the first labeled probe 10 and the second labeled probe 11 are bound to the complex of the single-stranded nucleic acid and the capture probe. It is preferable to make it. In the following embodiments, it is preferable to carry out the binding reaction in the same order.

FIG. 6 is a diagram schematically showing the state of binding between the labeled probe shown in FIG. 5, the target double-stranded nucleic acid, and the capture probe. The same reference numerals are given to the configurations common to the following drawings, and the description thereof will be omitted.
As shown in FIG. 6, the first single-stranded nucleic acid 6a binds to the first labeled probe 10 and the first capture probe 4, and the second single-stranded nucleic acid 6b binds to the second labeled probe 11 and the second labeled probe 11. A first labeled probe 10, a second labeled probe 11, a first capture probe 4 and a second capture probe 5 are configured to bind to the second capture probe 5. The first single-stranded nucleic acid 6a binds to the nucleic acid 10a contained in the first labeled probe 10, and the second single-stranded nucleic acid 6b binds to the nucleic acid 11a contained in the second labeled probe 11. The first single-stranded nucleic acid 6a binds preferentially to the first capture probe 4 over the second capture probe 5, and the second single-stranded nucleic acid 6b binds to the first capture probe 4 more preferentially than the first capture probe 4. It preferentially binds to the second capture probe 5.

When the second capture probe 5 has a base sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid 6a, the first single-stranded nucleic acid 6a is used as the second capture probe. In order to preferentially bind to the first trapped probe 4 over 5, the specific association conditions between the first single-stranded nucleic acid 6a and the first trapped probe 4 and the first single-stranded nucleic acid 6a It is preferable that the specific associative condition between and the second capture probe 5 is different. The specific association conditions depend on the type and length of the base sequence of the target nucleic acid molecule and the nucleic acid probe. Therefore, it is preferable to design the first capture probe 4 and the second capture probe 5 so that the specific association conditions are different.

Specifically, the specific association conditions between the single-stranded nucleic acid and the capture probe can be determined from the melting curve. Since the formation of aggregates generally depends on temperature conditions and salt concentration conditions, the temperature of the solution containing only the capture probe and single-stranded nucleic acid is changed from high temperature to low temperature, and the absorbance of the solution is measured. Therefore, the melting curve can be obtained. From the obtained melting curve, the temperature conditions range from the temperature at which the capture probe existing in the single-stranded state began to form an aggregate with the single-stranded nucleic acid to the temperature at which almost all of the captured probe became an aggregate. Can be a specific meeting condition. By changing the salt concentration in the solution from a low concentration to a high concentration instead of the temperature, the melting curve can be determined in the same manner and the specific association conditions can be obtained.

As described above, the specific association conditions differ depending on the type of single-stranded nucleic acid or capture probe and are determined experimentally, but in general, the Tm value (melting temperature) can be substituted. For example, by using a general-purpose primer / probe design software or the like, the Tm value of the region having a base sequence complementary to the single-stranded nucleic acid (50% of the double-stranded DNA) can be obtained from the base sequence information of the capture probe. The temperature at which it dissociates into single-stranded DNA) can be calculated.

In order to bind the first single-stranded nucleic acid 6a preferentially to the first capture probe 4 over the second capture probe 5, the first single-stranded nucleic acid 6a and the first capture probe 4 are combined. The Tm value of the aggregate is preferably higher than the Tm value of the aggregate of the first single-stranded nucleic acid 6a and the second capture probe 5, more preferably 3 ° C. or higher, and 5 ° C. or higher. Is more preferable, and it is particularly preferable that the temperature is 10 ° C. or higher. As a result, the second capture probe 5 can be more easily dissociated from the first single-stranded nucleic acid 6a than the first capture probe 4.
Similar to the above, in order to bind the second single-stranded nucleic acid 6b to the second trapped probe 5 in preference to the first trapped probe 4, the second single-stranded nucleic acid 6b and the second The Tm value of the aggregate with the capture probe 5 is preferably higher than the Tm value of the aggregate of the second single-stranded nucleic acid 6b and the first capture probe 4, and more preferably 3 ° C. or more. It is more preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. As a result, the first capture probe 4 can be more easily dissociated from the second single-stranded nucleic acid 6b than the second capture probe 5.

When the second capture probe 5 has a complementary base sequence with respect to at least a part of the base sequence of the first single-stranded nucleic acid 6a, the number of bases in the complementary sequence is 9 bases or less. Is preferable, and 5 bases or less is more preferable. When the first capture probe 4 has a complementary base sequence with respect to at least a part of the base sequence of the second single-stranded nucleic acid 6b, the number of bases in the complementary sequence is 9 bases or less. Is preferable, and 5 bases or less is more preferable.

From the viewpoint of preventing the binding regions of the first labeled probe 10 and the first capture probe 4 for the first single-stranded nucleic acid 6a from overlapping, the first sequence and the third sequence are different sequences from each other. The second sequence and the fourth sequence are different sequences from each other from the viewpoint that the binding regions of the second labeled probe 11 and the second capture probe 5 to the second single-stranded nucleic acid 6b do not overlap. Is preferable.
Further, among the base sequences of the first single-stranded nucleic acid 6a, it is more preferable that the sequence complementary to the first sequence and the sequence complementary to the third sequence do not have overlapping sequences. , Of the base sequences of the second single-stranded nucleic acid, it is more preferable that the sequence complementary to the second sequence and the sequence complementary to the fourth sequence do not have overlapping sequences.
Similarly, it is preferable that the various probes used in the respective embodiments described later have the above configuration.

Further, from the viewpoint of preventing the first labeled probe 10 and the second labeled probe 11 from binding to each other and reducing the utilization efficiency of the labeled probe, the first labeled probe 10 and the second labeled probe 11 complement each other. Tm value of the aggregate of the first labeled probe 10 and the first single-stranded nucleic acid 6a and the aggregate of the second labeled probe 11 and the second single-stranded nucleic acid 6b. The Tm value is preferably higher than the Tm value of the aggregate of the first labeled probe 10 and the second labeled probe 11, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and 10 It is particularly preferable that the temperature is higher than ° C. When the first labeled probe 10 and the second labeled probe 11 have sequences complementary to each other, the number of bases in the complementary sequences is preferably 9 bases or less, and more preferably 5 bases or less. preferable.

