JP2020125280A - Antibody-adsorbing agents comprising an immobilized fc-binding protein, and methods for separating antibodies using the same - Google Patents

Abstract

To provide antibody-adsorbing agents obtainable by immobilizing an affinity ligand capable of specifically binding to antibodies onto an insoluble carrier, which can adsorb a large amount of antibodies so that the agents are usable for antibody separation.SOLUTION: The invention provides an antibody-adsorbing agent obtainable by immobilizing an Fc-binding protein onto a porous hydrophilic polymer particle of which particle diameter is from 7 μm to 25 μm. The invention also provides a method for separating antibodies comprising the steps of: preparing a column filled with the adsorbing agent and equilibrating the column by passing an equilibrating buffer; adding to the equilibrated column a solution containing antibodies to adsorb the antibodies to the adsorbing agent; and eluting the adsorbed antibodies with an eluent.SELECTED DRAWING: Figure 2

Description

TECHNICAL FIELD The present invention relates to an antibody adsorbent having an Fc-binding protein immobilized thereon, and an antibody separation method using the same. More specifically, the present invention relates to an adsorbent in which the amount of adsorbed antibody is improved by changing the carrier for immobilizing the protein, and an antibody separation method using the adsorbent.

The sugar chain structure of an antibody drug is greatly involved in the efficacy and stability. Therefore, control of sugar chain structure is extremely important when producing antibody drugs.

Of the Fc-binding proteins, FcγRIIIa is known to recognize the sugar chain structure of an antibody (immunoglobulin). By using an adsorbent in which FcγRIIIa is immobilized as an affinity ligand on an insoluble carrier, the antibody can be bound to sugar chains. It can be separated based on the structure (Patent Document 1). Therefore, the adsorbent is useful for process analysis during production of antibody drugs. In addition, the amino acid residue at a specific position in the extracellular region (specifically, the region from the 17th position to the 192nd position in the amino acid sequence set forth in SEQ ID NO: 1) of FcγRIIIa is replaced with another specific amino acid residue. By substituting ##STR3## for heat stability, acid stability, and alkali stability required as affinity ligands (Patent Documents 1 to 3).

However, when an adsorbent obtained by immobilizing FcγRIIIa or the above-mentioned amino acid substitution product on an insoluble carrier was applied for the purpose of fractionating an antibody based on a sugar chain structure, the adsorbed amount of the antibody was insufficient and It was difficult to apply the adsorbent to the purpose of fractionating antibodies in industrial production of antibody pharmaceuticals.

JP, 2005-0886216, A JP, 2016-169197, A JP, 2017-118871, A

An object of the present invention is an antibody adsorbent obtained by immobilizing an affinity ligand capable of specifically binding to an antibody on an insoluble carrier, which adsorbent having a high antibody adsorption amount can also be used for the purpose of fractionating antibodies. Is to provide.

In order to solve the above problems, as a result of diligent studies by the present inventors, by optimizing an insoluble carrier for immobilizing an Fc-binding protein that is an affinity ligand, the amount of antibody adsorbed is improved compared to the conventional antibody adsorption. I was able to get the agent. Specifically, instead of the non-porous particles used as the insoluble carrier in the conventional antibody adsorbent, by using porous particles having a small particle size, compared to when using the non-porous particles as the insoluble carrier The amount of antibody adsorbed was improved.

That is, the present invention includes the embodiments described in [1] to [8] below.

[1] An antibody adsorbent obtained by immobilizing an Fc-binding protein on an insoluble carrier, wherein the insoluble carrier is porous hydrophilic polymer particles having a particle size of 7 μm or more and 25 μm or less.

[2] The adsorbent according to [1], wherein the Fc binding protein is human FcγRIIIa.

[3] The adsorbent according to [2], wherein human FcγRIIIa is the protein described in any of (a) to (f) below.
(A) contains at least the 33rd to 208th amino acid residues of the amino acid sequence of SEQ ID NO: 3, provided that at least the 192nd valine in the 33rd to 208th amino acid residues is replaced with phenylalanine. And a protein having antibody binding activity;
(B) contains at least the 33rd to 208th amino acid residues of the amino acid sequence of SEQ ID NO: 3, provided that at least the 192nd valine in the 33rd to 208th amino acid residues is replaced with phenylalanine. And further has an amino acid sequence containing substitution, deletion, insertion, or addition of 1 or several amino acid residues at 1 or several positions, retains the amino acid substitution of FcR9, and has an antibody binding activity. A protein having
(C) contains at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 3, but has 80% or more homology to the 33rd to 208th amino acid sequence, A protein (d) which retains the amino acid substitution of FcR9, has at least the 192nd valine amino acid substituted with phenylalanine, and has antibody binding activity (d) the amino acid residues 33 to 208 of the amino acid sequence of SEQ ID NO: 13. A protein containing at least a group and having antibody binding activity;
(E) At least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13 are provided, provided that, in the 33rd to 208th amino acid residues, 1 or at 1 or several positions. Alternatively, a protein having an amino acid sequence containing substitutions, deletions, insertions, or additions of several amino acid residues, retaining the amino acid substitution of FcR36i, and having antibody binding activity;
(F) containing at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13, but having 80% or more homology to the 33rd to 208th amino acid sequence, Also, the adsorbent according to any one of [1] to [3], wherein the protein having an FcR36i amino acid substitution and having antibody binding activity is [4] the porous hydrophilic polymer is polymethacrylate.

[5] A step of equilibrating the column by adding an equilibration liquid to the column packed with the adsorbent according to any one of [1] to [4], and adding a solution containing an antibody to the equilibrated column. And a method of adsorbing the antibody to the adsorbent and a step of eluting the antibody adsorbed to the adsorbent with an eluent.

[6] The method for producing an antibody drug according to [5], further comprising a step of collecting a fraction containing the antibody eluted with the eluent.

[7] A method for separating an antibody by the method according to [5], depending on the difference in sugar chain structure.

[8] The method according to [7], wherein the difference in sugar chain structure is due to the difference in the amount of galactose at the terminal.

Hereinafter, the present invention will be described in detail.

In the present invention, the Fc-binding protein immobilized on the insoluble carrier refers to a protein having a binding property to the Fc region of an antibody (immunoglobulin), and examples thereof include Fc receptor, Protein A, and Protein G. Specific examples of the Fc-binding protein that is a human Fc receptor include human FcγRI, human FcγRIIa, human FcγRIIb, human FcγRIIIa, and human FcRn. In particular, human FcγRIIIa is a human Fc receptor capable of recognizing the sugar chain structure of an antibody, and an antibody separating agent in which human FcγRIIIa is immobilized on an insoluble carrier can separate the antibody based on the sugar chain structure (JP-A-2015-2015). From Japanese Patent No. 086216 and Patent Document 1), it can be said that the present invention is a preferred embodiment as an Fc-binding protein immobilized on an insoluble carrier.

