JP2020015668A - Skin composition - Google Patents

Abstract

To provide compositions for administration to keratinocytes of the skin.SOLUTION: Provided is a composition for preventing cell aging of skin keratinocytes, which comprises an isolated recombinant full-length CLSP polypeptide as an active ingredient and in which CLSP polypeptide is delivered to basal layer keratinocytes at a concentration of 5 to 100 nM. Also provided is a composition for promoting CLSP expression in basal layer keratinocytes, which contains one or more plant extracts selected from the group consisting of Tussilago farfara flower extract, Valeriana fauriei Briq. root extract, Carthamus tinctorius flower/stem extract, Fallopia japonica root extract, Ocimum tenuiflorum leaf extract, and Angelica acutiloba var. sugiyamae Hikino root extract, or contains as an active ingredient one or more compounds selected from the group consisting of 8-cineole, hexyl acetate, linalool, linalyl acetate, and ethyl butyrate.SELECTED DRAWING: Figure 2

Description

  The present invention relates to skin keratinocytes and CLSP proteins.

  The epidermis of the skin is mainly composed of cells called keratinocytes. Keratinocytes proliferating in the basal layer, which is the innermost layer of the epidermis, move so as to be pushed outward (to the surface of the skin), and are separated into a spiny layer, a granular layer, and a stratum corneum in this order. It will become. That is, the epidermis is composed of multiple layers of keratinocytes with different degrees of differentiation. Keratinocyte proliferation or cell division usually occurs only in the basal layer (including the deepest monolayer and the adjacent suprabasal layer), and cell division occurs without cell division outside the spinous layer Only progress.

  Calmodulin-Like Skin Protein (CLSP) is a calcium-binding protein produced mainly in the skin. Non-Patent Document 1 discloses that CLSP expression is not detected in proliferating keratinocytes, but at the late stage of keratinocyte differentiation, that is, on the 6th to 7th days after differentiation, which is the time after the expression of loricrin has already started. Is expressed. Loricrin is a gene whose expression starts when keratinocytes move to the granular layer. Similarly, Non-Patent Document 2 also describes that the CLSP protein is absent in the basal layer and abundantly present in the differentiated outer epidermis. Non-Patent Document 2 also describes that lack of CLSP by shRNA had no effect on basal layer cell proliferation. Therefore, CLSP is thought to be involved in terminal differentiation (keratinization) of keratinocytes.

  It has been reported that CLSP levels increase in skin damaged by sunlight irradiation and in psoriatic skin (Non-Patent Documents 3 and 4).

  Patent Document 1 describes that when β-endorphin or a β-endorphin mimetic (cocoa bean extract) is administered to the epidermis, expression of three factors, CLSP, loricrin, and type I transglutaminase, is simultaneously enhanced. ing. Because all three of these factors are involved in the differentiation / keratinization of keratinocytes, Patent Document 1 discloses based on this finding that β-endorphin or β-endorphin in a cosmetic composition for enhancing the barrier function of the skin -Propose the use of endorphin mimetics.

  U.S. Patent No. 6,064,064 describes a full-length polypeptide for CLSP. Patent document 2 further states, "For example, in cosmetics, in the treatment of aging, in particular in the treatment of skin aging, in the treatment of skin damage associated with exposure to ultraviolet light, the normal or pathological epithelial proliferation. The protein of the present invention can be used to regulate dysfunction or epithelial differentiation failure (dry skin, hyperkeratosis, dyskeratosis, psoriasis, ichthyosis, neoplasia, etc.) " are doing. However, although "aging of the skin" etc. is an ambiguous concept, what kind of "treatment" means how to cure the symptoms, and in what specific form the protein is used, It is not clear whether treatment will be achieved.

Patent Document 3 describes a conventional finding that “observed an increase in expression of mRNA encoding a CLSP protein in the skin of an old individual as compared to the skin of a young individual”, and then described “the present inventors. Noticed, unexpectedly, a decrease in the expression of a particular form of CLSP in the stratum corneum of the aging human epidermis. Quite obviously, the form characterized by the inventors has been considered to date. Corresponding to a different stage of protein maturation than those in the form of CLSP and especially those in the form of CLSP mentioned above (underlined by the quoter). That is, although it was known that the expression of CLSP in general increased in the epidermis with aging, Patent Document 3 discovered that only a specific form of expression decreased with aging, and based on that finding, the “specific Is used as a marker for the state of aging over time.

  The “specific form” of the CLSP in the invention of Patent Document 3 is “complex form of CLSP”. This is a "multimer resulting from the association of complete CLSP with itself or a fragment thereof, or at least one target protein", which runs "clone DB15C9 as a capture antibody and clone DB7G12 as a detection antibody. "Compound form of CLSP" identified by enzyme-linked immunosorbent assay.

  US Pat. No. 6,037,064 further mentions "a method of using an effective amount of a complex according to the invention cosmetically as an agent useful for preventing and / or treating the signs of skin aging". However, the cosmetic use of this CLSP complex, which is a concept distinct from CLSP in general and which is identified by detection by a specific assay using a specific monoclonal antibody, depends on what It is not clear what this means.

