JP2020014401A - Rice mutant with high content of indigestible starch, rice flour, indigestible starch, rice gel, food, and texture improver, as well as production method of rice mutant with high content of indigestible starch - Google Patents

Abstract

To provide a rice mutant with a high content of indigestible starch without using genetic recombination techniques.SOLUTION: A non-genetically modified rice mutant in which the locus of rice branching enzyme type IIb (BEIIb) derived from Japonica rice is recessive homozygous and the type IIb (BEIIb) locus is recessive homozygous is obtained. In this double mutant, the activity of BEI and BEIIb is lower than that of the wild type. Further, the rice seed of this double mutant has a higher content of indigestible starch than the parent strain, BEIIb-deficient mutant. Specifically, when rice seeds after rice polishing are cooked, the content of the indigestible starch in cooked rice in not ground state is 60% or more and the content of the indigestible starch in the cooked rice in ground state is 20% or more as well as the content of the indigestible starch in brown rice flour of rice seed is 32% or more.SELECTED DRAWING: Figure 1

Description

  The present invention particularly relates to a rice mutant having a significantly high content of resistant starch (RS), a rice mutant containing a high content of resistant starch, rice flour, resistant starch, rice gel, food, a texture improver, and a resistant improver. The present invention relates to a method for producing a starch-rich rice mutant.

Starch is an insoluble, plant-specific storage polysaccharide. Also, most organisms on earth use starch as a carbohydrate source.
Starch as a chemical substance is a glucose polymer containing a straight chain of glucose with α1,4 and a branched structure with α1,6 glucosidic bonds.
Starch is also a polymer aggregate of amylopectin having a branched structure and amylose mainly composed of linear chains.

  It has been found that at least four enzymes are involved in starch biosynthesis. These four enzymes are ADP glucose pyrophosphorylase (AGPase) which is a substrate supply enzyme, starch synthase (SS) which extends α1,4 glucosidic bond, and a branching enzyme which forms a branched structure composed of α1,6 glucosidic bond ( BE) is a debranching enzyme (DBE) that trims an improperly-located branched structure added by BE to maintain the cluster structure characteristic of amylopectin. Thus, at least four enzymes are involved in starch biosynthesis in plants. It is considered that there are other enzymes involved in starch biosynthesis (see Non-Patent Document 1).

In addition, in higher plants, these enzymes have numerous isozymes and are involved in starch biosynthesis. Isozymes are a group of enzymes having different amino acid sequences that catalyze the same enzyme reaction. For example, rice (Oryza sativa) has 11 types of SS, 3 types of BE, and 4 types of DBE.
In recent years, it has been found that these isozymes share roles depending on tissue specificity or subtle substrate specificity. Elucidation of the function and role of isozymes will lead to elucidation of isozyme functions. Elucidation of the function of isozymes is indispensable for elucidating the overall mechanism of starch biosynthesis in plants.
For this reason, mutants of each isozyme have been conventionally developed. By examining the phenotype of a mutant in which a specific isozyme has been deleted, the function and role of the isozyme can be known.

For example, to clarify the function of each isozyme, mutants already isolated and analyzed in rice include SSI (Non-patent Document 2, Patent Document 1), SSIIa (Non-patent Document 3, Patent Document 2), SSIIIa (Non-Patent Document 4, Patent Document 3), GBSSI (Non-Patent Document 5, Non-Patent Document 11), BEI (Non-Patent Document 6), BEIIb (Non-Patent Document 7), ISA1 (Non-Patent Document 8) ), PUL (Non-Patent Document 9, Patent Document 4), PHO1 (Non-Patent Document 10), and the like.
For some of these mutants, the structure and properties of starch accumulated in seed endosperm have been clarified. Specifically, it may be different from the wild type, and may exhibit physical properties such as a difference in starch grain size, hot gelatinization temperature, and hot gelatinization viscosity due to the difference in structure. This has clarified the function of each enzyme to some extent.

On the other hand, starch includes a starch which is easily digested by α-amylase and the like, and a hardly digestible starch which is hardly digested. Resistant Starch (Resistant Starch, RS) is a starch that is hardly decomposed by digestive juice and reaches the large intestine through the small intestine as a polymer.
Indigestible starch reaches the large intestine with a relatively high molecular weight, secretes short-chain fatty acids through fermentation by intestinal bacteria, prepares the large intestine environment, and has the effect of preventing colon cancer and constipation. Reference 13) and wheat (Non-patent Reference 14). For this reason, barley grit and the like containing a large amount of resistant starch have already been commercialized in Australia.
In addition, indigestible starch is less likely to be decomposed into glucose in the small intestine and thus has a calorie-off effect. Indigestible starch is often contained in starch having a high amylose content. For this reason, high amylose corn is used as a diet material.
As described above, it is recommended that indigestible starch be ingested as a food having a function similar to dietary fiber.

In rice, ordinary cooked rice contains indigestible starch, but the ratio is often only about 1%.
In this regard, in each of the above rice mutants having mutations in enzymes involved in starch biosynthesis, the rice mutant lines showing higher amylose properties than the wild type showed significantly higher resistant starch levels than the wild type. Was. On the other hand, a mutant which lacked the branching enzyme BEIIb (hereinafter, referred to as "be2b") showed a significantly high indigestible starch amount. In be2b, the amount of resistant starch increases dramatically. Specifically, it has been found that an increase in the long chain of amylopectin and an increase in amylose lead to indigestibility. (Non-Patent Document 12).

Therefore, transgenic rice (Non-Patent Document 15 and Non-Patent Document 16) in which the expression level of BEIIb is reduced in order to increase the resistant starch is disclosed.
However, in the methods described in Non-Patent Document 15 and Non-Patent Document 16 in which the content of resistant starch in rice is increased, practical use is difficult due to the use of a genetic recombination technique.

  In this regard, a be2b strain of rice (Non-Patent Documents 20, 21 and Patent Document 5) that does not use recombination techniques has also been created.

