WO2014040987A1

WO2014040987A1 - The use of a nucleic acid sequence encoding a type i interferon (ifn) originating from atlantic salmon as an antiviral and immune stimulating agent

Info

Publication number: WO2014040987A1
Application number: PCT/EP2013/068720
Authority: WO
Inventors: Børre ROBERTSEN
Original assignee: University of Tromsø
Priority date: 2012-09-11
Filing date: 2013-09-10
Publication date: 2014-03-20

Abstract

The present invention relates to the use of a type I interferon encoding sequence, more particular the interferon c coding sequence, in the prevention and the combat of pathological disorders in farmed fish. The interferon c coding sequence is useful as an antiviral and immune stimulating agent and may be administered to the fish in need thereof using e.g. a suitable expression plasmid. The present invention furthermore relates to plasmid and host cells comprising an interferon c coding sequence, in addition to a method for the treatment or prevention of viral infections in farmed fish.

Description

The use of a nucleic acid sequence encoding a type I interferon (IFN)

originating from Atlantic salmon as an antiviral and immune stimulating agent. The present invention relates to the use of a nucleic acid sequence encoding a type I interferon (IFN) originating from Atlantic salmon, more specifically IFNc, as an immune stimulating agent useful in the prevention or treatment of disease of farmed Atlantic salmon or rainbow trout caused by virus.

Background of the invention Interferons (IFNs) belong to a family of cytokines expressed and secreted by vertebrate cells in response to virus infection. The activity of expressed IFNs is exerted via a complex change of signaling through the binding of the secreted IFNs to IFN receptors resulting in expression of a range of antiviral proteins [Sadler AJ, Williams BR. Interferon- inducible antiviral effectors. Nat Rev Immunol. 2008 Jul;8(7):559-68].

Interferons have been classified by their chemical and biological characteristics and are typically divided into three IFN classes, i.e. type I IFNs, type II IFNs and type III IFNs [Donnelly RP, Kotenko SV. Interferon-lambda: a new addition to an old family. J Interferon Cytokine Res. 2010 Aug; 30(8):555-64]. Type I IFNs include the mammalian IFN-as and IFN- s, which are induced by viruses in most cells and have a crucial role in the innate immunity against viruses. Type II IFN is identical to IFN-γ and is produced by natural killer cells (NK cells) and T-lymphocytes. IFN-γ plays a central role in the T-cell mediated immune response of the adaptive immune system whereby it activates macrophages for enhanced killing of intracellular bacteria. Type III IFNs have similar roles as type I IFN in innate immunity against viruses, but contrary to IFN I, type III IFNs induce antiviral activity in some but not all cell types [Donnelly RP, Kotenko SV.

Interferon-lambda: a new addition to an old family. J Interferon Cytokine Res. 2010 Aug; 30(8):555-64]. Type III IFNs are also distinct from type I IFNs with regard to sequence and gene structure.

Typically, type I IFNs are induced rapidly during virus infection through host cell recognition of virus RNA and are then secreted and transported by the blood stream. The antiviral effect of type I IFNs is exerted through binding to the IFN receptor, which is present on most cells [Sadler AJ, Williams BR. Interferon-inducible antiviral effectors. Nat Rev Immunol. 2008 Jul;8(7):559-68)]. Binding triggers signal transduction through the Jak-Stat pathway and leads to transcription of several genes encoding antiviral proteins such as Mx and ISG15 [Sadler AJ, Williams BR. Interferon- inducible antiviral effectors. Nat Rev Immunol. 2008 Jul; 8(7):559-68)].

Characteristic of the mammalian type I IFNs is that they are encoded by intronless genes and bind to the same heterodimeric receptor containing the IFNAR-1 and IFNAR-2 subunits. Human type I IFNs are encoded by over 20 genes clustered on chromosome 9 encompassing 13 functional IFN-a genes, 1 IFN-β gene, lIFN-ω gene, 1 IFN-ε, and lIFN-κ gene [Pestka S, Krause CD, Walter MR. Interferons, interferon- like cytokines, and their receptors. Immunol Rev 2004;202: 8-32].