  Other than skin, Patent Document 4 describes a pharmaceutical composition containing CLSP as an active ingredient for suppressing nerve cell dysfunction or nerve cell death associated with Alzheimer's disease. This is a pharmaceutical composition based on the discovery that CLSP can act as an agonist of the receptor for humanin, a factor that suppresses neuronal cell death associated with Alzheimer's disease.

JP 2005-47914 A Japanese Patent No. 3851818 Japanese Patent No. 5980469 JP 2012-131711 A

The Journal Of Biological Chemistry, Vol. 275, No. 17, April 28, pp. 12841-12847, 2000 Genes & Development, 2015, 29: 2225-2230 The Journal Of Investigative Dermatology, 119: 3-13, July 2002 Experimental Dermatology 2006: 15: 469-477

  The present inventors have found that administration of the isolated recombinant full-length CLSP polypeptide to keratinocytes at the growth stage prevents cell senescence (senescence). This is an unexpected finding. Conventionally, CLSP is thought to be expressed and function not at the stage of keratinocyte proliferation (physically corresponding to the basal layer) but at the stage of terminal differentiation (physically equivalent to the stratum corneum to stratum corneum). And that only certain complex forms were considered useful for preventing and / or treating the signs of skin aging. The inventors have further found multiple components that can enhance CLSP expression in keratinocytes in the proliferative phase. Embodiments of the present invention are based on these findings.

That is, the present disclosure includes the following embodiments.
[1]
A composition for preventing cell senescence of keratinocytes of skin, comprising an isolated recombinant full-length CLSP polypeptide as an active ingredient, wherein the CLSP polypeptide is contained in a basal layer at a concentration of 5 to 100 nM. A composition that is delivered to keratinocytes.
[2]
The composition according to [1], comprising no polypeptide other than the CLSP polypeptide.
[3]
The composition according to [1] or [2], wherein the cell senescence is cell senescence exhibited by β-galactosidase activity at pH 6.
[4]
The composition according to any one of [1] to [3], wherein the CLSP polypeptide is an E. coli recombinant polypeptide.
[5]
And keratinocytes, and isolated recombinant full-length CLSP polypeptide, in vitro composition comprising an X-gal or _C 12 FDG is a substrate of β- galactosidase activity in pH6 a cellular senescence marker.
[6]
A composition for promoting the expression of CLSP in keratinocytes in the basal layer of the skin, comprising a coltsfoot flower extract, a valerian root extract, a safflower flower / stem extract, a knotweed root extract, and a holy basil leaf extract , And one or more plant extracts selected from the group consisting of beetle root extracts as active ingredients.
[7]
The composition according to [6], comprising a combination of two or more of the plant extracts as an active ingredient.
[8]
The composition according to [7], comprising a coltsfoot flower extract and valerian root extract, a coltsfoot flower extract and a safflower flower / stem extract, or a combination of a valerian root extract and a safflower flower / stem extract.
[9]
A composition for promoting the expression of CLSP in keratinocytes in the basal layer of the skin, comprising at least one selected from the group consisting of 1,8-cineole, hexyl acetate, linalool, linalyl acetate, and ethyl butyrate. A composition comprising the compound of the formula (1) as an active ingredient.
[10]
The composition according to [9], comprising a combination of two or more of the compounds as an active ingredient.
[11]
The composition according to [10], comprising 1,8-cineole and hexyl acetate, 1,8-cineole and linalool, or a combination of hexyl acetate and linalool.
[12]
A multi-component composition for promoting the expression of CLSP in keratinocytes in the basal layer of the skin, comprising: the composition according to any one of [6] to [8]; A multi-component composition comprising: a composition according to any of the preceding claims.

FIG. 1A shows the expression of endogenous CLSP protein at 6, 9 and 13 days after seeding of normal human epidermal keratinocytes. FIG. 1B shows that normal human epidermal keratinocytes (+) exposed to hydrogen peroxide at 24 and 72 hours after seeding had CLSPs 15 days after seeding compared to cells not treated with hydrogen peroxide (−). This shows that the expression level was increased. FIG. 1C shows that CLSP expression levels of normal human epidermal keratinocytes (+) irradiated with ultraviolet light 2 days and 4 days after seeding are several days later than those of cells without ultraviolet light irradiation (−). Indicates that FIG. 2 shows the effect of the isolated recombinant full-length CLSP polypeptide on cell senescence of keratinocytes represented by SA-βgal activity. Significant cell senescence was induced in cells treated with hydrogen peroxide (+) compared to cells treated with hydrogen peroxide (-), but administration of isolated recombinant full-length CLSP polypeptide (CLSP) It has been shown that aging was suppressed. FIG. 3 is an experiment similar to FIG. 2 and shows the results of testing the effects of N-terminal-deleted CLSP polypeptides ΔN2 and 14-3-3σ in addition to the recombinant full-length CLSP polypeptide (CLSP). FIG. 4 is also an experiment similar to FIG. 2 and shows the results when the recombinant full-length CLSP polypeptide (CLSP) is administered in a mixture with 14-3-3σ. FIG. 5 is an experiment similar to FIG. 2 and shows the results of testing the effect of blocking gp130 with an anti-gp130 antibody (Antigp130) before administration of the recombinant full-length CLSP polypeptide (CLSP). FIG. 6 shows the results of performing the same experiment as in FIG. 3 by inducing cell senescence by ultraviolet rays instead of hydrogen peroxide.