JP 2003-079260 A JP 2005-269928 A JP 2006-051023A JP-A-2007-020475 JP 2012-019742 A JP 2009-254265 A

Y. Nakamura, Towards a better understand of the metabolic system for amylectin biosynthesis in plants: rice endosperas asa model. , Plant Cell Physiol. , Japan, Japan Society of Plant Physiology, 2002, 43, p. 718-725 N. Fujita et al., Function and Characterization of Starch Synthase Iusing Mutants in Rice. , Plant Physiol. U.S.A., American Society of Plant Biology, 2006, 140, p. 1070-1084 Y. Nakamura et al., Essential amino acids of search synthase IIa differentate amylectin structure and start qualitative qualitative amicadic amicadic anicandica nicadica nicadica nicadica nicotine. , Plant MoI Biol. 2005, 58, p. 213-227 N. Fujita et al., Characterization of SSIIIa-specific mutants of rice (Oryza sativa L.); the function of SSIIIa and the derivative physics effect III. , Plant Physiol. U.S.A., American Society of Plant Biology, April 2007, 144, 4, p. 2009-2023 Y. Sano, Differential regulation of waxy gene expression in license endosperm. , Theor Appl Genet, 1984, 68, p. 467-473 H. Satoh et al., Starch-branching enzyme I-definition mutating specialties effects the structure and properties of search inrice endorsper. , Plant Physiol. American Society of Plant Biology, USA, 2003, 133, p. 1111-1121 A. Nishi et al., Biochemical and genetic analysis of the effects of amylose-extender mutation in rice endosperm. , Plant Physiol. American Society of Plant Biology, 2001, 127, p. 459-472 Y. Nakamura et al., Correlation between activities of starch debranching enzyme and α-polyglucan structure in endosperms of sugary-1 mutants. Plant J .; Blackwell, 1997, 12, p. 143-153 N. Fujita et al., Characterization of PUL-specific Mutants of Rice (Oryza sativa L.) and the function of PUL on the other biosynthesis education. , J Exp Bot. Oxford University Press, March 2009, 60, 3, p. 1009-1023 H. Satoh et al., Plasticic α-glucan phosphorylation mutation drastically effects the synthesis and structure of search in rice endosperm. Plant Cell, United States, American Society of Plant Biologist, 2003, 20, p. 1833-1849 M. Isshiki et al., A Naturally Occurring Functional All of the Rice Waxy Locus Hasa GT to TT Mutation at the 5'splice site of the first year. 133-138 Tsukii et al., Alterations of Starcht Structure Lead to Incremented Resistant Starch of Steamed Rice, Identification of High-Res. 88-92 Bird AR other, A novel barley cultivar (Himalaya 292) with a specific gene mutation in starch synthase IIa raises large bowel starch and short-chain fatty acids in rats, Journal of Nutrition, 2004 years, 134, p. 831-835 Regina A et al., High-amylose what generated by by RNA interference improves indices of large-bowel health in rates, Procedings of National ed. 3546-3551 Butardo VM, etc., Impact of down-regulation of search branching enzyme IIb in by by artifical microRNA- and annual joint RNA-related original RNAi-associated RNA-related RNA-associated RNAi 4927-4941 Zhu L et al., High-amylose rice improves indices of animal health in normal and diabetic rats, Plant Biotechnology Journal, 2012, 10, p. 353-362 Wang ZY et al., The amylose content in rice endosperis is related to the post-transscriptional regulation of the waxy gene, The Plant Journal, 19th, 1992, The Plant Journal. 316-622 Aiko Nishi et al., Endosperm starch properties of double mutation of rice branching enzyme (BE), Journal of Applied Glycoscience, 2008, Vol. 55, (3), Suppl. , P. 43 Naoko Fujita et al., Aiming at Regional Dissemination of Low Calorie Functional Rice -Development of Cooking Methods and Simplification of Cultivation-, Akita Prefectural University Web Journal B, 2017, 4, p. 158-163 Asai H et al., Definitions in both search synthase, (SS) IIIa and branching enzyme IIb lead to significant increasion in a case of scholarship 5497-5507 Itoh Y other, Characterization of the endosperm starch and the pleiotropic effects of biosynthetic enzymes on their properties in novel mutant rice lines with high resistant starch and amylose content, Plant Science, 2017 years, 258, p. 52-60. Wada T, et al., Development and Characterization of a New Rice Cultivar, 'Chikushi-kona 85', Derived From Starch-Branching Enzyme Recruitment18. 17069

However, in each of the BEIIb-deficient mutants including the be2b strain described in Non-Patent Document 12, the content of resistant starch was about 15 to 25% when measured on cooked rice. In addition, the be2b strain was low in practicality due to small seeds and poor cookability. In fact, the specific sale of rice containing resistant starch has been limited and has not led to mass production.
In order to obtain higher functionality, rice varieties that can be grown on a large scale and contain as much resistant starch as possible were required. For this reason, there has been a demand for a highly practical non-genetically modified rice mutant that contains a large amount of indigestible starch, can be cultivated on a large scale, and has a high yield.

  The present invention has been made in view of such a situation, and has as its object to solve the above-mentioned problems.

The rice mutant with high indigestible starch of the present invention has a rice homozygous rice branching enzyme type I (BEI) and type IIb (BEIIb) locus derived from japonica rice, which is recessive homozygous (be1 / be2b). It is characterized by being fixed and non-genetically modified.
The resistant rice starch-rich mutant of the present invention is characterized in that the activity of the BEI and the BEIIb is lower than that of the wild type.
The rice starch-rich mutant of the present invention is characterized in that the rice seed after milling has a higher percentage of resistant starch than the parent strain, BEIIb-deficient mutant (be2b).
The rice mutant high in resistant starch of the present invention is characterized in that when the rice seed is cooked, the content of the resistant starch in the cooked rice in a non-ground state is 60% or more, and in the ground rice in a ground state. The content of the indigestible starch is 20% or more, and the content of the indigestible starch in the brown rice flour of the rice seed is 32% or more.
The rice mutant high in resistant starch of the present invention is characterized in that the starch produced from the endosperm of the rice seed is different from the starch produced from the endosperm of the rice seed of the BEIIb-deficient mutant (be2b), which is the parent line. In the amylopectin chain length distribution, DP19 or less is reduced and DP20 or more is increased.
In the rice mutant containing a high content of resistant starch, the starch produced from the endosperm of the rice seed is higher than the starch produced from the endosperm of the rice seed of the BEIIb-deficient mutant (be2b), which is the parent line. And a gelatinization peak temperature higher by 7 ° C. or more.
The resistant rice starch-rich mutant of the present invention is characterized in that the starch produced from the endosperm of the rice seed has a calculated amylose ratio of 50% or more.
The rice mutant high in resistant starch of the present invention is characterized in that the rice seed can be used as rice gel by powdering and stirring rice porridge.
The rice flour of the present invention is characterized by being produced by pulverizing the endosperm of the rice seed of the resistant rice starch-rich rice mutant.
The resistant starch of the present invention is characterized by being extracted from cooked rice of the rice seed of the resistant rice rice mutant and / or the rice flour.
The rice gel of the present invention is characterized by being manufactured by stirring the rice seed porridge of the rice mutant containing a high content of resistant starch.
The food of the present invention is characterized by being produced by including any one or any combination of the rice seed, the rice flour, the resistant starch, and the rice gel of the resistant rice-rich rice mutant. And
The texture improving agent of the present invention is characterized by containing any one or any combination of the rice flour, the indigestible starch, and the rice gel.
The method for producing the resistant starch-rich rice mutant of the present invention is a double recessive homo mutant of rice branching enzymes type I (BEI) and type IIb (BEIIb) derived from japonica rice by a non-genetically modified method. Is characterized by being genetically fixed.
In the method for producing an indigestible starch-rich rice mutant of the present invention, the last base of the tenth exon of the BEI gene is mutated from guanine to adenine, and the last base of the ninth intron of the BEIIb gene is changed to The double recessive homozygous mutant is specified using a single base substitution mutated from guanine to adenine as a molecular marker.

  According to the present invention, it is possible to provide a rice mutant having a higher content of resistant starch in rice seed and higher practicability than in the past.

Proteins extracted from be1 / be2b (# 1403), their parent mutants be1 (EM557), be2b (EM10), and wild-type (Taichung 65 and Kinnan style) mature endosperm according to an embodiment of the present invention 5 is a photograph showing the result of Western blotting. PCR using molecular markers of be1 / be2b (# 1403), their parent mutants be1 (EM557), be2b (EM10), and wild-type (Taichung 65 and Kinnan style) according to the embodiment of the present invention. FIG. 3 is a diagram showing a DNA band pattern cut with a restriction enzyme after amplification. Shapes and averages of be1 / be2b (# 1403), their parent mutants be1 (EM557), be2b (EM10), and wild-type (Taichung 65 and Kinnan style) mature brown rice according to an embodiment of the present invention It is a figure which shows the brown rice weight. Amylopectin chains of be1 / be2b (# 1403), their parent mutants be1 (EM557), be2b (EM10), and wild-type (Taichung 65 and Kinnan style) endosperm according to an embodiment of the present invention. It is a graph which shows a length distribution (Mol%).