It is more preferred that the first labeled probe 10 and the second labeled probe 11 do not have sequences that hybridize to each other under measurement conditions. As used herein, "does not have a sequence that hybridizes under measurement conditions" means that probes such as the first labeled probe 10 and the second labeled probe 11 are associated with each other under measurement conditions of the target double-stranded nucleic acid. Means not. It is also used with the same meaning in various probes described later.

Further, it is prevented that the first labeled probe 10 and the second labeled probe 11 bind to the first capture probe 4 and the second capture probe 5 to reduce the detection efficiency of the target double-stranded nucleic acid. From the viewpoint, when the first labeled probe 10 has a complementary base sequence to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the first labeled probe 10 The Tm value of the aggregate of the first single-stranded nucleic acid 6a and the first labeled probe 10 is the Tm value of the aggregate of the first labeled probe 10 and the first capture probe 4, and the first labeled probe 10 and the second capture probe 4. It is preferably higher than the Tm value of the aggregate with the probe 5, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. Further, when the second labeled probe 11 has a complementary base sequence to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the second labeled probe 11 and the second labeled probe 11 The Tm value of the aggregate with the second single-stranded nucleic acid 6b is the Tm value of the aggregate of the second labeled probe 11 and the first capture probe 4, and the second labeled probe 11 and the second capture probe. It is preferably higher than the Tm value of the aggregate with 5, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. By doing so, it is possible to suppress the binding of the first labeled probe 10 and the second labeled probe 11 to the first capture probe 4 and the second capture probe 5. When the first labeled probe 10 has a complementary base sequence to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the number of bases in the complementary sequence is It is preferably 9 bases or less, and more preferably 5 bases or less. When the second labeled probe 11 has a complementary base sequence with respect to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the bases of the complementary sequences are used. The number is preferably 9 bases or less, and more preferably 5 bases or less. It is more preferable that neither the first labeled probe nor the second labeled probe has a sequence that hybridizes under the measurement conditions with respect to the first capture probe and the second capture probe.

The lower limit of the number of bases in the third sequence and the fourth sequence is, for example, 10 bases, preferably 15 bases, and preferably 20 bases. On the other hand, the upper limit of the number of bases in the third sequence and the fourth sequence is, for example, 150 bases, preferably 100 bases, more preferably 50 bases.

The first labeled probe and the second labeled probe may be composed of DNA, RNA, or a combination thereof. Further, an artificial nucleic acid may be contained from the viewpoint of suppressing degradation by a DNA-degrading enzyme or an RNA-degrading enzyme.

[Second Embodiment]
FIG. 7 is a diagram schematically showing a labeled probe used in the method for detecting a target double-stranded nucleic acid according to the second embodiment of the present invention. The labeled probe 13 shown in FIG. 7 differs from the labeled probe shown in FIG. 5 in that one magnetic bead 12 is bound to a nucleic acid 10a composed of a third sequence and a nucleic acid 11a composed of a fourth sequence. With this configuration, the target double-stranded nucleic acid can be detected with one type of labeled probe.

FIG. 8 is a diagram schematically showing the state of binding between the labeled probe shown in FIG. 7, the target double-stranded nucleic acid, and the capture probe.
As shown in FIG. 8, the second single-stranded nucleic acid 6b binds to the labeled probe 13 and the second capture probe 4 so that the first single-stranded nucleic acid 6a binds to the labeled probe 13 and the first capture probe 4. A labeled probe 13, a first capture probe 4 and a second capture probe 5 are configured to bind to 5. The first single-stranded nucleic acid 6a binds to the nucleic acid 10a contained in the labeled probe 13, and the second single-stranded nucleic acid 6b binds to the nucleic acid 11a contained in the labeled probe 13.

Further, from the viewpoint of preventing the labeled probes 13 from binding to each other and reducing the utilization efficiency of the labeled probes, when the labeled probes 13, that is, the nucleic acids 10a and 11a have sequences complementary to each other, the nucleic acids 10a and The Tm value of the aggregate with the first single-stranded nucleic acid 6a and the Tm value of the aggregate of the nucleic acid 11a and the second single-stranded nucleic acid 6b are higher than the Tm value of the aggregate of the nucleic acid 10a and the nucleic acid 11a. It is preferably high, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. By doing so, it is possible to suppress the binding of the labeled probes 13 to each other. When the labeled probes 13, that is, the nucleic acids 10a and 11a have sequences complementary to each other, the number of bases in the complementary sequences is preferably 9 bases or less, and more preferably 5 bases or less. .. It is more preferable that the labeled probes 13, that is, nucleic acids 10a and 11a do not have sequences that hybridize under measurement conditions.

Further, from the viewpoint of preventing the labeled probe 13 from binding to the first capture probe 4 and the second capture probe 5 to reduce the detection efficiency of the target double-stranded nucleic acid, the first capture probe 4 and the second capture probe 5 When the labeled probe 13, that is, the nucleic acid 10a and the nucleic acid 11a have complementary base sequences to at least a part of the base sequence of each of the second capture probes 5, the nucleic acid 10a and the first single-stranded nucleic acid 6a The Tm value of the aggregate and the Tm value of the aggregate of the nucleic acid 11a and the second single-stranded nucleic acid 6b are the Tm value of the aggregate of the nucleic acid 10a and the first capture probe 4, and the Tm value of the nucleic acid 11a and the first. It is preferably higher than the Tm value of the aggregate with the capture probe 4, the aggregate of the nucleic acid 10a and the second capture probe 5, and the Tm value of the aggregate of the nucleic acid 11a and the second capture probe 5. 3 It is more preferably higher than ° C., further preferably higher than 5 ° C., and particularly preferably higher than 10 ° C. By doing so, it is possible to suppress the binding of the labeled probe 13 to the first capture probe 4 and the second capture probe 5. When the labeled probe 13 has a base sequence complementary to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the number of bases in the complementary sequence is 9 bases or less. It is preferably 5 bases or less, and more preferably 5 bases or less. It is more preferable that the labeled probe 13 does not have a sequence that hybridizes under the measurement conditions with respect to the first capture probe and the second capture probe.