Examples of human FcγRIIIa include the proteins described in any of (i) to (xiv) below.
(I) In the amino acid sequence of natural human FcγRIIIa set forth in SEQ ID NO: 1, amino acid residues from the 17th glycine to the 192nd glutamine, which are part of the extracellular region (EC region in FIG. 1), A protein containing at least;
(Ii) contains at least the amino acid residues from the 17th glycine to the 192nd glutamine of the amino acid sequence set forth in SEQ ID NO: 1, provided that at least the 176th valine is present in the 17th to 192nd amino acid residues. A protein which has an amino acid substitution with phenylalanine and has antibody binding activity;
(Iii) contains at least the amino acid residues from the 17th glycine to the 192nd glutamine of the amino acid sequence of SEQ ID NO: 1, provided that at least the 176th valine is present in the 17th to 192nd amino acid residues. A protein having an amino acid sequence substituted with phenylalanine and further having one or several amino acid residue substitutions, deletions, insertions or additions at one or several positions, and having antibody binding activity; iv) It contains at least an amino acid residue from the 17th glycine to the 192nd glutamine in the amino acid sequence of SEQ ID NO: 1, provided that the amino acid sequence from the 17th to 208th is 70% or more, preferably 80. % Or more, more preferably 90% or more, particularly preferably 95% or more homology, and at least the valine at position 176 is substituted with an amino acid phenylalanine, and has protein binding activity;
(V) Amino acid residues 33 to 208 of the amino acid sequence set forth in SEQ ID NO: 3 (of the amino acid residues from the 17th glycine to the 192nd glutamine of the amino acid sequence set forth in SEQ ID NO: 9, Protein (vi) SEQ ID NO: 3 containing at least the amino acid substitution of phenylalanine at the 192nd valine in the 33rd to 208th amino acid residues. Which includes at least the 33rd to 208th amino acid residues of the amino acid sequence of, wherein at least the 192nd valine is amino acid-substituted with phenylalanine in the 33rd to 208th amino acid residues, and further 1 or a number A protein having an amino acid sequence containing substitution, deletion, insertion, or addition of one or several amino acid residues at position 1, and having the amino acid substitution of FcR9 and having antibody binding activity;
(Vii) contains at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 3, but 80% or more, and more preferably 90% or more of the 33rd to 208th amino acid sequence , A protein having homology of 95% or more, and having an amino acid substitution of FcR9, at least the valine at position 192 is substituted with a phenylalanine amino acid, and having antibody binding activity;
(Viii) Of the amino acid sequence of SEQ ID NO: 5, amino acid residues from the 33rd glycine to the 208th glutamine (amino acids from the 33rd glycine to the 208th glutamine of the amino acid sequence of SEQ ID NO: 3 Among the residues, a protein containing at least a polypeptide in which the 192nd valine is amino acid-substituted with phenylalanine);
(Ix) contains at least an amino acid residue from the 17th glycine to the 192nd glutamine of the amino acid sequence of SEQ ID NO: 1, provided that at least the 176th valine is present in the 17th to 192nd amino acid residues. Amino acid substitution to isoleucine,
And a protein having antibody binding activity;
(X) at least containing the amino acid residues from the 17th glycine to the 192nd glutamine of the amino acid sequence set forth in SEQ ID NO: 1, provided that at least the 176th valine is present in the 17th to 192nd amino acid residues. A protein which has an amino acid substitution to isoleucine and further has an amino acid sequence containing substitution, deletion, insertion or addition of one or several amino acid residues at one or several positions, and which has antibody binding activity;
(Xi) contains at least an amino acid residue from the 17th glycine to the 192nd glutamine of the amino acid sequence of SEQ ID NO: 1, but 70% or more, preferably 70% or more, with respect to the 17th to 208th amino acid sequence 80% or more, more preferably 90% or more, particularly preferably 95% or more homology, at least the valine at position 176 is amino acid substituted with isoleucine, and a protein having antibody binding activity;
(Xii) 33rd to 208th amino acid residues of the amino acid sequence shown in SEQ ID NO: 13 (of the amino acid residues from the 17th glycine to the 192nd glutamine of the amino acid sequence shown in SEQ ID NO: 36, 36 Protein having at least one amino acid substitution) and having antibody binding activity;
(Xiii) Substitution, deletion, insertion of 1 or several amino acid residues at 1 or several positions, containing at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13. , Or a protein having an amino acid sequence containing addition, and having an amino acid substitution of FcR36i and having antibody binding activity;
(Xiv) contains at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13, but 80% or more, and more preferably 90% or more of the 33rd to 208th amino acid sequence , More preferably 95% or more homology, retains FcR36i amino acid substitution, and has antibody binding activity.

The proteins described in (i) to (xiv) above all need to include at least a part of the extracellular region of human FcγRIIIa (EC region in FIG. 1) or an amino acid substitution product thereof. It may include all or part of the signal peptide region (S in FIG. 1) on the N-terminal side, or the cell transmembrane region (TM in FIG. 1) and intracellular region (FIG. 1) on the C-terminal side of the extracellular region. It may include all or part of C). Further, in natural human FcγRIIIa, Leu66His (this notation means that the leucine at the 66th position in SEQ ID NO: 1 (82nd position in SEQ ID NO: 3) has been replaced with histidine by amino acid, the same applies hereinafter), Leu66Arg, Gly147Asp, Among Tyr158His, mutants in which any one or more amino acid substitutions occur are known. These amino acid substitutions are (ii) to (vii), (ix) to (xi), (xiii) and ( The protein described in xiv) may have. Furthermore, in the proteins described in (ii) to (vii), (ix) to (xi), (xiii), and (xiv), “1 or several” means the position of the amino acid residue in the three-dimensional structure of the protein. The number is preferably 1 to 50, more preferably 1 to 30, most preferably 1 to 20 or 1 to 10 (eg, 1, 2, 3, 4 or 5), though it varies depending on the type and type. is there. The amino acid residue at a specific position may be replaced with an amino acid other than the above-mentioned amino acids as long as it has antibody binding activity. An example thereof is conservative substitution in which amino acids having similar physical properties and/or chemical properties to each other are substituted. It is known to those skilled in the art that conservative substitution is not limited to Fc-binding proteins, and generally the function of a protein is maintained between those with substitution and those without substitution. Examples of conservative substitutions include substitutions that occur between glycine and alanine, aspartic acid and glutamic acid, serine and proline, or glutamic acid and alanine (protein structure and function, Medical Science International, 9 , 2005).

In the present invention, the Fc-binding protein to be immobilized on the insoluble carrier is further added to its N-terminal side or C-terminal side with an oligopeptide useful for separating an antibody of interest from a solution in the presence of a contaminant. Good. Examples of the oligopeptide include polyhistidine, polylysine, polyarginine, polyglutamic acid and polyaspartic acid. Further, an cysteine-containing oligopeptide useful for immobilizing the Fc-binding protein of the present invention on a solid phase such as a support for chromatography (for example, the 200th to the 208th amino acid sequence of SEQ ID NO: 11) Up to amino acid residues) may be further added to the N-terminal side or C-terminal side of the Fc-binding protein. The length of the oligopeptide added to the N-terminal side or C-terminal side of the Fc-binding protein is not particularly limited. When the oligopeptide is added to the Fc-binding protein of the present invention, a polynucleotide encoding the oligopeptide is prepared and then genetically engineered using a method well known to those skilled in the art to the N-terminal side of the Fc-binding protein. Alternatively, it may be added to the C-terminal side, or the chemically synthesized oligopeptide may be chemically bonded to the N-terminal side or C-terminal side of the Fc-binding protein of the present invention and added. Furthermore, a signal peptide for promoting efficient expression in a host may be added to the N-terminal side of the Fc-binding protein. When the host is E. coli, examples of the signal peptide include PelB (oligopeptide consisting of amino acid residues 1 to 22 of UniProt No. P0C1C1), DsbA, and MalE (UniProt No. P0AEX9 from 1 to 26). Examples thereof include oligopeptides consisting of amino acid residues up to the second) and signal peptides that secrete proteins into the periplasm such as TorT (JP 2011-097898 A).

The adsorbent of the present invention is characterized by using porous hydrophilic polymer particles having a particle diameter of 7 μm or more and 25 μm or less as an insoluble carrier for immobilizing the Fc-binding protein described above. Examples of hydrophilic polymers include synthetic polymers such as polyvinyl alcohol, polymethacrylate, poly(2-hydroxyethyl methacrylate), and polyurethane. The particle size is preferably 7 μm or more and 22 μm or less, more preferably 7 μm or more and 18 μm or less, further preferably 7 μm or more and 15 μm or less, and particularly preferably 8 μm or more and 12 μm or less. In the present invention, the particle size means a volume average particle size, and was specifically determined by measuring the particle size distribution with a Coulter counter (manufactured by Coulter Co.).