<Embodiment>
Hereinafter, embodiments of the present invention will be described with reference to the drawings.
As described above, there has been a demand for a practical rice mutant from which seeds having a high content of resistant starch can be obtained.
The present inventors have conducted intensive experiments to search for practical rice mutants for the acquisition of resistant starch, thoroughly studied the metabolic system of rice starch, and have a valuable phenotype. We searched for new mutants. At this time, the present inventors paid attention to BEI and IIb type double recessive homo mutants (double mutants, hereinafter referred to as “be1 / be2b”). This is because be1 / be2b, which was conventionally produced on a trial basis, loses its properties without being well examined, and the amount of resistant starch is not known at all.
For this reason, the present inventors have newly created be1 / be2b, and have conducted intensive experiments and examined the properties. Then, the produced be1 / be2b rice seed was found to be an indigestible starch-rich rice mutant having a very high indigestible starch content and high practicality, and completed the present invention. Was.

More specifically, be1 / be2b according to the embodiment of the present invention has a recessive homozygous locus for rice branching enzymes type I (BEI) and type IIb (BEIIb) derived from Japonica rice. And a non-genetically modified product.
The be1 / be2b of the present embodiment can obtain the following properties as compared with the parent mutant (be1, be2b) and the wild type (WT).

From the rice seeds of be1 / be2b according to the embodiment of the present invention, starch having properties and shapes different from those of ordinary rice starch can be obtained. Among these properties, particularly unique are the apparent amylose content and the resistant starch content.
Specifically, the mutant rice of be1 / be2b (rice seed) of the present embodiment has a higher resistant starch content than the parent line be2b. This is unparalleled among conventional non-recombinant rice (Non-Patent Documents 20, 21, 22 and Patent Documents 5, 6).

That is, the rice seed of be1 / be2b according to the embodiment of the present invention, when cooked, contains much more indigestible starch than the conventional rice mutant.
More specifically, when the rice seed after rice polishing in be1 / be2b of the present embodiment is cooked, the content of resistant starch in the cooked rice in a non-ground state is 60% or more, and the cooked rice in a ground state , The content of resistant starch is 20% or more, and the content of resistant starch in brown rice flour of rice seed is 32% or more.
Here, the indigestible starch content of cooked rice varies greatly depending on the cooking method and the measuring method. For example, be1 / be2b is 76.2% of cooked rice which is not ground, but becomes 28.4% when ground. In addition, the indigestible starch content of brown rice flour was 35.1%, all of which were significantly higher than the parent line be2b.

As another feature, the starch produced from the endosperm of the rice seed according to the embodiment of the present invention has a higher amylopectin content than the starch produced using the parental rice (be2b) caused by a decrease in the activity of BEIIb. In the chain length distribution, DP19 or less is reduced and DP20 or more is increased.
That is, as shown in FIG. 4 in Examples described later, starch produced from endosperm of rice seed of be1 / be2b of the present embodiment has a chain length distribution of amylopectin in which DP19 or less decreases and DP20 or more decreases. To increase. This is because the amount of long chain amylopectin is much higher than that of be2b starch, which is much higher than that of normal rice.

Furthermore, the starch produced from the endosperm of the be1 / be2b rice seed according to the embodiment of the present invention has an amylose ratio of 50% or more.
In addition, the starch produced from the endosperm of rice seed of be1 / be2b according to the embodiment of the present invention has a gelatinization peak temperature higher by 7 ° C. or more than the starch produced using be2b.
That is, the rice seed according to the embodiment of the present invention, the rice flour produced from the rice seed, and the starch have different physical properties from be2b because the amount of long chain amylopectin is greater than that of the parent line be2b. And specifically, the gelatinization peak temperature increases.

Here, the rice seeds of be1 / be2b of the present embodiment, the polished rice, rice flour, and starch produced from the rice seeds have a high aging property due to a high amylose content and a long amylopectin long chain. In a cooking method in which cooking properties work advantageously, cooking properties can be enhanced.
Specifically, the rice seed of the present embodiment, the milled rice, the rice flour, and the starch produced from the rice seed are suitable for noodles and rice confections, which are cooking methods in which aging properties are advantageous. More specifically, the rice seed, rice flour, and starch of the present embodiment can be suitably used for foods such as pilaf or risotto, rice crackers, and granola. As a result, it is possible to produce a food having characteristics different in taste, texture, texture, flavor, and the like from the related art. That is, it can be used as a "texture improver". Further, it can be used for various health foods, diet foods, and supplements obtained by purifying indigestible starch using the same.

Furthermore, the rice seed of be1 / be2b according to the embodiment of the present invention is characterized in that it can be used as a rice gel by stirring rice flour and porridge by powdering.
Specifically, the rice seeds of be1 / be2b of the present embodiment can be pulverized by a pulverizer or the like and provided as rice flour. That is, rice flour can be produced by powdering endosperm of rice seeds of be1 / be2b.
Also, by stirring the rice seed porridge of be1 / be2b, it can be used as rice gel.
Rice flour or rice gel, which is a crushed product of be1 / be2b rice seed according to the embodiment of the present invention, can be used by being mixed with bread, noodles, and the like.
At this time, the rice flour and the rice gel of the present embodiment can also be used as a “texture improver” for improving the texture of bread and noodles made with conventional 100% rice flour. The compounding ratio, compounding order, compounding method, and the like when used as the “texture improver” can be arbitrarily set according to the processing method, the manufacturing method, the storage method, and the like.

In addition, the be1 / be2b rice seed itself of the present embodiment can be provided as diet rice as unpolished rice or polished rice. At this time, by blending this diet rice with mochi rice or regular rice, high aging can be alleviated and, while maintaining the amount of indigestible starch, it can be edible as cooked rice with good taste.
In addition, the starch itself extracted from the mutant rice of the present embodiment can be used as a starch containing a large amount of indigestible starch.

More specifically, the food according to the embodiment of the present invention is characterized by being manufactured including any one or any combination of rice seeds of be1 / be2b, rice flour, resistant starch, and rice gel. And
That is, the food using the rice seed of be1 / be2b, the powder, the rice gel, and the like of the present embodiment can be used as a diet material derived from rice such as noodles, bread, pilaf, porridge, rice confectionery, and the like. It is. In addition, these foods are expected to have a low calorie content when taken habitually and to prepare a large intestine environment, which is expected to have effects such as prevention of diabetes, colorectal cancer, and constipation. Furthermore, if a food made of 100% rice flour is developed, it can be provided as a gluten-free food without gluten derived from flour as an effective food for patients with wheat allergy.

Furthermore, the indigestible starch according to the embodiment of the present invention is characterized in that it is extracted from cooked rice and / or rice flour of be1 / be2b rice seeds.
The be1 / be2b of the present embodiment contains many indigestible starch even in cooked rice. For this reason, it becomes possible to easily separate the indigestible starch by dissolving and enzymatically treating the cooked rice. Furthermore, be1 / be2b of the present embodiment contains more indigestible starch even in a crushed state as compared with the conventional system. Therefore, even if resistant starch is extracted from rice flour, a large amount can be obtained practically.
The rice flour and starch of be1 / be2b of this embodiment can be used for industrial applications because of the high amylose content. This is because when molding is required, such as with a biodegradable plastic, a higher aging property is advantageous. For example, since amylose is soluble in warm water, it can be formed into a film and used for applications such as biodegradable films, medical materials, and sutures. In addition, it can be used as a member for “scaffolding” of regenerative medicine by using the property of being absorbed and decomposed in the body.
Furthermore, it can be used for various industrial uses, such as materials for producing glass fiber, industrial paste, compounding agents for building materials, and materials for plant cultivation.

  Here, these rice flour, indigestible starch, rice gel, and food can be directly specified based on the characteristics of the indigestible starch, the contained DNA, and the like.