[Third Embodiment]
FIG. 9 is a diagram schematically showing the state of binding between the target double-stranded nucleic acid and the magnetic beads in the method for detecting the target double-stranded nucleic acid according to the third embodiment of the present invention. In FIG. 9, the magnetic beads 12 have avidin or streptavidin 15 instead of the nucleic acid 10a consisting of the third sequence and the nucleic acid 11a consisting of the fourth sequence, and biotin 14 is bound to the end of the target double-stranded nucleic acid. This is different from the state of bonding shown in FIG. By having the above structure, the magnetic beads can be reliably bound to the first single-stranded nucleic acid or the second single-stranded nucleic acid through the interaction between biotin and avidin or streptavidin.
As shown in FIG. 9, the magnetic beads 12 having avidin or streptavidin 15 detect the first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b having biotin 14 at the 5'end or 3'end. It can be used when That is, the magnetic beads 12 having avidin or streptavidin 15 bind directly to the first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b having biotin 14 at the 5'end or 3'end. It is configured in. The first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b having biotin 14 at the 5'end or 3'end are, for example, primers having biotin at the end, using the target double-stranded nucleic acid as a sample. It can be obtained by performing PCR or the like using a set.

[Fourth Embodiment]
FIG. 10 is a diagram schematically showing a probe with biotin used in the method for detecting a target double-stranded nucleic acid according to a fourth embodiment of the present invention. As shown in FIG. 10, the first probe 16 with biotin contains nucleic acid 10a consisting of the third sequence and has biotin 14. The second probe 17 with biotin contains nucleic acid 11a consisting of the fourth sequence and has biotin 14. The fourth embodiment can be preferably used when it is difficult to directly add biotin to the target double-stranded nucleic acid by using a probe with biotin.

FIG. 11 is a diagram schematically showing the binding state of the biotin-attached probe, the target double-stranded nucleic acid, and the capture probe shown in FIG. FIG. 11 differs from the binding state shown in FIG. 9 in that a probe with biotin is used instead of the target double-stranded nucleic acid with biotin.
As shown in FIG. 11, the first single-stranded nucleic acid 6a binds to the first biotin-attached probe 16 and the first capture probe 4, and the second single-stranded nucleic acid 6b binds to the second biotin-attached probe 17. A first probe with biotin 16, a second probe with biotin 17, a first capture probe 4 and a second capture probe 5 are configured so as to bind to the second capture probe 5.

Further, from the viewpoint of preventing the first probe with biotin 16 and the second probe with biotin 17 from binding to reduce the utilization efficiency of the probe with biotin, the probe 16 with biotin and the probe with second biotin are prevented. When 17 has sequences complementary to each other, the Tm value of the aggregate of the first biotin-attached probe 16 and the first single-stranded nucleic acid 6a and the second biotin-attached probe 17 and the second single-stranded nucleic acid The Tm value of the aggregate with the nucleic acid 6b is preferably higher than the Tm value of the aggregate of the probe 16 with the first biotin and the probe 17 with the second biotin, and more preferably 3 ° C. or higher. It is more preferably higher than ° C., and particularly preferably higher than 10 ° C. By doing so, it is possible to suppress the binding of the first probe 16 with biotin and the second probe 17 with biotin. When the first probe 16 with biotin and the second probe 17 with biotin have sequences complementary to each other, the number of bases in the complementary sequences is preferably 9 bases or less, and 5 bases or less. Is more preferable. It is more preferable that the first probe 16 with biotin and the second probe 17 with biotin do not have sequences that hybridize with each other under measurement conditions.

Further, the first biotin-attached probe 16 and the second biotin-attached probe 17 bind to the first capture probe 4 and the second capture probe 5, and the detection efficiency of the target double-stranded nucleic acid decreases. When the first probe with biotin 16 has a complementary base sequence with respect to at least a part of the base sequences of each of the first capture probe 4 and the second capture probe 5, the first The Tm value of the aggregate of the probe 16 with biotin and the first single-stranded nucleic acid 6a is the Tm value of the aggregate of the probe 16 with biotin and the first capture probe 4 and the probe with biotin. It is preferably higher than the Tm value of the aggregate of 16 and the second capture probe 5, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. When the second probe with biotin 17 has a complementary base sequence with respect to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the second probe with biotin The Tm value of the aggregate of 17 and the second single-stranded nucleic acid 6b is the Tm value of the aggregate of the second biotin-attached probe 17 and the first capture probe 4 and the second biotin-attached probe 17 and the second. It is preferably higher than the Tm value of the aggregate with the second capture probe 5, more preferably 3 ° C. or higher, further preferably 5 ° C. or higher, and particularly preferably 10 ° C. or higher. By doing so, it is possible to suppress the binding of the first probe 16 with biotin and the second probe 17 with biotin to the first capture probe 4 and the second capture probe 5. When the first biotin-attached probe 16 has a complementary base sequence for at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the number of bases in the complementary sequence Is preferably 9 bases or less, and more preferably 5 bases or less. When the second probe 17 with biotin has a complementary base sequence with respect to at least a part of the base sequences of the first capture probe 4 and the second capture probe 5, the complementary sequence of the probe 17 is used. The number of bases is preferably 9 bases or less, and more preferably 5 bases or less. It is more preferable that neither the first probe 16 with biotin nor the second probe 17 with biotin has a sequence that hybridizes with respect to the first capture probe and the second capture probe under the measurement conditions.

FIG. 12 is a diagram schematically showing how magnetic beads are further bound to the complex of the biotin-attached probe, the target double-stranded nucleic acid, and the capture probe shown in FIG.
As shown in FIG. 12, the magnetic beads 12 having avidin or streptavidin 15 are routed through a first biotin-loaded probe 16 or a second biotin-loaded probe 17 having biotin 14 at the 5'end or 3'end. It is configured to indirectly bind to the first single-stranded nucleic acid 6a and the second single-stranded nucleic acid 6b.

In the method for detecting a target double-stranded nucleic acid of the first and second embodiments, binding of the first capture probe and the second capture probe to the first single-stranded nucleic acid and the second single-stranded nucleic acid, The order of binding between the first single-stranded nucleic acid and the second single-stranded nucleic acid and the labeled probe (first labeled probe and second labeled probe) is not particularly limited and may be any order. It is possible, and a plurality of types of bonds may be performed at the same time.

Further, in the method for detecting a target double-stranded nucleic acid according to the third embodiment, the first single-stranded nucleic acid and the second single-stranded nucleic acid having biotin are added to the first capture probe and the second capture probe. The order of binding, the first single-stranded nucleic acid having biotin and the second single-stranded nucleic acid to the magnetic beads having avidin or streptavidin is not particularly limited, and may be any order. Multiple types of bonds may be performed at the same time. Among them, since avidin or streptavidin is easily denatured by heat, magnetic beads having avidin or streptavidin with a first single-stranded nucleic acid having biotin and a second single-stranded nucleic acid after a bond requiring heating. It is preferable to carry out the combination with.