In the present specification, the porous particles mean sponge-like particles having pores on the surface and are hollow inside, specifically particles having a porosity of 30% to 95%, It is more preferable that the porosity is 50% or more. The porosity of the particles of the present invention is measured by the operations described in (a) to (e) below. The measurement method is a general method as a porosity measurement method for porous particles in the field of liquid chromatography.

(A) A column for chromatography is packed with the porous particles of the present invention.

(B) Using water as an eluent, the elution volume of blue dextran having a molecular weight of 2,000,000 and sodium chloride from the column is measured.

(C) The gel volume is calculated by subtracting the elution volume of blue dextran having a molecular weight of 2,000,000 measured in step (b) from the column volume of the column.

(D) The pore volume is calculated by subtracting the elution volume of blue dextran having a molecular weight of 2,000,000 measured in operation (b) from the elution volume of sodium chloride measured in operation (b).

(E) The porosity is calculated by dividing the pore volume calculated in operation (d) by the gel volume calculated in operation (c).

That is, using the elution volume of sodium chloride (Vn), the elution volume of blue dextran having a molecular weight of 2,000,000 (Vo) and the column volume (Vc), the porosity can be calculated from the following formula. Rate (%)=((Vn−Vo)/(Vc−Vo))×100.

To immobilize an Fc-binding protein on an insoluble carrier, an N-hydroxysuccinimide (NHS) activated ester group, epoxy group, carboxyl group, maleimide group, haloacetyl group, tresyl group, formyl group, It may be immobilized by providing an active group such as haloacetamide and covalently binding the Fc-binding protein and the insoluble carrier through the active group. The carrier to which the active group has been added may be prepared, for example, by introducing the active group onto the surface of the carrier under appropriate reaction conditions.

On the other hand, as a method for introducing an active group onto the surface of a carrier, a method of reacting one of compounds having two or more active sites with a hydroxyl group, an epoxy group, a carboxyl group, an amino group or the like existing on the surface of the carrier is exemplified. it can. Among the examples of the compound, examples of a compound that introduces an epoxy group into a hydroxyl group or an amino group on the surface of a carrier include epichlorohydrin, ethanediol diglycidyl ether, butanediol diglycidyl ether, and hexanediol diglycidyl ether. After introducing an epoxy group on the surface of the carrier by the compound, as a compound for introducing a carboxyl group on the surface of the carrier, 2-mercaptoacetic acid, 3-mercaptopropionic acid, 4-mercaptobutyric acid, 6-mercaptobutyric acid, glycine, 3- Aminopropionic acid, 4-aminobutyric acid, a hydroxyl group or an epoxy group present on the surface of a carrier, a carboxyl group, as a compound for introducing a maleimide group into an amino group, N-(ε-maleimidocaproic acid) hydrazide, N-(ε- Maleimidopropionic acid) hydrazide, 4-[4-N-maleimidophenyl]acetic acid hydrazide, 2-aminomaleimide, 3-aminomaleimide, 4-aminomaleimide, 6-aminomaleimide, 1-(4-aminophenyl)maleimide, 1 -(3-Aminophenyl)maleimide, 4-(maleimide)phenylisocyanate, 2-maleimidoacetic acid, 3-maleimidopropionic acid, 4-maleimidobutyric acid, 6-maleimidohexanoic acid, N-(α-maleimidoacetoxy)succinimide ester , (M-maleimidobenzoyl)N-hydroxysuccinimide ester, succinimidyl-4-(maleimidomethyl)cyclohexane-1-carbonyl-(6-aminohexanoic acid), succinimidyl-4-(maleimidomethyl)cyclohexane-1-carboxylic acid, Examples include (p-maleimidobenzoyl)N-hydroxysuccinimide ester and (m-maleimidobenzoyl)N-hydroxysuccinimide ester.

As a compound for introducing a haloacetyl group into a hydroxyl group or an amino group present on the surface of a carrier, chloroacetic acid, bromoacetic acid, iodoacetic acid, chloroacetic acid chloride, bromoacetic acid chloride, bromoacetic acid bromide, chloroacetic acid anhydride, bromoacetic acid anhydride, Iodoacetic anhydride, 2-(iodoacetamido)acetic acid-N-hydroxysuccinimide ester, 3-(bromoacetamido)propionic acid-N-hydroxysuccinimide ester, 4-(iodoacetyl)aminobenzoic acid-N-hydroxysuccinimide ester It can be illustrated. A method of reacting a hydroxyl group or an amino group existing on the surface of the carrier with a ω-alkenyl alkaneglycidyl ether and then halogenating the ω-alkenyl site with a halogenating agent to activate the alkenyl moiety is also exemplified. Examples of the ω-alkenyl alkaneglycidyl ether include allyl glycidyl ether, 3-butenyl glycidyl ether, and 4-pentenyl glycidyl ether, and examples of the halogenating agent include N-chlorosuccinimide, N-bromosuccinimide, and N-iodosuccinimide. it can.

As another example of the method of introducing an active group onto the surface of a carrier, there is a method of introducing an activating group into a carboxyl group existing on the surface of a carrier by using a condensing agent and an additive. Examples of the condensing agent include 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), dicyclohexylcarbodiamide, and carbonyldiimidazole. Examples of the additive include N-hydroxysuccinimide (NHS), 4-nitrophenol, and 1-hydroxybenztriazole.

Suitable examples of the porous hydrophilic polymer particles used in the method of the present invention include Shodex (manufactured by Showa Denko KK), Sepharose (manufactured by GE), Amberlite (manufactured by Organo), Cellufine (manufactured by JN), and POROS. (Thermo Fisher SCIENTIFIC Co., Ltd.), TOYOPEARL (manufactured by Tosoh Corp.) and the like can be mentioned, but not limited thereto.

As a buffer solution used for immobilizing the Fc-binding protein on the insoluble carrier, an acetate buffer solution, a phosphate buffer solution, a MES (2-morpholinoethanesulfonic acid) buffer solution, and a HEPES (4-(2-hydroxyethyl)-l-piperazine ethenesulfonic acid) buffer, Tris buffer, and borate buffer. The reaction temperature for immobilization may be appropriately set within the temperature range of 5°C to 50°C in consideration of the reactivity of the active group and the stability of the Fc-binding protein, and preferably from 10°C. It is in the range of 35°C.

In order to separate an antibody using the antibody adsorbent of the present invention obtained by immobilizing an Fc-binding protein on an insoluble carrier by the method described above, a liquid-feeding means such as a pump is used in a column packed with the antibody adsorbent. The column is equilibrated by adding an equilibration solution to the column, and the solution containing the antibody is added by the solution sending means to specifically adsorb the antibody to the antibody adsorbent, and then an appropriate eluate is sent to the column. The adsorbed antibody may be eluted by adding it by liquid means. In the present invention, separation of antibodies is not limited to antibody separation (removal of impurities) from a solution containing contaminants, but also includes separation between antibodies based on structure, properties, activity and the like.

Examples of the equilibration solution include a phosphate buffer solution, an acetate buffer solution, a MES buffer solution, and a citrate buffer solution. Further, the buffer solution contains 10 mM to 100 mM (preferably 40 mM to 60 mM) of an inorganic salt such as sodium chloride. May be added. The pH of the equilibration liquid may be appropriately determined from the range of pH 4.0 to 7.0 in consideration of the buffer component, the column shape, the packing pressure of the adsorbent into the column, and the like.

In order to elute the antibody adsorbed on the antibody adsorbent, it is sufficient to weaken the interaction between the antibody and the ligand (Fc binding protein). Specifically, the pH is lowered by the buffer solution, the counter peptide is added, and the temperature is increased. An increase and a change in salt concentration can be exemplified. A specific example of the eluent for eluting the antibody adsorbed on the antibody adsorbent is a buffer solution that is more acidic than the solution used for adsorbing the antibody on the antibody adsorbent. Examples of the buffer solution include a citrate buffer solution, a glycine hydrochloric acid buffer solution, and an acetic acid buffer solution, which have a buffering capacity on the acidic side. The pH of the eluate may be set within a range that does not impair the function of the antibody (binding property to antigen, etc.), and as an example, pH 2.5 to 6.0, pH 3.0 to 5.0, pH 3. It is 0 or more and 4.0 or less.