The method for producing a resistant rice starch-rich mutant according to an embodiment of the present invention includes two methods, a Japonica rice-derived rice branch-forming enzyme type I (BEI) and a type IIb (BEIIb), by a non-genetically modified method. It is characterized in that a severe recessive homozygote is produced and genetically fixed. Thus, by using a non-genetically modified method, BEI is deleted in addition to the deletion of BEIIb derived from Japonica rice, and the BEI is deleted and genetically fixed, so that the indigestible starch content is reduced as compared with the parent mutant and the wild type. Be1 / be2b can be created that is significantly enhanced.
More specifically, the method for producing a rice mutant according to the embodiment of the present invention is characterized in that the last base of the tenth exon of the BEI gene is mutated from guanine to adenine, and the last base of the ninth intron of the BEIIb gene is changed. The double recessive homo mutant is identified by using a single base substitution in which the base is mutated from guanine to adenine as a molecular marker.
As a result of these double mutations, the rice mutant of the present embodiment has lower BEI and BEIIb activities than the wild type.
Specific changes in the phenotype due to the production may be due to the absence of each band by Western blotting, or double amplification from the PCR amplification using molecular markers and the agarose gel electrophoresis pattern of restriction enzyme-cleaved DNA. It is possible to confirm that there is.

With the above configuration, the following effects can be obtained.
As described above, corn, barley, and the like contained strains with high amounts of indigestible starch. However, it has been revealed that the mechanism of starch biosynthesis of these plants is very different from that of rice, and it was unclear whether this mechanism could be applied to rice.

Also, it has been conventionally assumed that starch having a high amylose content contains a large amount of resistant starch. However, it was not known in detail what structure or starch exhibited indigestibility.
On the other hand, a mutant (be2b strain) in which the branching enzyme BEIIb was deleted and the long chain of amylopectin became relatively large (be2b strain) showed that the amount of the long chain of amylopectin was not usually different from that of rice and was higher than that of the strain showing high amylose properties The amount of resistant starch was remarkably large (Non-Patent Document 12). This has revealed that the indigestible starch is derived from the long chain amount of amylopectin rather than the amylose content.

However, in the be2b strain of Non-Patent Document 12, the content of resistant starch was about 15 to 25% when measured with cooked rice.
Here, the calorie intake of indigestible starch is calculated as 2 calories, which is half that of ordinary starch. For this reason, the cooked rice of be2b, which has an indigestible starch content of about 15 to 25%, has only 7.5 to 12.5% of calories off compared to the case of eating cooked rice of a normal variety. Was. Further, although these values are measured without grinding the cooked rice, the content of resistant starch is further reduced because the rice is actually chewed when eating. Furthermore, rice having a high content of resistant starch is not good in taste when cooked as cooked rice, and it is quite difficult to eat it at 100%. Therefore, it is usually eaten in a state blended with rice. Further, it has been found that when used as rice flour, the amount of indigestible starch may be further reduced as compared to when it is eaten as cooked rice, because it is easily digested due to increased exposure to digestive juices.
In view of the above, in order to expect higher functionality when actually ingested, a rice variety that can be cultivated on a large scale and contains as much indigestible starch as possible is required. In this regard, conventional rice mutants containing indigestible starch such as be2b have been less practical.
Therefore, there has been a demand for a non-genetically modified rice mutant having a high content of resistant starch, a high yield, and improved practicality.

On the other hand, the rice mutant containing high resistant starch according to the embodiment of the present invention is a rice mutant having a rare rare starch resistant content.
More specifically, as shown in Table 3 and FIG. 3 in Examples described later, the indigestible starch content of the cooked rice of the present embodiment is lower than that of EM10 which is an example of the conventional be2b. The value is about twice as high, and the content of resistant starch is at least 20%.

Furthermore, the rice seed, rice flour, purified starch, and / or rice gel of the rice mutant high in resistant digestible starch according to the embodiment of the present invention can be used for foods and drinks and industrial products using these.
Specifically, the be1 / be2b rice seed of the present embodiment has a remarkably high indigestible starch content, so that it is possible to reduce the calories by using even a small amount of the food, and to produce a diet food. , Leading to lower costs. More specifically, as described above, the indigestible starch contains 2 kcal / g as compared to 4 kcal / 1 g for a normal carbohydrate. Therefore, by adding the mutant rice of the present embodiment to a food, Calorie intake can be reliably reduced.
In addition, in the case where the rice seed of be1 / be2b of the present embodiment is added as rice flour, purified starch, and / or rice gel to produce a food, the content of resistant starch in the food varies depending on the cooking method. , Can enhance the functionality. When blending, the amount of addition can be reduced as compared with conventional rice.

In addition, the texture improver of the present embodiment, by adding this to existing foods such as bread and noodles, for example, to reduce the viscosity of these foods, so that there is a more "eating response" to enhance the flavor can do. This makes it possible to add the food so that the food texture desired by the food manufacturer is obtained. In addition, the effects desired by the manufacturer can be added when processing and storing the food.
Furthermore, the texture improving agent of the present embodiment is not an additive that is chemically modified like modified starch and is required to be labeled as a food additive. That is, the texture improving agent of the present embodiment can be used not as a food additive but as an additive derived from a natural material. On this basis, it can be expected to have a positive effect on the intestinal flora and promote health.

In addition, EM10, which is an example of the conventional be2b, cannot be used practically because of small seeds, which causes difficulty in rice polishing, and relatively low yield.
On the other hand, the rice seed of the rice mutant according to the embodiment of the present invention has a higher content of resistant starch and a larger seed than EM10, and thus has higher practicality.

In addition, in order to further increase the seed weight of be1 / be2b of this embodiment, it is possible to improve the variety and use the strain (strain).
For example, the present inventors have also carried out breed improvement by backcrossing Akita 63, a super-high-yielding rice, for # 1403 which is a clone (strain, strain) of be1 / be2b shown in Examples described later. As a result, it was confirmed that the seeds were enlarged. That is, these backcrossed lines can be used as rice mutants in other embodiments of the present invention.
It is also conceivable to newly produce a be1 / be2b strain by the above-mentioned method for producing an indigestible starch-rich rice mutant, and to select a strain having better properties.
If a seed with a large seed is obtained in this way, it is a great merit in polishing rice. In addition, since the seeds are large, the yield is high, and this high productivity also contributes to economic efficiency. That is, the cost can be reduced when obtaining indigestible starch or producing food. For this reason, the practicality at the time of actually producing foods or the like or providing it as cooked rice can be improved.

  Hereinafter, embodiments of the present invention will be described with reference to the drawings, but the present invention is not limited to these embodiments.

[Experimental methods and materials]
(Isolation of be1 / be2b double mutant rice)
By crossing the BEI mutant (EM557) with the BEIIb-deficient mutant rice (EM10), a be1 / be2b double mutant rice was produced and its properties were examined.

Hereinafter, a method for producing a be1 / be2b double mutant rice will be described. The present inventors crossed a BEIIb-deficient mutant rice (EM10) with a BEI mutant (EM557) and sowed F1 seeds with a replacement payment in the next fiscal year to obtain F2 seeds. It was estimated that about 25% of the double mutant rice of be1 / be2b was contained therein.
Protein is extracted using 1/4 of the endosperm opposite to the embryo of the cloudy seed and subjected to Western blotting with BEI antibody and BEIIb antibody, and the remaining 3/4 of the embryo side of the seed lacking BEI and BEIIb is extracted. Was sterilized and transferred to an agar medium.
Individuals deficient in the BEI and BEIIb genes were selected from the leaf blades of these young plants by the PCR method, cultivation was continued, and F3 seeds were obtained and named # 1403. In this # 1403, it was confirmed by Western blotting that both proteins were defective.

  The SDS-PAGE technique for western blotting will be described. An acrylamide gel was set in the electrophoresis tank, a migration buffer (25 mM Tris, 192 mM glycine, 0.1% SDS) was poured, and 5 μL of a molecular weight marker (Cat # 161-0373, manufactured by Bio Rad) was prepared in the gel well. Each 10 μL of the sample was applied, and electrophoresis was performed at room temperature. Until the bromophenol blue (BPB) front dye passes through the concentrated gel, a steady current of 10 mA per gel is passed, and after reaching the separation gel, a current of 20 mA is passed per gel to perform electrophoresis. An electric current was applied until the die reached about 1 cm from the bottom of the gel, and the gel was stopped.