Further, in the method for detecting a target double-stranded nucleic acid according to the fourth embodiment, binding of the first capture probe and the second capture probe to the first single-stranded nucleic acid and the second single-stranded nucleic acid, the first Binding of one probe with biotin and a second probe with biotin to a first single-stranded nucleic acid and a second single-stranded nucleic acid, magnetic beads having avidin or streptavidin and a probe with first biotin and a second The order of binding to the probe with biotin is not particularly limited, and any order may be used, and a plurality of types of binding may be performed at the same time. Among them, since avidin or streptavidin is easily denatured by heat, the magnetic beads having avidin or streptavidin are bound to the first probe with biotin and the second probe with biotin after the binding requiring heating. Is preferable.

<Other configurations>
The nucleic acid capture sensor of the present embodiment may include other configurations in addition to the sensor element and capture probe. Examples of other configurations are shown below.

[substrate]
As shown in FIG. 2, it is preferable that the support and the protective film are laminated in this order on the substrate.

The thickness of the substrate is not particularly limited, but can be, for example, 400 μm or more and 2000 μm or less. When the thickness of the substrate is in such a range, it is possible to obtain a nucleic acid capture sensor having appropriate strength, thinness and weight reduction.
Here, the "thickness of the substrate" means the thickness of the entire substrate, and for example, the thickness of the substrate composed of a plurality of layers means the total thickness of all the layers constituting the substrate.

(Support)
Examples of the material of the support include semiconductors and conductors such as silicon and AlTiC (artic), and insulators such as alumina and glass. The support may be composed of only one of these materials, or may be composed of two or more. Further, the form of the support is not particularly limited.

The support may be composed of one layer (single layer) or may be composed of two or more layers. When the support is composed of a plurality of layers, the plurality of layers may be the same or different from each other, and the combination of the plurality of layers is not particularly limited.

The thickness of the support is not particularly limited, but can be, for example, 400 μm or more and 2000 μm or less.
Here, the "thickness of the support" means the thickness of the entire support, for example, the thickness of the support composed of a plurality of layers is the total thickness of all the layers constituting the support. means.

(Protective film)
The protective film is not particularly limited as long as it can protect the sensor element.
Examples of the material of the protective film include oxides such as alumina, silica, titanium oxide, zirconium oxide, indium oxide, tartar oxide, zinc oxide, gallium oxide and tin oxide; gold, silver, platinum, rhodium, ruthenium, palladium and the like. Noble metals; inorganic substances such as aluminum nitride and silicon nitride; organic substances such as polyimide. The protective film may be composed of only one of these materials, or may be composed of two or more. Further, the form of the protective film is not particularly limited.

The protective film may be composed of one layer (single layer) or may be composed of two or more layers. When the protective film is composed of a plurality of layers, the plurality of layers may be the same or different from each other, and the combination of the plurality of layers is not particularly limited.

The thickness of the protective film can be, for example, 10 nm or more and 1000 nm or less. The thickness of the protective film on the sensor element can be, for example, 1 nm or more and 1000 nm or less.
Here, the "thickness of the protective film" means the thickness of the entire protective film, and for example, the thickness of the protective film composed of a plurality of layers means the total thickness of all the layers constituting the protective film. means.

≪Nucleic acid detection cartridge≫
The nucleic acid detection cartridge of the present embodiment includes the nucleic acid capture sensor and magnetic beads.

According to the nucleic acid detection cartridge of the present embodiment, by providing the nucleic acid capture sensor, in detecting the target double-stranded nucleic acid in the sample, two types of target double-stranded nucleic acids can be detected with respect to one type of target double-stranded nucleic acid in the sample. Since the detection signal is obtained, the reliability of the measurement result is improved. Further, as shown in Examples described later, for example, by using the ratio of two types of detection signals, it is possible to detect an abnormality in measurement.

<Structure of nucleic acid detection cartridge>
The structure of the nucleic acid detection cartridge of the present embodiment will be described below with reference to the drawings. In addition, in the figure used in the following description, in order to make it easy to understand the characteristics of the nucleic acid detection cartridge, the main part may be enlarged for convenience, and the dimensional ratio of each component is actually shown. Not necessarily the same.

13 to 14 are diagrams showing a nucleic acid detection cartridge 200 according to an embodiment of the present invention. FIG. 13 is a plan view schematically showing the nucleic acid detection cartridge 200 according to the embodiment of the present invention. FIG. 14 is an exploded perspective view of the nucleic acid detection cartridge 200 shown in FIG.
As shown in FIG. 13, the nucleic acid detection cartridge 200 includes a nucleic acid capture sensor 100, a sample solution storage unit 101, a washing solution storage unit 102, and a magnetic bead solution (labeled probe solution) storage unit 103.

The sample solution storage unit 101 is configured to inject and store the sample solution 7 containing the target double-stranded nucleic acid. The sample solution storage unit 101 preferably includes an openable and closable upper lid for injecting the sample solution 7.

The cleaning solution 102 and the magnetic bead solution (labeled probe solution) storage unit 103 are configured to store the cleaning solution and the magnetic bead solution (labeled probe solution), respectively. In the magnetic bead solution (labeled probe solution) storage unit 103, for example, a solution containing the first labeled probe 10 and the second labeled probe 11 shown in FIG. 5 described above is stored. In another example, the magnetic bead solution (labeled probe solution) storage unit 103 stores the solution containing the labeled probe 13 shown in FIG. 7 described above. In yet another example, the magnetic bead solution (labeled probe solution) storage unit 103 stores a solution containing the magnetic beads 12 having the avidin or streptavidin 15 shown in FIG. 9 described above. It is preferable that these solutions are stored in a nucleic acid detection cartridge in a sealed state.

As shown in FIG. 14, the nucleic acid detection cartridge 200 includes a base plate 201, a substrate 202 laminated on the base plate 201, and a cover plate 203 mounted on the base plate 201 with the substrate 202 sandwiched therein. There is.