When an antibody is eluted with a change in salt concentration, it may be eluted in a single step with a buffer solution containing a high concentration of salt (eluent), or the salt concentration may be increased stepwise (step gradient). The salt concentration may be increased with a linear concentration gradient (linear gradient), but it is preferable to elute with a linear gradient. For example, when sodium chloride is used as the water-soluble salt, it may be eluted with a linear gradient of sodium chloride concentration from 0M to 1M. When the antibody is eluted by changing the pH, it may be eluted in one step with an acidic buffer solution (elution solution) having a pH lower than that of the equilibration buffer solution, and the pH of the buffer solution may be optionally decreased stepwise. The pH of the buffer solution may be lowered with a linear gradient (linear gradient), but it is preferable to elute with a linear gradient. For example, a neutral to weakly acidic buffer solution in which the antibody is adsorbed may be eluted with a linear gradient from an acidic buffer solution in which the antibody is eluted.

The antibody can be obtained by collecting the fraction containing the antibody eluted by the above-mentioned method. The preparative collection may be performed by a conventional method. Specifically, for example, a method of exchanging the collection container at fixed time intervals or a fixed volume, a method of changing the collection container according to the shape of the chromatogram of the eluate, an automatic fraction collector, etc. It can be mentioned that the sample is collected.

The present invention is characterized in that, in an antibody adsorbent obtained by immobilizing an Fc-binding protein on an insoluble carrier, the insoluble carrier is porous hydrophilic polymer particles having a particle size of 7 μm or more and 25 μm or less. The adsorbent of the present invention has an increased amount of antibody adsorbed as compared with the conventional adsorbent using non-porous particles as the insoluble carrier. Therefore, the present invention is useful for fractionating antibodies in industrial production of antibody pharmaceuticals.

In particular, when human FcγRIIIa is used as the Fc-binding protein, the antibody separating agent obtained by immobilizing these proteins on an insoluble carrier is separated based on the sugar chain structure (JP-A-2015-0886216) or antibody-dependent. An antibody having a specific sugar chain structure or an antibody having a high (or low) antibody-dependent cytotoxic activity can be selected because separation can be performed based on the strength of the cytotoxic activity (JP-A-2016-023152). Target and can be prepared in large quantities.

FIG. 3 is a schematic diagram of human FcγRIIIa. The numbers in the figure show the numbers of the amino acid sequences described in SEQ ID NO:1. In the figure, S is a signal sequence, EC is an extracellular region, TM is a cell transmembrane region, and C is an intracellular region. 9 is an elution pattern showing the results of Example 9. 11 is an elution pattern showing the results of Example 10. 5 is an elution pattern showing the results of Comparative Example 3. 9 is an elution pattern showing the results of Comparative Example 4. It is an elution pattern showing the results of Example 11. 9 is an elution pattern showing the results of Example 12. 9 is an elution pattern showing the results of Example 13. 9 is an elution pattern showing the results of Example 14. 16 is an elution pattern showing the results of Example 15. 17 is an elution pattern showing the results of Example 16. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 17. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 18. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 19. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 20. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 21. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 22. It is a ratio of the sugar chain structure contained in each antibody drug showing the results of Example 23.

Hereinafter, the present invention will be described in more detail with reference to examples and comparative examples, but the present invention is not limited to these examples.

Example 1 Preparation of FcR9 Amino Acid Substitution For the Fc binding protein FcR9 (SEQ ID NO: 3) prepared by the method described in WO2015/199154, the 192nd valine (natural type consisting of the amino acid sequence described in SEQ ID NO: 1 For human FcγRIIIa, an Fc-binding protein FcR9_F was prepared by substituting phenylalanine for 176th valine).

Specifically, a polynucleotide having the amino acid substitution is prepared from a plasmid pET-FcR9 (WO2015/199154) containing a polynucleotide encoding FcR9 (SEQ ID NO: 4) by PCR, and the polynucleotide is expressed. After ligation to the vector pETMalE (JP 2011-206046 A), E. coli BL21(DE3) strain was transformed with the ligation product to obtain a transformant expressing FcR9_F. In addition, FcR9 (SEQ ID NO: 3) is the Fc-binding protein containing the extracellular region of human FcγRIIIa shown in SEQ ID NO: 2 in which the 43rd valine (corresponding to the 27th in SEQ ID NO: 1) is glutamic acid and the 45th ( Phenylalanine at position 29 in SEQ ID NO: 1 is isoleucine, tyrosine at position 51 (corresponding to position 35 in SEQ ID NO: 1) is asparagine, and glutamine at position 64 (corresponding to position 48 in SEQ ID NO: 1) is arginine. , The 91st (corresponding to the 75th in SEQ ID NO: 1) phenylalanine to leucine, the 108th (corresponding to the 92nd in SEQ ID NO: 1) asparagine to serine, the 133rd (corresponding to 117th in SEQ ID NO: 1) Fc-binding protein in which valine is replaced by glutamic acid, 137th (corresponding to 121st in SEQ ID NO: 1) glutamic acid is glycine, and 187th (corresponding to 171st in SEQ ID NO: 1) phenylalanine is serine. Is. In the present specification, the 9 amino acid substitutions carried by the FcR9 (SEQ ID NO: 3) with respect to the Fc-binding protein (SEQ ID NO: 2) containing the native human FcγRIIIa extracellular region are referred to as “FcR9 amino acid substitutions”. Sometimes called.

The amino acid sequence of FcR9_F is shown in SEQ ID NO:5, and the sequence of the polynucleotide encoding FcR9_F is shown in SEQ ID NO:6. In SEQ ID NO: 5, the 1st methionine (Met) to the 26th alanine (Ala) are MalE signal peptides (oligopeptides consisting of amino acid residues 1 to 26 of UniProt No. P0AEX9), and 27 The lysine (Lys) to the 32nd methionine (Met) is a linker sequence, and the 33rd glycine (Gly) to the 208th glutamine (Gln) is the amino acid sequence of FcR9_F (from 17th of SEQ ID NO: 1 to (Corresponding to the 192nd region), 209th to 210th glycines (Gly) are linker sequences, and the 211st to 216th histidines (His) are tag sequences.

Example 2 Preparation of Fc binding protein (FcR9_F_Cys) with cysteine tag added (1) Expression vector pET-FcR9_F containing the polynucleotide (SEQ ID NO: 6) encoding FcR9_F (SEQ ID NO: 5) prepared in Example 1 PCR was performed as a template. The primers in the PCR are SEQ ID NO: 7 (5′-TAGCCATGGGGCATGCGTACCAGAGATCTGCCCGAAAGC-3′) and SEQ ID NO: 8 (5′-CCCAAGCTTTATCCGCAGGTATCGTTGCCGGCACCCTTGGGTAATGGTAATATTCACGCGTCTCGG-3) from the nucleotide sequence used to oligo sequence-3'). For PCR, after preparing a reaction solution having the composition shown in Table 1, the reaction solution was heat-treated at 98° C. for 5 minutes, the first step at 98° C. for 10 seconds, the second step at 55° C. for 5 seconds, and the temperature at 72° C. It was carried out by repeating 30 cycles of the reaction in which the third step of 1 minute was defined as one cycle.

(2) The expression vector pTrc-PelBV3 prepared by the method described in WO2015/199154, which is obtained by purifying the polynucleotide obtained in (1), digesting it with restriction enzymes NcoI and HindIII, and then previously digesting it with restriction enzymes NcoI and HindIII. The E. coli W3110 strain was transformed with the ligation product.

(3) The obtained transformant was cultured in an LB medium containing 100 μg/mL carbenicillin, and then the expression vector pTrc-FcR9_F_Cys was obtained using the QIAprep Spin Miniprep kit (manufactured by Qiagen).