  In one aspect, the present disclosure provides a composition for preventing cellular senescence of keratinocytes of the skin. Cell senescence is an irreversible growth arrest state that occurs in normal cells that had previously had the ability to proliferate.

One of the characteristics of cells undergoing cell senescence is the expression of pH-dependent β-galactosidase activity. That is, cells that have entered cell senescence express β-galactosidase activity at pH 6, which is not found in non-senescent cells or simply temporarily quiescent or immortalized cells. This is called cell senescence-associated β-galactosidase (SA-βgal) activity. SA-βgal is most typically detected by X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside), which is a substrate for β-galactosidase. X-gal exhibits a blue color when degraded by SA-βgal activity, so that cell senescence can be detected microscopically. Another example of a substrate used to detect or measure SA-βgal activity is 5-dodecanoylaminofluorescein di-β-D-galactopyranoside (C ₁₂ FDG). C ₁₂ FDG fluoresces when degraded by SA-βgal activity. The phenomenon of cell senescence and SA-βgal activity and its assay method are well known to those skilled in the art and are described in detail, for example, in Nature Protocols, 2009, Vol. 4, No. 12, 1798-1806.

  Thus, in one embodiment, the cell senescence is cell senescence exhibited by β-galactosidase activity at pH 6. Administration of the composition of the present embodiment can achieve prevention of SA-βgal activity as compared to the case where the composition is not administered. Prevention means elimination or reduction of SA-βgal activity expression. The term “administration” in the present disclosure means that the active ingredient of the composition is delivered to living cells, and for example, the act of applying cosmetically to skin tissue may be included in the administration.

  The composition of the present embodiment contains the isolated recombinant full-length CLSP polypeptide as an active ingredient. Polypeptides include proteins and protein fragments. The amino acid sequence of the human-derived full-length CLSP polypeptide is shown in SEQ ID NO: 1 and can also be referred to in the GenBank database at reference number NM_017422.4. The CLSP polypeptide in the present embodiment can be obtained by purifying and isolating the CLSP polypeptide expressed in bacteria, particularly E. coli, by genetic engineering techniques known to those skilled in the art. Is a peptide. A recombinant CLSP polypeptide is an exogenous polypeptide that is distinguished from an endogenous polypeptide. Isolation means purified to a state substantially free of other polypeptides. For example, a sample of an isolated CLSP polypeptide will comprise at least 99% of the polypeptide component by dry weight of the CLSP polypeptide, more preferably at least 99.9% of the CLSP polypeptide.

  It is believed that the recombinant full length CLSP polypeptide so isolated exists in monomeric form. The fact that the CLSP polypeptide is monomeric means that, for example, in addition to being detected as a single band in polyacrylamide gel electrophoresis under denaturing conditions, polyacrylamide gel electrophoresis under native conditions or gel filtration This can be confirmed by detecting a single molecular species corresponding to the monomer in the chromatography. No binding, association, or formation of a complex in a mixture with another type of polypeptide can be confirmed by the same method.

  When a CLSP polypeptide molecule coexists with another polypeptide molecule in a solution, it is inevitable that the molecules may collide with each other and temporarily come into contact with each other, but this is the usual meaning of “binding”, “association”, Alternatively, it is understood by those skilled in the art that it does not correspond to “complex”. Therefore, the composition of this embodiment does not necessarily exclude other polypeptides. However, in any case, it is preferable that the composition of the present embodiment does not contain any polypeptide other than the recombinant full-length CLSP polypeptide. In particular, it is preferable that the composition of the present embodiment does not contain the 14-3-3σ protein. Even when a polypeptide other than the recombinant full-length CLSP polypeptide is contained in the composition, the total mole number thereof is preferably 1/10 or less of the total mole number of the recombinant full-length CLSP polypeptide. , 1/100 or less, more preferably 1 / 1,000 or less.

  The CLSP polypeptide in this embodiment is delivered to keratinocytes in the basal layer at a concentration of 5-100 nM. This concentration is preferably between 5 and 50 nM, more preferably between 5 and 15 nM. The administration mode that can achieve the delivery of the CLSP polypeptide at these concentrations to the basal layer keratinocytes can be appropriately selected by those skilled in the art based on ordinary knowledge. For example, the composition can be delivered directly to the basal layer by intradermal injection or a microneedle.

  The composition of the present embodiment may include a pharmaceutically acceptable carrier in addition to the CLSP polypeptide. A particularly preferred example of such a carrier is water. The composition of this embodiment may include further pharmaceutically acceptable additional components. Examples include, but are not limited to, buffers, inorganic salts, glycerol, animal or vegetable fats, oils, surfactants, colorants, and fragrances. Other examples include, but are not limited to, hyaluronic acid, collagen, ceramide, royal jelly, amino acids, vitamins, plant lipids, and plant extracts. The plant extract or compound described in the following embodiment of the present disclosure is also suitable as an additional component in the composition of the present embodiment. In one embodiment, the composition is free of plant lipids.