Specifically, the nucleic acid detection cartridge 200 includes a sample solution storage unit 101, a washing solution storage unit 102, a magnetic bead solution (labeled probe solution) storage unit 103, a nucleic acid capture sensor 100, a flow path 104d, and a sample solution storage. A flow path 104a connected to the section 101 and configured to transport the sample solution from the sample solution storage section 101 to the flow path 104d, and a flow path whose both ends are connected to the washing solution storage section 102 and the flow path 104d, respectively. 104b, a flow path 104c whose both ends are connected to a magnetic bead solution (labeled probe solution) storage part 103 and a flow path 104d, respectively, and a flow path 104c connected to a flow path 104d, from each storage part and the flow paths 104a, 104b and 104c. Each solution transported via the flow path 104d is provided on the substrate 202 with a flow path 104e configured to be transportable on the nucleic acid capture sensor 100 and a solution connected to the flow path 104e and passed over the nucleic acid capture sensor 100. It has a flow path 104f configured to be discharged to the drainage pool 107 through the formed hole 106.

In the nucleic acid detection cartridge 200 shown in FIG. 14, the sample solution storage unit 101, the washing solution storage unit 102, the magnetic bead solution (labeled probe solution) storage unit 103, and the flow paths 104a, 104b, 104c, 104d, 104e and 104f are included. It is provided on the cover plate 203, and is provided on the substrate 202 on the nucleic acid capture sensor 100. However, the sample solution storage unit 101, the cleaning solution storage unit 102, the magnetic bead solution (labeled probe solution) storage unit 103, and the flow paths 104a, 104b, 104c, 104d, 104e, and 104f are not limited to this, and the base plate 201 is not limited to this. It may be provided in.

The sample solution storage unit 101, the cleaning solution storage unit 102, and the magnetic bead solution (labeled probe solution) storage unit 103 are provided on the upper surface 203a of the cover plate 203, and the flow paths 104a, 104b, 104c, 104d, 104e, and 104f are provided. Is provided on the lower surface 203b of the cover plate 203. The sample solution storage unit 101, the cleaning solution storage unit 102, and the magnetic bead solution (labeled probe solution) storage unit 103 communicate with the flow paths 104a, 104b, and 104c, respectively, through communication holes (not shown). The nucleic acid detection cartridge 200 is made of, for example, a transparent resin, and the flow paths 104a, 104b and 104c are configured to be visible from the upper surface 203a side of the cover plate 203.

Further, the sample solution storage unit 101, the cleaning solution storage unit 102, and the magnetic bead solution (labeled probe solution) storage unit 103 may be provided with a valve and a pump so as to feed each solution. Alternatively, the sample solution storage unit 101, the washing solution storage unit 102, and the magnetic bead solution (labeled probe solution) storage unit 103 are each subjected to physical pressure from the upper surface outside each storage unit in a sealed state. The solution may be configured to be extruded into the flow path. Specifically, as shown in FIG. 14, the sample solution storage unit 101, the cleaning solution storage unit 102, and the magnetic bead solution (labeled probe solution) storage unit 103 are respectively cap members 101a and 102a formed of elastic members. And 103a are detachably attached. For example, with the cap member 101a attached to the sample solution storage section 101, the sample solution is injected and stored in the sample solution storage section 101 using an instrument such as a syringe, and then the cap member 101a is pressed to obtain the sample solution. The sample solution in the reservoir 101 is supplied to the flow paths 104a, 104d and 104e. The same applies to the case where the solution is stored in the cleaning solution storage unit 102 and the magnetic bead solution (labeled probe solution) storage unit 103, and thus the description thereof will be omitted.

A nucleic acid capture sensor 100 is provided on the upper surface 202a of the substrate 202, and the nucleic acid capture sensor 100 is embedded in the substrate 202 so that the upper surface is exposed.

Further, the nucleic acid detection cartridge 200 includes a flow path 104f provided on the downstream side of the nucleic acid capture sensor 100, and a drainage pool 107 connected to the flow path 104f via a hole 106 provided in the substrate 202. In the nucleic acid detection cartridge 200 shown in FIG. 14, the flow path 104f is provided on the lower surface 203b of the cover plate 203, and the drainage pool 107 is provided on the upper surface 201a of the base plate 201. The flow path 104f is not directly connected to the sample solution storage unit 101, but is directly connected only to the drainage pool 107.

The nucleic acid detection cartridge according to the present embodiment is not limited to the one shown in FIGS. 13 to 14, and the nucleic acid detection cartridge shown in FIGS. 13 to 14 is partially modified or deleted within the range not impairing its effect. , Other configurations may be added to those described so far.
For example, in the nucleic acid detection cartridges shown in FIGS. 13 to 14, they are arranged between the sample solution storage section 101 and the washing solution storage section 102, or between the washing solution storage section 102 and the magnetic bead solution (labeled probe solution) storage section 103. It is connected to the biotin-containing probe solution storage unit, the biotin-containing probe solution storage unit, and the flow path 104d, which are configured to store the solution containing the first biotin-containing probe and the second biotin-containing probe. , A flow path configured to be able to feed the probe solution with biotin may be further provided.

<Method for detecting target double-stranded nucleic acid>
Next, a method for detecting the target double-stranded nucleic acid using the nucleic acid detection cartridge of the present embodiment will be described below.
By injecting the sample solution 7 before or after the heat treatment into the sample solution storage unit 101 and then inserting it into the nucleic acid detection device, processing such as detection of the target double-stranded nucleic acid and measurement of the concentration is automatically performed. When the sample solution before the heat treatment is used, it may be heated after being injected into the sample solution storage unit 101. At this time, the nucleic acid detection device includes a heating unit configured to heat the sample solution storage unit. Next, in a sealed state, pressure is physically applied from the upper surface outside the sample solution storage unit 101 to push the sample solution 7 from the sample solution storage unit 101 into the flow path 104a, and further send the liquid to the flow paths 104d and 104e. To reach the nucleic acid capture sensor 100. After the sample solution 7 reaches the nucleic acid capture sensor 100, it is preferably allowed to stand for 10 minutes or more and 60 minutes or less. At this time, the first single-stranded nucleic acid and the second single-stranded nucleic acid in the sample solution bind to the first capture probe and the second capture probe, respectively. Next, in a sealed state, pressure is physically applied from the upper surface outside the cleaning solution storage unit 102, the cleaning solution 8 is pushed out from the cleaning solution storage unit 102 into the flow path 104b, and further sent to the flow paths 104d and 104e. Then, it reaches the nucleic acid capture sensor 100. At this time, the sample solution that has reached the nucleic acid capture sensor 100 is sent to the flow path 104f and discarded. The nucleic acid capture sensor 100 is washed with the washing solution 8, and the nucleic acid molecules and other components that are not bound to the first capture probe and the second capture probe are removed from the measurement system. Next, when the first sensor element and the second sensor element are magnetic sensor elements, an external magnetic field is applied after the washing solution reaches the nucleic acid capture sensor 100, and the first sensor in the nucleic acid capture sensor 100 is applied. Start measuring the output of the element and the second sensor element. Next, while continuing to measure the outputs of the first sensor element and the second sensor element, physical pressure is applied from the upper surface outside the magnetic bead solution (labeled probe solution) storage unit 103 in a sealed state. The magnetic bead solution (labeled probe solution) 9 is extruded from the magnetic bead solution (labeled probe solution) storage unit 103 into the flow path 104c, and further sent to the flow path 104e to reach the nucleic acid capture sensor 100. As an example of the magnetic beads (labeled probe), the labeled probe shown in FIG. 5 or FIG. 7 is used.

