JP2020127390A - Hepcidin expression inhibitor, and food and drink for improving and/or preventing iron-deficiency anemia - Google Patents

Abstract

To provide a novel hepcidin expression inhibitor that effectively utilizes waste.SOLUTION: A hepcidin expression inhibitor has grape seed and/or pericarp extract as an active ingredient.SELECTED DRAWING: None

Description

The present invention relates to a hepcidin expression inhibitor, and food and drink for improving and/or preventing iron deficiency anemia.

Iron is a raw material for hemoglobin, which is a constituent of red blood cells, and is a very important element for the human body including oxygen transport. There are various causes of anemia, but the most common one is iron deficiency anemia. In the market, there are supplements and drinks for supplementing iron.

Iron metabolism in the living body is called a closed system, and most of them repeat circulation and reuse. The total amount of iron in the body is said to be 3000 to 4000 mg, 70% of which is incorporated in the cycle for hematopoiesis. Red blood cells made from bone marrow travel around the body and carry oxygen. Aged red blood cells are phagocytosed by macrophages and stored intracellularly. Then, it is transported from the taken-in cells to the outside via the iron transporter, ferroportin, and returns to the bone marrow.

Recently, hepcidin has been discovered as a hormone controlling iron metabolism. Hepcidin regulates iron transport from cells by inhibiting iron transporters. Hepcidin, a peptide hormone synthesized and secreted in the liver, regulates iron metabolism by binding to ferroportin and inducing degradation in lysosomes.

It is expected that suppressing hepcidin increases the amount of iron transport from cells and activates the hematopoietic cycle. Most of iron is covered by a closed system, but is lost in a trace amount due to sweating and bleeding. The amount of iron absorbed from food through the intestinal tract is 1 to 2 mg per day, which is very small compared to the total iron amount in the body. Therefore, in order to improve anemia, it is important not only to supplement iron but also to improve availability in vivo.

It has been reported that in mice to which myricetin was administered, hepcidin expression in the liver was suppressed and serum iron concentration was increased (Non-patent Documents 1 and 2).

Patent Document 1 describes a blood iron increasing agent for high-load exercisers, which contains catechins as an active ingredient.

JP, 2017-43548, A

Mu et al., Journal of Nutritional Biochemistry, 2016, Vol.30, p53-61 Mu et al., British Journal of Nutrition, 2014, Vol.111, p1181-1189

Patent Document 1 shows that the blood iron increasing agent was effective only for persons with high load exercise, and was not effective for persons without high load exercise. As described above, an effective anemia-improving and preventive agent has not been obtained even for persons with normal to low exercise amount.

By the way, in wine production, grape seeds are usually discarded, but the inventors of the present invention have found that an alcohol extract of grape seeds suppresses the expression of hepcidin.

An object of the present invention is to provide a novel hepcidin expression inhibitor that effectively utilizes waste, and food and drink for improving and/or preventing iron deficiency anemia.

The present invention provides a hepcidin expression inhibitor containing, as an active ingredient, an extract of grape seed and/or pericarp.

Since the seeds and skins of grapes are usually discarded in wine production and the like, the present invention makes effective use of waste. Further, the present invention contains a grape seed and/or pericarp extract as an active ingredient, and thus is useful as a novel hepcidin expression inhibitor.

In the hepcidin expression inhibitor, the extract is preferably a water extract or an alcohol extract, and more preferably a lower alcohol extract. In this case, a higher hepcidin expression suppressing effect will be exhibited.

The present invention also provides a food or drink for improving and/or preventing iron deficiency anemia, which comprises an extract of grape seed and/or pericarp as an active ingredient.

In the food and drink for improving and/or preventing iron deficiency anemia, the extract is preferably a water extract or an alcohol extract, and more preferably a lower alcohol extract. In this case, a higher effect of improving and/or preventing iron deficiency anemia will be exhibited.

INDUSTRIAL APPLICABILITY The present invention provides a novel hepcidin expression inhibitor that effectively utilizes waste, and foods and drinks for improving and/or preventing iron deficiency anemia.