  In another aspect, the present disclosure provides a method of making the composition of the above embodiments. The method comprises expressing the full-length CLSP polypeptide in E. coli, lysing the E. coli cells to release the full-length CLSP polypeptide, and purifying the released full-length CLSP polypeptide to obtain the isolated full-length CLSP polypeptide. Obtaining an aqueous solution containing the CLSP polypeptide. Many techniques for purifying a target polypeptide from an E. coli lysate are known to those skilled in the art, and can be appropriately selected in the present embodiment. For example, purification using a CLSP-specific antibody, purification via an affinity tag, purification using the binding / dissolving properties on various affinity columns, purification by cutting out a band from an electrophoresis gel, and methods for these methods Any combination or the like can be used.

In another aspect, the disclosure provides a keratinocyte, the isolated recombinant full-length CLSP polypeptide, and X-gal or _C 12 FDG is a substrate of β- galactosidase activity in pH6 a cell aging markers An in vitro composition comprising the composition is provided. This composition can be useful, for example, in identifying cellular senescence promoting factors, identifying cellular senescence inhibitors, and analyzing their interactions. The concentration of the CLSP polypeptide in the composition can be, for example, but not limited to, 5-100 nM, 5-50 nM, or 5-15 nM. The pH of this composition is preferably 6.0 ± 0.5, more preferably 6.0 ± 0.1. The keratinocytes in this composition may be fixed with a fixative known in the microscopic art, for example, formaldehyde, glutaraldehyde or a combination thereof.

  For example, a compound that inhibits or enhances the anti-cell senescence effect of full-length CLSP polypeptide in proliferating keratinocytes by performing a screening in which the present in vitro composition is mixed with a plurality of candidate compounds, respectively. May be possible.

  According to the above embodiment, in the keratinocytes in the proliferation stage, that is, in the keratinocytes in the basal layer, the action of preventing the cell senescence can be obtained by introducing the monomeric full-length CLSP polypeptide without preparing a specific complex form. Was obtained.

  In another aspect, the present disclosure provides a composition for promoting expression of CLSP in keratinocytes of the skin. The composition of this embodiment is selected from the group consisting of coltsfoot flower extract, valerian root extract, safflower flower / stalk extract, knotweed root extract, holy basil leaf extract, and beetle root extract 1 Contains plant extracts of more than one species as active ingredients. The keratinocytes of the present embodiment may be keratinocytes in either the growth stage or the differentiation stage, but keratinocytes in the growth stage, that is, keratinocytes in the basal layer are particularly suitable.

  A coltsfoot flower extract is a solid obtained by extracting flowers of coltsfoot using an aqueous ethanol solution as an extraction solvent and drying the obtained extract. The ethanol concentration of this aqueous ethanol solution may be, for example, 20 to 80% by weight, preferably 30 to 70% by weight, and more preferably 40 to 60% by weight. An aqueous ethanol solution containing 50% by weight of ethanol is particularly preferred.

  The safflower flower / stem extract, knotweed root extract, holy basil leaf extract, and beetle ibis root extract were prepared by using the above-mentioned ethanol aqueous solution as an extraction solvent, respectively, using safflower flower / stalk, knotweed root, and holy basil. It is a solid obtained by extracting from the leaves and roots of the beetle and drying the resulting extract. Valerian root extract is a solid obtained by extracting from Valerian root using hot water as an extraction solvent and drying the obtained extract. The temperature of the hot water is, for example, 80 ° C. or higher, preferably 90 ° C. or higher, and more preferably 100 ° C. or higher.

  The coltsfoot flower extract is preferably contained in the composition at a concentration of 0.005 to 0.04% by weight, more preferably 0.01 to 0.03% by weight, and even more preferably 0.015 to 0.02% by weight. Can be

  Valerian root extract is preferably contained in the composition at a concentration of 0.001 to 0.01% by weight, more preferably 0.002 to 0.007% by weight, even more preferably 0.003 to 0.005% by weight. Can be

  The safflower flower / stem extract is preferably a composition having a concentration of 0.005 to 0.04% by weight, more preferably 0.01 to 0.03% by weight, and still more preferably 0.015 to 0.02% by weight. Can be included.

  The knotweed root extract is preferably included in the composition at a concentration of 0.001 to 0.01% by weight, more preferably 0.002 to 0.007% by weight, and even more preferably 0.003 to 0.005% by weight. Can be

  The holy basil leaf extract is preferably added to the composition at a concentration of 0.002 to 0.02% by weight, more preferably 0.005 to 0.015% by weight, and even more preferably 0.007 to 0.01% by weight. May be included.

  The beetroot extract is preferably added to the composition at a concentration of 0.01 to 0.1% by weight, more preferably 0.02 to 0.07% by weight, and even more preferably 0.03 to 0.05% by weight. May be included.

  It is particularly preferable that a combination of two or more of the above plant extracts is contained in the composition, since a synergistic effect exceeding the expected result from the sum of the effects of the individual extracts alone can be obtained. In particular, the composition of the present embodiment may include a combination of a coltsfoot flower extract and a valerian root extract, a coltsfoot flower extract and a safflower flower / stem extract, or a combination of a valerian root extract and a safflower flower / stem extract. preferable. When a combination of two or more plant extracts is included in the composition, the content of each extract may be reduced due to this synergistic effect. For example, it can be less than half the concentration described above.