Continue measuring the outputs of the first sensor element and the second sensor element, for example, using these output saturation values, the concentration of the target double-stranded nucleic acid calculated from the output of the first sensor element and the second. Obtain the concentration of the target double-stranded nucleic acid calculated from the output of the second sensor element.
The calculation of the concentration of the target double-stranded nucleic acid can be set in advance in a nucleic acid detection device (not shown) so as to automatically calculate from the measurement result.

By using the nucleic acid detection cartridge of the present embodiment, the process of the magnetic beads adsorbing on the nucleic acid capture sensor can be measured in real time.

≪Nucleic acid detection kit≫
The nucleic acid detection kit of the present embodiment includes the nucleic acid capture sensor and magnetic beads.

According to the nucleic acid detection kit of the present embodiment, in the detection of the target double-stranded nucleic acid in the sample, two types of detection signals can be obtained for one type of target double-stranded nucleic acid in the sample, and thus the measurement result. Improves reliability. Further, as shown in Examples described later, for example, by using the ratio of two types of detection signals, it is possible to detect an abnormality in measurement.

The nucleic acid detection kit according to the embodiment of the present invention includes the nucleic acid cartridge in which the magnetic bead solution, the washing solution, etc. are not stored in advance, and a storage container in which the magnetic bead solution, the washing solution, etc. are subdivided and enclosed. For example, a tube or the like) may be provided. In this nucleic acid detection kit, the user fills a nucleic acid cartridge with a sample solution, a magnetic bead solution, a washing solution, etc., seals the nucleic acid cartridge, and then sets it in a nucleic acid detection device to detect and measure the concentration of the target double-stranded nucleic acid. It can be carried out.

The nucleic acid detection kit according to another embodiment of the present invention includes the nucleic acid capture sensor and a storage container (for example, a tube or the like) in which a magnetic bead solution, a washing solution, or the like is subdivided and enclosed. There may be. In this nucleic acid detection kit, the user sets the nucleic acid capture sensor in a nucleic acid detection device having a flow path inside, and uses a syringe pump or the like to send various solutions enclosed in a tube onto the nucleic acid capture sensor. By doing so, the target double-stranded nucleic acid can be detected and the concentration can be measured.

Examples of various solutions included in the nucleic acid detection kit include a form in which a mixed solution of the first labeled probe 10 and the second labeled probe 11 and a washing solution are subdivided into separate tubes, and a solution of the labeled probe 13. The washing solution is divided into separate tubes, or a solution of magnetic beads 12 having avidin or streptavidin 15, and a solution containing a first probe 16 with biotin and a second probe 17 with biotin. , The form in which the cleaning solution is subdivided into separate tubes and the like.

Examples of the magnetic beads include those similar to those exemplified in the above-mentioned nucleic acid capture sensor.
In addition, examples of the first labeled probe, the second labeled probe, the labeled probe, the first biotin-attached probe, and the second biotin-attached probe are the same as those exemplified in the nucleic acid capture sensor.

Hereinafter, the present invention will be described with reference to Examples, but the present invention is not limited to the following Examples.

[Example]
1. 1. Material (sensor)
A sensor having two GMR elements (GMR1 and GMR2) as the first sensor element and the second sensor element and having a carboxy group (-COOH) on the surface of the protective film on the GMR element was used.

(Target double-stranded nucleic acid)
The double-stranded nucleic acid consisting of N1 and N2 shown below was used.
N1:
5'-ATGTCTTTGCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGT-3' (SEQ ID NO: 1)
N2:
5'-ACCACCAGGATGAACAGGAAGAAGCCCACCCCGTAGCTGAGGATGCCTGCATACACACTGCCCGCCTCGTCAGCCTCCACCAGCTCCTCCTCGGCTGCAAAGACAT-3' (SEQ ID NO: 2)

(Capture probe)
C1 (fixed on GMR1): 5'-AGCTCCTCCTCGGCTGCAAAGACAT-3'-NH ₂ (SEQ ID NO: 3)
C2 (fixed on GMR2): H ₂ N-5'-ATGTCTTTGCAGCCGAGGAGGAGCT-3' (SEQ ID NO: 4)

(Probe with biotin)
B1: Biotin-5'-ACCACCAGGATGAACAGGAAGAAGC-3'(SEQ ID NO: 5)
B2: 5'-GCAGGCATCCTCAGCTACGGGGTGG-3'-Biotin (SEQ ID NO: 6)

The binding region of the two types of capture probe and the probe with biotin to the target double-stranded nucleic acid is shown in FIG.

(solution)
-Composition of sample solution 1 nM or 5 nM target double-stranded nucleic acid 0.1% by mass Tween 20 (manufactured by Sigma-Aldrich, product number P7949-100ML, surfactant)
Tris Hydrochloric Acid Buffer (pH 7.3)

-Composition of probe solution with biotin 5 nM probe with biotin B1
5 nM probe with biotin B2
0.1% by mass Tween 20
Tris Hydrochloric Acid Buffer (pH 7.3)

-Washing solution 0.1% by mass Tween 20
Phosphate buffered saline

-Magnetic beads solution 0.5% by mass of magnetic beads with streptavidin (Magnetic Beads, Coated with Streptavidin)
0.1% by mass Tween 20
Phosphate buffered saline

2. 2. Preparation of Nucleic Acid Capture Sensor The capture probes C1 and C2 were immobilized on the GMR element according to the procedure shown below. First, a HEPES buffer solution containing 5 μM of the capture probe C1 was dropped onto the surface of the protective film on GMR1 by a spotter, and then washed with pure water. The carboxy group (-COOH) on the surface of the protective film and the amino group (-NH ₂ ) at the 3'end of the capture probe C1 are dehydrated and condensed to form an amide bond, and the capture probe C1 is formed on the surface of the protective film on GMR1. Was fixed. As for the capture probe C2, the capture probe C2 was immobilized on the surface of the protective film on the GMR2 by using the same method as that of the capture probe C1 except that the capture probe C2 was dropped on the surface of the protective film on the GMR2. GMR1 and GMR2, for which the capture probe had been immobilized, were set in the nucleic acid detection cartridge. In the nucleic acid detection cartridge, the above-mentioned washing solution is stored in advance in the washing solution storage part, and the above-mentioned magnetic bead solution is stored in advance in the magnetic bead solution storage part.