It is a graph which shows the relative expression level of hepcidin by the water extract of the skin of a grape or a seed. It is a graph which shows the hepcidin relative expression level by the ethanol extract of the skin or the seeds of a grape.

Hereinafter, modes for carrying out the present invention will be described in detail. The present invention is not limited to the embodiments below.

One aspect of the hepcidin expression inhibitor according to the present invention contains an extract of grape seed and/or pericarp as an active ingredient.

The grape may be white grape or red grape. Examples of grape varieties include Vitis vinifera species, Vitis labrusca species, Vitis davidii species, and hybrids of these grapes. Specifically, for example, Chardonnay, Sauvignon Blanc, Semillon, Saint Emilion, Riesling, Koshu, Muscat, Chenin Blanc. ), Sylvaner, Gewurztraminer, Silvarner, Muller-Thurgau, Kerner, Cabernet Sauvignon, Merlot, Cabernet Cabernet Franc, Malbec, Pinot Noir, Gamey, Syrah, Grenache, Zweigeltrebe, Sangiovese, Tempranillo Tempranillo, Nebbiolo, Muscat Bailey A, and Kyoho. The grape variety is preferably a Kellner variety.

The grape seed and/or pericarp extract is produced by extracting grapes with an extraction solvent. The extraction solvent is preferably an aqueous solvent, and examples thereof include water and alcohol. The extraction solvent may be a solvent containing water and/or alcohol, or may be a solvent consisting of water and/or alcohol. The grape seed and/or pericarp extract is preferably a water extract produced by extraction with an extraction solvent comprising water, or an alcohol extract produced by extraction with an extraction solvent comprising alcohol.

The alcohol may be a lower alcohol. The lower alcohol means a linear or branched alcohol having 1 to 5 carbon atoms. Specific examples of the lower alcohol include, for example, methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, tert-butanol, 1-pentanol, 2-pentanol, 3-pentanol, amyl. Examples thereof include alcohol and neopentyl alcohol. The preferred lower alcohol is methanol or ethanol, and the more preferred lower alcohol is ethanol. That is, the alcohol extract is preferably a lower alcohol extract, more preferably a methanol extract or an ethanol extract, and even more preferably an ethanol extract. The alcohol extract may be an extract of one type of alcohol or an extract of two or more types of alcohol.

The grape seed and/or pericarp extract can be produced, for example, by the method described in Examples below. Specifically, grape seeds and/or pericarp are immersed in the extraction solvent described above, the obtained liquid is filtered using a filter paper or the like, and if necessary, dialysis treatment using a dialysis membrane and removal of the solvent. And the like. The grape seeds and pericarp may be partially or wholly powdered and then immersed in an extraction solvent. The amount of the extraction solvent used may be, for example, 20 to 200 ml, or 75 to 150 ml per 10 g of the total of grape seeds and pericarp. The temperature for immersion (immersion temperature) may be room temperature (5 to 35° C.). The time of immersion (the time of maintaining the immersion temperature above) may be 0.5 hours or longer, or 1 hour or longer, and may be 10 hours or shorter, or 5 hours or shorter. The solvent may be removed by freeze-drying, solvent evaporation, or the like.

The content of the grape seed and/or pericarp extract as an active ingredient in the hepcidin expression inhibitor according to the present embodiment may be, for example, 1% by mass or more, 10% by mass or more, 20 It may be at least 50% by weight, and may be at least 50% by weight. The content of the grape seed and/or pericarp extract as an active ingredient in the hepcidin expression inhibitor according to the present embodiment may be, for example, 100% by mass or less, and may be 95% by mass or less.

Since the hepcidin expression inhibitor according to the present embodiment contains the above-mentioned active ingredient, the expression of hepcidin can be suppressed by ingesting the hepcidin expression inhibitor. As a result of suppressing the expression of hepcidin, the amount of iron transported from cells is increased, the amount of iron in blood can be increased, and iron deficiency anemia can be improved or prevented. Iron deficiency anemia is anemia caused by iron deficiency. The improvement of iron deficiency anemia specifically means increasing the concentration of red blood cells, hemoglobin, and/or iron in blood. The prevention of iron deficiency anemia specifically means to keep the concentration of red blood cells, hemoglobin, and/or iron in the blood within an appropriate range and prevent the decrease thereof.