  In another aspect, the present disclosure provides a composition for promoting expression of CLSP in keratinocytes of the skin, comprising a group consisting of 1,8-cineole, hexyl acetate, linalool, linalyl acetate, and ethyl butyrate. Provided are compositions comprising one or more selected compounds as active ingredients. The keratinocytes of the present embodiment may be keratinocytes in either the growth stage or the differentiation stage, but keratinocytes in the growth stage, that is, keratinocytes in the basal layer are particularly suitable.

  1,8-Cineol may be included in the composition at a concentration of preferably 1-10 mM, more preferably 2-7 mM, even more preferably 3-5 mM.

  Hexyl acetate may be included in the composition at a concentration of preferably 0.5-5 mM, more preferably 1-3 mM, even more preferably 2-2.5 mM.

  Linalool may be included in the composition at a concentration of preferably 0.5-5 mM, more preferably 1-3 mM, even more preferably 2-2.5 mM.

  Linalyl acetate may be included in the composition at a concentration of preferably 0.1-1 mM, more preferably 0.2-0.7 mM, even more preferably 0.3-0.5 mM.

  Ethyl butyrate may be included in the composition at a concentration of preferably 1-10 mM, more preferably 2-7 mM, even more preferably 3-5 mM.

  It is particularly preferable that a combination of two or more of the above compounds is contained in the composition, since a synergistic effect exceeding the result expected from the total effect of the individual compounds alone can be obtained. In particular, the composition of the present embodiment preferably contains 1,8-cineole and hexyl acetate, 1,8-cineole and linalool, or a combination of hexyl acetate and linalool. When a combination of two or more of these compounds is included in the composition, the content of each compound may be reduced due to this synergistic effect. For example, it can be less than half the concentration described above.

  A multi-component composition comprising a combination of one or more plant extracts described above and one or more compounds described above is particularly effective in promoting CLSP expression in keratinocytes. For example, a composition containing a coltsfoot flower extract and 1,8-cineole, hexyl acetate, and / or linalool is preferable. Also preferred are compositions comprising 1,8-cineole and coltsfoot flower extract, valerian root extract, and / or safflower flower / stem extract.

  Embodiments of compositions comprising one or more plant extracts as described above and / or one or more compounds as described above may include, in addition to these components, a pharmaceutically acceptable carrier. A particularly preferred example of such a carrier is water. The composition of this embodiment may include further pharmaceutically acceptable additional components. Examples include, but are not limited to, buffers, inorganic salts, glycerol, animal or vegetable fats, oils, surfactants, colorants, and fragrances. Other examples include, but are not limited to, hyaluronic acid, collagen, ceramide, royal jelly, amino acids, proteins, vitamins, plant lipids, and plant extracts. In certain embodiments, the compositions are free of plant lipids.

  Hereinafter, embodiments will be described more specifically with reference to examples, but the present disclosure is not limited to these embodiments.

[General cell culture]
Normal human epidermal keratinocytes (NHEK) were obtained from KURABO INDUSTRIES (product number KK-4009). HuMedia-KG2 (growth medium manufactured by Kurabo Industries, product number KK2150-S) was used as a culture medium. In the experiment in which the polypeptide sample was added, HuMedia-KB2 (containing no growth additive, product number KK2350-S) was used at the time of the addition. Cultures were performed in a 5% CO ₂ incubator at a temperature of 37 ° C. In order to subculture the cells, they were subcultured after diluting to a density of 25 × 10 ⁴ cells per 75 cm ² flask when the cell density reached 60-70% saturation. In order to advance the differentiation of the cells, the culture was continued as it was until the cell density reached saturation (confluency). In each case, the medium was replaced with a fresh medium every two days.

[Expression of endogenous CLSP in normal keratinocytes]
NHEK was seeded at a density of 10 × 10 ⁴ cells / well in a 6-well plate, and the medium was changed every two days. At 6, 9 and 13 days after cell seeding, the cells were washed once with 1 × PBS (phosphate buffered saline) and then washed with IP buffer (20 mM HEPES (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.5% (v / v) Triton® X-100, cOmplete® protease inhibitor cocktail) and collected with a scraper. After sonication of the collected cell suspension to lyse the cells, the lysate was centrifuged to recover the supernatant, which was used as a sample for Western blotting.

  As a primary antibody for labeling CLSP (hCLSP), a rabbit polyclonal antibody recognizing the N-terminus was used. As a primary antibody for labeling β-actin, a rabbit anti-actin (20-33) polyclonal antibody (catalog number A5060) from Sigma-Aldrich was used. An HRP-conjugated goat anti-rabbit IgG antibody was used as a secondary antibody common to both. Specific antigen-antibody binding on Western blots was detected using ECL ™ Western Blotting Reagents (GE Healthcare) containing HRP substrate.

  The results shown in FIG. 1A show that CLSP was not detected in keratinocytes on the sixth day after seeding, whereas on day 9 or later, keratinocytes differentiated and CLSP expression was detected and increased. Is shown. This result is consistent with the descriptions in Non-Patent Documents 1 and 2. The detection amount of β-actin confirms that almost the same amount of cells was loaded in each lane.