  One membrane (PVDF membrane, manufactured by MILLIPORE, IPVH0010) for transferring the proteins separated on the gel by SDS-PAGE and six filter papers are cut to the same size as the gel, and the membrane is 100% methanol. Immersed in a transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, 0.1% SDS). The filter paper was kept soaked in the transfer buffer as it was. The gel subjected to SDS-PAGE was transferred to a plastic case containing a transfer buffer and immersed for 15 minutes. On the anode side of the blotting electrode, three filter papers soaked in a transfer buffer are layered so that bubbles do not enter, a membrane is layered thereon so that bubbles do not enter, and then a gel is layered so that bubbles do not enter. Three filter papers were stacked so that bubbles did not enter. An upper electrode plate (cathode) was set, and a current of 80 mA per one membrane was passed for one hour. One hour later, the power supply was stopped, the membrane was transferred to a plastic container, and 15 mL of a blocking solution (4% skim milk / TBS (10 mM Tris-HCl (pH 7.5), 500 mM NaCl)) was added and immersed for 30 minutes (blocking). ). 30 minutes later, a primary antibody (in this experiment, anti-BEI serum (Non-patent document 6) diluted 1500-fold with 4% skim milk / TBS, and anti-BEIIb serum (Non-patent document 7) diluted 3000-fold) were added. And slowly soaked overnight at 4 ° C.

The next day, the membrane was rinsed three times with about 50 mL of distilled water and washed once with about 50 mL of TBST2 (50 mM NaCl, 1 mM Tris-HCl (pH 7.5), 1% Tween 20). Thereafter, a secondary antibody obtained by diluting anti-rabbit goat serum peroxidase (manufactured by Bio Rad) 5000-fold was added together with 10% of 4% skim milk / TBS and allowed to slowly soak for about 2 hours. Thereafter, the membrane was rinsed three times with about 50 mL of distilled water, washed once with about 50 mL of TBST2, washed once with TBS, immersed in fresh TBS, and used for detection.
A 1 mL of an ECL solution (Pierce West Pico Chrmiluminescent substrate) was applied to the membrane subjected to the Western blotting to develop a color. ) Was used to edit the brightness and contrast of the detected band. After photographing, the membrane was sufficiently washed with distilled water, dried and stored.

  Next, a method for extracting DNA from young plants for PCR selection will be described. About 2 cm of the leaf blade of the young plant transplanted from the medium to the cell tray was transferred to a tube for multi-beads shocker, frozen in liquid nitrogen and crushed with a multi-beads shocker (SPEED METER: 2000 rpm, ON TIME: 5 seconds, OFF TIME). : 0 second, CYCLE: once). 400 μL of a DNA extraction buffer (200 mM Tris-HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA, 0.5% SDS) was added and vortexed, followed by centrifugation at 15,000 rpm at 20 ° C. for 5 minutes. 300 μL of the supernatant was transferred to a new 1.5 mL tube, 300 μL of isopropyl alcohol was added, mixed well, and allowed to stand for 15 minutes. Thereafter, the mixture was centrifuged under the same conditions as described above, and after confirming that there was a translucent precipitate at the bottom of the tube, 1 mL of 70% ethanol was added and stirred, and after centrifugation, the supernatant was removed. The remaining precipitate was dried under reduced pressure, and suspended on ice by adding 25 μL of TE buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA-2Na). Thereafter, it was stored frozen at -30 ° C until used in the experiment.

  The BEI gene of Japonica rice (OsBEI gene, Non-patent Document 6) is composed of 14 exons and 13 introns. The BEI-deficient mutant EM557 has the last base of exon 10 from guanine. Mutated to adenine. The BEI gene of Japonica rice (OsBEIIb gene, Non-Patent Document 7) is composed of 22 exons and 21 introns, and EM10, a BEIIb-deficient mutant, has a ninine intron at the last base. Is mutated to adenine. Using these single base substitutions, molecular markers were developed.

  In order to detect a mutation in EM557, BEI-dCAPS-F (5'TCTCTGCAGTCAAGCTCTGCATTGTTCC3 ') and BEI-ScaI-R (5'GGGCCCACTACTAAATTACAATTGCCAGTAC3') PCR was performed with the enzyme using the primers and the genomic DNA, and the PCR was performed with the enzyme PCR product using the PCR product with PCR enzyme Ia. Processed. Specifically, 5 μL of Quick Taq HS dye mix (manufactured by TOYOBO), 4 μM of each primer, 0.5 μL of each primer, 1 μL of DNA, and 3 μL of distilled water were mixed and mixed at 94 ° C. for 2 minutes × 1 cycle, (94 ° C. for 20 seconds, 50 ° C. PCR was performed for 20 seconds at 68 ° C. for 20 seconds × 38 cycles). 3 μL of PCR product, 1 μL of 10 × restriction enzyme buffer, 0.2 μL of ScaI, and 5.8 μL of distilled water were mixed, and reacted at 37 ° C. for 30 minutes or more. , 0.035% xylenecyanol, 30 mM EDTA) and electrophoresed on 1 × TBE, 15% acrylamide gel. After the electrophoresis, the gel was stained with ethidium bromide and detected with a UV transilluminator. When the BEI had the EM557 mutation, two 173 bp and 30 bp bands were present, and when there was no mutation, a single 203 bp band was present. Obtained.

Similarly, in order to detect the mutation of EM10, PCR was performed using EM10-NlaIV-F (5 ′ GACTATGCAGGAGAAGTACATATTCAAGC3 ′) and BEI-NlaIV-R2 (5′CTGTGAACAACCATCCATGAGCAC3 ′) primer and genomic DNA (Quick Taq). Dye mix (manufactured by TAKARA) 5 μL, 4 μM 0.5 μL of each primer, 1 μL of DNA, and 3 μL of distilled water were mixed, 94 ° C. for 2 minutes × 1 cycle, (94 ° C. for 30 seconds, 50 ° C. for 45 seconds, 68 ° C. for 120 seconds) X 35 cycles). 3 μL of PCR product, 1 μL of 10 × restriction enzyme Buffer, 0.2 μL of NlaIV, and 5.8 μL of distilled water were mixed, reacted at 37 ° C. for 30 minutes or more, and then reacted with 2 μL of Loading dye (36% glycerol, 0.05% BPB). , 0.035% xylenecyanol, 30 mM EDTA) and run on a 1 × TAE, 0.8% agarose gel. When the gel was stained with ethidium bromide, a single band of 1026 bp was obtained when BEIIb had the EM10 mutation, and two bands of 577 bp and 447 bp were obtained without BEIIb.
As described above, it is possible to perform analysis using a reliable material in which BEI and BEIIb deficiencies have been confirmed based on the difference in the molecular weight of the obtained band.

(Starch purification method)
The starch was purified by a cold alkali soaking method (Yamamoto et al., Denpun Kagaku 28: 241-244 (1981)).
10 g of brown rice was polished to 80%, 200 mL of 0.1% NaOH was added and left overnight at 4 ° C. The next day, the supernatant was discarded, ground in a mortar, passed through a 150 μm mesh, and centrifuged at 3,000 g and 4 ° C. for 10 minutes.
600 mL of 0.1% NaOH was added to the precipitate, shaken in ice for 3 hours, and left overnight at 4 ° C.
The next day, the supernatant was discarded, suspended with distilled water, and neutralized with 1N acetic acid. Further, it was washed five times with distilled water, dried and made into a powder in a mortar.