The hepcidin expression inhibitor according to the present embodiment may be in any form such as solid (for example, powder), liquid (water-soluble or fat-soluble solution or suspension), paste, and powder, granules, tablets. , Capsules, solutions, suspensions, emulsions, ointments, plasters and the like. It may also be in the form of a controlled release formulation. The hepcidin expression inhibitor according to the present embodiment may be composed of only the above-mentioned active ingredient.

The hepcidin expression inhibitor according to this embodiment may be administered (ingested) to a human or a non-human mammal. The dose (intake amount) of the hepcidin expression inhibitor according to the present embodiment may be, for example, 10 mg to 1000 mg per day, based on the extract of grape seeds and/or pericarp as the above-mentioned active ingredient, It may be 20-1000 mg and may be 50-500 mg.

The hepcidin expression inhibitor according to this embodiment may be orally or parenterally administered, but is preferably orally administered. The hepcidin expression inhibitor may be administered once a day, or may be administered in multiple divided doses a day, as long as the daily dose is within the above range.

The above-mentioned various preparations include the above-mentioned active ingredients and pharmaceutically acceptable additives (excipients, binders, lubricants, disintegrants, emulsifiers, surfactants, bases, solubilizers, suspensions It can be prepared by admixing with (agent etc.).

For example, the excipient includes lactose, sucrose, starch, dextrin and the like. Examples of the binder include polyvinyl alcohol, gum arabic, tragacanth, gelatin, hydroxypropylmethylcellulose, hydroxypropylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone and the like. Examples of the lubricant include magnesium stearate, calcium stearate, talc and the like. Examples of the disintegrant include crystalline cellulose, agar, gelatin, calcium carbonate, sodium hydrogen carbonate, dextrin and the like. Examples of the emulsifier or surfactant include Tween60, Tween80, Span80, glyceryl monostearate and the like. Examples of the base include cetostearyl alcohol, lanolin, polyethylene glycol, rice bran oil, fish oil (DHA, EPA, etc.), olive oil and the like. Examples of the solubilizing agent include polyethylene glycol, propylene glycol, sodium carbonate, sodium citrate, Tween 80 and the like. Examples of the suspending agent include Tween60, Tween80, Span80, glyceryl monostearate, polyvinyl alcohol, polyvinylpyrrolidone, methylcellulose, hydroxymethylcellulose, sodium alginate and the like.

The hepcidin expression inhibitor according to the present embodiment can be used as a component of products such as pharmaceuticals, quasi drugs, food compositions, food additives, feeds, feed additives and the like. The product comprising the hepcidin expression inhibitor according to the present embodiment or containing the hepcidin expression inhibitor according to the present embodiment may be for hepcidin expression inhibitor. The above products take steps to improve and prevent iron deficiency anemia, improve iron utilization, increase red blood cell, hemoglobin and/or iron levels, and make you feel tired. Sometimes you may be palpitated, you may be out of breath, and so on.

The present invention also provides a food or drink for improving and/or preventing iron deficiency anemia, which comprises an extract of grape seed and/or pericarp as an active ingredient. The details of the embodiment of the active ingredient are the same as in the case of the hepcidin expression inhibitor.

The iron deficiency anemia-improving and/or preventing food or drink according to the present embodiment contains the above-mentioned active ingredient, so that by ingesting the food or drink, hepcidin expression is suppressed, and the amount of iron transported from cells is increased. The amount of red blood cells, hemoglobin and/or iron in the blood can be increased and iron deficiency anemia can be improved or prevented.

The intake of the food or drink for iron deficiency anemia improvement and/or prevention according to the present embodiment is, for example, 10 mg to 1000 mg per day based on the extract of grape seed and/or pericarp as the above-mentioned active ingredient. It may be 20 to 1000 mg, and may be 50 to 500 mg.

Examples of the food and drink include breads, noodles, rice, tofu, dairy products, soy sauce, miso, confectionery and beverages. Examples of the drink include water, soft drink, tea drink, fruit juice drink, milk drink, alcoholic drink, non-alcoholic drink, sports drink, nutritional drink and the like. It can also be used as a participating component in health foods, foods with functional claims, special-purpose foods, dietary supplements, supplements or foods for specified health uses.