(4) The nucleotide sequence of pTrc-FcR9_F_Cys is analyzed using an oligonucleotide consisting of the sequence described in SEQ ID NO: 9 (5′-TGTGGTATGCGTGTGCAGG-3′) or SEQ ID NO: 10 (5′-TCGGCATGGGGTCAGGTG-3′). It was

The amino acid sequence of the polypeptide expressed by the expression vector pTrc-FcR9_F_Cys is shown in SEQ ID NO: 11, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 12, respectively. In SEQ ID NO: 11, the 1st methionine (Met) to the 22nd alanine (Ala) is an improved PelB signal peptide (olipropeptide consisting of the 1st to 22nd amino acid residues of UniProt No. P0C1C1). However, it is an oligopeptide obtained by substituting the 6th proline with serine as an amino acid, and the 24th glycine (Gly) to the 199th glutamine (Gln) is the amino acid sequence of the Fc binding protein FcR9_F (33rd of SEQ ID NO: 5). To the 208th region), and the 200th glycine (Gly) to the 207th glycine (Gly) is a cysteine tag sequence.

Example 3 Preparation of FcR9_F_Cys (1) 400 mL of 2YT liquid medium containing 100 μg/mL carbenicillin (Peptone 16 g/L, yeast extract) containing the transformant expressing FcR9_F_Cys produced in Example 2 in a 2 L baffle flask. (10 g/L, 5 g/L of sodium chloride) and precultured by aerobically shaking culture at 37° C. overnight.

(2) Glucose 10 g/L, yeast extract 20 g/L, trisodium phosphate dodecahydrate 3 g/L, disodium hydrogen phosphate dodecahydrate 9 g/L, ammonium chloride 1 g/L and carbenicillin 100 mg/ 180 L of the liquid culture medium of (1) was inoculated into 1.8 L of liquid medium containing L, and main culture was performed using a 3 L fermenter (manufactured by Biot). The main culture was started under the conditions of a temperature of 30° C., a pH of 6.9 to 7.1, an aeration rate of 1 VVM, and a dissolved oxygen concentration of 30% saturation concentration. 50% phosphoric acid was used as an acid and 14% ammonia water was used as an alkali for controlling the pH, and dissolved oxygen was controlled by changing the stirring speed. The stirring speed was set to a lower limit of 500 rpm and an upper limit of 1000 rpm. .. After the start of the culture, when the glucose concentration could not be measured, the fed-batch medium (glucose 248.9 g/L, yeast extract 83.3 g/L, magnesium sulfate heptahydrate 7.2 g/L) was dissolved oxygen (DO). ) Under control.

(3) When the absorbance at 600 nm (OD600 nm) reaches about 150, the culture temperature is lowered to 25°C as a guide for the amount of cells, and after confirming that the set temperature has been reached, the final concentration should be 0.5 mM. IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added, and the culture was continued at 25°C.

(4) The culture was stopped about 48 hours after the start of the culture, and the culture solution was centrifuged at 4° C. at 8000 rpm for 20 minutes to collect the bacterial cells.

(5) The collected cells were suspended in 20 mM Tris-HCl buffer (pH 7.0) at 5 mL/1 g (cells), and an ultrasonic generator (Insonator 201M (trade name), manufactured by Kubota Shoji) was used. ) Was used to crush the cells at 4° C. for about 10 minutes at an output of about 150 W. The disrupted cell suspension was centrifuged twice at 8000 rpm for 20 minutes at 4°C, and the supernatant was collected.

(6) The supernatant obtained in (5) was equilibrated with 20 mM phosphate buffer (8 mM sodium dihydrogen phosphate, 12 mM disodium hydrogen phosphate) (pH 7.0) in advance to 140 mL of TOYOPEARL CM-. It was applied to a VL32×250 column (manufactured by Merck Millipore) packed with 650 M (manufactured by Tosoh Corporation) at a flow rate of 5 mL/min. After washing with the buffer used for equilibration, elution was carried out with a 20 mM phosphate buffer (pH 7.0) containing 0.5 M sodium chloride.

(7) XK26/ which was loaded with 90 mL of IgG sepharose (manufactured by GE Healthcare) equilibrated with the eluate obtained in (6) in advance in 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. It was applied to 20 columns (manufactured by GE Healthcare). After washing with the buffer used for equilibration, elution was performed with 0.1 M glycine-hydrochloric acid buffer (pH 3.0). The pH of the eluate was neutralized by adding 1M Tris-HCl buffer (pH 8.0) in an amount of 1/4 of the eluate.

About 20 mg of highly pure FcR9_F_Cys was obtained by the purification.

Example 4 Preparation of FcR36i Amino Acid Substitution The Fc binding protein FcR36i in which 36 amino acid substitutions were made to the Fc binding protein containing the native human FcγRIIIa extracellular region shown in SEQ ID NO: 2 was prepared. FcR36i is a Fc-binding protein containing the extracellular region of natural human FcγRIIIa shown in SEQ ID NO: 2, in which the glutamic acid at position 37 (corresponding to position 21 in SEQ ID NO: 1) is changed to glycine and the position at position 39 (23 position in SEQ ID NO: 1). Leucine is equivalent to methionine, 43th (corresponding to 27th in SEQ ID NO: 1) valine is glutamic acid, 45th (corresponding to 29th in SEQ ID NO: 1) isoleucine, and 49th (SEQ ID NO:). 1 corresponds to the 33rd glutamine to proline, 51st (corresponding to the 35th in SEQ ID NO: 1) tyrosine to asparagine, 56th (corresponding to the 40th in SEQ ID NO: 1) to glutamine, 64 The glutamine at position th (corresponding to position 48 in SEQ ID NO: 1) is arginine, the tyrosine at position 67 (corresponding to position 51 in SEQ ID NO: 1) is histidine, and the glutamine at position 70 (corresponding to position 54 in SEQ ID NO: 1) is For aspartic acid, the 72nd (corresponding to the 56th position in SEQ ID NO: 1) asparagine, the 81st (corresponding to the 65th position in SEQ ID NO: 1) arginine, the 84th position (68th position in SEQ ID NO: 1) Serine to proline, 90th (corresponding to 74th in SEQ ID NO: 1) tyrosine to phenylalanine, 91st (corresponding to 75th in SEQ ID NO: 1) to isoleucine, 94th (SEQ ID NO: 1 corresponds to the 78th alanine to serine, the 96th (corresponding to the 80th in SEQ ID NO: 1) threonine to serine, and the 108th (corresponding to the 92nd in SEQ ID NO: 1) asparagine to serine, 133 The 13th (corresponding to 117th in SEQ ID NO: 1) valine is glutamic acid, the 135th (corresponding to 119th in SEQ ID NO: 1) lysine is valine, and the 137th (corresponding to 121st in SEQ ID NO: 1) glutamic acid is For glycine, the 138th (corresponding to the 122nd in SEQ ID NO: 1) aspartic acid, the 148th (corresponding to the 132nd in SEQ ID NO: 1) arginine to the 156th (140th in SEQ ID NO: 1) (Corresponding) threonine to methionine, 157th (corresponding to 141st in SEQ ID NO: 1) tyrosine to phenylalanine, 163rd (corresponding to 147th in SEQ ID NO: 1) to valine, 174th (SEQ ID NO: 1) Then, the tyrosine of 158th corresponds to valine, and the 181st (165th in SEQ ID NO: 1) Lysine to glutamic acid, 187th (corresponding to 171st in SEQ ID NO: 1) phenylalanine to serine, 192nd (corresponding to 176th in SEQ ID NO: 1) to isoleucine, 194th (SEQ ID NO: 1) Serine at position 178) is arginine, 196th (corresponding to position 180 in SEQ ID NO: 1) asparagine is lysine, 200th (corresponding to position 184 in SEQ ID NO: 1) is glycine, and position 201 is glycine. Threonine (corresponding to the 185th position in SEQ ID NO: 1) is alanine, 203th (corresponding to the 187th position in SEQ ID NO: 1) asparagine, and 206th (corresponding to the 190th position in SEQ ID NO: 1) isoleucine It is an Fc-binding protein in which valine has amino acid substitutions. In the present specification, the 36 amino acid substitutions at the specific position may be referred to as “FcR36i amino acid substitution”.