3. 3. Measurement of target double-stranded nucleic acid in sample solution The measurement of target double-stranded nucleic acid in sample solution was performed according to the procedure shown below. In addition, FIG. 16 shows the flow of binding of the target double-stranded nucleic acid, each probe, and the magnetic beads on the nucleic acid capture sensor. In FIG. 16, the arrows mean that the sequences are complementary.
(1) The sample solution and the probe solution with biotin were mixed at a volume ratio of 1: 1 to prepare a mixed solution.
(2) The mixed solution obtained in (1) was heated at 97 ° C. for 20 minutes.
(3) Immediately after ice-cooling the heated mixed solution, it was injected into the sample solution storage portion of the nucleic acid detection cartridge and set in the nucleic acid detection device to bring the mixed solution onto GMR1 and GMR2.
(4) With the mixed solution reaching on GMR1 and GMR2, the mixture was allowed to stand for 30 minutes.
(5) Next, the cleaning solution stored in the cleaning solution storage portion of the nucleic acid detection cartridge was brought onto GMR1 and GMR2 to clean the surfaces of GMR1 and GMR2.
(6) An external magnetic field of 30 Oe was applied in the in-plane direction of GMR1 and GMR2, and measurement of the respective resistance values (R1 and R2, respectively) obtained by converting the output values of GMR1 and GMR2 was started.
(7) While continuing the measurement of the resistance values of GMR1 and GMR2, the magnetic bead solution stored in the magnetic bead solution storage portion of the nucleic acid detection cartridge was sent onto GMR1 and GMR2.
(8) The resistance change rates of GMR1 and GMR2 (r1 ₁₀ and r2 ₁₀ respectively) 10 minutes after the transfer of the magnetic bead solution before the transfer were calculated using the following formulas. In the formula, t represents the time and t = 0 represents the start of feeding the magnetic bead solution.

_{r1 t = (R1 t -R1 0} ) / R1 0 × 100
r2 _t = (R2 _t −R2 ₀ ) / R2 ₀ × 100

(9) is calculated from the resistance change rate _{r2 10} concentrations (N1) and GMR1 of target double-stranded nucleic acid that is calculated from the resistance change ratio _{r1 10} of GMR1 using a preliminarily prepared calibration curve and _{r1 10} and _{r2 10} The concentration (N2) of the target double-stranded nucleic acid was calculated.

The measurement was performed 5 times each using a sample solution containing 1 nM and 5 nM target double-stranded nucleic acids. One nucleic acid capture sensor (GMR1 and GMR2) and one nucleic acid detection cartridge were used for each measurement and were disposable. The results are shown in Table 1.

In Table 1, in Run4, the difference between N1 and N2 and the value of r2 ₁₀ / r1 ₁₀ are large, and it is determined that some error has occurred during the measurement of Run4. When the analysis was performed after the measurement of Run4, it was found that an error occurred in Run4 due to the inclusion of air bubbles in the flow path of the nucleic acid detection cartridge.
Further, in Run9, the difference between N1 and N2 and the value of r2 ₁₀ / r1 ₁₀ are large, and it is determined that some error has occurred during the measurement of Run9. When the GMR was analyzed after the measurement of Run9, it was found that an error occurred due to a defect of the GMR2.

In this embodiment, for example, the normal range is a range in which r2 ₁₀ / r1 ₁₀ is 0.5 or more and 1.0 or less as a reference value, and the measurement in which r2 ₁₀ / r1 ₁₀ is out of the normal range is after the measurement. It is easy to see that an error has occurred without analysis. Therefore, by using the nucleic acid capture sensor of this example, if r2 ₁₀ / r1 ₁₀ deviates from the above normal range in one measurement, it is determined that some error has occurred during the measurement, and remeasurement is performed. You can choose that.

[Comparison example]
1. 1. Material (sensor)
A sensor having one GMR element (GMR1) as a sensor element and having a carboxy group (-COOH) on the surface of the protective film on the GMR element was used.

As the target double-stranded nucleic acid, the same one as in the examples was used. Further, as the capture probe, only the capture probe C1 was used among the capture probes described in the examples. As the probe with biotin, only the probe B1 with biotin was used among the probes with biotin described in Examples. The binding region of one type of capture probe and the probe with biotin to the target double-stranded nucleic acid is shown in FIG.

(solution)
The sample solution, the washing solution and the magnetic bead solution used were the same as those described in the examples.

-Probe solution with biotin 5 nM probe with biotin B1
0.1% by mass Tween 20
Tris Hydrochloric Acid Buffer (pH 7.3)

2. 2. Preparation of Nucleic Acid Capture Sensor The capture probe C1 was immobilized on the GMR device according to the procedure shown below. First, a HEPES buffer solution containing 5 μM of the capture probe C1 was dropped onto the surface of the protective film on GMR1 by a spotter, and then washed with pure water. The carboxy group (-COOH) on the surface of the protective film and the amino group (-NH ₂ ) at the 3'end of the capture probe C1 are dehydrated and condensed to form an amide bond, and the capture probe C1 is placed on the sensor surface on GMR1. It was fixed. GMR1 in which the capture probe was immobilized was set in the nucleic acid detection cartridge. Similar to the examples, in the nucleic acid detection cartridge, the washing solution is stored in advance in the washing solution storage part, and the magnetic bead solution is stored in advance in the magnetic bead solution storage part.