In the food and drink for improving iron deficiency anemia and/or food/drink for improvement according to the present embodiment, the content of the grape seed and/or pericarp extract as the active ingredient may be, for example, 1% by mass or more. It may be at least mass%, may be at least 20 mass%, and may be at least 50 mass%. In the food and drink for iron deficiency anemia improvement and/or prevention according to the present embodiment, the content of the grape seed and/or the skin extract as an active ingredient may be, for example, 100% by mass or less, and 95% by mass. % Or less, 90% by mass or less, and 80% by mass or less.

Hereinafter, the present invention will be described more specifically based on Examples. However, the present invention is not limited to the following examples.

<1. Preparation of water extracts of various materials>
[1-1. Preparation of water extract of white grape skin]
The pericarp obtained from the squeezing residue of white grapes (Kelner variety from Hokkaido) was pulverized. Next, extraction was carried out by immersing 10 g of powdery white grape skin in 100 ml of water at room temperature and holding it for 2 hours. The obtained liquid was filtered with a filter paper, and the filtrate was dialyzed using a dialysis membrane (Spectrpore Co., Ltd. (MW1,400)). The liquid after the dialysis treatment was freeze-dried and the solvent was removed to obtain a water extract of the skin of white grape.

[1-2. Preparation of water extract of white grape seed]
An aqueous extract of white grape seeds was prepared by the same procedure as described in 1-1 above, except that seeds obtained from squeezed slag of white grapes (Kelner from Hokkaido) were used as the material for extraction. did.

[1-3. Preparation of water extract of red grape skin]
An aqueous extract of red grape skins was prepared in the same manner as in 1-1 above, except that the skins obtained from juice of red grapes (Hokkaido's Zweigeltrebe variety) were used as the extraction material. Was prepared.

[1-4. Preparation of Water Extract of Red Grape Seed]
An aqueous extract of red grape seeds was prepared by the same procedure as in 1-1 above, except that the seeds of red grapes (Tsubaiger Trebe spp. from Hokkaido) were used as the material for extraction.

<2. Preparation of ethanol extracts of various materials>
[2-1. Preparation of ethanol extract of white grape seed]
The seeds obtained from the squeezing residue of white grapes (Kelner from Hokkaido) were pulverized. Next, extraction was performed by immersing 10 g of powdery white grape seeds in 100 ml of room temperature ethanol and holding for 2 hours. The obtained liquid was filtered with a filter paper, and the solvent was distilled off to obtain an ethanol extract of white grape seeds.

<3. Evaluation of hepcidin expression inhibitory action>
(Cell culture)
HepG2 cells (Riken BRC) were cultured in DMEM+10% FBS medium at 37° C. in a 5% CO ₂ incubator. In the hepcidin expression test, HepG2 cells seeded in a 48-well plate were used. At the stage of becoming semi-confluent, the medium was replaced with DMEM-FBS medium, and IL-6 and the test substance were added. The final concentration of IL-6 in DMEM-FBS medium was 100 ppb. The final concentration of the water extract in DMEM-FBS medium was 100 (μg/mL), and the final concentration of the ethanol extract in DMEM-FBS medium was 20 (μg/mL). Then CO ₂ incubator at 24 hours of incubation, and subjected to expression analysis RNA was extracted from the cells. When IL-6 was added to HepG2 cells as a preliminary test, induction of hepcidin expression was confirmed in a concentration-dependent manner.

(RNA extraction, real-time PCR)
The cells after sample addition and culturing were washed twice with sterile PBS, and 0.25 mL of Trizol reagent was added, followed by stirring using a vortex mixer. 0.05 mL of chloroform was added to the cells, the supernatant was transferred to a new tube after partitioning, and RNA was precipitated by addition of an equal volume of isopropanol. A precipitate was obtained by centrifugation (20,000 g, 5 minutes), washed with a 70% ethanol solution, and then air-dried. The dried RNA was dissolved in 0.1 mL RNase-free water, and 0.25 mL of ethanol and 0.01 mL of 3M NaOAc were added to precipitate RNA. After recovering the precipitated RNA, it was redissolved in sterile distilled water and the absorbance of the total RNA was measured to confirm the concentration and purity.