The amino acid sequence of FcR36i is shown in SEQ ID NO: 13, and the sequence of the polynucleotide encoding FcR36i is shown in SEQ ID NO: 14, respectively. A polynucleotide sequence in which restriction enzyme (NcoI and HindIII) sites were linked to a polynucleotide sequence (SEQ ID NO: 14) encoding the amino acid sequence of FcR36i (SEQ ID NO: 13) was prepared by total synthesis (Fasmac Co., Ltd.), and a conventional method was used. After treatment with a restriction enzyme, the product was ligated to pETMalE (JP 2011-206046A), and E. coli BL21(DE3) strain was transformed with the ligation product to obtain a transformant expressing FcR36i. An FcR36i expression vector pET-FcR36i was obtained by extracting an expression vector from the transformant. In SEQ ID NO: 13, the 1st methionine (Met) to the 26th alanine (Ala) are MalE signal peptides (oligopeptides consisting of amino acid residues 1 to 26 of UniProt No. P0AEX9), and 27 The lysine (Lys) to the methionine (Met) at the 32nd position is a linker sequence, and the 33rd glycine (Gly) to glutamine (Gln) at the 208th position is the amino acid sequence of FcR36i (from 17th position in SEQ ID NO: 1). (Corresponding to the 192nd region), 209th to 210th glycines (Gly) are linker sequences, and the 211st to 216th histidines (His) are tag sequences.

Example 5 Production of Fc-binding protein (FcR36i_Cys) of the present invention to which a cysteine tag is added (1) Expression vector pET containing the polynucleotide (SEQ ID NO: 14) encoding FcR36i (SEQ ID NO: 13) produced in Example 4 PCR was performed in the same manner as in Example 2(1) using -FcR36i as a template. In addition, the primer in PCR is SEQ ID NO: 15 (5'-CATATGAAAATAAAAAACAGGTGCACCGCATCCTCCGCATTTATCCCGCATTAACGAC-3') and SEQ ID NO: 16 (5'-CCCAAGCTTTCCGCAGGTTATCGGTCGCGGCACCCTTGGGCCTAGCTGTAGGAGACACCTGTAGGTAGACGTAGTAGCTAGGTAG).

(2) The polynucleotide obtained in (1) was purified, and transformants expressing the expression vectors pTrc-FcR36i_Cys and FcR36i_Cys were obtained by the same method as in Examples 2(2) and (3).

(3) The pTrc-FcR36i_Cys nucleotide sequence was analyzed by the same method as in Example 2(4).

The amino acid sequence of the polypeptide expressed by the expression vector pTrc-FcR36i_Cys is shown in SEQ ID NO:17, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO:18.

In SEQ ID NO: 17, the 1st methionine (Met) to the 22nd alanine (Ala) are modified PelB signal peptides (olipropeptides consisting of amino acid residues 1 to 22 of UniProt No. P0C1C1). However, it is an oligopeptide in which 6th proline is replaced with serine as an amino acid, and the 24th glycine (Gly) to the 199th glutamine (Gln) is the amino acid sequence of the Fc-binding protein FcR36i (33rd of SEQ ID NO: 13). To the 208th region), and the 200th glycine (Gly) to the 207th glycine (Gly) is a cysteine tag sequence.

Example 6 Preparation of FcR36i_Cys The procedure of Example 3 (1) to (7) was repeated except that the transformant expressing FcR36i_Cys prepared in Example 5 was used, and about 20 mg of highly pure FcR36i_Cys was prepared. Obtained.

Example 7 Measurement of antibody adsorption amount with porous hydrophilic polymer particles (FcR9_F)-immobilized porous hydrophilic polymer particles (antibody adsorbent of the present invention) (1) Presence on the surface of porous hydrophilic polymer particles having a particle diameter of 10 μm The activated hydroxyl group was activated with an iodoacetyl group, and then the activated gel was reacted with FcR9_F_Cys prepared in Example 3 to obtain an FcR9_F-immobilized gel.

(2) PBS (Phosphate Buffered Saline) (pH 7.4) was added so as to form a 50% slurry with respect to 1 mL of the immobilized gel prepared in (1).

(3) After homogenizing the prepared slurry, 100 μL of the slurry (5 for the immobilized gel)
0 μL) was added to a spin column (Cosmo Spin Filter H 0.45 μm, manufactured by Nacalai Tesque) and centrifuged at 3000 rpm for 1 minute to prepare a suction dry gel.

(4) 150 μL of PBS was added to the suction dry gel, and the mixture was centrifuged at 3000 rpm for 1 minute. The gel was washed by repeating this operation three times.

(5) To the gel after washing, 150 μL of PBS and human immunoglobulin (globulin muscle injection 1500 mg/10 mL “JB”, manufactured by Japan Blood Products Organization) were sequentially added, and the gel was obtained by stirring at 25° C. for 2 hours. Immunoglobulin (antibody) was adsorbed.

(6) After the adsorption operation of (5), the spin column was centrifuged at 3000 rpm for 1 minute to separate the solution containing the unadsorbed antibody and the gel.

(7) 150 μL of PBS was added to the gel, and the gel was centrifuged at 3000 rpm for 1 minute. The gel was washed by repeating this operation three times.

(8) Add 150 μL of 50 mM citrate buffer (pH 3.0) to the gel, and add 3000 r
It was centrifuged at pm for 1 minute. By repeating this operation three times, the antibody adsorbed on the gel was eluted. The concentration of the antibody was calculated by measuring the absorbance of the eluate, and the amount of the antibody adsorbed on the FcR9_F-immobilized gel was determined.

The results are shown in Table 2. The amount of antibody adsorbed on 1 g of the immobilized gel was 9.4 mg.

Example 8 Measurement of antibody adsorption amount with porous hydrophilic polymer particles (FcR36i)-immobilized porous hydrophilic polymer particles (antibody adsorbent of the present invention) (1) Except that FcR36i_Cys prepared in Example 6 was used An FcR36i-immobilized gel was obtained by the same method as in Example 7(1).

(2) Using the FcR36i-immobilized gel prepared in (1), the amount of antibody adsorbed on the FcR36i-immobilized gel was determined by the same method as in Example 7 (2) to (8).

The results are shown in Table 2. The amount of antibody adsorbed on 1 g of the immobilized gel was 10.7 mg.

Comparative Example 1 Measurement of Antibody Adsorption by Non-Porous Hydrophilic Polymer Particles Immobilized with Fc Binding Protein (FcR9_F) (1) Other than using non-porous hydrophilic polymer particles having a particle size of 5.8 μm, An FcR9_F-immobilized gel was obtained by the same method as in Example 7(1).

(2) Using the immobilized gel prepared in (1), the amount of antibody adsorbed on the FcR9_F immobilized gel was determined by the same method as described in Example 7(2) to (8).

The results are shown in Table 2. The amount of antibody adsorbed on 1 g of the immobilized gel was 1 mg or less, which was lower than that of the immobilized gel prepared in Example 7. From the results of Example 7 and Comparative Example 1, as an insoluble carrier to be immobilized on the Fc-binding protein, a non-porous hydrophilic polymer particle having a particle diameter of 5.8 μm (Comparative Example 1) and a porous hydrophilic having a particle diameter of 10 μm were used. It can be seen that the amount of antibody adsorbed is higher when the hydrophilic polymer particles (Example 7, one aspect of the present invention) are used.

Comparative Example 2 Measurement of antibody adsorption amount by non-porous hydrophilic polymer particles having Fc binding protein (FcR36i) immobilized (1) Comparative Example 1(1) except that FcR36i_Cys prepared in Example 6 was used. An FcR36i-immobilized gel was obtained by the same method as described above.