[Effects of hydrogen peroxide exposure and UV irradiation]
(Hydrogen peroxide treatment)
At 24 and 72 hours after NHEK cell seeding, cells were treated with 100 μM hydrogen peroxide in KB2 medium for 2 hours. In each case, after the treatment, the cells were washed twice with 1 × PBS and continued to be cultured in the KG2 medium. Medium exchange was performed every two days. After 15 days from the cell seeding, the cells were washed once with 1 × PBS, suspended in an IP buffer, and collected with a scraper. After sonication of the collected cell suspension to lyse the cells, the lysate was centrifuged to recover the supernatant, which was used as a sample for Western blotting.

(UV irradiation)
In the UVA (wavelength 315-380 nm) test, UVA was irradiated at 30 kJ / m2 ^two days after cell seeding. In the UVB (wavelength 280-315 nm) test, UVB was irradiated at 5 kJ / m2 ^two and four days after cell seeding. Medium exchange was performed every two days. At 8, 11 and 14 days after cell seeding, the cells were washed once with 1 × PBS, suspended in IP buffer, and collected with a scraper. After sonication of the collected cell suspension to lyse the cells, the lysate was centrifuged to recover the supernatant, which was used as a sample for Western blotting.

  As shown in FIG. 1B, the expression of endogenous CLSP was increased in the hydrogen peroxide treated sample (+) as compared to the untreated (−) sample. Also, as shown in FIG. 1C, both UVA and UVB irradiation significantly increased the expression of endogenous CLSP.

[Expression and isolation of recombinant CLSP polypeptide]
DNAs encoding the full-length CLSP polypeptide having the amino acid sequence of SEQ ID NO: 1 and the CLSPΔN2 polypeptide having the amino acid sequence of SEQ ID NO: 2 were cloned into a pcDNA3.1 plasmid vector. CLSPΔN2 is obtained by deleting the 2nd to 60th amino acid residues of the full-length CLSP polypeptide, that is, deleting the N-terminal region excluding the first methionine residue. These plasmid constructs were propagated in E. coli and purified. Furthermore, these coding DNAs were subcloned into a pGX4T plasmid vector to produce a GST (glutathione-S-transferase) fusion protein. The fusion polypeptide expressed from the pGX4T construct can be treated with thrombin to separate the GST moiety from the CLSP moiety. After culturing E. coli transformed with the pGX4T construct for one day, the E. coli cells were lysed to collect a cell lysate containing the GST-fused full-length CLSP polypeptide or the GST-fused CLSPΔN2 polypeptide.

  Glutathione beads were added to the recovered cell lysate for binding. After removing other components of Escherichia coli by washing the bead-polypeptide complex on the column, the mixture was treated with thrombin to separate GST and CLSP polypeptide. Thereafter, GST-bound glutathione beads were removed by column purification, and the eluted fraction was collected as a purified recombinant CLSP polypeptide. A gel obtained by electrophoresis (SDS-PAGE) of the sample was subjected to Coomassie staining, and it was confirmed that the recombinant CLSP polypeptide was isolated. The isolated recombinant CLSP polypeptide was further sterilized with a 0.2 μm filter and used for the cell test described below.

  A sample of the recombinant full-length CLSP polypeptide isolated as described above was electrophoresed on an acrylamide gel without the addition of a denaturant, using a polyclonal antibody against the N-terminus of CLSP and a goat anti-rabbit IgG-HRP secondary antibody. Labeling by Western blotting detected a single band. When the same polypeptide as above was heat-denatured at 95 ° C. for 3 minutes and subjected to parallel electrophoresis on the same native gel, both the native and denatured samples showed the same size near the 17 kDa size marker. One band was detected at each position. From these results, it is understood that the isolated recombinant full-length CLSP polypeptide exists in a monomer form.

[Effect of recombinant full-length CLSP polypeptide on cell senescence]
Normal human keratinocytes were seeded at a density of 3 × 10 ⁵ cells / 35 mm dish. Twenty-four hours later, the medium was replaced with serum-free normal human epidermal keratinocyte basal medium (HuMedia-KB2), and the medium was supplemented with BSA (bovine serum albumin) or the isolated recombinant full-length CLSP polypeptide. It was added to a concentration of 10 nM and cultured for 1 hour. Then, PBS (-) without hydrogen peroxide or PBS (+) with hydrogen peroxide was added. Hydrogen peroxide was adjusted to a final concentration of 100 μM. Two hours after the addition of hydrogen peroxide, the cells were washed twice with 1 × PBS (−), the medium was replaced again with a growth medium containing BSA or recombinant full-length CLSP at a final concentration of 10 nM, and cultured for 52 to 56 hours. did.

  Thereafter, the cells were washed once with 1 × PBS (−), and then, Fixative Solution (fixing solution) of the Senescence β Galactosidase Staining Kit (Cell Signaling Technology Japan) was added, and the cells were fixed at room temperature for 15 minutes. Further, after washing twice with 1 × PBS (−), Staining Solution (including X-gal) of the same kit was added, and staining was carried out at 37 ° C. overnight. For each dish, three fields of view were photographed at random using a fluorescence microscope (BZ-8000, KEYENCE CORPORATION) with a magnification of 200 times, and the proportion of cells stained with SA-βgal was measured. The significance test was performed using GraphPad Prism7 (n = 3).