CDNA was synthesized using the QuantiTect Reverse Transcription kit. The mRNA expression level of this was evaluated by a relative quantification method using a LightCycler 480SYBR Green I Master and a gene-specific primer set. The specific primer sequences of each gene are as follows.
hHepcidin_F:
TTTCCCCACAACAGACGGGACAACT (SEQ ID NO: 1)
hHepcidin_R:
GGGCAGCAGGAATAAATAAGGAAGGG (SEQ ID NO: 2)
hActb_F:
AGGATGCAGAAGGAGATCACTG (SEQ ID NO: 3)
hActb_R:
GGGTGTAACGCAACTAAGTCATAG (SEQ ID NO: 4)

Details of the reagents and cells used in this test are as follows.
Interleukin-6 (IL-6, Sigma Aldrich, I1395-10UG), Trizol reagent (invitorgen), QuantiTect Reverse Transcription kit (Qiagen), LightCycler 480 SYBR Green (Green).

The fruit juices 1 to 3 shown below were prepared. Using the fruit juices 1 to 3, [1-1. Preparation of water extract of white grape skin], and a water extraction treatment and a dryness operation were performed by the same method as described in the above. Each of the obtained water extracts of the fruit juices 1 to 3 was used as a test substance for comparison. The test substance for comparison was added so that the final concentration in the DMEM-FBS medium was 100 (μg/mL).
Fruit juice 1: High polyphenol white concentrated juice Juice 2: Normal white concentrated juice Juice 3: High polyphenol red concentrated juice

The results are shown in FIGS. 1 and 2. As a control, the expression level of hepcidin is a relative value with the expression level in the addition section of the extraction solvent (ethanol or water) being 1.0.

FIG. 1 shows the relative expression level of hepcidin in the water extract of grape skins, grape seeds, or juice. In FIG. 1, 1 to 8 on the horizontal axis represent the following water extract of fruit skin or seed or fruit juice. In addition, the water extract of grape skins or grape seeds should be added to cells after redissolving the extract obtained by removing water as an extraction solvent and drying to an appropriate concentration. did. Similarly, the water extract of fruit juice was added to the cells after extraction, removal of the solvent and re-dissolution.
1: Control (addition area of extraction solvent)
2: White grape skin 3: White grape seed 4: Red grape skin 5: Red grape seed 6: Fruit juice 1 (high polyphenol white concentrated fruit juice) (polyphenol content 3150 mg/kg)
7: Fruit juice 2 (usually white concentrated fruit juice) (Sauvignon Blanc species, polyphenol content 128 mg/kg)
8: Juice 3 (high polyphenol red concentrated juice) (mainly Cabernet Sauvignon species, polyphenol content 11300 mg/kg)

FIG. 2 shows the relative expression level of hepcidin by the ethanol extract of white grape seeds. In FIG. 2, 1 on the horizontal axis represents a control (dimethylsulfoxide-added section), and 2 on the horizontal axis represents an ethanol extract of white grape seeds. After the solvent was distilled off, the ethanol extract was redissolved in a small amount of dimethyl sulfoxide (DMSO) so as to have an appropriate concentration and added to the cells.

A high hepcidin expression-suppressing action was confirmed in the grape seed or pericarp extract.

Claims (6)

A hepcidin expression inhibitor containing an extract of grape seeds and/or pericarp as an active ingredient. The hepcidin expression inhibitor according to claim 1, wherein the extract is a water extract or an alcohol extract. The hepcidin expression inhibitor according to claim 1, wherein the extract is a lower alcohol extract. A food or drink for improving and/or preventing iron deficiency anemia, which comprises an extract of grape seed and/or pericarp as an active ingredient. The food or drink for improving and/or preventing iron deficiency anemia according to claim 4, wherein the extract is a water extract or an alcohol extract. The food or drink for improving and/or preventing iron deficiency anemia according to claim 4, wherein the extract is a lower alcohol extract.

Images