(2) Using the immobilized gel prepared in (1), the amount of antibody adsorbed on the immobilized gel was determined by the same method as in Examples 7(2) to (8).

The results are shown in Table 2. The amount of the antibody adsorbed on 1 g of the immobilized gel was 1 mg or less, which was lower than that of the immobilized gel prepared in Example 8. Similar to the results of Example 7 and Comparative Example 1, from the results of Example 8 and Comparative Example 2, as the insoluble carrier to be immobilized on the Fc-binding protein, non-porous hydrophilic polymer particles having a particle diameter of 5.8 μm ( It can be seen that the amount of adsorbed antibody is higher when the porous hydrophilic polymer particles having a particle diameter of 10 μm (Example 8, one aspect of the present invention) are used than in Comparative Example 2).

Example 9 Separation of antibody (Rituxan (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) (1) 3.3 mL of the FcR9_F-immobilized gel prepared in Example 7(1) was placed on a stainless steel column (Tosoh Corporation). The column was connected to an HPLC device (AKTA Avant, manufactured by GE Healthcare) and equilibrated with a 50 mM citrate buffer solution (Buffer A) having a pH of 5.8.

(2) Apply 5 mL of a 1 mg/mL monoclonal antibody (Rituxan, manufactured by Zenyaku Kogyo) whose concentration was adjusted with the buffer used for equilibration of (1) at a flow rate of 0.5 mL/min to immobilize the antibody. It was adsorbed on a gel.

(3) After washing with the buffer used for equilibration in (1) at a flow rate of 0.5 mL/min for 30 minutes, a pH gradient of 50 mM citrate buffer (Buffer B) having a pH of 4.36 (pH 4.40 at 40 minutes). The monoclonal antibody adsorbed on the immobilized gel was eluted with a 4 mM 50 mM citrate buffer (Buffer B) gradient of 100%).

The elution pattern is shown in FIG. The antibody was eluted in the state of being divided into three peaks. So far, it has been shown that an antibody can be separated based on the sugar chain structure by using an adsorbent in which FcγRIIIa is immobilized as an affinity ligand on an insoluble carrier (Patent Document 1), and from the results, the separating agent of the present invention can be separated. Confirmed that antibody separation was possible based on the difference in sugar chain structure. Further, four fractions FrA, FrB, FrC and FrD shown in FIG. 2 were fractionated and used for sugar chain structure analysis (Example 17).

Example 10 Separation of antibody (Rituxan) by the antibody adsorbent (FcR36i, particle diameter 10 μm) of the present invention From Example 9(1), except that the FcR36i-immobilized gel prepared in Example 8(1) was used ( The antibody was separated by the same method as 3).

The elution pattern is shown in FIG. The antibody was eluted in the state of being divided into three peaks, and it was confirmed that the separating agent of the present invention can separate antibodies based on the difference in sugar chain structure.

Comparative Example 3 Antibody (Rituxan) Separation by Fc-Binding Protein-Immobilized Gel (FcR9_F, Particle Diameter 30 to 60 μm) (1) Example 7 (except that porous hydrophilic polymer particles having a particle diameter of 30 to 60 μm were used An FcR9_F-immobilized gel was obtained by the same method as in 1).

(2) Using the immobilized gel prepared in (1), the antibody was separated in the same manner as in Example 9 (1) to (3).

The elution pattern is shown in FIG. Since the antibody was not separated and was eluted as one peak, the particle size was 10 μm smaller than that of the porous hydrophilic polymer having a particle size of 30 to 60 μm (Comparative Example 3).
It can be seen that the separation ability is higher when the porous hydrophilic polymer of m (Example 9, one aspect of the present invention) is used.

Comparative Example 4 Separation of antibody (Rituxan) by Fc-binding protein-immobilized gel (FcR36i, particle size 30 to 60 μm) (1) Same as Comparative Example 3 (1) except that FcR36i_Cys prepared in Example 6 was used. By the method, FcR36i-immobilized gel was obtained.

(2) Using the immobilized gel prepared in (1), the antibody was separated in the same manner as in Example 9 (1) to (3).

The elution pattern is shown in FIG. Similar to the result of Comparative Example 3, since the antibody was not separated and was eluted as one peak, it was more porous than the porous hydrophilic polymer having a particle diameter of 30 to 60 μm (Comparative Example 4) and having a particle diameter of 10 μm. It can be seen that the use of the hydrophilic polymer (Example 10, one aspect of the present invention) has higher separation ability.

Example 11 Separation of antibody (Erbitux (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) Except that Arbitux (manufactured by Merck Serono) was used as the antibody, Examples 9(1) to (3) were used. The antibody was separated in the same manner as in (1).
The elution pattern is shown in FIG. The antibody was separated into approximately three overlapping peaks.
Further, three fractions FrE, FrF and FrG shown in FIG. 6 were fractionated and used for sugar chain structure analysis (Example 18).

Example 12 Separation of antibody (Herceptin (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) Except that Herceptin (manufactured by Roche) was used as the antibody, Examples 9(1) to (3) The antibody was separated in the same manner as in.
The elution pattern is shown in FIG. 7. The antibody was separated into three peaks.
Further, three fractions FrH, FrI and FrJ shown in FIG. 7 were fractionated and used for sugar chain structure analysis (Example 19).

Example 13 Separation of antibody (Cadsyla (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) Examples 9(1) to (3) except that Kadsyla (manufactured by Roche) was used as the antibody. The antibody was separated in the same manner as in.
The elution pattern is shown in FIG. The antibody eluted as one large, broad peak.
Further, three fractions FrK, FrL and FrM shown in FIG. 8 were fractionated and used for sugar chain structure analysis (Example 20).

Example 14 Separation of antibody (Avastin (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) Except that Avastin (manufactured by Roche) was used as the antibody, Examples 9(1) to (3) were used. The antibody was separated in the same manner as in.
The elution pattern is shown in FIG. The antibody was eluted as one large peak and two overlapping peaks.
Further, three fractions FrN, FrO and FrP shown in FIG. 9 were fractionated and used for sugar chain structure analysis (Example 21).

Example 15 Separation of antibody (Humira (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) Except for using Humira (Abvi Godo) as the antibody, the results of Examples 9(1) to (3) The antibody was separated in the same manner as in (1).
The elution pattern is shown in FIG. The antibody was eluted as one large peak and two overlapping peaks.
Further, four fractions FrQ, FrR, FrS and FrT shown in FIG. 10 were fractionated and used for sugar chain structure analysis (Example 22).

Example 16 Separation of antibody (Actemra (registered trademark)) by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) Example 9(1) to (3) except that Actemra (manufactured by Roche) was used as the antibody. The antibody was separated in the same manner as in.
The elution pattern is shown in FIG. The antibody eluted as three overlapping peaks.
Further, three fractions FrU, FrV and FrW shown in FIG. 11 were fractionated and used for sugar chain structure analysis (Example 23).

From Examples 9 and 11 to 16, it was shown that various kinds of antibody drugs can be separated by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm). It was also found that the pattern of antibody drug separation differs depending on the type of antibody drug.

Example 17 Sugar chain structure analysis of an antibody separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) (Rituxan)
(1) The antibodies contained in FrA, FrB, FrC, and FrD of FIG. 2 collected in Example 9 were denatured by heat treatment at 100° C. for 10 minutes, and then sequentially treated with glycoamidase A/pepsin and pronase, and gel A sugar chain fraction was obtained through a purification operation by a filtration method.

(2) After concentrating and drying the sugar chain obtained in (1) with an evaporator, 2-aminopyridine and then dimethylamineborane are allowed to act sequentially in an acetic acid solvent to give a fluorescent labeled sugar chain, which is then subjected to gel filtration. Purified.

(3) The fluorescent labeled sugar chain obtained in (2) was subjected to an anion exchange column (TSKgel DEAE-5PW, φ7.5 mm×7.5 cm: manufactured by Tosoh Corporation) to give a neutral sugar chain fraction and monosialylated sugar. The chain fraction was separated.