(Starch branching and gel filtration)
To 5 mg of the purified starch, 0.25 mL of distilled water was added and mixed, 0.25 mL of 2N NaOH was added, and gelatinization was performed at 37 ° C. for 2 hours.
To this was added 3.65 mL of distilled water, and 90 μL of 5N HCl was added to neutralize. Next, 1.5 mL of 100 mM acetate buffer (pH 3.5) was added. 12.5 μL (about 875 units) of amyloderamosa isoamylase (EC 3.2.168, manufactured by Hayashibara Biochemical Laboratory) was added, and the mixture was reacted while shaking at 37 ° C. for 24 hours.
Then, 5 mL of ethanol was added, and the mixture was dried by a rotary evaporator. 0.4 mL of distilled water and 0.4 mL of 2N NaOH were added thereto, gelatinized at 4 ° C. for 30 minutes, filtered through a 5 μm filter, and the filtrate was applied to a gel filtration column.

  The column used was one in which one TSKgel toyopearl HW55S (300 × 20 mm) and three TSKgel toyopearl HW50S (300 × 20 mm) (both columns were manufactured by TOSOH) were connected in series. % NaCl / 0.05N NaOH was used. 3 mL was collected per test tube and fractionated into 68 tubes, and the λmax of the starch-iodine complex of each fraction was determined. The sugar amount was detected with an RI detector (RI8020, manufactured by TOSOH) connected to the column.

(Chain length distribution analysis)
In the chain length distribution analysis, the sample was a powder obtained by removing the outer and inner lamina and embryo from one ripe seed, crushing the endosperm with pliers, and further grinding using a plastic homogenizer (manufactured by Greiner) in an Eppendorf tube. Was used.
5 mL of methanol was added to each, and the mixture was boiled for 10 minutes. Next, the mixture was centrifuged at 2,500 × g for 10 minutes, the supernatant was removed, and 5 mL of 90% methanol was added and washed twice.
Further, 15 μL of 5N sodium hydroxide was added to the precipitate, and the mixture was boiled for 5 minutes to gelatinize the starch.
After neutralizing the gelatinized solution with 9.6 μL of glacial acetic acid, 1089 μL of distilled water, 100 μL of 0.6 M acetate buffer (pH 4.4), 15 μL of 2% sodium azide, P.P. 2 μL (about 210 units) of amyloderamosa isoamylase (EC 3.2.168, manufactured by Hayashibara Biochemical Laboratory) was added, and the mixture was reacted at 37 ° C. for 8 hours or more while stirring with a stir bar.
Next, after adding 2 μL of isoamylase and reacting for 8 hours or more, the mixture was centrifuged at 10,000 × g at room temperature, and the supernatant was filtered through a deionization column (AG501-X8 (D), manufactured by Bio-Rad). .
An α-glucan chain having a reducing end corresponding to a sugar content of 5 to 10 nmol in a sample is dried by a centrifugal concentrator, and a 1-aminopyrene-3,6,8-trisulfate (APTS) solution (2.5% APTS) , 15% acetic acid) and 2 μL of a sodium borohydride solution (1 M sodium borohydride, 100% tetrahydrofuran) were added, and reacted at 55 ° C. for 90 minutes.
At the time of analysis, it was used after diluting 12.5 times with distilled water. The chain length distribution analysis was performed using a capillary electrophoresis apparatus (P / ACE MDQ, manufactured by AB Sciex).
Each peak area having a glucose polymerization degree (DP) of 3 or more was quantified, and the ratio (Mole%) of each DP when the sum of the peak areas up to DP60 was 100% was calculated.

(Measurement of gelatinization temperature by differential scanning calorimeter DSC (Differential Scanning Calorimetry))
9 μL of distilled water was added to about 3 mg of starch dried at 105 ° C. for 2 hours, mixed, and the differential scanning calorie when the temperature was changed from 5 ° C. to 100 ° C. at a rate of 3 ° C./min. Instrument Co., Ltd.).
Thereafter, the gelatinization start temperature, the gelatinization peak temperature, the gelatinization end temperature, and the gelatinization heat amount were calculated using the same type of application software.

(Measurement of resistant starch content)
First, a rice cooking method in measuring the resistant starch content of cooked rice that is not ground is described. About 100 mg of polished rice (5 to 8 grains) was weighed in a centrifuge tube with a 15 mL lid, and the sample was washed twice with centrifuge tube using a Pasteur pipette. Distilled water was added so that the water content in the centrifuge tube was 1.5 times the weight of the polished rice ± 0.3 mg. That is, the total weight in the centrifuge tube was set to be 2.5 times that of the milled rice. The water on the side of the centrifuge tube was centrifuged and dropped. Put about 250 mL of tap water into the rice cooker of a 5-cook rice cooker, place a micro tube stand and a glass petri dish (diameter 12 cm), and place a 15-mL centrifuge tube containing the sample on top of it, and place it on the 5-cook rice cooker. And cooked.
Next, a rice cooking method for measuring the indigestible starch content of cooked rice that is not ground will be described. About 1 g of milled rice was weighed into a centrifuge tube with a 15 mL lid, and water was added in a manner similar to that described above so that the amount of water became 1.5 times, followed by rice cooking. The cooked rice was ground in a mortar, weighed 250 mg, and used to determine the content of resistant starch.
When measuring the content of resistant starch in brown rice flour, brown rice was crushed with pliers and a mortar, and about 100 mg thereof was measured and the content of resistant starch was measured by the following method.

The indigestible starch content was measured by RS assay Kit (manufactured by Megazyme Co., Ltd .; hereinafter, referred to as “RS measurement kit”).
Pancreatin α-amylase (10 mg / mL) + amyloglucosidase (3 U / mL) for measurement using the RS measurement kit was prepared as follows. In a 50 mL centrifuge tube, 50 mL of 0.1 M malate sodium buffer (pH 6.0) and 0.5 g of porcine pancreatic α-amylase attached to the RS measurement kit were dissolved, and the mixture was stirred on ice with a shaker for 5 minutes. Amyloglucosidase (AMG) solution (0.5 mL) diluted to 300 U (unit) / mL was added, stirred, centrifuged at 3,000 rpm, 25 ° C. for 10 minutes, and the supernatant was transferred to a new 50 mL centrifuge tube. This reagent was changed to the required amount in the same size and was prepared each time.

  4 mL of pancreatin α-amylase (10 mg / mL) + AMG (3 U / mL) thus prepared is added to each cooked rice, and the mixture is heated at 164 rpm and 37 ° C. using a constant temperature shaker (MH-10, manufactured by TAITEC). Shake vigorously for 16 hours. 4 mL of 100% ethanol was added and stirred, and the mixture was centrifuged at 3,000 rpm, 25 ° C. for 10 minutes, and the supernatant was quickly collected in a 50 mL centrifuge tube. After 2 mL of 50% ethanol was added to the precipitate and stirred, 8 mL of 50% ethanol was added again to make the total amount 10 mL, and the mixture was stirred. After centrifugation at 3,000 rpm at 25 ° C. for 10 minutes, the supernatant was quickly transferred to the above 50 mL centrifuge tube. This operation was performed once again, and the precipitate (the indigestible starch contained therein was designated as rs) and the supernatant (the amount of solubilized starch contained therein was designated as non-rs) were separated. The centrifuge used in this series of operations was (Allegra X-30R, manufactured by BECKMAN), and a bucket of a swing rotor (SX4400) was used.

The supernatant remaining in the precipitate was removed as much as possible with a pipette, and 2 mL of 2M KOH was added while rs in the 15 mL centrifuge tube was crushed with a plastic pestle. A stir bar was added and the mixture was stirred in ice for 20 minutes. 8 mL of a 1.2 M acetate buffer (pH 3.8) and 0.1 mL of AMG (3300 U / mL) were added to decompose rs to glucose. The mixture was heated at 50 ° C. for 30 minutes while being vortexed once every 5 minutes, and centrifuged at 4,500 rpm at 25 ° C. for 10 minutes.
The rs degraded to glucose was adjusted to 11 mL on the centrifuge tube, and the non-rs was scaled up to 30 mL for non-rs with distilled water. rs was a sample high in indigestible starch (more than 15% indigestible starch), and non-rs was diluted 10-fold with 0.1 M sodium acetate buffer (pH 4.5). 10 μL of each lysis solution and diluent and 150 μL of a glucose measurement reagent (GOPOD solution) were applied to each of two holes of a 96-well microplate. In another hole, a glucose solution standard solution (mg / mL) for preparing a calibration curve, and a 0.1 M sodium acetate buffer (pH 4.5) and a glucose measurement reagent (GOPOD solution) were applied thereon. The plate was covered with a microplate sheet and reacted at 50 ° C. for 20 minutes in a hybridization oven (TAITEC HB-80). After the reaction, the absorbance at 510 nm was measured using a microplate reader.
A calibration curve was drawn from the measured value of the glucose solution, the glucose concentration (μg / μL) of each sample was determined, and the rs and non-rs amounts in 100 mg milled rice were calculated. The resistant starch content (%) indicating the resistant starch content was calculated by the following equation (1).

Indigestible starch content (%) = rs (mg) / [rs (mg) + non-rs (mg)] Formula (1)

〔result〕
First, referring to FIG. 1, Western blotting of proteins extracted from be1 / be2b (# 1403) and their parent mutants (EM557 and EM10) and wild-type (Taichung 65 and Kinnan style) mature endosperm. The results will be described.
In addition, EM557 and EM10 were selected using MNU (N-methyl-N-nitrosourea, methanenitrosourea) treatment which is a mutagen of the embryo. The MNU process is described in the literature (Non-Patent Document 6 and Yano, M., Okuno, K., Kawakami, J., Satoh, H. and Omura, T. (1985) High amylose mutuals license. Genet 69: 253-257.).
The parent system of EM557 is Taichung No. 65, and the parent system of EM10 is Kinnan style.

  Specifically, the rice mutants of this example are be1 / be2b (# 1403) and their parent mutants (EM557 and EM10) and wild type (Taichung 65 and Kinnan style). BEI and BEIIb protein bands were detected by Western blotting to confirm whether the F3 seeds obtained by the selection had homozygous desired genotypes.

The photograph in FIG. 1 (a) shows the urea buffer solution (8M Urea, 125 mM Tris-HCL, pH 6.8, 4% SDS, 5%) from # 1403 F3 seed and one parent mutant and one wild type seed. 2 shows the results of Western blotting in which proteins extracted using (2-mercaptoethanol) were separated by SDS-PAGE and detected with a BEI antibody. The photograph in FIG. 1 (b) shows the result of detection with the BEIIb antibody. Each lane shows, from the left, proteins extracted from different seeds of # 1403 (six grains), be1 (EM557), be2b (EM10), Kinnanfu and Taichung 65 seed.
In the western blotting in which the protein of # 1403 was extracted, BEI and BEIIb bands were missing in all the seeds.

  Next, FIG. 2 shows a DNA band pattern obtained by shearing a restriction enzyme after PCR amplification using a molecular marker for confirming deletion of BEI and BEIIb. When the BEI gene is deficient, 173 bp and 30 bp bands are detected, and when normal, a 203 bp band is detected. Similarly, when the BEIIb gene is deficient, a band of 1026 bp is detected, and when normal, two bands of 577 bp and 447 bp are detected. In the DNAs derived from 6 different individuals of # 1403, two bands of 173 bp and 30 bp were obtained in BEI, and a band of 1026 bp was obtained in BEIIb gene, indicating that the BEI and BEIIb genes are deficient. Proven.

Next, referring to FIG. 3, the form of fully-ripened brown rice of be1 / be2b double mutant rice, and clones of their parent mutants (EM557 and EM10) and wild type (Taichung 65 and Kinnan style) Will be described.
In each clone, the left figure is a photograph taken with light from below the ripe brown rice, and the right figure is a photograph taken with light from above the ripe brown rice. The seeds of the be1 parent mutant were almost the same as those of the wild type, but the seeds of EM10, a clone of be2b, were cloudy and smaller than the wild type (Nipponbare).
On the other hand, the seed of # 1403, which is a clone of be1 / be2b, showed a form of "white turbidity", in which the whole brown rice was white and turbid, like EM10 of be2b. In addition, the size of the seed of # 1403 was larger than that of EM10.

FIG. 3 also shows data obtained by measuring one grain weight (mg) of be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style) brown rice. Is shown. In FIG. 3, n = 50 in the measurement, the weight (mg) of brown rice is the mean ± standard error, and the relative value is the value when Nipponbare is 100.
Thus, EM10, a clone of be2b, had a 56.9% seed weight of the wild type.
In addition, the weight of brown rice of # 1403, which is a be1 / be2b clone, was 62.6% of that of the wild type (Kinan style), which was significantly larger than that of the parent line EM10, and no further decrease in the weight of brown rice was observed.

Next, the chain length distribution of amylopectin will be described with reference to FIG.
FIG. 4 is a graph showing the chain length distribution of amylopectin in be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style) ripe endosperm. In FIG. 4, the horizontal axis is DP (degree of polymerization), which is a value indicating the degree of polymerization of glucose. The vertical axis indicates Molecular (%).
In EM10, a clone of a single mutant of BEIIb, the short chain with DP ≦ 14 was drastically reduced compared to the wild type, and the long chain with DP ≧ 15 was increased instead.
In addition, clone # 1403 of be1 / be2b was characterized by a large decrease in the short chain of DP6-14 similar to the pattern of EM10. However, the degree of reduction of DP10-19 was higher than EM10, and long chains of DP20 and higher were higher than EM10.
As described above, the chain length distribution pattern of amylopectin # 1403 showed a feature that the number of short chains decreased and the number of long chains increased, and the number of long chains increased more than when EM10 was compared with the wild type.

  Next, the starch structure analysis by the gel filtration method will be described with reference to Table 1 below.

In Table 1, n = 3 of the measurement, and the error bar indicates the standard error.
The gel filtration pattern of the debranched starch is divided into three peaks, the earliest detected peak (Fraction I) is apparent amylose, and the second detected peak (Fraction II) is a B2 chain linking the cluster. The longer long chain of amylopectin, the third peak detected (Fraction III) is the short chain in the cluster of amylopectin. Table 1 shows Fr. quantified from the gel filtration patterns of be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style), respectively. Fractions I to III and Fr. The ratio of III to II is shown.

As for be1, the apparent amylose content was equivalent to that of the wild type as a result of gel filtration of the debranched starch. be2b has an apparent amylose content about 1.5 times higher than that of the wild type (Non-Patent Document 19). Also in the experimental results of this example, the apparent amylose content of the Kinnan style was 20.6%, while the clone EM10 of be2b showed a value of about 1.3 times, 26.5%.
In contrast, the amylose content of be1 / be2b was 51.7%, about 2.0 times higher than the be2b clone EM10. In be2b, the ratio of long chains of amylopectin was very large because the III / II value, which is the ratio of short chains, was very small at 1.0. The value of be1 / be2b was 0.5, and the ratio of long chains of amylopectin was high.

From the above, it was revealed that be1 / be2b has a higher ratio of amylopectin long chain than be2b, and also shows that the amylose content is much higher than that of be2b.
This indicates that starch having a long chain and high amylose content of amylopectin tends to have a high proportion of indigestible starch, and that be1 / be2b has a very high percentage of indigestible starch. For this reason, it is thought that a characteristic product can be manufactured as a food processing field, an additive, and an industrial material centering on a diet material.

  Next, the gelatinization temperature of be1 / be2b starch will be described with reference to Table 2 below.

Table 2 shows the gelatinization temperature and calorific value of the endosperm starch of be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style) endosperm starch. is there.
Specifically, gelatinization start temperature and gelatinization peak of each starch paste sample of be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style) The results obtained by measuring the temperature, the gelatinization end temperature, and the gelatinization heat with a differential scanning calorimeter (DSC) are shown.
The gelatinization peak temperature of EM10 was about 16 ° C. higher than the Kinnan style. # 1403 was 7.5 ° C. higher than EM10 and showed the highest gelatinization temperature among the starches measured. On the other hand, the heat of gelatinization of # 1403 showed the lowest value among the measured starches. The endothermic reaction obtained at the time of the above gelatinization is derived from amylopectin, and # 1403 having an extremely high amylose content is considered to have a low amount of gelatinization due to a small amount of amylopectin.

  Next, the starch / digestible starch content of be1 / be2b will be described with reference to Table 3.

Table 3 shows, in addition to be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild-type (Taichung 65 and Kinnan style), a highly resistant starch rice line as a control. It is a table | surface which shows the indigestible starch amount of the cooked rice of brown rice, and the brown rice flour of three lines (high RS rice lines A-C). In Table 3, numerical values indicate mean ± standard error (N = 3).
Specifically, in addition to be1 / be2b (# 1403), their parent mutants (EM557 and EM10), and wild type (Taichung No. 65 and Kinnan style), one milled rice of high RS rice lines A to C was used. The results of measuring the indigestible starch content of cooked rice that was cooked with a water content of 0.5 times and not ground and the cooked rice that was ground in a mortar and brown rice powder that was not heated using an RS measurement kit are shown.

Here, the high RS rice strain A used # 4019 (Patent Document 5), which is a strain with a high indigestible starch content in which BEIIb activity is reduced and starch synthase IIIa activity is also reduced. In # 4019, the seed weight was increased 1.5 times the original weight by backcrossing with Akita 63, which is a super-high-yield rice (Non-Patent Document 19).
The high RS rice strain B is a double mutant prepared by crossing with a mutant of waxy rice having an amylose content of 0% using EM10 as a parent line (Patent Document 6). This double mutant crossed with waxy rice has resistant starch derived from the property that the average chain length of amylopectin of EM10 is extremely long despite not containing amylose. The high RS rice line B is not very practical because the seeds are very small and the yield does not increase because the variety is not improved.
The high RS rice strain C is Chikushikoi No. 85, which has been submitted for variety registration by backcrossing EM129, which is an example of a be2b strain with reduced BEIIb activity, to a high-yielding variety (Non-Patent Document 22). This high RS rice strain C is shown to have an action of suppressing an increase in blood sugar level, and is higher in yield than EM10.

As a result, the non-milled cooked rice of the high RS rice strain A line has an indigestible starch content of 15.8%, the milled cooked rice has an indigestible starch content of 8.0%, and brown rice flour has a low starch content. The digestible starch content was 4.7%, which was lower than the parent strain EM10.
High RS rice strain B does not contain amylose, and although the indigestible starch content of brown rice flour is as high as 30.2%, the content of indigestible starch is higher in crushed cooked rice compared to EM10. Relatively few.
The high RS rice strain C had an indigestible starch content of 11.2% for brown rice flour, which was equivalent to EM10, but the indigestible starch content of cooked rice was much lower than EM10. .

  Here, the value of the resistant starch content of the cooked rice that is not ground depends on the degree of rice polishing. In other words, wrinkled EM10, # 1403, and high RS strain B, which have small seeds and are wrinkled, tend to have a higher value of the resistant starch content than other strains because more peel remains when rice is polished. It is in. On the other hand, the ground rice does not depend on the degree of rice polishing because the inside of the endosperm is exposed by grinding even if the peel remains. In the cooked rice which was not ground, the content of resistant starch of # 1403 was 76.2%, which was much higher than that of any of the lines.

The indigestible starch content of the mashed cooked rice was lower than that of the uncooked cooked rice in all strains, but # 1403 was 28.4%, which is much higher than EM10 and other high RS rice strains. Showed high values. Regarding brown rice flour, the high RS rice strain B showed a high value of 30.2%, but the RS of # 1403 was 35.1%, which was higher than this.
As described above, it was revealed that RS of # 1403 shows a remarkably high value among conventional high RS rice in both cooked rice and brown rice flour.

  It should be noted that the configuration and operation of the above-described embodiment are examples, and it is needless to say that the configuration and operation can be appropriately modified and executed without departing from the spirit of the present invention.

  The present invention relates to a rice seed of a rice mutant of a rice double mutant having reduced activity of rice branching enzymes type I (BEI) and type IIb (BEIIb) derived from Japonica rice, which is rarely digestible in rice. It is industrially applicable because it has a soluble starch content.

Claims (15)

Indigestibility characterized by the fact that the loci of rice branching enzymes type I (BEI) and type IIb (BEIIb) derived from Japonica rice are recessive homologous, genetically fixed, and non-genetically modified. Rice mutant with high starch content. 2. The rice starch-rich mutant with high resistance to digestion according to claim 1, wherein the activity of the BEI and the BEIIb is lower than that of a wild type. 3. 3. The rice mutant containing high resistant starch according to claim 1, wherein the rice seed after milling has a higher content of resistant starch than a parental BEIIb-deficient mutant. 3. When the rice seeds are cooked,
The content of the indigestible starch in the cooked rice in the non-ground state is 60% or more, and the content of the indigestible starch in the cooked rice in the ground state is 20% or more,
The resistant rice starch-rich mutant according to claim 3, wherein the content of the resistant starch in the brown rice flour of the rice seed is 32% or more. The starch produced from the rice seed endosperm has a chain length distribution of amylopectin less than DP19 or less, compared to the starch produced from the rice seed endosperm of the BEIIb-deficient mutant, DP20, The rice mutant having a high content of indigestible starch according to claim 3 or 4, wherein the amount is increased. Starch produced from the endosperm of the rice seed,
The gelatinization peak temperature is 7 ° C. or more higher than starch produced from endosperm of rice seed of the BEIIb-deficient mutant as the parent line, wherein the difficulty is as set forth in any one of claims 3 to 5. Rice mutant high in digestible starch. The starch produced from the endosperm of the rice seed, wherein the calculated percentage of amylose is 50% or more. The rice mutant high in resistant digestive starch according to any one of claims 3 to 6, characterized in that: body. The rice seed can be used as a rice gel by stirring a rice flour and a gruel by pulverizing the rice seed. The high content of resistant starch according to any one of claims 3 to 7. Rice mutant. A rice flour produced by powdering the endosperm of the rice seed of the resistant rice starch-rich mutant according to any one of claims 3 to 7. The rice mutant of the rice mutant containing the resistant starch-rich rice mutant according to any one of claims 3 to 8 and / or the rice flour according to claim 9 which is extracted from the rice flour according to claim 9. Digestible starch. A rice gel produced by stirring the rice seed porridge of the resistant rice starch-rich rice mutant according to any one of claims 3 to 8. The rice seed of the rice mutant having a high content of indigestible starch according to any one of claims 3 to 8, the rice flour according to claim 9, the indigestible starch according to claim 10, and the eleventh embodiment. A food product characterized by comprising any one or any combination of the rice gels described in (1). A texture improver comprising any one or any combination of the rice flour according to claim 9, the indigestible starch according to claim 10, and the rice gel according to claim 11. Indigestibility characterized by producing double recessive homo mutants of rice branching enzymes type I (BEI) and type IIb (BEIIb) derived from Japonica rice by a non-GMO method A method for producing a starch-rich rice mutant. A single base substitution in which the last base of the tenth exon of the BEI gene is mutated from guanine to adenine and the last base of the ninth intron of the BEIIb gene is mutated from guanine to adenine is used as a molecular marker, The method for producing a resistant rice starch-rich rice mutant according to claim 14, wherein the double recessive homo mutant is identified.

Images