  The results are shown in FIG. This result indicates that cell senescence was significantly promoted in the hydrogen peroxide treated sample (+) as compared with the hydrogen peroxide untreated sample (−). The results show that administration of the recombinant full-length CLSP polypeptide significantly reduced the proportion of cells exhibiting SA-βgal activity, as compared to BSA as a control. Thus, it has been found that administration of the isolated recombinant full-length CLSP polypeptide can suppress or prevent cellular senescence.

  The experiment shown in FIG. 3 tests CLSPΔN2 and 14-3-3σ at the same concentration as the recombinant full-length CLSP polypeptide (CLSP) in the same experiment as described above. 14-3-3σ is a protein that binds to CLSP and controls the late stage of keratinocyte differentiation (Non-Patent Document 2). However, in this experiment, 14-3-3 [sigma] did not show an effect of preventing cell senescence of keratinocytes in the proliferation stage (Fig. 3). CLSPΔN2 showed a slight tendency to prevent cellular senescence, but did not show the clear effect of full-length CLSP polypeptide (FIG. 3).

  In the experiment shown in FIG. 4, the possibility of the influence of the interaction between proteins was tested. When the isolated recombinant full-length CLSP was administered in combination with BSA (each at 10 nM; the same applies hereinafter) (CLSP / BSA), a clear cell aging prevention effect was also observed in the same manner as described above. Such an effect was not obtained with a mixture of BSA and 14-3-3σ (BSA / 14-3-3σ). When 14-3-3σ was combined with the recombinant full-length CLSP (CLSP / 14-3-3σ), the ratio of cells showing cell senescence increased slightly compared to CLSP / BSA. It was suggested that the keratinocytes may have an activity to suppress CLSP in preventing cell senescence.

In the experiment shown in FIG. 5, the effect of the anti-gp130 antibody was tested. gp130 is one of the three subunits that make up the humanin receptor. Patent Document 4 describes that CLSP binds to this receptor like humanin. Normal human keratinocytes were seeded at a density of 3 × 10 ⁵ cells / 35 mm dish. Twenty-three hours after cell seeding, a serum-free normal human epidermal keratinocyte basal medium containing a mouse anti-human gp130 monoclonal antibody (Anti-Human gp130 MAb, R & D Systems, Inc.) or normal mouse IgG at a concentration of 60 ng / mL was prepared. The medium was replaced and the cells were cultured for 1 hour. After 24 hours from the cell seeding, the experiment was performed in the same procedure as the above-mentioned CLSP administration experiment.

  In the experiment of FIG. 5, similarly to the experiment described above, treatment with hydrogen peroxide promoted cell senescence (comparing (+) with (−)), and recombinant full-length CLSP prevented the cell senescence (CLSP ( +) With BSA (+)). When the cells were pretreated with the anti-gp130 antibody, the effect of the recombinant full-length CLSP to prevent cell aging was found to be inhibited (compare CLSP (+) and CLSP / Antigp130 (+)). This inhibition was not seen when normal IgG was used instead of anti-gp130 antibody, so this inhibition is specific for anti-gp130 antibody (compare CLSP / Antigp130 (+) and CLSP / IgG (+)) . These results indicate that the ability of recombinant full-length CLSP to prevent cell aging in proliferating keratinocytes is exerted via a receptor containing gp130, and that blocking the receptor with an anti-gp130 antibody results in loss of the cell aging prevention effect. It is to support.

In the experiment shown in FIG. 6, cell senescence was induced by ultraviolet irradiation instead of hydrogen peroxide exposure, and the effect of recombinant full-length CLSP was examined. First, normal human epidermal keratinocytes were seeded at a cell density of 2 × 10 ⁵ cells / 35 mm dish, and after 24 hours, the medium was replaced with a serum-free normal human epidermal keratinocyte basal medium (HuMedia-KB2), and then BSA, recombinant full-length CLSP polypeptide (CLSP) or ΔN2 (deltaN2) was added to a final concentration of 10 nM, and cultured for 1 hour. Thereafter, the medium was replaced with Hank's Buffer containing a final concentration of 10 nM BSA, recombinant full-length CLSP or ΔN2, and irradiation with UVB was performed at 5 kJ / m ² . After irradiation, the cells were washed with 1 × PBS, the medium was replaced with a growth medium containing BSA, recombinant full-length CLSP or ΔN2 at a final concentration of 10 nM, and cultured for 52 to 56 hours. After washing the cells once with 1 × PBS, Fixative Solution was added to fix the cells at room temperature for 15 minutes. After further washing twice with 1 × PBS, Staining Solution was added and staining was performed at 37 ° C. overnight. For each dish, three fields of view were photographed at random using a fluorescence microscope (BZ-8000, KEYENCE CORPORATION) with a magnification of 200 times, and the ratio of cells stained with SA-βgal was measured.

  In FIG. 6, "-" represents a sample without UV irradiation, and "+" represents a sample with UV irradiation. Essentially the same results were obtained as in the experiment of FIG. Therefore, it was shown that the cell aging prevention effect of the recombinant full-length CLSP was not specific to cell aging caused by hydrogen peroxide.