(4) The neutral sugar chain fraction and the monosialylated sugar chain fraction obtained in (3) were isolated into individual sugar chains using an ODS column. After obtaining the molecular weight information of the sugar chain isolated by MALDI-TOF-MS analysis, the sugar chain structure was assigned in comparison with the retention time of the ODS column chromatograph.

The results of the assigned sugar chain structure are shown in FIG. 12 and Table 3, and a schematic diagram of the sugar chain structure is shown in Table 4. Compared with the antibody contained in FrA, the antibody contained in FrD had a higher proportion of the antibodies having a galactose-containing sugar chain structure (G1Fa and G2F), and the galactose-free sugar chain structure (G0F) was contained in the terminal. The percentage of antibodies that they had was low.

Example 18 Sugar chain structure analysis of an antibody separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) (Arbitux)
The sugar chain structure was analyzed in the same manner as in (1) to (4) of Example 17, except that the antibodies contained in FrE, FrF, and FrG of FIG. 6 collected in Example 11 were used. It was
The results of the assigned sugar chain structure are shown in FIG. 13 and Table 5. Compared to the antibody contained in FrE, the antibody contained in FrG had a higher proportion of the antibodies having a galactose-containing sugar chain structure (G1Fa and G2F), and the galactose-free sugar chain structure (G0F) was contained in the terminal. The percentage of antibodies that they had was low.

Example 19 Sugar chain structure analysis of antibodies separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) (Herceptin)
The sugar chain structure was analyzed in the same manner as in (1) to (4) of Example 17, except that the antibodies contained in FrH, FrI, and FrJ of FIG. 7 collected in Example 12 were used. It was
The results of the assigned sugar chain structure are shown in FIG. 14 and Table 6. Compared with the antibody contained in FrH, the antibody contained in FrJ contained a higher proportion of antibodies having a galactose-containing sugar chain structure (G1Fa and G2F), and had a galactose-free sugar chain structure (G0F) at the end. The percentage of antibodies that they had was low.

Example 20 Sugar chain structure analysis of antibodies separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) (cadsaila)
The sugar chain structure was analyzed in the same manner as in (1) to (4) of Example 17, except that the antibodies contained in FrK, FrL, and FrM of FIG. 8 collected in Example 13 were used. It was
The results of the assigned sugar chain structure are shown in FIG. 15 and Table 7. Compared with the antibody contained in FrK, the antibody contained in FrM had a higher ratio of the antibody having a galactose-containing sugar chain structure (G1Fa), and the terminal contained a galactose-free sugar chain structure (G0F). The percentage of antibody was low.

Example 21 Analysis of sugar chain structure of antibody separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) (Avastin)
The sugar chain structure was analyzed in the same manner as in (1) to (4) of Example 17, except that the antibodies contained in FrN, FrO, and FrP of FIG. 9 collected in Example 14 were used. It was
The results of the assigned sugar chain structure are shown in FIG. 16 and Table 8. In the antibody contained in FrP, the ratio of the antibody having a galactose-containing sugar chain structure (G1Fa and G2F) is higher in the antibody contained in FrP than in the antibody contained in FrN, and the sugar chain structure not containing a galactose at the end (G0F) is contained. The percentage of antibodies that they had was low.

Example 22 Sugar chain structure analysis of antibodies separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle size 10 μm) (Humira)
Analysis of sugar chain structure by the same method as in (1) to (4) of Example 17 except that the antibodies contained in FrQ, FrR, FrS and FrT of FIG. 10 collected in Example 15 were used. I went.

The results of the assigned sugar chain structure are shown in FIG. 17 and Table 9. Compared with the antibodies contained in FrQ and FrR, the antibodies contained in FrP have a higher proportion of the antibodies having a galactose-containing sugar chain structure (G1Fa and G2F), and the sugar chains having no galactose in the terminal (G0F ) Had a low proportion of antibodies.

Example 23 Sugar chain structure analysis of an antibody separated by linear gradient elution using the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) (Actemra)
The sugar chain structure was analyzed in the same manner as in (1) to (4) of Example 17, except that the antibodies contained in FrU, FrV, and FrW of FIG. 11 collected in Example 16 were used. It was
The results of the assigned sugar chain structure are shown in FIG. 18 and Table 10. Compared with the antibody contained in FrU, the antibody contained in FrW had a higher ratio of the antibody having a galactose-containing sugar chain structure (G1Fa), and had the galactose-free sugar chain structure (G0F) at the end. The percentage of antibody was low.

From Examples 17 to 23, as a result of analyzing the sugar chain structure of the antibody drug separated by the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm), it was found that the antibody eluted later than the sugar chain of the antibody eluted earlier It was found that the sugar chain had a higher proportion of sugar chain structures containing galactose at the end.

From this, an antibody having a sugar chain structure containing galactose at the end strongly binds to FcR9_F and is eluted with a slow elution time when separated on an Fc9_F-immobilized gel (that is, eluted at a low pH), An antibody having a sugar chain structure containing no galactose at the end has weak binding to FcR9_F, and is rapidly eluted when separated with the antibody adsorbent of the present invention (FcR9_F, particle diameter 10 μm) (ie, at a high pH). It will be eluted).

Claims (8)

An antibody adsorbent obtained by immobilizing an Fc-binding protein on an insoluble carrier, wherein the insoluble carrier is a porous hydrophilic polymer particle having a particle size of 7 μm or more and 25 μm or less. The adsorbent according to claim 1, wherein the Fc-binding protein is human FcγRIIIa. The adsorbent according to claim 2, wherein human FcγRIIIa is the protein according to any one of (a) to (f) below.
(A) contains at least the 33rd to 208th amino acid residues of the amino acid sequence of SEQ ID NO: 3, provided that at least the 192nd valine in the 33rd to 208th amino acid residues is replaced with phenylalanine. And a protein having antibody binding activity;
(B) contains at least the 33rd to 208th amino acid residues of the amino acid sequence of SEQ ID NO: 3, provided that at least the 192nd valine in the 33rd to 208th amino acid residues is replaced with phenylalanine. And further has an amino acid sequence containing substitution, deletion, insertion, or addition of 1 or several amino acid residues at 1 or several positions, retains the amino acid substitution of FcR9, and has an antibody binding activity. A protein having
(C) contains at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 3, but has 80% or more homology to the 33rd to 208th amino acid sequence, A protein (d) which retains the amino acid substitution of FcR9, has at least the 192nd valine amino acid substituted with phenylalanine, and has antibody binding activity (d) the amino acid residues 33 to 208 of the amino acid sequence of SEQ ID NO: 13. A protein containing at least a group and having antibody binding activity;
(E) At least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13 are provided, provided that, in the 33rd to 208th amino acid residues, 1 or at 1 or several positions. Alternatively, a protein having an amino acid sequence containing substitutions, deletions, insertions, or additions of several amino acid residues, having the amino acid substitution of FcR36i, and having antibody binding activity;
(F) containing at least the 33rd to 208th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 13, but having 80% or more homology to the 33rd to 208th amino acid sequence, A protein having an FcR36i amino acid substitution and having antibody binding activity The adsorbent according to claim 1, wherein the porous hydrophilic polymer is polymethacrylate. A step of equilibrating a column by adding an equilibration liquid to a column packed with the adsorbent according to any one of claims 1 to 4, and adding a solution containing an antibody to the equilibrated column to add the antibody to the column. A method for separating an antibody, comprising a step of adsorbing to an adsorbent and a step of eluting the antibody adsorbed to the adsorbent with an eluent. The method for producing an antibody drug according to claim 5, further comprising a step of collecting a fraction containing an antibody eluted with an eluent. A method for separating an antibody according to the method of claim 5 depending on the difference in sugar chain structure. The method according to claim 7, wherein the difference in sugar chain structure is due to the difference in the amount of galactose at the terminal.