3. 3. Measurement of target double-stranded nucleic acid in sample solution The measurement of target double-stranded nucleic acid in sample solution was performed according to the procedure shown below. In addition, FIG. 18 shows the flow of binding of the target double-stranded nucleic acid, each probe, and the magnetic beads on the nucleic acid capture sensor. In FIG. 18, the arrows mean that the sequences are complementary.
(1) The sample solution and the probe solution with biotin were mixed at a volume ratio of 1: 1 to prepare a mixed solution.
(2) The mixed solution obtained in (1) was heated at 97 ° C. for 20 minutes.
(3) Immediately after ice-cooling the heated mixed solution, it was injected into the sample solution storage portion of the nucleic acid detection cartridge and set in the nucleic acid detection device to bring the mixed solution onto GMR1.
(4) With the mixed solution reaching GMR1, it was allowed to stand for 30 minutes.
(5) Next, the cleaning solution stored in the cleaning solution storage portion of the nucleic acid detection cartridge was brought onto GMR1 to clean the surface of GMR1.
(6) An external magnetic field of 30 Oe was applied in the in-plane direction of GMR1, and measurement of the resistance value (R1) of GMR1 obtained by converting the output value of GMR1 was started.
(7) While continuing the measurement of the resistance value of GMR1, the magnetic bead solution stored in the magnetic bead solution storage portion of the nucleic acid detection cartridge was sent onto GMR1.
(8) The resistance change rate (r1 ₁₀ ) of GMR1 10 minutes after the transfer of the magnetic bead solution before the transfer was calculated using the formula shown below. In the formula, t represents the time and t = 0 represents the start of feeding the magnetic bead solution.

_{r1 t = (R1 t -R1 0} ) / R1 0 × 100

(9) was calculated concentration of the target double-stranded nucleic acid that is calculated from the resistance change ratio _{r1 10} of GMR1 using a preliminarily prepared calibration curve and _{r1 10} (N1).

The measurement was performed 5 times each using a sample solution containing 1 nM and 5 nM target double-stranded nucleic acids. One nucleic acid capture sensor (GMR1) and one nucleic acid detection cartridge were used for each measurement and were disposable. The results are shown in Table 2.

In Table 2, in Run3, N1 is significantly different from the concentration of the target double-stranded nucleic acid in the sample solution, and it is considered that some error has occurred during the measurement of Run3. However, since the concentration of the target double-stranded nucleic acid is unknown when the user actually performs the measurement in a hospital or the like, it cannot be determined that an error has occurred during the measurement of Run3. Therefore, when the nucleic acid capture sensor of the comparative example is used, there is a possibility that the error is not noticed and the concentration different from the actual concentration of the target double-stranded nucleic acid is calculated.

According to the nucleic acid capture sensor of the present embodiment, it is possible to provide a nucleic acid capture sensor capable of detecting abnormalities in measurement with high reliability of measurement results in detecting double-stranded nucleic acids.

1 ... First sensor element 2 ... Second sensor element 3 ... Substrate 3a ... Support 3b ... Protective film 4 ... First capture probe 4a ... Nucleic acid consisting of the first sequence 5 ... Second capture probe 5a ... Nucleic acid consisting of the second sequence 6 ... Target double-stranded nucleic acid 6a ... First single-stranded nucleic acid 6b ... Second single-stranded nucleic acid 7 ... Sample solution 8 ... Washing solution 9 ... Magnetic bead solution (labeled probe solution)
10 ... 1st labeled probe 10a ... Nucleic acid consisting of 3rd sequence 11 ... 2nd labeled probe 11a ... Nucleic acid consisting of 4th sequence 12 ... Magnetic beads 13 ... Labeled probe 14 ... Biotin 15 ... Avidin or streptavidin 16 ... First probe with biotin 17 ... Second probe with biotin 51, 52 ... Wiring 100 ... Nucleic acid capture sensor 101 ... Sample solution storage section 101a, 102a, 103a ... Cap member 102 ... Washing solution storage section 103 ... Magnetic bead solution (Labeled probe solution) Reservoir 104a, 104b, 104c, 104d, 104e, 104f ... Flow path 105 ... Electrical connection 106 ... Hole 107 ... Drainage pool 200 ... Nucleic acid detection cartridge 201 ... Base plate 201a ... Top surface 202 ... Substrate 202a ... Top surface 203 ... Cover plate 203a ... Top surface 203b ... Bottom surface

Claims (12)

The first sensor element and the second sensor element,
A first capture probe that is placed on the first sensor element and has a first sequence that is complementary to at least a part of the base sequence of the first single-stranded nucleic acid constituting the target double-stranded nucleic acid. ,
A second capture probe that is placed on the second sensor element and has a second sequence that is complementary to at least a part of the base sequence of the second single-stranded nucleic acid constituting the target double-stranded nucleic acid. When,
A nucleic acid capture sensor. The nucleic acid capture sensor according to claim 1, wherein the first sensor element and the second sensor element are magnetic sensor elements. The nucleic acid capture sensor according to claim 2 and
With magnetic beads
Nucleic acid detection cartridge comprising. A first labeled probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having the magnetic beads.
A second labeled probe having a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid and having the magnetic beads,
With
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection cartridge according to claim 3, wherein the second sequence and the fourth sequence are different sequences from each other. A third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid. A labeled probe having and having the magnetic beads
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection cartridge according to claim 3, wherein the second sequence and the fourth sequence are different sequences from each other. The nucleic acid detection cartridge according to claim 3, wherein the magnetic beads have avidin or streptavidin. A first biotin-coated probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having biotin.
A second probe with biotin having a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid and having biotin,
With more
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection cartridge according to claim 6, wherein the second sequence and the fourth sequence are different sequences from each other. The nucleic acid capture sensor according to claim 2 and
With magnetic beads
Nucleic acid detection kit. A first labeled probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having the magnetic beads.
A second labeled probe having a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid and having the magnetic beads,
With
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection kit according to claim 8, wherein the second sequence and the fourth sequence are different sequences from each other. A third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid. A labeled probe having and having the magnetic beads
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection kit according to claim 8, wherein the second sequence and the fourth sequence are different sequences from each other. The nucleic acid detection kit according to claim 8, wherein the magnetic beads have avidin or streptavidin. A first biotin-coated probe having a third sequence complementary to at least a part of the base sequence of the first single-stranded nucleic acid and having biotin.
A second probe with biotin having a fourth sequence complementary to at least a part of the base sequence of the second single-stranded nucleic acid and having biotin,
With more
The first sequence and the third sequence are different sequences from each other.
The nucleic acid detection kit according to claim 11, wherein the second sequence and the fourth sequence are different sequences from each other.

Images