  In FIGS. 2-6, data are presented as means ± standard error, which are expressed using Excel statistics, ANOVA4 software, or GraphPad Prism 7 (GraphPad Software Inc., La Jolla, Calif.). Analysis was performed by one-way analysis of variance or repeated measures analysis of variance. One-way analysis of variance was followed by Dunnett or Tukey's test.

[Identification of CLSP expression promoter]
A number of compounds and plant extracts were screened for their potential to increase CLSP expression in keratinocytes. Validation experiments for specific compounds and plant extracts found by the screening are described below.

Human epidermal keratinocytes were seeded at a cell density of 3 × 10 ⁵ cells / well in a 6-well plate and cultured overnight in HuMedia-KG2 medium. 1.8-cineole 5 mM, linalool 2.5 mM, linalyl acetate 0.5 mM, hexyl acetate 2.5 mM, ethyl butyrate 5 mM, safflower extract powder 0.2 mg / mL, and beetle corn extract powder 0. 5 mg / mL, holy basil extract powder 0.1 mg / mL, coltsfoot poppo extract powder 0.2 mg / mL, valerian extract powder 50 μg / mL, or knotweed extract powder 50 μg / mL, freshly added and dissolved. The medium was replaced with a medium or a fresh medium to which these substances were not added, and the cells were further cultured for 24 hours. Thereafter, total RNA was extracted from the collected cells using a commercially available RNA extraction kit, and cDNA synthesis was performed. Using the following primers specific to the CLSP gene or GAPDH gene, the gene expression level was quantified by real-time PCR using the Cyber Green method. GAPDH was used as an internal standard.

PCR primer sequence CLSP forward: GTTGACACGGATGGAAACG (SEQ ID NO: 3)
CLSP reverse: ACTCCTGGAAGCTGATTTCG (SEQ ID NO: 4)
GAPDH forward: CCACTCCTCCACCTTTGACG (SEQ ID NO: 5)
GAPDH reverse: CACCCTGTTGCTGTAGCCAA (SEQ ID NO: 6)

  The safflower extract powder used in this experiment is a solid content obtained by drying an extract extracted from flowers and stems of safflower using 50% ethanol as an extraction solvent. The beetle extract powder is a solid content obtained by drying an extract extracted from the roots of beetle using 50% ethanol as an extraction solvent. Holy basil extract powder is a solid content obtained by drying an extract extracted from holy basil leaves using 50% ethanol as an extraction solvent. Coltsfoot extract powder is a solid obtained by drying an extract extracted from coltsfoot flowers using 50% ethanol as an extraction solvent. Valerian extract powder is a solid content obtained by drying an extract extracted from Valerian root using hot water as an extraction solvent. The knotweed extract powder is a solid content obtained by drying an extract extracted from knotweed root using 50% ethanol as an extraction solvent.

  The results are shown in Table 1 below. It was confirmed that administration of these compounds or plant extracts promoted CLSP expression.

  INDUSTRIAL APPLICABILITY The present invention can be used in the industrial fields related to skin beauty, makeup, and health, and in the industrial field related to skin aging research.

Claims (12)

  A composition for preventing cell senescence of keratinocytes of skin, comprising an isolated recombinant full-length CLSP polypeptide as an active ingredient, wherein the CLSP polypeptide is contained in a basal layer at a concentration of 5 to 100 nM. A composition that is delivered to keratinocytes.   The composition of claim 1, wherein the composition does not contain a polypeptide other than the CLSP polypeptide.   The composition according to claim 1, wherein the cell senescence is cell senescence exhibited by β-galactosidase activity at pH 6.   The composition according to any one of claims 1 to 3, wherein the CLSP polypeptide is an E. coli recombinant polypeptide. And keratinocytes, and isolated recombinant full-length CLSP polypeptide, in vitro composition comprising an X-gal or _C 12 FDG is a substrate of β- galactosidase activity in pH6 a cellular senescence marker.   A composition for promoting the expression of CLSP in keratinocytes in the basal layer of the skin, comprising a coltsfoot flower extract, a valerian root extract, a safflower flower / stem extract, a knotweed root extract, and a holy basil leaf extract , And one or more plant extracts selected from the group consisting of beetle root extracts as active ingredients.   The composition according to claim 6, comprising a combination of two or more of the plant extracts as an active ingredient.   The composition according to claim 7, comprising a coltsfoot flower extract and valerian root extract, a coltsfoot flower extract and a safflower flower / stem extract, or a combination of a valerian root extract and a safflower flower / stem extract.   A composition for promoting the expression of CLSP in keratinocytes of the basal layer of the skin, comprising at least one selected from the group consisting of 1,8-cineole, hexyl acetate, linalool, linalyl acetate, and ethyl butyrate A composition comprising the compound of the formula (1) as an active ingredient.   The composition according to claim 9, comprising a combination of two or more of the compounds as an active ingredient.   11. The composition of claim 10, comprising 1,8-cineole and hexyl acetate, 1,8-cineole and linalool, or a combination of hexyl acetate and linalool. A multi-component composition for promoting the expression of CLSP in keratinocytes of the basal layer of the skin, wherein the composition according to any one of claims 6 to 8 and the composition according to any one of claims 9 to 11. A multi-component composition comprising: