JP2019167312A - Malaria therapeutic, malaria preventive and antimalaria innate immunity stimulant - Google Patents

Abstract

To provide a novel malaria therapeutic, malaria preventive and antimalaria innate immunity stimulant.SOLUTION: A malaria therapeutic, malaria preventive and antimalaria innate immunity stimulant are developed that include baculovirus (particularly, recombinant baculovirus including a gene encoding DAF amino acid sequence).SELECTED DRAWING: None

Description

  The present invention relates to a malaria therapeutic agent containing baculovirus, a malaria preventive agent and an antimalarial innate immune stimulator.

(malaria)
Malaria remains a serious public health problem and causes significant economic losses worldwide. Nearly half of the world's population is at risk of malaria. In 2015, there were approximately 212 million malaria patients, an estimated 429,000 malaria deaths, most of them children under 5 years old (Non-Patent Document 1). Malaria infection is initiated by injecting Plasmodium sporozoites into the skin during blood sucking by Anopheles mosquitoes. Sporozoites move to the liver and invade hepatocytes. It grows "quietly" in the liver for 5-6 days (liver phase), then exits the liver cells into the blood and infects red blood cells (red endophase). Plasmodium falciparum develops into exoerythrocytic schizonts in the liver in 5-6 days. In the case of P. vivax and P. ovale, protozoa in some infected hepatocytes spend months or years as hypnozoites called dormant liver stage forms. Later, the erythromerium is recurred.

  Currently, primaquine (PQ) is the only curative treatment for P. vivax hypnozoites, but PQ has a high risk of life-threatening hemolytic anemia in glucose-6-phosphate-dehydrogenase enzyme (G6PD) deficiency. (Non-Patent Document 2). A malaria eradication strategy requires safer and more effective curatives that effectively kill hypnozites.

  As described above, the current protective effect against malaria infection is insufficient, and development of new therapeutic agents and preventive agents is necessary.

WHO. World Malaria Report 2015. WorldMalaria Report 2015 (2015). Alving, A. S., Carson, P. E., Flanagan, C. L. & Ickes, C. E. Enzymatic deficiency in primaquine-sensitive erythrocytes. Science 124,484-485 (1956).

  The subject of this invention is providing the novel antimalarial agent, the antimalarial agent, and the antimalarial innate immunity activation agent.

  As a result of researches to solve the above-mentioned problems, the present inventors have found that a therapeutic agent for malaria including a baculovirus (in particular, a recombinant baculovirus containing a gene encoding the amino acid sequence of DAF), a preventive agent for malaria, and a natural antimalarial agent. An immunostimulant was developed to complete the present invention.

The present invention is as follows.
1. A treatment for malaria, including the Baculoviridae virus.
2. The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydrosis Virus, Saksan Nucleopolyhedrovirus (Antheraea pernyi Nuclear Polylydrosis Virus), and Granulovirus The therapeutic agent for malaria according to item 1, wherein
3. 3. The agent for treating malaria according to item 1 or 2, which is administered within 42 hours after infection.
4). 3. The agent for treating malaria according to item 1 or 2, which is administered within 24 hours after infection.
5. 5. The malaria therapeutic agent according to any one of 1 to 4 above, wherein the administration method is intramuscular administration.
6). Malaria preventive agent containing baculoviridae virus.
7). The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydorosis Virus, Saksan Nuclear Polyhedrosis Virus, and Granulovirus The agent for preventing malaria according to item 6 above.
8. The agent for preventing malaria according to 6 or 7 above, which is administered one or more times at intervals of 8.6 hours to 13 days.
9. 9. The agent for preventing malaria according to any one of items 6 to 8, wherein the administration method is intramuscular administration.
10. Antimalarial innate immunity stimulant containing baculoviridae virus.
11. The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydrosis Virus, Saksan Nucleopolyhedrovirus (Antheraea pernyi Nuclear Polylydrosis Virus), and Granulovirus 11. The antimalarial innate immunity activator according to 10 above.
12 12. The antimalarial according to item 10 or 11, wherein the baculovirus is administered to a patient after a recombinant virus other than a baculovirus containing a gene encoding an amino acid sequence of a malaria antigen is administered to the patient. Innate immune stimulant.
13. 13. The antimalarial innate immunity activator according to 12 above, wherein the malaria antigen is CSP.
14 14. The antimalarial innate immunity stimulating agent according to item 12 or 13, wherein the recombinant virus other than the baculovirus is a recombinant adenovirus.
15. 15. The antimalarial innate immunity stimulating agent according to any one of 10 to 14, and the antimalarial innate immunity stimulating agent comprising a recombinant adenovirus comprising a gene encoding the amino acid sequence of a malaria antigen and a promoter capable of expressing the gene Composition.
16. 15. The antimalarial innate immunity activator according to any one of items 10 to 14, which is a malaria vaccine additive.
17. IFN-α and IFN-γ production promoter containing baculoviridae virus.
18. The baculoviridae viruses are Autographa Californica Nuclear Polylyed Disease Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylyedorosis Virus, Orgya Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata NuclearPolyhedorosis Virus), Lymantriadisper NuclearPolyhedorosis Virus, Saksan Nuclear Polyhedrosis Virus and Granulovirus 18. The IFN-α and IFN-γ production promoter according to item 17 above.
19. 19. A cancer therapeutic agent comprising the IFN-α and IFN-γ production promoter according to 17 or 18 above.
20. 19. A therapeutic agent for liver disease comprising the IFN-α and IFN-γ production promoter according to 17 or 18 above.
21. 21. The therapeutic agent for liver disease according to 20 above, wherein the liver disease is a liver disease derived from hepatitis virus.
22. 19. A vaccine additive added to a vaccine other than the malaria vaccine, comprising the IFN-α and IFN-γ production promoter according to 17 or 18 above.

In the present invention, a malaria therapeutic agent, a malaria preventive agent, and an antimalarial innate immune enhancer can be provided.
Baculovirus is an insect virus that infects silkworms and does not infect humans. The know-how of the extermination method has been accumulated from the long history of Japanese sericulture. Currently, it is widely used around the world as a protein high expression vector. As a result, safety and versatility are high and technically established.
As described above, the antimalarial innate immunity activator of the present invention has few problems until practical use.

Induction of pro-inflammatory cytokines by BV administration and subsequent elimination of liver stage parasites. (A, B) Luciferase expression at different time points after im (10 ⁸ pfu) (A) or iv (10 ⁷ pfu) (B) administration of BES-GL3 (described as BV). (C, D) Kinetics of IFN-γ (C) and TNF-α (D), pro-inflammatory cytokines in serum at different time points after iv administration of BV (10 ⁷ pfu) (n = 6). (E, F) Liver injury marker kinetics. ALT (E) and AST (F) in serum at different time points after iv administration of BV (10 ⁷ pfu) (n = 6). Comparison of ALT (G) and AST (H) in serum (G, H) BV (n = 6) 6 hours after im (10 ⁸ pfu) and serum 6 hours after iv administration (10 ⁷ pfu) . (I, J) Pb-Luc sporozoite challenge infection at 0 hours, followed by im administration of BV at the indicated time points (10 ⁸ pfu). Luminescence from the liver indicates parasite growth, and luminescence in the thigh is from a BV source. (K, L) Delayed parasitemia in infected mice. Groups of infected mice administered BV10 ⁶ pfu or 10 ⁴ pfu 24 hours after infection, Table 2 (BV10 ⁸ pfu administration 42 hours after infection and PQ low dose 24 hours after infection) and Table 3 (CpG 24 hours after infection) Parasitemia in infected mice group shown in (A, B, I, J) The heat map image visualized in the mouse represents the total flow velocity (p / sec / cm ² ) of photons in the region. (CH, K, L) Bars or points represent mean ± SD. Differences from the (G, H) PBS group were evaluated by the Kruskal-Wallis test with Dunn's correction (a Kruskal-Wallis test with Dunn's correction). Differences from the (K, L) PBS group were evaluated by two-way ANOVA. * P <0.05, ** P <0.01, *** P <0.001, **** P <0.0001. Contribution of IFN-α to elimination of liver stage parasites induced by im administration of BV. (AC) BES-GL3 (described as BV) (10 ⁸ pfu), cytokine in serum of both WT and TLR9 ^{− / −} mice 6 hours after CpG or PBS im administration (n = 9-10) There are IFN-α (A), IFN-γ (B) and IL-12 (C) levels. Bars are mean ± SD. (DE) Prediction of time to reach 1% parasitemia. (D) Serum transfer assay to determine the role of both types of IFN in elimination of liver stage parasites. Serum was collected 6 hours after im administration of BV to mice and neutralized with either anti-IFN-α antibody or anti-IFN-γ antibody. Mice (n = 5) infected with sporozoites 24 hours ago were intravenously injected (iv administration) with antibody-treated serum, untreated serum or PBS. (E) Effect of heat treatment on inactivated BV. BV, HI-BV or PBS was administered im 24 hours after sporozoite infection (n = 5). Differences from (AC) PBS group were evaluated by Kruskal-Wallis test with Dunn's correction. (D, E) The difference from the PBS group was evaluated by Kaplan-Meier log-rank (Mantel-Cox) test. ** P <0.01, **** P <0.0001. Induction of ISG in the liver by im administration of BV. Gene expression of antiviral proteins (A), IFITs (B) and IRFs (C) in the livers of WT and TLR9 ^{− / −} mice 6 hours after im administration of BES-GL3 (denoted as BV) (10 ⁸ pfu) Was measured by real-time RT-PCR (n = 5-7). Bars represent mean ± SEM. Differences from the PBS group were evaluated by Mann-Whitney test. * P <0.05, ** P <0.01. Thermal inactivation of BV. (A) Luciferase expression in transduced HepG2 cells. HepG2 cells were transduced with BES-GL3 (described as BV) or HI-BV (heat treated at 56 ° C. for 30 minutes). Cell lysates were subjected to luciferase assay. Luciferase activity is expressed as relative luminescence units (RLU). (B-C) IFN-α (B) and IFN-γ (C) levels of cytokines in serum from PBS, BV or HI-BV treated mice (n = 5). Bars and error bars represent mean ± SD, respectively. Experimental design. (A) Mice were administered BES-GL3 (described as BV) iv, im or in, followed by iv 1,000 Pb-conGFP sporozoites or 1,000 iRBCs at various time intervals (6 hours to 14 days) I challenged. The results are shown in Table 1. (B) Mice were injected i.v. with 1,000 Pb-conGFP sporozoites. Mice were administered either BV, CpG or PQ 24 or 42 hours after liver stage development. The results are shown in Tables 2 and 3. (C) Mice were immunized with AdHu5-prime (prime) and PBS-boost (boost) regimens at 3-week intervals. Mice were challenged i.v. with 1,000 PfCSP-Tc / Pb sporozoites 24 hours after boosting. The results are shown in Table 4. (D) Mice were immunized i.m. at 3 week intervals with heterologous AdHu5-prime and BDES-boost regimen. Three weeks after priming the mice, 1,000 PfCSP / Pb sporozoites were challenged i.v. (first challenge) and boosted 24 hours later. Protected mice were re-challenged in a similar manner 21 days after the first boosting (second challenge). The results are shown in Table 4. (E) Six hours after immunization with BV, the mice were challenged i.v. with 1000 PfCSP-Tc / Pb sporozoites (first challenge). Protected mice re-challenge 21 days after the first challenge (second challenge). (F) Sera obtained from donor mice administered BV 6 hours ago were pooled. Recipient mice were injected i.v. with 1,000 Pb-conGFP sporozoites. Twenty-four hours later, recipient mice were administered i.v. with anti-IFN-α antibody or anti-IFN-γ antibody treated or untreated serum. The results are shown in FIG. 2D. Schematic of recombinant baculovirus BES-GL3 and BDES-sPfCSP2-WPRE-Spider.

(Malaria therapeutic agent, malaria preventive agent and antimalarial innate immunity stimulator of the present invention)
The “malaria therapeutic agent” of the present invention is a recombinant baculo containing a gene encoding the amino acid sequence of baculovirus or DAF, and a promoter capable of expressing the gene and a gene encoding the amino acid sequence of malaria antigen, if necessary. It is a malaria therapeutic agent characterized by including a virus. The “baculovirus (Baculoviridae virus)” of the present invention means both wild-type baculoviruses and recombinant baculoviruses.
The “malaria preventive agent” of the present invention is capable of expressing a gene encoding the amino acid sequence of baculovirus or DAF, and a gene encoding the amino acid sequence of malaria antigen as needed, and the DAF gene and / or malaria antigen gene. It is a malaria preventive agent (malaria onset preventive agent) characterized by including the recombinant baculovirus containing a various promoter.
The “antimalarial innate immunity stimulator” of the present invention is a baculovirus, a gene encoding the amino acid sequence of the malaria antigen and / or a gene encoding the amino acid sequence of DAF, and, if necessary, the malaria antigen gene and / or DAF. An antimalarial innate immunity stimulating agent comprising a recombinant baculovirus containing a promoter capable of expressing a gene.
Further, the "antimalarial innate immunity stimulator" of the present invention is a recombinant virus other than baculovirus containing a gene encoding the amino acid sequence of the malaria antigen, a plasmid DNA into which the gene encoding the amino acid sequence of the malaria antigen has been introduced, Alternatively, the protein having the amino acid sequence of the malaria antigen can be administered to the patient and then administered to the patient.
The malaria therapeutic agent, malaria preventive agent and antimalarial innate immunity stimulator of the present invention will be described below.

The present invention includes the following.
1. A malaria therapeutic agent comprising a recombinant baculovirus comprising:
(1) a gene encoding the amino acid sequence of DAF, or a gene encoding the amino acid sequence of malaria antigen and a gene encoding the amino acid sequence of DAF (2) a promoter capable of expressing the gene A malaria prevention agent comprising a recombinant baculovirus comprising:
(1) a gene encoding the amino acid sequence of DAF, or a gene encoding the amino acid sequence of malaria antigen and a gene encoding the amino acid sequence of DAF (2) a promoter capable of expressing the gene An antimalarial innate immunity stimulant comprising a recombinant baculovirus comprising:
(1) a gene encoding the amino acid sequence of malaria antigen and a gene encoding the amino acid sequence of DAF, a gene encoding the amino acid sequence of malaria antigen, or a gene encoding the amino acid sequence of DAF (2) the gene can be expressed Promoter

(gene)
In the present specification, a gene (DNA molecule) includes not only double-stranded DNA but also each single-stranded DNA comprising sense strand and antisense strand constituting it, and is limited in length. Is not to be done.
Therefore, unless otherwise specified, the gene encoding the amino acid sequence of the DAF of the present invention and the gene (polynucleotide) encoding the amino acid sequence of the malaria antigen are double-stranded DNA including genomic DNA and single-stranded DNA including cDNA. DNA (sense strand), single-stranded DNA (antisense strand) having a sequence complementary to the sense strand, synthetic DNA, and fragments thereof are included.

(Malaria antigen)
The “malaria antigen” of the present invention refers to the malaria parasite sporozoite stage antigen CSP (Circumsporozoite Protein), TRAP (Thrombospondin-Related Adhesive Protein), metrozoite stage antigen MSP (Merozoite Surface Protein) 1, AMA1 (ApicalMembraneAntigen) Although 1) etc. can be illustrated, CSP is particularly preferable.

(Protein having amino acid sequence of malaria antigen)
The “protein having the amino acid sequence of the malaria antigen” used in the present invention has the same amino acid sequence or the same function as the amino acid sequence of the malaria antigen presented (presentable) by baculovirus and has a homology of 90% or more, It is not particularly limited as long as it is 95% or more, 98% or more, or 99% or more. Furthermore, the amino acid sequence may be modified by a method known per se.

(CSP)
CSP is the main membrane protein of the sporozoite protozoa that invades people from mosquitoes. There is a repeat sequence of about 40 times of four amino acid sequences (NANP) of asparagine-alanine-asparagine-proline having a molecular weight of about 50 kDa and having high antigenicity in the center. CSP is thought to play an important role in the invasion of hepatocytes because it shows very high invasion inhibition by invasion inhibition experiments in which monoclonal antibodies against NANP are mixed with sporozoites and sprinkled on hepatocytes.
Among the many antigens of malaria, CSP is particularly expected as a vaccine candidate antigen and has been studied for many years. RTS, S, which is the most developed as a vaccine for malaria, also uses CSP as an antigen. In addition, PfCSP expressed in Plasmodium falciparum has four cysteines and maintains a three-dimensional structure, and it has been reported that this three-dimensional structure plays an important role in the mechanism of malaria parasite entry into the liver.
The CSP used in the present invention is preferably PfCSP (SEQ ID NO: 24), which is a protozoan-derived base sequence, or sPfCSP2 (SEQ ID NO: 25) containing a fourth cysteine optimized for a mammal. Use.

In addition, the CSP used in the present invention includes the following.
(1) The protected derivative, sugar chain modified product, acylated derivative, or acetylated derivative of CSP according to any one of the above.
(2) A protein having a homology of 90% or more, 95% or more, 98% or more, or 99% or more with the CSP according to any one of the above, and having an action substantially equivalent to that of the CSP.
(3) In the CSP according to any one of the above, 100 to 10, 50 to 30, 40 to 20, 10 to 5, and 5 to 1 amino acids are substituted, deleted, inserted and / or added. And a protein having an action substantially equivalent to that of the CSP.
Furthermore, the genes of CSP used in the present invention include the following.
(1) A gene encoding a polypeptide comprising the amino acid sequence of any one or more of the above CSPs.
(2) In any one or more of the above CSP amino acid sequences, 1 to 20 amino acids are substituted, deleted, inserted and / or added, and encodes a polypeptide having substantially the same action as CSP gene.
(3) A polypeptide having 90%, 95%, 98%, or 99% homology with any one or more of the above CSP amino acid sequences and having substantially the same activity as CSP Gene to do.

(Protein to be displayed on the virus surface)
In the recombinant baculovirus of the present invention, a protein other than the malaria antigen protein (for example, a protein having an action of improving the malaria defense effect) can be expressed on the virus surface in the same or separate manner as the malaria antigen.
In the present invention, DAF {CD55 antigen which is a glycoprotein and also known as decay-accelerating factor (DAF)}, TRAP and the like can be exemplified as a complement regulator, preferably DAF, more preferably human DAF ( hDAF: SEQ ID NO: 26) can be exemplified, but is not particularly limited.

In addition, the DAF used in the present invention includes the following.
(1) The protected derivative, sugar chain modified product, acylated derivative, or acetylated derivative of DAF according to any one of the above.
(2) A protein having a homology of 90% or more, 95% or more, 98% or more, or 99% or more with the DAF described in any one of the above and having substantially the same action as the DAF.
(3) In the DAF according to any one of the above, 100 to 10, 50 to 30, 40 to 20, 10 to 5, and 5 to 1 amino acids are substituted, deleted, inserted and / or added. And a protein having substantially the same action as the DAF.
Further, the DAF gene used in the present invention includes the following.
(1) A gene encoding a polypeptide comprising the amino acid sequence of any one or more of the above DAFs.
(2) In any one or more of the amino acid sequences of DAF, 1-20 amino acids are substituted, deleted, inserted and / or added, and encodes a polypeptide having substantially the same effect as DAF. gene.
(3) A gene that encodes a polypeptide having 90% or more homology with any one or more of the amino acid sequences of DAF and having substantially the same action as DAF.

The protein having the mutation may be naturally occurring, or may be obtained by introducing a mutation based on a gene derived from nature. Means for introducing mutations are known per se. For example, site-directed mutagenesis, gene homologous recombination, primer extension or polymerase chain reaction (hereinafter abbreviated as PCR) is used alone or in appropriate combination. it can.
For example, the method described in the book (edited by Sambrook et al., “Molecular Cloning, Laboratory Manual Second Edition”, 1989, Cold Spring Harbor Laboratory; Maruzen Co., Ltd.) or by modifying those methods. Ulmer's technology (Ulmer, KM, Science), 1983, Vol. 219, p.666 -671) can also be used. In the case of a peptide, from the viewpoint of not changing the basic properties (physical properties, functions, physiological activity, immunological activity, etc.) of the peptide upon introduction of mutation, for example, homologous amino acids (polar amino acids, nonpolar amino acids, Mutual substitution between hydrophobic amino acids, hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, aromatic amino acids, etc.) is readily envisioned.

(Baculovirus)
The baculovirus used in the present invention is an entomopathogenic virus that infects insects, and is a group of DNA viruses (Baculoviridae) having a circular double-stranded DNA as a gene. Among them, a group of viruses called nuclear polyhedorosis virus (NPV) form inclusion bodies called polyhedra in the nucleus of infected cells in the late stage of infection. Even if a foreign gene to be expressed is inserted in place of the polyhedron gene, the virus can infect and proliferate without problems and produce a large amount of a desired foreign gene product, which is used for producing a desired protein.
Examples of baculoviruses used in the present invention include Autographa Californica Nuclear Polyhedorosis Virus (AcNPV), Bombyx mori Nuclear Polyhedorosis Virus (BmNPV), and Olgia Pseudotsugata nuclear polyhedrosis. Examples include viruses (Orgyia pseudotsugata Nuclear Polyhedorosis Virus: OpNPV) and Lymantia disper Nuclear Polyhedorosis Virus (LdNPV), with AcNPV being particularly preferred.
The baculovirus used in the present invention may be any of wild type, mutant type, and recombinant baculovirus. Examples of the host cell to be co-transfected include insect cells such as Spodoptera frugiperda.
The antimalarial agent, the antimalarial agent and the antimalarial innate immunity stimulator of the present invention contain baculovirus to completely protect and / or partially protect malaria. Complete protection refers to the complete absence of red endoparasites (parasemia 0%). Partial protection means that the time taken for parasitemia to reach 1% is delayed (delayed onset) compared to when it is not administered.

(promoter)
The promoter that can be used in the present invention is not particularly limited as long as DAF and / or malaria antigen (amino acid sequence of malaria antigen) can be expressed in a recombinant baculovirus (in particular, the surface of the recombinant baculovirus).
In particular, the dual promoter {developed by Dr. Yoshida, the present inventor {controls two promoters: a promoter that works in mammalian cells (eg, CMV promoter) and a promoter that works in insect cells (eg, polyhedrin promoter, pPolh)] Below, a promoter characterized by introducing a gene encoding a desired protein} is preferred.

In one embodiment, under the control of a linked dual promoter, one of which is a vertebrate promoter and the other is a baculovirus promoter, it encodes a gene encoding one malaria antigen and a viral membrane protein that can be expressed in insect cells. There is provided a transfer vector comprising a fusion gene containing a gene to be synthesized, or a structure incorporating a gene encoding the amino acid sequence of DAF.
This transfer vector is co-transfected with baculovirus DNA in insect cells to induce homologous recombination, is under the control of the baculovirus promoter, is expressed in insect cells, and germinated viral particle components It is possible to obtain a recombinant baculovirus in which the fusion gene capable of producing a possible fusion protein is incorporated into a baculovirus.

As a mammalian promoter (promoter capable of functioning in mammalian cells) which is one of the components of the transfer vector used in the present invention, cytomegalovirus promoter, SV40 promoter, retrovirus promoter, metallothionein promoter, heat shock protein promoter CAG promoter, elongation factor 1α promoter, actin promoter, ubiquitin promoter, albumin promoter, MHC class II promoter and the like.
Examples of the avian promoter (promoter that can function in avian cells) include an actin promoter, a heat shock protein promoter, an elongation factor promoter, a ubiquitin promoter, an albumin promoter, and the like.
Examples of fish promoters (promoters that can function in fish cells) include actin promoters, heat shock protein promoters, elongation factor promoters, and the like.
Examples of baculovirus promoters (promoters that can function in insect cells) include polyhedrin promoter, p10 promoter, IE1 promoter, p35 promoter, p39 promoter, and gp64 promoter.

(Method for producing recombinant baculovirus)
Production of a recombinant baculovirus is a process of producing a gene in which a desired malaria antigen gene and a gene encoding an amino acid sequence of a protein that can be a constituent of a virus particle are fused, or a transfer vector incorporating a DAF gene , Cotransfecting the transfer vector and baculovirus DNA into a host cell, and isolating the recombinant baculovirus.

In the method for producing the recombinant baculovirus, the method for introducing the transfer vector into the host cell and the transformation method thereby are not particularly limited, and various methods commonly used in this field are employed. be able to.
The resulting recombinant baculovirus can be cultured according to a conventional method, and the fusion protein and / or DAF protein in which the malaria antigen protein is fused to the constituents of the virus particle are displayed on the virus particle.

In one embodiment, under the control of a linked dual promoter, one of which is a vertebrate promoter and the other is a baculovirus promoter, it encodes a gene encoding a malaria antigen and a viral membrane protein that can be expressed in insect cells. And a transfer vector comprising a structure in which a fusion gene containing a gene encoding a gene encoding a DAF amino acid sequence and / or a gene encoding an IL-12 amino acid sequence is incorporated.
This transfer vector is co-transfected with baculovirus DNA in insect cells to induce homologous recombination, is under the control of the baculovirus promoter, is expressed in insect cells, and germinated viral particle components It is possible to obtain a recombinant baculovirus in which the fusion gene capable of producing a possible fusion protein is incorporated into a baculovirus.

(Protein that can be a constituent of virus particles)
Examples of the gene encoding the amino acid of the protein that can be a constituent of the virus particle include gp64 protein (GenBank Accession No. L22858), vesicular stomatitis virus glycoprotein G (VSVG: GenBank Accession No. M21416), herpes simplex Viral glycoprotein (KOS: GenBank Accession No. K01760), type 1 human immunodeficiency virus gp120 (GenBank Accession No. U47783), human respiratory syncytial virus membrane glycoprotein (GenBank Accession No. M86651), influenza A virus hemagglutinin Examples include genes such as proteins (GenBank Accession No. U38242) and genes such as viral envelope proteins closely related to baculovirus.
In the present invention, when a recombinant baculovirus is administered to a vertebrate, the malaria antigen protein displayed on the surface of the baculol virus functions as a component vaccine. Furthermore, malaria antigen protein is produced in mammalian cells and functions as a preventive or therapeutic agent for malaria infection by its immunostimulatory action. In addition, when a recombinant baculovirus is administered to a vertebrate, the DAF protein displayed on the surface of the baculovirus protects the baculovirus from attack by the correction component contained in the serum and improves the vaccine effect.

(Recombinant viruses other than baculovirus)
The “recombinant virus other than baculovirus” used in the present invention is the same as the gene encoding the amino acid sequence of the malaria antigen possessed by baculovirus (and / or the gene encoding the amino acid sequence of DAF possessed by baculovirus). It means a virus other than baculovirus, including a gene (or substantially the same gene).
For example, adenovirus, adeno-associated virus, vaccinia virus, fowlpox virus lentivirus and the like can be exemplified, but preferably adenovirus.

(Adenovirus and its production method)
An adenovirus is a virus composed of a single double-stranded linear DNA.
As a method for producing a recombinant adenovirus, a malaria antigen gene is introduced into a known (commercially available) plasmid for preparing an adenovirus vector, and the introduced plasmid is transduced into human embryonic kidney-derived cells by a known method and cultured. . Next, a recombinant adenovirus expressing a malaria antigen is obtained from the culture supernatant or the cultured cells.

(Plasmid DNA into which a gene encoding the amino acid sequence of malaria antigen has been introduced)
The “plasmid DNA introduced with a gene encoding the amino acid sequence of malaria antigen” used in the present invention is the same gene (or substantially the same gene) as the gene encoding the amino acid sequence of the malaria antigen possessed by baculovirus. There is no particular limitation as long as it is introduced into plasmid DNA.
Plasmid DNA can be prepared by a method known per se.

(Manufacture of recombinant transfer vectors)
In the present invention, a transfer vector having a structure capable of expressing a malaria antigen and DAF in both insect cells and vertebrate cells (particularly mammalian cells) can be used. In the present invention, the structure of the transfer vector produced is that the amino acid sequence of the desired malaria antigen protein is downstream of a dual promoter in which one is a vertebrate promoter (particularly a mammalian promoter) and the other is a baculovirus promoter. The DAF protein amino acid sequence downstream of the baculovirus promoter as a separate gene cassette. It may be characterized by having a DNA sequence encoding
The DNA regions containing the DNA sequences of the two vertebrate promoters (particularly mammalian promoters) and the baculovirus promoter to be linked may be directly linked, or intervening DNA sequences between the promoter DNA sequences. May be present.

In the above structure, the gene encoding the protein of the gene that can be a constituent of the virus particle and the fusion gene containing the desired malaria antigen gene may be composed of a DNA sequence obtained by directly linking these two genes. In addition, an intervening DNA sequence may exist between them.
It is preferable that the antigen-presenting region of a protein of a desired malaria antigen gene is fused with a protein that can be a constituent of a virus particle.
In addition, a fusion gene containing these two genes may be formed in advance and incorporated into a vector, or one of the genes may be incorporated into the vector first, and then the other gene may be incorporated into the vector. A fusion gene may be formed.

Each of the above operations uses a commercially available expression vector that already has a promoter region such as a mammalian promoter or baculovirus promoter and a gene region that encodes the amino acid sequence of a protein that can be a constituent of a virus particle, and optionally a restriction enzyme By cutting out and incorporating another promoter, a DAF gene, a gene in which a desired malaria antigen gene and a gene encoding the amino acid sequence of a protein that can be a constituent of a virus particle are fused, is inserted into the cloning region of the vector. Or by inserting the desired malaria antigen gene or DAF gene into the N-terminal side of the DNA region of the gene encoding the amino acid sequence of a protein that can be a component of a virus particle already incorporated in the plasmid. Various components can be inserted
As described above, the gene encoding the amino acid sequence of a protein that can be a component of a virus particle capable of expressing the gene encoding the desired malaria antigen and / or the DAF gene in the baculovirus particle (virus surface) is fused. An expressible transfer vector can be produced.

(Examples of using recombinant baculovirus as a malaria prevention agent)
As a method of using the recombinant baculovirus of the present invention as an agent for preventing malaria, the recombinant baculovirus of the present invention can be used once intramuscularly, intranasally, or through the respiratory tract in vertebrates, particularly mammals including humans. Or administer multiple times. The malaria preventive agent of the present invention can be a non-hemolytic single-use preparation.
According to the following examples, baculovirus, or recombinant baculovirus containing a gene encoding the amino acid sequence of DAF 10 ⁸ pfu to 10 ¹² pfu, preferably 10 ⁹ pfu to 10 ¹¹ pfu, more preferably 0.5 × 10 ¹⁰ pfu to 9.9 × 10 ¹⁰ pfu, more preferably 1.0 × 10 ¹⁰ pfu to 5.0 × 10 ¹⁰ pfu on the 13th, 12th, 11th, 10th, 9th, 8th, 7th, 6th, 5th of malaria infection 4 days, 3 days, 2 days, 1 day, 12 hours or 6 hours ago, or any period in between (for example, 13 days to 6 hours ago, 13 days to 12 hours ago or 7 days to 12 (Preferably iv administration or im administration, more preferably im administration, more preferably im administration in the thigh muscle or the left thigh muscle), and the onset of malaria, particularly parasitemia can be prevented. Heading. For example, a baculovirus or a recombinant baculovirus containing a gene encoding the amino acid sequence of DAF is once or multiple times every 13 days, once or multiple times every 12 days, once or multiple times every 11 days, 10 days 1 or more times, 1 or more times in 9 days, 1 or more times in 8 days, 1 or more times in 7 days, 1 or more times in 6 days, 1 or more times in 5 days Once or more than once every 4 days, Once or more times every 3 days Once or more times every 2 days Once or more times a day, Once every 12 hours or more than once every 6 hours Once or several times, or once in any period between them (for example, once or more than 13 days to 6 hours, once or more than 13 days to 12 hours, or 7 days to 12 Once or more times) Given (preferably administered iv or im administration, more preferably im administration, more preferably im administration in the thigh muscle or left femoral muscle) may prevent the development of malaria by, especially parasitemia.

(Examples of using recombinant baculovirus as a treatment for malaria)
As a method of using the recombinant baculovirus of the present invention as a therapeutic agent for malaria, the recombinant baculovirus of the present invention is applied once to a vertebrate, particularly a mammal including a human, intramuscularly, nasally or via the respiratory tract. Or administer multiple times. The malaria therapeutic agent of the present invention can be made into a non-hemolytic single-use preparation.
According to the following examples, baculovirus, or recombinant baculovirus containing a gene encoding the amino acid sequence of DAF 10 ⁸ pfu to 10 ¹² pfu, preferably 10 ⁹ pfu to 10 ¹¹ pfu, more preferably 0.5 × 10 ¹⁰ pfu to 9.9 × 10 ¹⁰ pfu, more preferably 1.0 × 10 ¹⁰ pfu to 5.0 × 10 ¹⁰ pfu after malaria infection for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 Time, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours 43 hours, 44 hours, 45 hours , 46 hours, 47 hours, 48 hours, 49 hours or 50 hours within one or more times, preferably once (eg iv or im administration, preferably im administration, more preferably im administration in the thigh muscle) ) Has been found to be able to treat the onset of malaria, particularly parasitemia.

(Examples of using recombinant baculoviruses as antimalarial innate immunity stimulators)
As a method of using the recombinant baculovirus of the present invention as an antimalarial innate immunity stimulator, the recombinant baculovirus of the present invention can be applied to vertebrates, particularly mammals including humans, intramuscularly, nasally, or respiratoryly. Administered once or multiple times. The antimalarial innate immune enhancer of the present invention can be a non-hemolytic single-use preparation.
The antimalarial innate immunity stimulator of this invention can be made into the malaria vaccine additive containing a baculovirus. In this case, the antimalarial innate immunity stimulator of the present invention can be added within a range that does not interfere with the effect of the malaria vaccine. The malaria vaccine is not particularly limited, and examples thereof include RTS, S, CpG and the like.
In addition, as a method of using the recombinant baculovirus of the present invention as an anti-malarial innate immunity stimulator, a recombinant other than baculovirus containing a gene encoding the amino acid sequence of a malaria antigen is firstly obtained by a priming-boosting method. Virus, plasmid DNA into which a gene encoding the amino acid sequence of malaria antigen is introduced, or a protein having the amino acid sequence of malaria antigen is intramuscularly, nasally, or respiratory tracted to vertebrates, particularly mammals including humans After one or more doses, the recombinant baculovirus of the invention is then administered one or more times. Furthermore, if necessary, a baculovirus or a gene encoding the amino acid sequence of DAF and a recombinant virus containing a promoter capable of expressing the gene (particularly, a recombinant baculovirus) may be administered in combination (mixed administration). good.
According to the following examples, a recombinant baculovirus containing a gene encoding the amino acid sequence of a malaria antigen (particularly CSP) is transformed into a recombinant adenovirus (including a gene encoding the amino acid sequence of the malaria antigen (particularly CSP)). In particular, after adenovirus is administered to a patient (for example, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days after administration) 27 days or 28 days later, preferably 19 to 24 days after administration, and more preferably 21 to 22 days later).
More specifically, as a method for human administration, a known administration method can be adopted, and the following can be exemplified, but it is not particularly limited.
Based on GSK's RTS, S / AS01 phase III clinical trial (N Engl J Med 367 (2012) 2284-95).
First immunization: Intramuscular injection in 6-12 week infants ChAd63-CS (5x10 ¹⁰ vp) (prepared by Oxford Jenner Institute, reference: J Infect Dis 211 (2014) 1076-86)
Second immunization: intramuscular injection after 1-3 months Vaccine of the present invention (1x10 ⁹ pfu)

(Malaria treatment agent, malaria preventive agent, antimalarial innate immunity enhancer or antimalarial innate immunity enhancer composition)
The combination of the antimalarial agent, the antimalarial agent, the antimalarial innate immunity enhancer or the antimalarial innate immunity enhancer composition of the present invention can be exemplified as follows, but is not particularly limited.
(1) Baculovirus (2) Recombinant baculovirus expressing malaria antigen and DAF simultaneously (3) Recombinant baculovirus expressing malaria antigen and DAF simultaneously and recombinant adenovirus expressing malaria antigen (4) Malaria antigen (5) recombinant baculovirus expressing malaria antigen and recombinant adenovirus expressing malaria antigen (6) recombinant baculovirus expressing DAF The recombinant baculovirus used in the present invention is Different gene cassettes can be inserted simultaneously (Reference: Kanai et al., Protein Expr Purif 91 (2013) 77-84). Therefore, it is possible to incorporate malaria antigens other than CSP, HIV, and tuberculosis antigen genes. That is, if a system using this recombinant baculovirus is used, a multivalent vaccine can be prepared for infectious diseases in which cellular immunity induction is indispensable.

The antimalarial innate immunity enhancer composition of the present invention showed a high protective effect without being used in combination with an adjuvant from the results of the following examples. Therefore, it is not necessary to use an adjuvant as an essential component. good.
The antimalarial innate immunity enhancer composition (including the antimalarial innate immunity enhancer) of the present invention comprises a recombinant baculovirus suspension suspended in PBS (phosphate buffered physiological saline) or physiological saline. Direct injection into the local area (eg, lung tissue, liver, intramuscular and brain, etc.), inhalation nasally or via the airway, or intravascular (eg, intraarterial, intravenous, and portal vein) Is administered.

(Prevention and treatment methods for malaria)
In this invention, the prevention method and treatment method of malaria are also made into object. More specifically, the baculovirus of the present invention is administered to vertebrates, particularly mammals including humans, one or more times intramuscularly, nasally or via the respiratory tract.
Alternatively, the baculovirus of the present invention was first introduced by the Priming-Boosting method, a recombinant virus other than baculovirus containing a gene encoding the amino acid sequence of the malaria antigen, and a gene encoding the amino acid sequence of the malaria antigen. After the plasmid DNA or the protein having the amino acid sequence of the malaria antigen is administered to a malaria patient (including a subject to be prevented before onset of malaria) one or more times intramuscularly, nasally or via the respiratory tract, The baculovirus of the present invention is administered once or multiple times. Further, if necessary, a baculovirus or a recombinant virus (particularly, a recombinant baculovirus) containing a gene encoding the amino acid sequence of DAF and a promoter capable of expressing the gene is co-administered (mixed administration).

(Examples of using baculovirus as an IFN-α and IFN-γ production promoter)
The present invention is directed to IFN-α and IFN-γ production promoters including baculovirus.
As a method of using baculovirus as an IFN-α and IFN-γ production promoter, baculovirus can be applied to vertebrates, particularly mammals including humans, intramuscularly, nasally, or via respiratory tract, except for malaria vaccine. One or more doses are administered in combination with the vaccine. The IFN-α and IFN-γ production promoter of the present invention can be a non-hemolytic single-use preparation.
The dose, frequency and interval of administration of the IFN-α and IFN-γ production promoter of the present invention are not particularly limited, and the purpose of prevention (particularly prevention of recurrence) and / or clinical treatment, disease type, patient's It is appropriately selected according to conditions such as weight, age, and severity of disease.
For example, the following dosage forms can be used, but are not particularly limited.
10 ⁸ pfu~10 ¹² pfu baculovirus equivalent amount, preferably 10 ⁹ pfu~10 ¹¹ more preferably ^{pfu 0.5 × 10 10 pfu~9.9 × 10} 10 pfu, more preferably 1.0 × ¹⁰ 10 pfu~5.0 × 10 10 pfu is administered once a day or divided into several times a day (morning, noon, evening).

(Example of use as a cancer therapeutic agent)
The present invention is directed to a cancer therapeutic agent containing an IFN-α and IFN-γ production promoter.
As a method for use as a cancer therapeutic agent, IFN-α and IFN-γ production promoters including baculovirus are applied intramuscularly, nasally, or airways to vertebrates, particularly mammals including humans, preferably It is administered once or multiple times in combination with other cancer therapeutic agents. The cancer therapeutic agent of the present invention can be a non-hemolytic single-use preparation. Other cancer therapeutic agents to be administered in combination with the cancer therapeutic agent of the present invention are not particularly limited, and may be anticancer agents known per se, such as the purpose of clinical treatment, tumor type, patient age, severity of disease, etc. It is selected appropriately according to the conditions.
The dose, frequency, and interval of administration of the cancer therapeutic agent of the present invention are not particularly limited, and the purpose of prevention (particularly prevention of recurrence) and / or clinical treatment, the type of disease, the patient's weight, age, the severity of the disease. It is appropriately selected according to conditions such as severity.
For example, the following dosage forms can be used, but are not particularly limited.
10 ⁸ pfu~10 ¹² pfu baculovirus equivalent amount, preferably 10 ⁹ pfu~10 ¹¹ more preferably ^{pfu 0.5 × 10 10 pfu~9.9 × 10} 10 pfu, more preferably 1.0 × ¹⁰ 10 pfu~5.0 × 10 10 pfu is administered once a day or divided into several times a day (morning, noon, evening). In addition, daily administration is preferred, but it can also be administered once every few days or several times every other week.
As used herein, cancer refers to malignant tumors, that is, pancreatic cancer, breast cancer, lung adenocarcinoma, colon cancer, hepatocellular carcinoma, gastric cancer, thyroid cancer, ovarian cancer, salivary glandular cystic cancer, prostate cancer, Burkitt lymphoma, Acute myeloid leukemia, mucinous liposarcoma, glioblastoma, alveolar rhabdomyosarcoma, Wilms tumor, oligodendroglioma, corticocarcinoma, multiple myeloma, nodular lymphocyte-dominated Hodgkin lymphoma, trait Cellular leukemia, medulloblastoma, B-cell chronic lymphocytic leukemia, lung cancer, squamous cell carcinoma of the lung, type II endometrial cancer, diffuse large B-cell lymphoma, esophageal cancer, peripheral T-cell lymphoma, undifferentiated One or more types of cancer selected from large cell lymphoma, Ewing sarcoma and progenitor T cell lymphoblastic leukemia, particularly preferably one or more types selected from pancreatic cancer, breast cancer, lung adenocarcinoma and colon cancer Of cancer.

(Example of use as a therapeutic agent for liver disease)
The present invention is directed to a liver disease therapeutic agent comprising an IFN-α and an IFN-γ production promoter.
As a method for use as a therapeutic agent for liver disease, IFN-α and IFN-γ production promoters including baculovirus are used alone in vertebrates, particularly mammals including humans, intramuscularly, nasally, or via airway. Or in combination with other therapeutic agents for liver disease once or multiple times. The therapeutic agent for liver disease of the present invention can be a non-hemolytic single-use preparation. The liver disease is not particularly limited, but hepatitis is preferable, and hepatitis C is more preferable.
The dose, frequency and interval of administration of the therapeutic agent for liver disease of the present invention are not particularly limited, and the purpose of prevention (especially prevention of recurrence) and / or clinical treatment, disease type, patient weight, age, disease It is appropriately selected according to conditions such as seriousness.
For example, the following dosage forms can be used, but are not particularly limited.
10 ⁸ pfu~10 ¹² pfu baculovirus equivalent amount, preferably 10 ⁹ pfu~10 ¹¹ more preferably ^{pfu 0.5 × 10 10 pfu~9.9 × 10} 10 pfu, more preferably 1.0 × ¹⁰ 10 pfu~5.0 × 10 10 pfu is administered once a day or divided into several times a day (morning, noon, evening). In addition, daily administration is preferred, but it can also be administered once every few days or several times every other week.

(Example of use as a vaccine additive other than malaria vaccine)
The present invention is directed to a vaccine additive other than a malaria vaccine containing an IFN-α and an IFN-γ production promoter.
As a method for using as a vaccine additive other than malaria vaccine, IFN-α and IFN-γ production promoters including baculovirus were applied to vertebrates, particularly mammals including humans. In addition, it is administered once or multiple times in combination with a vaccine other than the malaria vaccine. Vaccine additives other than the malaria vaccine of the present invention can be made into a non-hemolytic single-use preparation.
The dose, frequency and interval of administration of vaccine additives other than the malaria vaccine of the present invention are not particularly limited, and the purpose of prevention (especially prevention of recurrence) and / or clinical treatment, disease type, patient weight, age It is appropriately selected according to conditions such as the severity of the disease.
For example, the following dosage forms can be used, but are not particularly limited.
10 ⁸ pfu~10 ¹² pfu baculovirus equivalent amount, preferably 10 ⁹ pfu~10 ¹¹ pfu, more preferably ^{0.5 × 10 10 pfu~9.9 × 10 10} pfu, more preferably 1.0 × ¹⁰ 10 pfu~5.0 × 10 ¹⁰ pfu is administered once a day or divided into several times a day (morning, noon, evening). In addition, it can be administered simultaneously with the vaccine used in combination, or once every several days or several times every other week.

  The various agents of the present invention can contain a pharmacologically acceptable carrier. Examples of the carrier include excipients, disintegrants or disintegration aids, binders, lubricants, coating agents, dyes, diluents, bases, solubilizers or solubilizers, isotonic agents, and pH adjustment. An agent, a stabilizer, a propellant, an adhesive, etc. can be mentioned.

(Features of the present invention)
About the baculovirus of this invention, or recombinant baculovirus, the effect of any one or more of the following was confirmed from the following Example.
(1) BV im administration is less invasive than iv administration.
(2) BV iv administration can induce a stronger systemic innate immune response than im administration depending on the target disease such as cancer. (3) BV iv administration 6 hours before sporozoite infection Can completely protect against the development of parasitemia (can maintain a state in which no red endoparasite appears).
(4) Immunization of BV 12 hours to 7 days before sporozoite infection can completely prevent the onset of erythroparasitic paraemia.
(5) iv administration or im administration of BV 24 hours after sporozoite infection can completely prevent the onset of erythroparasitic disease.
(7) Im administration of BV 24 to 42 hours after infection can partially prevent the onset of erythroblastic parasitemia (the time it takes for parasitemia to reach 1% can be delayed).
(8) BV can kill parasites through a TLR9-independent pathway.
(9) BV can induce IFN-α and IFN-γ production through a TLR9-independent pathway and an IRF3-dependent pathway. Therefore, BV has an effect of promoting IFN-α and IFN-γ production.
(10) BV induces IFN production and can kill parasites through an effector mechanism activated by IFNs.
(11) BV plays an important role in the introduction of heat-sensitive viral components into cells, causing type I IFN production by innate immunity by DNA sensing, and the heat-resistant component of BV kills parasites by an IFN-independent mechanism. Can be destroyed.
(12) BV induces IFN production, and systemic type I IFN secretion can strongly induce ISG gene expression in the liver.
(13) AdHu5-PfCSP / BDES-sPfCSP2-WPRE-Spider vaccine has a short-term therapeutic / preventive effect due to innate immunity and exerts a general vaccine effect as acquired immunity (CSP specific) after 21 days .
More specifically, boosting with BDES-sPfCSP2-WPRE-Spider is effective from 24 hours before the boost to 7 days after the boost (8 days in total). In other words, even if infection occurs from 24 hours before the boost to the boost, there is a complete therapeutic effect, and there is a preventive effect until the seventh day after the boost.
Prime by AdHu5-PfCSP / Boost by BDES-sPfCSP2-WPRE-Spider exerts a protective effect by general acquired immunity from the 21st day after boost.
(14) Administration of BV is effective for the therapeutic effect of cancer.
(15) BV im administration is effective for the treatment of liver diseases such as hepatitis C.
(16) Immediate administration of BV 6 hours before infection can kill liver stage parasites and prevent parasitemia.
(17) BES-GL3 iv administration or im administration 24 hours after sporozoite infection, onset of erythroparasitic disease for 8 days from 0 hours to 8 days after infection (24 hours before to 7 days after administration) Can be completely protected and / or partially protected (anti-malarial innate immune activation effect).
Thus, by mixing the anti-malarial innate immunity stimulating agent of the present invention with a vaccine, there is a complete therapeutic effect even if it is infected from 24 hours before vaccination to vaccination, and there is a preventive effect until 7 days after vaccination. It can be used as a malaria vaccine additive.
Furthermore, both IFN-α and IFN-γ produced by BV are known to have antiviral activity, and by mixing with other vaccines, the above effect for a total of 8 days can be expected, It can be used as a vaccine additive other than malaria vaccine.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope which concerns on this invention is not limited to a following example.

  All animal care and handling procedures were approved by the Kanazawa University Animal Health Review Board (No. 22118-1) and Jichi Medical University (No. 09193). All animal experiments minimized animal suffering. Mice were anesthetized with ketamine {100 mg / kg; i.m. (intramuscular administration); Tokyo Daiichi Sankyo} and xylazine (10 mg / kg; i.m .; Bayer) as needed.

<Materials and methods>
(Animals, cell lines, parasites and mosquitoes)
Female inbred BALB / c (H-2 ^d ) mice were obtained from Japan SLC and used at 7-8 weeks of age in all experiments. TLR9-deficient mice (TLR9 ^-/- ) on the BALB / c background received a gift from Osaka University. In this example, when “BALB / c mouse” is simply described, it means wild type (WT). Spodoptera frugiperda (Sf9) and HepG2 cells are described in the literature {Iyori, M. et al. Protective efficacy of baculovirus dual expression system vaccine expressing Plasmodium falciparumcircumsporozoite protein. ).}. Three transgenic P. berghei ANKA parasites, green fluorescent protein (GFP) -P. Berghei (Pb-conEGFP) {Franke-Fayard, B. et al. A Plasmodium berghei reference line that constitutively expresses GFP at a high level throughout the complete life cycle. Mol Biochem Parasitol 137, 23-33, doi: 10.1016 / j.molbiopara.2004.04.007 (2004).}, Luciferase-P. Berghei (Pb-Luc) {Matsuoka, H., Tomita, H., Hattori, R., Arai, M. & Hirai, M. Visualization of Malaria Parasites in the Skin Using the Luciferase Transgenic Parasite, Plasmodium berghei. Tropical medicine and health 43, 53-61, doi: 10.2149 / tmh.2014- 18 (2015).} And PfCSP-P. Berghei (PfCSP-Tc / Pb) {Sumitani, M. etal. Reduction of malaria transmission by transgenic mosquitoesexpressing an antisporozoite antibody in their salivary glands. Insect Mol Biol 22, 41-51, doi: 10.1111 / j.1365-2583.2012.01168.x (2013).} is the standard protocol {Yoshida, S., Kawasaki, M., Hariguchi, N., Hirota, K. & Matsumoto, M A baculovirus dual expression system-based malariavaccine induces strong protection against Plasmodium berghei sporozoitechallenge in mice. Infect Immun77, 1782-1789, doi: IAI.01226-08 [pii] and Yamamoto, DS, Sumitani, M., Nagumo, H. , Yoshida, S. & Matsuoka, H. Induction of antisporozoite antibodies by bitingof transgenic Anopheles stephensi delivering malarial antigen via blood feeding.Insect Mol Biol 21, 223-233 (2012).} BALB at Kanazawa University and Jichi Medical University Maintained by cycling through / c mice and Stefen anopheles (Anopheles stephensi, SDA 500 strain). INOS KO (iNOS ^-/- ) mice on the B6 background received a gift from Kyorin University.

(Recombinant virus)
Recombinant baculovirus BES-GL3 and BDES-sPfCSP2-WPRE-Spider are described in literature {Iyori, M. et al. DAF-shielded baculovirus-vectoredvaccine enhances protection against malaria sporozoite challenge in mice. Malar J 16, 390, doi: 10.1186 / s12936-017-2039-x (2017).} (see FIG. 6). The purified baculovirus particles were confirmed to contain no endotoxin using an Endospecy (registered trademark) endotoxin measurement kit (Seikagaku Corporation) (<0.01 endotoxin units / 10 ⁹ pfu). Recombinant adenoviruses AdHu5-Luc and AdHu5-sPfCSP2 are published in the literature {Yoshida, K. etal. Adenovirus-prime and baculovirus-boost heterologous immunizationachieves sterile protection against malaria sporozoite challenge in a murine model. -018-21369-y (2018).}. In this specification, BDES-sPfCSP2-WPRE-Spider and AdHu5-sPfCSP2 are referred to as BDES-PfCSP and AdHu5-PfCSP, respectively.

(Collecting sporozoites)
Stefen anopheles was infected by sucking the blood of infected mice with three transgenic P. berghei ANKA parasites using standard methods of mosquito infection. Mosquito salivary glands were excised by hand on the 21st to 24th days of infection and collected. Salivary glands were collected in DMEM (Thermo Fisher Scientific KK) and homogenized in a plastic homogenizer. Migratory sporozoites were counted in a disposable hemocytometer using phase contrast microscopy.

(Analysis of protective effects against sporozoite parasites)
BALB / c mice were administered 10 ⁴ to 10 ⁸ pfu of BES-GL3 iv (intravenously), im (intramuscularly) or in (intranasally). Alternatively, 50 μg of CpG ODN1826 (TCCATgACgTTCCTgACgTT: SEQ ID NO: 1, Fasmac Inc.) was administered to BALB / c mice im (intramuscularly) instead of BES-GL3. These mice were infected with iv challenge with 1,000 Pb-conGFP sporozoites or 1,000 infected erythrocytes at various time intervals (6 hours to 14 days). P. berghei blood-stage infection of each mouse was confirmed by microscopic examination of a thin smear of Giemsa-stained tail blood prepared on days 5, 6, 7, 8, 11 and 14 after challenge infection . The time required to reach 1% parasitemia is the literature {Epstein, JE et al. Live attenuated malaria vaccine designed to protect through hepatic CD8 T cell immunity. Science 334, 475-480, doi: 10.1126 / science.1211548 ( 2011).} As determined. In order for mice to be considered negative for infection, at least 20 fields (magnification x 1,000) were examined. The complete absence of erythroparasite paraemia on day 14 after challenge was defined as “protection”.

(Analysis of removal effect on liver stage parasites)
BALB / c mice were injected with 1000 Pb-conGFP sporozoites iv and BES-GL3 was iv (10 ⁷ pfu) or im (10 ⁸ pfu) at various time intervals (6 hours, 24 hours or 42 hours) Administered. Note that the mouse muscle injection 10 ⁸ pfu roughly corresponds to the human muscle injection 10 ¹⁰ pfu. By the above-mentioned method, each mouse was confirmed for P. berghei red endophase infection and evaluated for 1% parasitemia.
Alternatively, instead of BV, a single low dose (0.1 mg) or single high dose (2 mg) primaquine (PQ) (Primaquine diphosphate 98) in a concentration range of 20 mg / kg body weight to 40 mg / kg body weight, respectively %; Aldrich) was administered intraperitoneally (ip) 24 hours after injection of 1,000 Pb-conGFP sporozoites. By the above-mentioned method, each mouse was confirmed for P. berghei red endophase infection and evaluated for 1% parasitemia.

(In vivo bioluminescence imaging 1)
On day 0, BAES / GL3 was administered iv or im to BALB / c mice and D-luciferin (15 mg / ml; OZ Biosciences) was administered ip (150 μl / mouse) at appropriate time points.
Ten minutes later, the mice were anesthetized with a ketamine (100 mg / kg) / xylazine (10 mg / kg) mixture and luciferase expression was detected with the IVIS® Lumina LT in vivo imaging system (PerkinElmer).

(In vivo bioluminescence imaging 2)
BALB / c mice were injected with 1,000 Pb-luc sporozoites by iv, and BES-GL3 (10 ⁸ pfu) was administered im to the left thigh muscle 24 hours or 42 hours later.
Mice were anesthetized with a ketamine (100 mg / kg) / xylazine (10 mg / kg) mixture 72 hours after sporozoite injection, and luciferase expression was detected with the IVIS® Lumina LT in vivo imaging system. 5-14 days after infection, the same mice were analyzed for end-stage red infection by determining the course of parasitemia in thin blood membranes stained with Giemsa of tail blood.

(Cytokine, AST and ALT assays)
BAV / c mice were administered BV iv or im and cardiac puncture whole blood was collected at various time points and stored at −20 ° C. until analysis. Serum cytokine concentrations were measured using Mouse IFN-γ ELISA MAX ™ standard kit (Biolegend Inc.), Mouse IL-12 / IL-23 (p40) ELISA MAX ™ standard kit (Biolegend Inc.), mouse TNF- α ELISA MAX ™ deluxe kit (Biolegend Inc.) was determined by sandwich ELISA using the manufacturer's instructions. The concentration of IFN-α was determined by sandwich ELISA. More specifically, a rat monoclonal antibody against mouse IFN-α (PBL Biomedical Laboratories clone RMMA-1) was used as a capture antibody (2 μg / ml for coating), and a rabbit IFN-α polyclonal antibody against mice (PBL Biomedical Laboratories) Was used in 80 neutralizing units for detection and HRP-conjugated goat anti-rabbit IgG (Bio-Rad) was used as a secondary reagent. Recombinant mouse IFN-α (PBL Biomedical Laboratories) was used as a standard. The lower detection limits for IFN-γ and IL-12 immunoassays were <20 pg / ml and <10 pg / ml, respectively, and the lower detection limits for IFN-α and TNF-α immunoassays were <20 pg / ml and <10 pg / ml, respectively. ml. Serum ALT and AST concentrations were measured using a GPT / GOT assay kit (Transaminase CII-test; Wako Pure Chemical Industries, Ltd.) according to the manufacturer's instructions.

(Serum transfer analysis)
Serum collected by cardiac puncture from 5 BALB / c mice administered with BES-GL3 by im 6 hours before (-6 hours) was pooled, and immediately after that IFN-α and IFN-γ concentrations were determined. It was measured. IFN-α and IFN-γ in 100 μl of serum were anti-IFN-α (Anti-Mouse Interferon Alpha, Rabbit Serum; PBL Biomedical Laboratories) and anti-IFN-γ {Ultra-LEAF ™ Purified anti-mouse IFN-γ Antibody; BioLegend Inc.} was neutralized by incubating with antibody for 6 hours on ice. Incubation with the appropriate amount of anti-IFN-α or anti-IFN-γ neutralized IFN-α or IFN-γ in 100 μl of serum. 24 hours after iv injection of 1,000 Pb-conGFP sporozoites to BALB / c mice, 100 μl of serum treated with either anti-IFN-α or anti-IFN-γ was administered iv. By the above-mentioned method, each mouse was confirmed for P. berghei red endophase infection and evaluated for 1% parasitemia.

(BV heat inactivation)
HI-BV (heat inactivated BV) was prepared from BES-GL3 by heat inactivation at 56 ° C. for 30 minutes. HepG2 cells are seeded at 4 × 10 ⁴ cells per well in a 48-well cell culture plate (Sigma-Aldrich). After 24 hours, HI-BV (10 ⁸ pfu) or BES-GL3 (10 ⁸ pfu) at MOI 100 Transduced.
Cells were transduced with either HI-BV (10 ⁸ pfu) or BES-GL3 (10 ⁸ pfu) at a MOI of 100. After 24 hours, the medium was removed and cell extracts were prepared by adding cell culture lysis reagent (Promega Corporation) according to the manufacturer's instructions (Promega). The emission intensity of the sample was measured using a microplate reader (GloMax® 96 Microplate Luminometer, Promega), and the photoreaction of each well was measured for 5 seconds. Luciferase activity is expressed as relative luminescence units (RLU). BALB / c mice received HI-BV or BES-GL3 im 24 hours after iv injection of 1,000 Pb-conGFP sporozoites. By the above-mentioned method, each mouse was confirmed for P. berghei red endophase infection and evaluated for 1% parasitemia. HI-BV or BES-GL3 was administered to another group of BALB / c mice, serum was collected 6 hours later, and the levels of IFN-α and IFN-γ were measured by the above-mentioned ELISA.

(RNA isolation from liver and qRT-PCR quantification)
BALB / c (WT or TLR9 ^{− / −} ) mice were administered 1 × 10 ⁸ pfu BES-GL3 in im. Alternatively, 50 μg CpG ODN1826 was administered im instead of BV. After 6 hours, whole liver was obtained by incision of treated mice. Each whole liver was placed in a capped 5 ml plastic tube with 4 ml Buffer RLT (Qiagen) containing 1% 2-mercaptoethanol. Two stainless beads (outer diameter 5 mm) were added. The tube was capped, attached to a μT-12 bead crusher (TAITEC), and shaken vigorously at 2,500 rpm for 3 minutes 30 seconds. Total RNA was isolated from 100 μl homogenate using RNeasy kit (Qiagen). CDNA was synthesized using random hexamers and Multiscribe reverse transcriptase (AppliedBiosystems). RNA transcripts were quantitatively analyzed by real-time PCR using SYBR (registered trademark) Green Premix Ex Taq (trademark) (Takara Bio Inc.) and the following primer sets.
gapdh (F: TGCCCCCATGTTTGTGATG: SEQ ID NO: 2, R: TGTGGTCATGAGCCCTTCC: SEQ ID NO: 3),
mx1 (F: AACCCTGCTACCTTTCAA: SEQ ID NO: 4, R: AAGCATCGTTTTCTCTATTTC: SEQ ID NO: 5),
oas1a (F: ACTCCTTTGTGGCTCAGTGG: SEQ ID NO: 6, R: ACCAGCTCCACGTCTGTAGTG: SEQ ID NO: 7),
oas1b (F: TTCTACGCCAATCTCATCAGTG: SEQ ID NO: 8, R: GGTCCCCCAGCTTCTCCTTAC: SEQ ID NO: 9),
oasl1 (F: ATGTTAATACTTCCAGCAAGC: SEQ ID NO: 10, R: GCAAAGACAGTGAGCAACTCT: SEQ ID NO: 11),
pkr (F: GATGGAAAATCCCGAACAAGGAG: SEQ ID NO: 12, R: AGGCCCAAAGCAAAGATGTCCAC: SEQ ID NO: 13),
ifit1 (F: CCTTTACAGCAACCATGGGAGA: SEQ ID NO: 14, R: GCAGCTTCCATGTGAAGTGAC: SEQ ID NO: 15),
ifit3 (F: CTGAACTGCTCAGCCCACAC: SEQ ID NO: 16, R: TGGACATACTTCCTTCCCTGA: SEQ ID NO: 17),
ifit44 (F: TCGATTCCATGAAACCAATCAC: SEQ ID NO: 18, R: CAAATGCAGAATGCCATGTTTT: SEQ ID NO: 19),
irf3 (F: GATGGCTGACTTTGGCATCT: SEQ ID NO: 20, R: ACCGGAAATTCCTCTTCCAG: SEQ ID NO: 21), and
irf7 (F: CTTCAGCACTTTCTTCCGAGA: SEQ ID NO: 22, R: TGTAGTGTGGTGACCCTTGC: SEQ ID NO: 23).
Amplification of gapdh was performed in each experiment. The Ct value of each sample was normalized with the gapdh Ct value (ΔCt), and each ΔCt value was normalized with the ΔCt value of the PBS control wild type mouse (ΔΔCt). Results were expressed as relative expression (1 / 2ΔΔCt).

(Immunity and challenge infection)
The protective effect of heterologous AdHu5-prime / em (envelopedmodified) BDES-boost immunity against sporozoite challenge infection was evaluated.
Literature {Yoshida, K. et al. Adenovirus-prime andbaculovirus-boost heterologous immunization achieves sterile protection againstmalaria sporozoite challenge in a murine model. Scientific reports 8, 3896, doi: 10.1038 / s41598-018-21369-y (2018)} BALB / c mice were immunized im with a heterologous Ad63-prime / emBDES-boost regimen at 3 week intervals by the method described in. The vaccine dose was 100 μl containing 5 × 10 ⁷ pfu for AdHu5-PfCSP and 100 μl containing 1 × 10 ⁸ pfu for BDES-PfCSP. Literature {Bauza, K. et al. Efficacy of a Plasmodium vivaxmalaria vaccine using ChAd63 and modified vaccinia Ankara expressingthrombospondin-related anonymous protein as involved with transgenic Plasmodiumberghei parasites. Infect Immun82, 1277-1286, doi: 10.1128 / iai.01187-13 ( 2014).} Each mouse was challenged with 1,000 PfCSP-Tc / Pb sporozoites iv challenge 3 weeks after priming (first challenge infection) and boosted 24 hours later. By the above-mentioned method, each mouse was confirmed for P. berghei red endophase infection and evaluated for 1% parasitemia. Protected mice were iv rechallenge with 1,000 PfCSP-Tc / Pb sporozoites 21 days after boosting and complete erythroparasiticemia on day 14 after the first and second challenge The lack was defined as “defense”.

(Statistical analysis)
Two-tailed Fisher's exact probability test was performed using SPSS software (version 19) to determine the significance of the difference in vaccine protection effect. A p value less than 0.05 was considered statistically significant. Statistical analysis was performed using Prism version 7.0a (GraphPad Software Inc.) or Microsoft® Excel (Microsoft).

<Result>
(In vivo transgene expression and innate immune response by BV administration)
The results of BV administration by transvenous route (iv) and intramuscular route (im) for transgene expression and innate immune response are shown in FIG.
Use BES-GL3 with two gene cassettes consisting of a luciferase gene under the control of the CMV promoter and a DAF gene under the control of the p10 promoter to evaluate the effect of innate immune responses that BV induces on malaria infection did. These cassettes were designed to express luciferase as a transduction marker and present DAF on the virion for protection of BV from complement attack {Iyori, M. et al. DAF -shieldedbaculovirus-vectored vaccine enhances protection against malaria sporozoitechallenge in mice. Malar J 16, 390, doi: 10.1186 / s12936-017-2039-x (2017).}. That is, the role of DAF used in this example is to protect the luciferase (GL3) gene in the virus by shielding the baculovirus from complement attack and preventing partial destruction of the baculovirus. The luciferase gene is for monitoring the expression of the transgene in the liver and muscle, and is irrelevant to the innate immune response according to the present invention. Thus, the wild-type Autographa Californica Nuclear Polyhedrosis Virus is related to the IES-α production and anti-parasitic effects used in this example even when partially destroyed by complement attack. It is thought that the same effect as GL3 can be demonstrated.
BES-GL3 im administration to the left thigh muscle of mice strongly increased the luciferase expression level but gradually decreased to 2% on day 28 (FIG. 1A).
As shown in FIG. 1B, it was confirmed that intravenous (iv) administration of BES-GL3 effectively transduced hepatocytes in vivo, although the expression level decreased rapidly in just 1 day.

(Kinetics of ALT and AST, pro-inflammatory cytokines in serum after iv administration of BES-GL3)
As a result of measuring serum cytokine levels after iv administration of BV, IFN-γ and TNF-α increased rapidly, reached maximum values after 6 hours, and decreased to baseline by 24 hours (Figure 1C). And D). ALT and AST increased rapidly, reaching a maximum value after 12 hours and decreased to baseline by 48 hours (FIGS. 1E and F). Im administration of BV did not affect ALT levels compared to iv administration of BV, but AST levels tended to be higher (FIGS. 1G and H). ALT is used as a sensitive indicator of liver damage, suggesting that im administration of BV is less invasive than iv.
Moreover, it was suggested that iv administration of BV can induce a systemic innate immune response stronger than im administration as needed, depending on the target disease such as cancer. That is, it was confirmed that administration of BV is effective for the therapeutic effect of cancer. More specifically, iv administration of BV is expected to have a higher innate immune response induced by the higher invasiveness compared to im administration. In addition, iv administration produced 80 times more IFN-γ than im administration (FIGS. 1C and 2B). Therefore, in the case of a disease requiring a strong innate immune response such as cancer, iv administration may be preferable depending on the degree of progression of the disease.
In addition, BV was confirmed to be effective in the treatment of liver diseases such as hepatitis C because im administration of BV induced the production of IFN-α used in the treatment of hepatitis C (Fig. 2A). did.

(Sterile protection by BV administration against sporozoite infection)
Table 1 shows the results of analysis of the sterilization protective effect against malaria sporozoite infection by iv administration and im administration of BV.
Here, we focused on the effects of innate immune responses induced by BV on malaria infection. Table 1 summarizes the results of the protective effect of BV administration against malaria sporozoite challenge infection. First, in order to examine the effect of iv administration of BV, mice were administered iv with 1 × 10 ⁷ pfu of BES-GL3, and 6 hours after the peak of IFN-γ production, the mice were treated with 1,000 Pb-conEGFP sporozoites. Challenged infection. All BV-treated mice were protected, but PBS-treated mice and AdHu5-treated mice were all infected (lines 1 to 3 in Table 1).
Next, after im administration of BES-GL3 (1 × 10 ⁸ pfu), sporozoite challenge infection was performed at various challenge infection intervals. All mice were protected for at least 7 days.
No protection was observed in mice that had been inoculated with sporozoites 6 hours after BES-GL3 in administration (line 11 in Table 1).
It was confirmed that BV had no residual effect on red endophytic parasites, as the infection occurred against challenge infection of 1,000 infected erythrocytes 6 hours after iv administration of BES-GL3 (Table 1). Line 12).
Im administration of CpG 6 or 24 hours prior to challenge infection protected 90% or 80% against sporozoite challenge infection, respectively (lines 13 and 14 in Table 1). This is due to previous findings showing short-term (2 days) protection of C.P. yoelii sporozoite challenge infection by CpG im (50 μg) {Gramzinski, RA et al. Interleukin-12- and gammainterferon-dependent Infect Immun69, 1643-1649, doi: 10.1128 / iai.69.3.1643-1649.2001 (2001).} in accordance with protection against malaria conferred by CpGoligodeoxynucleotide in mice. However, protection was partial (50%) when there was a longer period (7 days) between CpG im treatment and challenge infection.
From the above, it was suggested that the protective effect induced by im administration of BES-GL3 is more effective and lasts longer than CpG (7 days). The superior protective effect observed in these mice receiving BES-GL3 is most likely due to a BV-mediated innate immune response.
In all experiments under well-controlled conditions, 100% PBS treated control mice confirmed end-stage erythrocytic infection (parasitemia) within 6 days after injection of 1,000 Pb-conGFP sporozoites .

(BV administration completely eliminates liver stage parasites)
Table 2 shows the results of evaluating whether iv and im administration of BV completely eliminates liver stage parasites.
It has been reported that hepatocytes infected with liver stage parasites are killed by type I and type II IFNs stimulation pathways.
BES-GL3 was administered iv or im to mice after sporozoite challenge infection, and the effects of BV-induced type I IFN and type II IFN on liver stage parasites in vivo were evaluated.
Two intervals after sporozoite challenge infection, 24 hours and 42 hours, examined the trophozoite and parasite elimination effects on the exoerythrocytic (mature) schizont stages, respectively. Table 2 summarizes these results on the elimination effect of BES-GL3 administration on liver stage parasites.
All mice completely blocked red endoparasites by iv administration of BES-GL3 24 hours after infection with Pb-conGFP sporozoite, but excluded when iv administration of BES-GL3 to mice 42 hours after infection The effect disappeared (line 2 to line 3 in Table 2). Similar results were obtained when BES-GL3 was administered to mice im.

To visualize the removal of parasites by BV, mice were infected with Pb-Luc, a transgenic P. berghei that constitutively expresses luciferase, in the liver and subsequent blood (red endophase) FIG. 1 shows the result of detecting luciferase expression with IVIS, which is a highly sensitive method for detecting parasites.
Parasites were observed in the liver 24 hours and 42 hours after infection (left panels in FIGS. 1I and J).
Immediate administration of BES-GL3 to the left thigh muscle 24 hours after infection completely removed liver stage parasites 72 hours after infection, whereas PBS control mice developed red endoparasites (FIG. 1I). Right panel).
Im administration of BES-GL3 to the right thigh muscle 42 hours after infection caused red endoparasites (right panel in FIG. 1J).
A significant delay in parasitemia was observed upon im administration of BES-GL3 42 hours after infection (FIG. 1K).
Sporozoites injected from mosquitoes reach the liver within an hour. P. berghei exoerythrocyticmerozoites are released into the bloodstream from infected hepatocytes 44 to 48 hours after the liver stage {Garnham, PC Malaria in its various vertebrate hosts. In JP Kreier (ed.) , Malaria, vol. 1. Epidemiology, Chemotherapy, Morphology, and Metabolism. Academic Press, Inc., New York, 96-144 (1980).} (42 hours post infection) induced by a rapid downstream killing mechanism of the innate immune system in the liver within 2-6 hours. Low dose (10 ⁴ pfu and 10 ⁶ pfu) BES-GL3 24 hours after infection completely protects against red endoparasite infection (0% parasitemia without complete appearance of red endoparasite) Could not). However, when BES-GL3 was administered at 10 ⁶ pfu 24 hours after infection and 10 ⁸ pfu 42 hours after infection, partial protection against parasitemia (significantly delayed the time required to reach 1% parasitemia) ) Was observed (FIGS. 1K and L). From this, it was confirmed that the exclusion effect of im administration of BV was dependent on the dose of BV.

Primaquine (PQ), the only drug approved as a curative treatment for P. vivax hypnozites {Edgcomb JH, et al. (1950) Primaquine, SN 13272, a new curative agent in vivax malaria; a preliminary Comparison with report. J Natl Malar Soc 9 (4): 285-292.} was very important. Two different doses of PQ were administered, high dose (2 mg / mouse) and low dose (0.1 mg / mouse), 533 and 27 times higher than the recommended WHO dose per human body weight, respectively. A single dose of high dose PQ completely eliminated liver stage parasites (Table 2). On the other hand, all of the low-dose PQ eventually develops, but there is a delay in onset (delay of time required for parasitemia to reach 1% compared to the control group) (Fig. 1K). This indicates a reduction in the parasite load in the liver (extending time detected in the blood as a result of the death of many parasites in the liver). However, with low dose PQ, 27 times the dose recommended by WHO is administered, and it is still not the optimal treatment method.
Low-dose PQ did not reach the optimal dose for reduced parasite load in the liver and significant delay of parasitemia (FIG. 1K). Because high doses of PQ often cause side effects of nausea, vomiting, and gastric spasm, the WQ recommended PQ treatment schedule is 15 mg / day for 14 days (15 days), limiting patient compliance where PQ resistance can occur {Collins, WE & Jeffery, GM Primaquine resistance in Plasmodium vivax. Am J Trop Med Hyg 55, 243-249 (1996). And Baird, JK Resistance to therapies for infection by Plasmodium vivax. Clin Microbiol Rev 22, 508- 534, doi: 10.1128 / cmr.00008-09 (2009).}. These results indicated that im administration of BV has significant advantages over PQ.

(Destruction of BV-mediated hepatic parasites by TLR9-independent pathway)
CpG im administration completely eliminated parasites in the early liver stage (6 hours after infection), but mature schizonts (24 hours after infection) showed a significant delay in the parasites (Fig. 1K), but had little effect. (Table 3).
BV has the unique feature of activating dendritic cell (DC) -mediated innate immunity via MyD88 / TLR9-dependent and independent pathways {Abe, T. et al. Baculovirus induces type I interferon productionthrough toll-like receptor-dependent and -independent pathways in acell-type-specific manner. J Virol83, 7629-7640, doi: JVI.00679-09 [pii]}. Therefore, we examined whether TLR9 plays an important role in killing BV-mediated parasites in the liver. As shown in Table 3, all TLR9 ^{− / −} mice infected with liver stage parasites completely prevented red endoparasites after a single dose of BES-GL3 im. However, when CpG was administered im to TLR9 ^{− / −} mice, no elimination effect was observed in the absence of parasitemia delay.
These results clearly demonstrated that BV-mediated parasite killing is a TLR9-independent pathway.

(Destruction of IFN-mediated hepatic parasites by TLR9-independent pathway)
BV iv administration has been reported to produce type I IFNs in mice via TLR-independent and IRF3-dependent pathways {Abe, T. et al. Baculovirus induces type I interferon production through toll-like receptor -dependent and -independent pathways in acell-type-specific manner. J Virol83, 7629-7640, doi: JVI.00679-09 [pii]}. To elucidate the production of IFNs by im administration of BV, serum levels of IFN in wild type (WT) and TLR9 ^{− / −} mice were measured 6 hours after im administration of BES-GL3. BES-GL3 im administration produced IFN-α not only in WT mice (6,311 ± 2,363 pg / ml) but also in TLR9 ^{− / −} mice (1,590 ± 737 pg / ml), but PBS treatment mice or CpG im administration IFN-α was not produced in mice (<20.0 pg / ml, limit of detection) (FIG. 2A). That is, it was shown that BV type I IFN production is via a TLR-independent pathway and an IRF3-dependent pathway.
IFN-α is a standard treatment for chronic hepatitis C that develops due to infection with hepatitis C virus (HCV), but it has various side effects such as autoimmune thyroiditis. This example showed that IFN-α production was promoted by BV im. Therefore, BV im and / or iv administration provides a therapeutic agent for liver disease that has superior biological activity, cost-effectiveness, non-invasiveness and less harmful effects than current IFN-α treatment I showed that I can do it.
Type II IFN and IFN-γ were produced in both WT mice (1,367 ± 1,303 pg / ml) and TLR9 ^{− / −} mice (488 ± 132 pg / ml) (FIG. 2B). While CpG im induced a much lower amount of IFN-γ than BV, CpG iv induced highly invasive high levels of IFN-γ, although {Kawabata, T. et al. Functional alterations of liverinnate immunity of mice with aging in response to CpG-oligodeoxynucleotide. Hepatology (Baltimore, Md.) 48, 1586-1597, doi: 10.1002 / hep.22489 (2008).} 2C).
As described above, BV has an effect of promoting IFN-α and IFN-γ production. Both IFN-α and IFN-γ are known to have antiviral activity, and can be used as a vaccine additive other than the malaria vaccine by being mixed with a vaccine other than the malaria vaccine.
Further, both IFN-α and IFN-γ are known to have antitumor effects, and can be used as cancer therapeutic agents by administration alone or in combination with other cancer therapeutic agents.

  In order to determine if serum cytokines act as effectors against liver stage parasites, a serum transfer assay was performed. Pooled sera were collected 6 hours ago from donor mice that were administered BES-GL3 i.v. 100 μl of serum was transferred to recipient mice i.v. infected with 1,000 sporozoites 24 hours ago. One of the five recipient mice effectively eliminated liver stage parasites, and the other four infected recipient mice had a time to 1% parasitemia compared to PBS treated mice. There was a significant delay with an average delay of 3.54 days (FIG. 2D). Next, it was examined whether neutralization of serum IFN-α or IFN-γ affects liver stage parasites. 100 μl of serum was incubated with either anti-IFN-α antibody or anti-IFN-γ antibody. Complete neutralization of IFN-α and IFN-γ was confirmed by ELISA (FIGS. 4B and C). 100 μl of serum treated with either anti-IFN-α antibody or anti-IFN-γ antibody was administered i.v. to recipient mice injected with 1000 sporozoites i.v. 24 hours ago. Serum treated with anti-IFN-α antibody completely eliminated the parasitemia delay, but the elimination effect was partially impaired by anti-IFN-γAb treatment (FIG. 2D). These data suggest that IFN-γ-mediated killing can be mediated by a different effector mechanism than that activated by IFN-α. The effector mechanism induced by IFN-α and IFN-γ may be acting synergistically.

  In order to elucidate which elements of BV play an important role in the elimination of parasites, BES-GL3 was inactivated by heat treatment at 56 ° C. for 30 minutes (heat inactivated BV; HI-BV). Inactivation of viable BES-GL3 was confirmed by complete loss of luciferase activity upon transduction of HepG2 cells (FIG. 4A). Neither IFN-α nor IFN-γ was detected in the serum of mice administered HI-BV (FIGS. 4B and C). Surviving BES-GL3 completely eliminated the parasites and HI-BV did not completely eliminate them, but showed a significant delay in time to 1% parasitemia (mean delay 2.17 days, PBS P = 0.018 compared to the group) (FIG. 2E). The results show that the heat-sensitive virus component plays an important role in the introduction of cells and causes type I IFN production by innate immunity by DNA sensing, while the heat-resistant component of BV is also removed by an IFN-independent mechanism. Suggested that it contributed.

(Upregulation of IFN-stimulated gene (ISG) in the liver by BV im administration)
Type I IFN signaling leads to induction of a number of IFN-stimulated genes (ISG) {Der, SD, Zhou, A., Williams, BR & Silverman, RH Identification of genes differentially regulated by interferon alpha, beta, or gamma using Proc Natl Acad Sci USA 95, 15623-15628 (1998).}. Some ISGs are also involved in direct antibacterial activity, such as the control of post-transcriptional events for microbial killing with a focus on anti-viral effects and anti-viral effects. Gene targeting studies have shown that there are four IFN-mediated antiviral responses: the Mx GTPase pathway, the 2'-5 'oligoadenylate synthetase (OAS) -induced ribonuclease L pathway, the protein kinase R (PKR) pathway, and the ISG15 ubiquitin-like pathway It is divided into effector pathways {Sadler, AJ & Williams, BR Interferon-inducible antiviral effectors. NatRev Immunol 8, 559-568, doi: 10.1038 / nri2314 (2008).}. In addition, as with transcription factors IRF3 and IRF7, several ISGs, such as IFN-inducible proteins with tetratripeptide repeats (IFITs), are known to be involved in sensing liver infection by Plasmodium sporozoites. {Liehl, P. et al. Host-cell sensors for Plasmodiumactivate innate immunity against liver-stage infection. Nat Med 20, 47-53, doi: 10.1038 / nm.3424 (2014).}.
In order to confirm the involvement of ISGs, gene expression in the liver of mice administered with BES-GL3 im was measured by quantitative RT-PCR (qRT-PCR). BES-GL3 significantly induced gene expression of antiviral proteins (Isg15, Mx1, Oas1a / b, Oasl1 and Pkr) in wild type (WT) mice (FIG. 3A). These genes except Oas1a / b were up-regulated in TLR9 ^{− / −} mice by BV, probably due to the locus (FIG. 3A). Gene expression of IFIT proteins such as Ifit1, Ifit3 and Ifit44 was significantly and significantly enhanced in both WT and TLR9 ^{− / −} mice (FIG. 3B). The genes for transcription factors (Irf3 and Irf7) were similarly induced by BV (FIG. 3C). These results suggested that systemic type I IFN secretion by immobilizing BV in the thigh muscle strongly induced ISG in the liver.

(Sterile protection and complete elimination by AdHu5-prime / BDES-boost heterogeneous immunotherapy)
Table 4 shows the results of evaluating whether the AdHu5-prime / BDES-boost heterologous immune regimen eliminates liver stage parasites and protects against sporozoite challenge infection.
AdHu5-prime / BDES-boost heterologous immune regimen {Yoshida, K. etal. Adenovirus-prime and baculovirus-boost heterologous immunizationachieves sterile protection against malaria sporozoite challenge in a murinemodel. Scientific reports 8,3896, doi: 10.1038 / s41598-018- 21369-y (2018).} (A boost with BDES-sPfCSP2-WPRE-Spider after 3 weeks of priming with AdHu5-PfCSP) was evaluated for a newly developed malaria vaccine. Mice were challenged twice before and after AdHu5-prime followed by BDES-sPfCSP2-boost. All mice survived the first and second challenge infections without any symptoms (Group 2 in Table 4). In contrast, AdHu5-prime immunization alone did not exert a protective effect (Group 1 in Table 4). Although iv administration of BES-GL3 completely protected against the first challenge infection (Group 4 in Table 4), protection against the second challenge infection 21 days after boosting (22 days after the first challenge infection) There was no. All PBS im control mice were infected (groups 3 and 5 in Table 4).
The above results show that AdHu5-prime / BDES-boost xenogeneic immunotherapy is a short-term treatment before and after vaccination with BV-mediated innate immune response (a total of 8 days from 24 hours before boost to 7 days after boost). After vaccination with acquired immunity (vaccine-specific adaptive immune response) as well as preventive effect (complete therapeutic effect against infection from 24 hours before boost to boost, and preventive effect against infection until 7 days after boost) It was suggested that the vaccine can be protected (protected) over a long period of time (after 21 days after the boost), with a general vaccine effect. All animal experiment designs are shown in FIG.

<Overview>
This example showed that im administration of BV not only induced short-term sterilization protection against sporozoite infection, but also completely eliminated liver stage parasites. For liver-stage parasites that proliferate vigorously 24 hours after infection, BV-induced fast-acting innate immune responses indicate that they are completely killed and prevent red endoparasites in the absence of clinical symptoms It was. In particular, we have shown that BV enables the development of a new type of independent therapeutic immunostimulatory agent, anti-P. Vivax hypnozoites. At present, PQ is the only available drug that kills P. vivax quiescent hypnozites but has not yet been used extensively due to severe side effects in people with G6PD deficiency {Clyde , DF Clinical problems associated with the use of primaquineas a tissue schizontocidal and gametocytocidal drug. Bull World Health Organ 59, 391-395 (1981).}. The presence of hyponozoites and their drug insensitivity has been a major obstacle to the elimination program and plans to eradicate malaria {Roberts, L. & Enserink, M. Malaria. Did they really say ... eradication? Science 318, 1544 -1545, doi: 10.1126 / science.318.5856.1544 (2007).} Can only be achieved by taking effective measures to remove this hidden hypnozoite accumulation {Wells, TN, Burrows, JN & Baird, JK Targeting thehypnozoite reservoir of Plasmodium vivax: the hidden obstacle to malariaelimination.Trends Parasitol 26, 145-151, doi: 10.1016 / j.pt.2009.12.005 (2010). and Mueller, I. et al. Keygaps in the knowledge of Plasmodium vivax, a neglected human malaria parasite. Lancet Infect Dis 9, 555-566, doi: 10.1016 / S1473-3099 (09) 70177-X (2009).}. This example is believed to correlate with primate anti-hypnozoite activity {Fracisco, S. et al. Anti-relapse activity of mirincamycin in the Plasmodium cynomolgisporozoite-infected Rhesus monkey model. MalarJ 13, 409, doi: 10.1186 / 1475-2875-13-409 (2014).} In a mouse model with early liver stage P. berghei, BV was shown to be more effective than PQ. Although BV has not been used in the clinical setting, in previous studies by the inventors, BV-based vaccine vectors are safe, tolerable and systemic toxic and well tolerated in primate models {Iyori, M. et al. Protective efficacy of baculovirus dual expression system vaccine expressing Plasmodium falciparum circumsporozoite protein. PLoS One 8, e70819, doi: 10.1371 / journal.pone.0070819 (2013).}. Based on the above, it was confirmed that BV could provide a promising new non-hemolytic single dose formulation in place of PQ for initial clinical trials in humans.

BV has (i) low cytotoxicity, (ii) inability to replicate in mammalian cells, (iii) absence of existing antibodies, (iv) almost unstimulated form (near-naive) Presenting vaccine antigens on the viral envelope of (known as “Baculophage”), (v) transduction of mammalian cells (known as “BacMam”), and (vi) vaccine components and It has excellent attractive properties as a new vaccine vector, including its function as both a DNA vaccine (known as the “Baculovirus Bispecific Antibody Expression System (BDES)”) {Yoshida, S., Kawasaki , M., Hariguchi, N., Hirota, K. & Matsumoto, M.A baculovirus dual expression system-based malaria vaccine induces strongprotection against Plasmodium berghei sporozoite challenge in mice.Infect Immun 77, 1782-1789, doi: IAI.01226 -08 [pi i]}. This example provides a further unique advantage of BV as a therapeutic vaccine vector with short-term protection due to its intrinsically strong immune stimulatory properties. Current vaccines require several weeks after vaccination to induce a protective effect. In general, adaptive immunity induced by vaccines takes days to be effective, often requiring 2-3 doses. Infections just before and after vaccination cannot be prevented. Even effective licensed vaccines cannot protect individuals from target pathogens immediately after vaccination. An ideal vaccine is required to have a function capable of protecting against infection immediately before and after vaccination. Therefore, in addition to long-term protective immunity, it is ideal that next generation vaccines induce effective short-term non-specific immunity and minimize the risk of infection during the vaccination schedule.
In the Phase II-III malaria vaccine trial, all subjects were presumptively treated with antimalarials three times a day one week before the last vaccination, and asexual one week after the last vaccination P. falciparum parasitemia was reexamined. Subjects testing for parasite positivity are treated with second-line drugs or excluded from trial {Polhemus, ME et al. Evaluation of RTS, S / AS02A and RTS, S / AS01B in adults in a high malariatransmission area. PLoS ONE 4, e6465, doi: 10.1371 / journal.pone.0006465 [doi] (2009).}. Thus, clinical trials are aimed at testing the vaccine efficacy when its effect reaches a maximum after all vaccine schedules have been completed. However, for clinical applications, even if improved and effective vaccines are developed, the vaccinator is still at risk of infection until a fully scheduled vaccination is completed. In this example, the newly developed heterologous AdHu5-PfCSP-prime and BDES-PfCSP-boost vaccines eliminated liver-stage parasites infected 24 hours prior to BDES-boost, then 2 weeks after BDES boost. Induced sterilization protection against parasitic infection by vaccine-induced PfCSP-specific acquired immune response. Therefore, BDES-PfCSP boosting can cure and protect mice in a short period before and after vaccination.
With conventional malaria vaccines, vaccines are given to actual patients who cannot predict when they will become infected. For example, if they are infected the day before vaccination or the day after vaccination, they will become infected. There was a problem.
The present invention has the great advantage that such conventional vaccines can protect against infection before and after vaccination, which cannot protect against infection.
That is, the BV-based vaccines of the present invention not only can minimize the risk of infection of the vaccination person during the vaccination schedule, but also produce a strong and sustained adaptive immune response by stimulation of the innate immune system. Conceivable. It is also believed that BV itself can be used as a malaria vaccine additive to provide this short-term protection to RTS, S or other approved vaccines.

This example showed that im administration of BV strongly induced IFN-α and IFN-γ in serum in a TLR9-independent manner and up-regulated ISG expression in the liver. Furthermore, passive in vivo transfer of serum effectively eliminated liver stage parasites. When IFN-α in the serum was neutralized with an anti-IFN-α antibody, the effect of eliminating the parasite disappeared. Thus, we observed that the type I IFN signaling pathway plays an important role in the killing mechanism of liver stage parasites.
Furthermore, the therapeutic effect on liver stage parasites was confirmed using recombinant IFN-α protein. This revealed that IFN-α contained in the serum was induced by BV inoculation and acted on the liver to kill the liver parasite stage (preventive effect on malaria development). Therefore, it was confirmed that administration of BV, particularly im administration of BV 6 hours before infection, can kill liver stage parasites and prevent parasitemia.
On the other hand, it has been reported that the natural immune response of Plasmodium malaria parasite also induces an innate immune response in the liver stage infection, but this innate immune response ability cannot eliminate all parasites, causing infection and development . That is, the endogenous innate immune response induced by natural malaria parasite infection is not strong enough to eliminate, and / or the peak of the innate immune response is at the end of liver phase development, i.e. just before or simultaneously with the release of extra-erythrocyte merozoites Suggest what happens. Alternatively, the parasite may have taken strategies to avoid it, such as inhibiting the apoptotic pathway of host hepatocytes, to ensure its survival {van de Sand, C. et al Mol Microbiol 58, 731-742, doi: 10.1111 / j.1365-2958.2005.04888.x (2005).}. The liver stage of Plasmodium berghei inhibits host cell apoptosis. BV-inducible type I IFN is more effective and powerful due to its amount and timing of immediate effect compared to host-induced parasite-induced type I IFN, achieving its independent therapeutic and prophylactic effects can do. Recently, after transduction, host cells sense BV genomic dsDNA via cytoplasmic DNA sensor STING recognitions and respond to BV transduction via a TLR9-independent pathway. It has been reported to cause the production of IFN {Ono, C. et al. Innateimmune response induced by baculovirus attenuates transgene expression inmammalian cells. J Virol 88,2157-2167, doi: 10.1128 / JVI.03055-13 (2014). }. However, the involvement of STING in vivo remains unclear. For type II IFNs, exogenous IFN-γ stimulation in vitro has been reported to cause killing of hepatocytes infected with hepatic P. vivax in an autophagy-related protein-dependent manner {Boonhok, R. et al. al. LAP-like process as an immune mechanism downstream of IFN-gamma in control of the human malaria Plasmodium vivax liver stage. Proc Natl Acad Sci USA 113, E3519-3528, doi: 10.1073 / pnas.1525606113 (2016).}.
This example showed that IFN-α and IFN-γ were rapidly and potently produced in serum 6 hours after BV administration. It has been reported that there are about 300 ISGs linked to the type I IFN signaling pathway {Der, SD, Zhou, A., Williams, BR & Silverman, RHIdentification of genes differentially regulated by interferon alpha, beta, orgamma ProcNatl Acad Sci USA 95, 15623-15628 (1998). and Schoggins, JW & Rice, CM Interferon-stimulated genes and their antiviral effector functions. Curr Opin Virol1, 519-525, doi: 10.1016 / j.coviro. 2011.10.008 (2011). And de Veer, MJ et al. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol 69, 912-920 (2001).}. Among these, Isg15, Mx1, OAS1, OASL and well-known as an antiviral effector {Sadler, AJ & Williams, BR Interferon-inducible antiviraleffectors. Nat Rev Immunol 8,559-568, doi: 10.1038 / nri2314 (2008).} The expression of PKR gene was greatly promoted in hepatocytes by im administration of BV. Im administration of HI-BV induced a substantial parasite killing effect even in the absence of IFN-α and IFN-γ.

IFN-α has been extensively studied for its effectiveness in various disease states, and some of these, especially chronic hepatitis C, where IFN-α has been used as the only approved treatment since 1991 Currently used as standard treatment. However, its use may be accompanied by a wide variety of side effects such as autoimmune thyroiditis {Sleijfer, S., Bannink, M., Van Gool, AR, Kruit, WH & Stoter, G. Side effects of interferon-alpha therapy. Pharmacy world & science: PWS 27, 423-431, doi: 10.1007 / s11096-005-1319-7 (2005).}. In addition, standard treatment of hepatitis C with IFN-α and ribavirin costs an average of $ 22,000 and, depending on the genotype, only 42% of treated individuals can remove the infection {Lang, K. & Weiner, DB Immunotherapy for HCV infection: nextsteps. Expert Rev Vaccines 7,915-923, doi: 10.1586 / 14760584.7.7.915 (2008).}.
This example showed that 6.3 ng / ml IFN-α in mouse serum induced by im administration of BV completely killed liver stage parasites under normal levels of ALT. The production cost of BV is much cheaper than recombinant IFN-α. Thus, im administration of BV is superior to current IFN-α therapy with recombinant IFN-α by intravenous administration, with higher biological activity, cost-effectiveness, non-invasive and harmful It is useful as an alternative to IFN-α-based immunotherapy with low efficacy.

  Thus, BV effectively induces a fast-acting innate immune response that provides both a powerful first line of defensive and offensive attacks against pre-erythrocytic parasites . The results of this example showed that baculovirus has great potential to be a new and excellent prophylactic and therapeutic immunostimulator against liver stage parasites.

The following knowledge was obtained from this example.
(1) Im administration of BV is less invasive than iv.
(2) Depending on the target disease such as cancer, iv administration of BV can induce a systemic innate immune response stronger than im administration as needed.
BV effectively induces a fast-acting innate immune response against pre-erythrocytic parasites.
(3) The protective effect induced by im administration of BES-GL3 is more effective and lasts longer than CpG (7 days).
(4) BV completely eliminates liver stage parasites and completely prevents the onset of malaria.
Im administration of BV induces short-term complete protection against sporozoite infection, and the BV-induced fast-acting innate immune response completely kills liver stage parasites and completely prevents the development of malaria within 20 hours.
Administration of BES-GL3 iv or im 24 hours after infection completely eliminates liver stage parasites, thereby completely preventing the development of malaria.
BV represents a new and excellent preventive and therapeutic immunostimulator against liver stage parasites.
(5) BV delays parasitemia.
Parasemia is significantly delayed by im administration of BES-GL3 42 hours after infection.
BV im administration kills liver stage protozoa more effectively than PQ and significantly delays parasitemia.
BV is useful as a therapeutic vaccine vector that induces short-term protection with intrinsically strong immunostimulatory properties, enabling the development of anti-P. Vivax hypnozite drugs as therapeutic immunostimulants and using BV It can provide a promising new non-hemolytic single dose formulation to replace PQ.
(6) The parasite elimination effect of im administration of BV depends on the dose of BV.
(7) BV kills parasites through TLR9-independent and IFN-mediated pathways.
IFN-γ-mediated killing by BV is mediated by an effector mechanism different from that activated by IFN-α, and the effector mechanisms induced by IFN-α and IFN-γ act synergistically.
The heat-sensitive viral component of BV plays an important role in introduction into cells, causing innate immunity by DNA sensing to produce type I IFN, while the thermostable component of BV also contributes to removal by an IFN-independent mechanism To do.
Systemic type I IFN secretion by im administration of BV strongly induces ISG in the liver.
Administration of BV strongly induces IFN-α and IFN-γ in serum in a TLR9-independent manner, and promotes and enhances ISG expression in the liver.
In vivo passive transfer of sera from individuals dosed with BV effectively eliminates liver stage parasites. When IFN-α in the serum is neutralized with an anti-IFN-α antibody, the effect of eliminating the parasite disappears.
IFN-α and IFN-γ are rapidly and strongly produced in serum 6 hours after BV administration.
Im administration of HI-BV induces a substantial parasite killing effect in the absence of IFN-α and IFN-γ.
6.3 ng / ml IFN-α in mouse serum induced by im administration of BV completely kills liver stage parasites under normal levels of ALT.
Im administration of BV has higher biological activity, cost-effectiveness, non-invasive and less harmful effects than current IFN-α therapy with recombinant IFN-α by intravenous administration It is useful as an alternative to IFN-α based immunotherapy.
(8) AdHu5-prime / BDES-boost heterogeneous immunotherapy not only for short periods before and after vaccination with BV-mediated innate immune response, but also for long-term vaccination with vaccine-specific adaptive immune response Can protect (protect).
BV-based vaccines not only can minimize the risk of infection of the vaccinee during the vaccination schedule, but also produce a strong and sustained adaptive immune response through stimulation of the innate immune system. BV can also be used as an additive to give short-term protection to RTS, S or other licensed vaccines.
BDES-PfCSP boosting can cure and protect mice in a short time before and after vaccination. More specifically, after heterologous AdHu5-PfCSP-primed BDES-PfCSP-boost vaccine eliminates liver stage parasites infected 24 hours before BDES-boost, 2 weeks after BDES boost, after vaccine-induced PfCSP-specific Sterilization protection against parasitic infection by innate immune response can be induced.

a) BALB / c mice were injected with BES-GL3 (described as BV) by the route indicated in the table. After the intervals indicated in the table, mice were challenged with 1,000 Pb-conGFP sporozoites by iv challenge. Parasitemia was monitored 5 days, 6 days, 7 days, 8 days, 11 days and 14 days after sporozoite challenge infection. All mice with parasites in the blood died. b) An outline of the experimental design is shown in FIG. 5A. c) iv indicates intravenous, in indicates nasal cavity, im indicates intramuscular. d) Protection was defined as the complete absence of erythroparasitic disease 14 days after challenge. e) Cumulative data from 2 or 4 experiments. f) BALB / c mice were injected iv with AdHu5-luc. g) BALB / c mice were infected with 1,000 live Pb-conGFP infected erythrocytes (iRBC) by iv challenge. h) 50 μg of CpG ODN 1826 (described as CpG) was administered to BALB / c mice im.

a) BALB / c mice were injected iv with 1000 Pb-conGFP sporozoites. After the intervals indicated in the table, mice were administered either BES-GL3 (described as BV) or PQ. Parasitemia was monitored 5, 6, 7, 8, 11 and 14 days after sporozoite injection. All mice with parasites in the blood died. b) An outline of the experimental design is shown in FIG. 5B. c) Cumulative data from 3 experiments. d) As shown in FIGS. 1K and L, a significant delay of parasitemia was observed in all mice compared to the PBS group. e) Two different doses of PQ were administered to kill liver stage parasites. The high dose (2 mg / 100 μl) and the low dose (0.1 mg / 100 μl) were 533 and 27 times higher than the WHO recommended dose per human body weight, respectively.

a) TLR9 ^{− / −} (BALB / c background) or WT mice were injected iv with 1000 Pb-conGFP sporozoites. After 24 hours, mice were administered either BES-GL3 (described as BV) or CpG ODN 1826 (described as CpG). Parasitemia was monitored 5, 6, 7, 8, 11 and 14 days after sporozoite injection. All mice with parasites in the blood died. b) A significant delay in parasitemia was observed in all mice compared to the PBS group as shown in FIG. 1K.

a) BALB / c mice were im immunized with AdHu5-PfCSP (described as AdHu5). Three weeks later, mice were injected iv with 1,000 PfCSP-Tc / Pb sporozoites. After 24 hours, PBS was im injected. Parasitemia was monitored 5, 6, 7, 8, 11 and 14 days after sporozoite injection. All mice developed parasitemia and died. An outline of the experimental design is shown in FIG. 5C. b) Immunization with AdHu5 in BALB / c mice. Three weeks later, mice were injected iv with 1,000 PfCSP-Tc / Pb sporozoites and 24 hours later im injected with BDES-PfCSP (described as BDES). Infected mice were re-challenged 21 days after the first challenge. An outline of the experimental design is shown in FIG. 5D. c) BALB / c mice were im immunized with PBS. Three weeks later, mice were injected iv with 1,000 PfCSP-Tc / Pb sporozoites and 24 hours later with PBS im. Group 3 was used as a control infection for the first infection of group 1 and group 2. d) BALB / c mice were immunized with BES-GL3 (described as BV) iv. Six hours later, mice were infected with 1,000 PfCSP-Tc / Pb sporozoites by iv challenge. Infected mice were re-challenged 21 days after the first challenge. An outline of the experimental design is shown in FIG. 5E. e) BALB / c mice were immunized twice with PBS on day 0 and day 21. Three weeks later, mice were infected with 1,000 PfCSP-Tc / Pb sporozoites by iv challenge. Group 5 was used as a control infection for the second infection of group 4.

  In the present invention, a malaria therapeutic agent, a malaria preventive agent, and an antimalarial innate immune enhancer can be provided.

Claims (22)

A treatment for malaria, including the Baculoviridae virus.
The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydrosis Virus, Saksan Nucleopolyhedrovirus (Antheraea pernyi Nuclear Polylydrosis Virus), and Granulovirus The therapeutic agent for malaria according to claim 1, wherein
The malaria therapeutic agent according to claim 1 or 2, wherein the agent is administered within 42 hours after infection.
The malaria therapeutic agent according to claim 1 or 2, wherein the agent is administered within 24 hours after infection.
The malaria therapeutic agent according to any one of claims 1 to 4, wherein the administration method is intramuscular administration.
Malaria preventive agent containing baculoviridae virus.
The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydrosis Virus, Saksan Nucleopolyhedrovirus (Antheraea pernyi Nuclear Polylydrosis Virus), and Granulovirus The agent for preventing malaria according to claim 6.
The malaria preventive agent according to claim 6 or 7, which is administered one or more times at intervals of 6 hours to 13 days.
The malaria preventive agent according to any one of claims 6 to 8, wherein the administration method is intramuscular administration.
Antimalarial innate immunity stimulant containing baculoviridae virus.
The baculoviridae viruses are: Autographa Californica Nuclear Polyhedrosis Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylydorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata Nuclear Polyhedorosis Virus), Lymantriadisper Nuclear Polylydrosis Virus, Saksan Nucleopolyhedrovirus (Antheraea pernyi Nuclear Polylydrosis Virus), and Granulovirus The antimalarial innate immunity activator of Claim 10 which exists.
The antibacterial agent according to claim 10 or 11, wherein the baculovirus is administered to a patient after a recombinant virus other than a baculovirus containing a gene encoding an amino acid sequence of a malaria antigen is administered to the patient. Malaria innate immune stimulant.
The antimalarial innate immunity stimulator according to claim 12, wherein the malaria antigen is CSP.
The antimalarial innate immunity stimulating agent according to claim 12 or 13, wherein the recombinant virus other than the baculovirus is a recombinant adenovirus.
The antimalarial innate immunity stimulating agent according to any one of claims 10 to 14, and the antimalarial innate immunity stimulating comprising a recombinant adenovirus containing a gene encoding the amino acid sequence of the malaria antigen and a promoter capable of expressing the gene Agent composition.
The antimalarial innate immunity activation agent of any one of Claims 10-14 which is a malaria vaccine additive.
IFN-α and IFN-γ production promoter containing baculoviridae virus.
The baculoviridae viruses include Autographa Californica Nuclear Polylyed Disease Virus, Nucleopolyhedrovirus, Bombyxmori Nuclear Polylyedorosis Virus, Olgia Pseudotsugata Nuclear Polyhedrosis Virus Any one or more selected from the group consisting of (Orgyia pseudotsugata NuclearPolyhedorosis Virus), Lymantriadisper NuclearPolyhedorosis Virus, Saksan Nuclear Polyhedrosis Virus and Granulovirus The IFN-α and IFN-γ production promoter according to claim 17, wherein
A cancer therapeutic agent comprising the IFN-α and IFN-γ production promoter according to claim 17 or 18.
The liver disease therapeutic agent containing the IFN- (alpha) and IFN- (gamma) production promoter of Claim 17 or 18.
The liver disease therapeutic agent according to claim 20, wherein the liver disease is a liver disease derived from hepatitis virus.
  The vaccine additive added to vaccines other than the malaria vaccine containing the IFN- (alpha) and IFN- (gamma) production promoter of Claim 17 or 18.