In fish, interferon- like activity was identified as early as 1965 (Gravell and

Malsberger, Ann N Y Acad Sci, 1965; 126, pp 555-565), and was later detected in cells and organs of a number of fish species after viral infection or treatment with dsRNA {Kelly and Loh, In vitro, 1973; 9(2), pp 73-80, Renault et al., Dis Aquat Org, 1991 ; 10(1), pp 23-9, deSena and Rio, Infect Immun 1975; 1 1(4), pp 23-29, Dorson et al., Fish Shellfish Immunol, 1992, 2, pp. 31 1-313, Dorson et al. , Ann Microbiol, 1975 : 126(4), pp 458-489, Snegaroff, Fish Shellfish Immunol, 1993, 3(3), pp 191-198, Dogel-Gaillard et al., Fish Shellfish Immunol, 1993, 3(5), pp. 383-394, Nygaard et al, Fish Shellfish Immunol., 2000, 10(5), pp. 435-350, Graham and Secombes, J Fish Biol 1990; 36(4), pp 563-573, Eaton, Dis Aquat Org, 1990, 9(3), pp. 193-198, DeKlinkelin et al, Dev Comp Immunol, 1982, 2, pp. 167- 174, DeKlinkelin et al, J Gen Virol, 1973, 19(1), pp- 125-127).

Although the first human interferon gene was cloned as early as in 1980 (Tanigushi et al, Nature, 1980, 285(5766), pp. 547-549, Taniguchi et al, Proc Natl Acad Sci, 1980, 77(7), pp. 4003-4006), the first IFN coding genes in fish were isolated in 2003 from zebrafish, Atlantic salmon and the pufferfish Tetraodon nigrovirides, respectively (Altman et al., Danio rerio, J Virol, 2003, 77(3), pp. 1992-2002;

Robertsen et al., J Interferon Cytokin Res, 23 (10), pp. 601-612; Robertsen,

Norwegian patent application NO 20033000; Lutfalla et al., BMC Genomics 2003, 4(1), pp. 29). Thereafter, IFN genes were also identified in other species; e.g.

channel catfish (Long et al, Dev. Comp Immunol, 2004, 28(2), pp. 97-1 1 1) and sea bass (Casani et al., Mol. Immunol., 2009, 46, pp. 943 - 952).

The type I IFNs identified in fish differs from the human type I IFNs in that the fish IFN genes comprise introns. Moreover, fish IFNs show very low sequence similarity to mammalian IFNs (Robertsen, Fish Shellfish Immunol, 20, pp. 172-191. Later research has furthermore revealed that the type I IFN family in fish is quite larger than originally assumed. Today, 4 different subtypes of type I IFNs, denoted IFNa, IFNb, IFNc and IFNd, have been identified in Atlantic salmon and rainbow trout (Sun et al, Dev. Comp. Immunol., 2009, 33, pp. 547 - 558, Chang et al., Immunogenetics, 2009, 61 , pp. 315-325). The largest cluster of IFN genes has been found in Atlantic salmon, where eleven IFN genes were identified in the same genomic region encoding two IFNa (IFNal and IFNa3), four IFNb (IFNbl-b4) and five IFNc (IFNcl-c4) genes (Sun et al, 2009, supra). IFNc homo logs have been identified in Atlantic salmon and zebrafish, but not in rainbow trout (Chang et al, 2009, supra, Zou et al, J. Immunol, 2007, 179, pp. 3859 - 3871 , Purcell et al., Fish Shellfish Immunol., 2009, 26, pp. 293 - 304). Salmon IFNa2 (Robertsen B, Bergan V, Rokenes T, Larsen R, Albuquerque A. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity. J Interferon Cytokine Res 2003;23 : 601-612; Bergan V, Steinsvik S, Xu H, Kileng O, Robertsen B. Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions. FEBS J 2006;273 : 3893-3906) and IFNd (Gene bank accession no.

AGKD01088706) are encoded by single genes outside of this cluster.

Fish type I IFNs may be further divided into two groups based on whether they contain two or four disulfide bridging cysteines (Zou et al, 2009, supra, Hamming et al, J. Virol, 201 1 , J. Virol, 85, pp. 8181-8187). IFNa and IFNd have been found to comprise two cysteines, and IFNc and IFNb four cysteines (Hamming et al, 201 1 , supra, Zou et al, 2009, supra).

Interestingly, Atlantic salmon IFNa, IFNb, IFNc (Sun et al, 2009, supra) and IFNd subtypes have only 22 to 32 % amino acid sequence identity between themselves.

Antiviral activity of IFNa homo logs has been shown in several fish species including Atlantic salmon (Zou et al, Dev. Comp. Immunol. 201 1 , 35, pp. 1376- 1387). In Berg et al, Dev. Comp. Immunol, 2009, 33, pp. 638 - 645, the effect of an antiserum against Atlantic salmon IFNal was used to study its production in cells and neutralization of antiviral activity. IFNal had potent antiviral activity against infectious pancreatic necrosis virus (IPNV). Moreover, it was found that the antiviral activity in the supernatant of poly I:C treated TO cells was reduced by 95 - 98% by addition of antiserum against IFNal , and concluded that most of the antiviral activity induced by poly I:C was due to IFNal and/or IFNa2. In another work, Atlantic salmon IFNal showed, however, no antiviral activity against infectious salmon anemia virus (Kileng O, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish

Immunol 2007;23 : 378-389).

Antiviral activity of IFNb, IFNc and IFNd has not been shown in salmonids, while a rainbow trout IFNb homo log possessed little if any antiviral activity (Zou et al, 2007, supra). In zebrafish, antiviral activity of the IFNc homo log IFN(()2 has been demonstrated, while the IFNd homo log, zebrafish IFN(()4 showed little or no antiviral activity (Aggad et al, J. Immunol, 2009, 183, pp. 3924-393, Lopez-Munoz et al, J. Immunol, 2009, 182, pp. 3440 - 3449). In Atlantic Salmon, IFNa, IFNb and IFNc showed strikingly difference in expression properties in response to stimulation with poly I:C and the imidazoquinoline derivative S-27609. Also, the promotor regions of IFNa, INFb and IFNc were shown by Sun et al (2009) to be very different and IFNc transcription seems to be regulated differently compared to IFNa and IFNb (Sun et al, 2009, supra). Thus, the activity and role of IFNc are unknown and seems to be dependent of the expression of other IFNs in Atlantic salmon.

Robertsen et al, 2003, supra, reports of the transfection of HEK293 cells an expression vector comprising an IFNa coding sequences, and shows that the supernatant comprising the IFNa expression product exerted antiviral activity by the cytopathic effect (CPE) reduction assay. However, a more recent study showed that injection of rainbow trout with recombinant salmon IFNa2 provided only a short term protection (i.e. up to 7 days) against virus infection (Ooi EL, Verjan N, Haraguchi I, Oshima T, Kondo H, Hirono I, Aoki T, Kiyono H, Yuki Y. Innate immuno modulation with recombinant interferon-alpha enhances resistance of rainbow trout (Oncorhynchus mykiss) to infectious hematopoietic necrosis virus. Dev Comp Immunol. 2008;32(10): 121 1-20).

The teaching of the prior art as summarized above illustrates that even if a protein is identified as an IFN protein by sequence analysis, it may not possess strong antiviral activity. It is thus impossible to predict whether an interferon may be useful as a therapeutic agent in combating virus infections in farmed fish.

It has now surprisingly been found that IFNc may be used as an immune stimulating and antiviral agent to prevent viral infections in farmed salmonids on a long term basis. The present invention discloses that salmon IFNc when injected into fish as a gene construct induce antiviral activity, e.g. against infectious salmon anaemia virus (ISAV).

Summary of the invention The present invention thus provides an interferon c coding sequences for use as an immune stimulating and antiviral agent, wherein said sequences is SEQ ID No. 1 or fragments and variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1. According to one aspect of the invention, the interferon coding sequence is provided for the use in the treatment or prevention of viral infections in farmed fish, wherein the virus is selected from the group consisting of infectious pancreas necrosis virus (IPNV), salmonid alpha virus (SAV),

cardiomyopathy syndrome virus (CMSV), infectious salmon anaemia virus (ISAV), viral hemorrhagic septicaemia virus (VHSV), heart and muscle inflammation virus (HSMIV). According to yet another aspect, the viral infection is caused by ISAV.

According to yet another aspect, the present invention provides a plasmid comprising a polynucleotide sequence for use according to the present invention, wherein said polynucleotide sequence is operably linked to a promoter sequence.

According to one embodiment of the invention, the promoter sequence is selected from the group consisting of cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, simian virus 40 (SV-40) promoter, muscular β-actin promoter, preferably a CMV promoter. According to yet another embodiment, the plasmid according to the invention comprises at least one selection marker, such as a kanamycin, ampicillin or neomycin resistance gene. A host cell, such as a prokaryotic or eukaryotic host cell, is also provided, comprising a plasmid according to the invention. According to one embodiment, the host cell is E.coli.

According to yet an aspect of the present invention, a composition is provided comprising a plasmid comprising an interferon c coding sequence according to the use of the invention being operably linked to a promoter, and optionally one or more pharmaceutically acceptable excipients.

The present invention furthermore provides a recombinant IFNc for the use as an antiviral agent.

Finally, the present invention also provides a method for the treatment or prevention of viral infections in farmed fish, wherein said method comprises the steps of administering composition comprising an interferon c coding sequence represented by the sequence SEQ ID No. 1 and fragments and variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1 to the recipient fish.

Figures

Figure 1 shows the antiviral activity of IFNb against IPNV in salmon TO cells. IFNb was produced recombinantly in HEK293 cells.

Figure 2 show the antiviral activity of IFNc against IPNV in salmon TO cells. IFNc was produced recombinantly in HEK293 cells.

Figure 3 shows the induction of Mx proteins in TO cells treated with recombinant IFNb and IFNc produced in HEK293 cells. Figure 4 shows the effects of intramuscular injection of IFNb or IFNc coding expression plasmids on Mx expression in head kidney of Atlantic salmon.

Figure 5 shows the cumulative mortality of salmon that was injected with an IFNa or an IFNc coding expression plasmid or a control plasmid and challenged 7 weeks later with ISAV.

Figure 6 shows the cumulative mortality of salmon that was injected with an IFNb coding expression plasmid or a control plasmid and challenged 7 weeks later with ISAV.

Figure 7 shows the cumulative mortality of salmon that was injected with an IFNa or an IFNc coding expression plasmid or a control plasmid or a control plasmid and challenged 8 weeks later by cohabitation with ISAV infected salmons.

Figure 8 shows the cumulative mortality of salmon that was injected with an IFNa, IFNb, or an IFNc coding expression plasmid or a control plasmid, and challenged 8 weeks later with ISAV.

Detailed description of the invention

In the detailed description that follows, a number of expressions and terms commonly used within recombinant technology, within immunology and vaccine technology are used. In order to provide a clear and consistent understanding of the present invention, the claims and the scope to be given such terms, specific definition are provided below.

An "antiviral agent" or "immune stimulating agent" according to the present invention is to be understood to mean an agent which upon administration to a recipient fish results in that the fish exert an improved capability of preventing and/or combating a viral infection. The IFNc coding sequence may according to the present invention be used as an immune stimulating and antiviral agent useful in prophylactic and therapeutic treatment of recipient fish in need of such treatment.

A "coding sequence" is to be understood to mean a polynucleotide sequence, which may be transcribed into mRNA and/or translated into a polypeptide, i.e. when placed under the control of an appropriate control sequence such as a promoter. The starting point of the coding sequence may be determined by a translation start codon at the 5 '-terminus. The end of the coding sequence may be determined by a translation stop codon at the 3 '-terminus. A coding sequence may e.g. be

represented by an mRNA sequence, a cDNA sequence or a genomic DNA sequence, and/or a recombinant polynucleotide sequence. The term "interferon (IFN) coding sequence" as used is to be understood to mean a nucleic acid sequence encoding an interferon or a fragment or variant thereof. In particular, the present invention provides the use of an IFNc coding sequences an antiviral agent applicable in the treatment and prevention of virus infections in farmed fish.

The gene sequence coding IFNc was first disclosed by Sun et al, 2009, supra (Gene bank accession number: ACE75692.1). The present closed cDNA sequence is depicted in the sequence listing as SE ID No. 1. SEQ ID No. 3 depicts the cDNA sequence encoding IFNb. The amino acid sequence IFN b and IFNc is depicted in SEQ ID No. 2 and SEQ ID No. 4, respectively.

It is to be understood that the term "IFNc coding sequence" as used herein means not only the sequence as specifically depicted in SEQ ID No. 1 , but also fragment and variants thereof which when expressed in a recipient animal upon

administration is capable of acting as an antiviral agent. The skilled person is aware of the fact that the nucleic acid sequence encoding a protein may differ to some degree without affecting the activity of the encoded protein. E.g. SEQ ID No. 1 or the amino acid sequence encoded thereby may differ by way of some nucleotide or amino acid additions, deletions or alterations that have little effect, if any, on the functional activity of the resulting IFNc. The skilled person is also well aware of the fact that modification of a protein coding nucleic acid sequence may be introduced, which does not alter the function or the activity of the encoded amino acid sequence. For example, substitution of a nucleotide may result in that the triplet affected still encodes the same amino acid due to the degeneration of the genetic code. The substitution of a nucleotide may also result in the substitution of an amino acid with similar chemical characteristics, thus not affecting the structure and activity of the protein. Examples of substitutions not having effect on protein structure or activity is e.g. the substitution of aspartic acid for glutamic acid, or the substitution of lysine for arginine, or the substitution of a valine for leucine or iso leucine. The skilled person will also acknowledge that a nucleic acid sequence may be modified in such a way that in the resulting encoded protein, one or more amino acid(s) may be added or deleted compared with SEQ ID No. 2 without substantially altering the function of the resulting protein. Each of the types of modifications, deletions or additions mentioned above is well known to the skilled person. Thus, the skilled person will, based on the teaching herein and in combination of his/her common general knowledge, acknowledge that various alteration of the SEQ ID No. 1 may be introduced which do not significantly alter the function or activity of the resulting expressed protein. The skilled person will thus acknowledge that a nucleotide sequence differing from SEQ ID No. 1 by way of substitution(s), addition(s) or deletion(s) of nucleotides may be used according to the present invention depending on the retention of the interferon activity of the proteins encoded by the IFNc coding sequences in accordance with the use of said sequences.

Thus, fragments or variants of the SEQ ID No. 1 is to be understood to mean having at least 70% sequence identity with the said SEQ ID No. 1 , respectively. The term "70% sequence identity" is to be understood to refer to the percentage of

nucleotides that two or more sequences or fragments thereof, contains that are the same. A specified percentage of nucleotides can be referred as e.g. having 70%> sequence identity, 75% sequence identity, 80% sequence identity, 85% sequence identity, 90% sequence identity, 95% sequence identity, 99% sequence identity or more over a specified region when compared aligned for maximum correspondence. According to one embodiment of the present invention, SEQ ID No. 1 , or a sequence having at least 70% sequence identity with SEQ ID no. 1 is used as an antiviral agent. According to another embodiment of the present invention, a sequence having at least 80 % sequence identity with SEQ ID No. 1 is used as an antiviral agent. The skilled person in the art is well known with various commonly used means for comparing the identity between nucleic acid sequences. Reference is e.g. made to suitable computer programs commonly used in order to determine the % identity of two or more nucleic acid sequences, such as the Basic Local

Alignment Search Tool (BLAST) (Altshul et al., J of Molecul. Biol., 1990, 215, pp. 3389-3402).

The use of the IFNc encoding sequences according to the present invention is effectuated by inserting the said sequences in recombinant constructs resulting in the expression of said encoding sequences in the recipient fish. Said constructs comprise suitable control sequences enabling the expression of the IFNc encoding sequences, e.g. such as promoters and enhancers.

The term "promoter" is to be understood to represent a nucleotide sequence that is comprised of a sequence recognised by RNA polymerases, which upon binding to the DNA template provides for the production of mRNA of the adjacent structural gene. A "promoter" is thus a control sequence which is necessary to effect the expression of a coding sequence to which they are ligated. A non-limiting list of promoters that may be used according to the present invention is cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, simian virus 40 (SV-40) promoter, muscular β-actin promoter, elongation factor 1 alpha promoter.

According to one embodiment of the invention, the CMV promoter is operably linked to the IFNc coding sequence in an appropriate expression plasmid.

The expression "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For example, a promoter sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions suitable for the promoter sequence.

The interferon coding sequence may be introduced into the fish in any suitable form enabling expression of said coding sequence in the recipient fish. For example, the interferon coding sequence may be introduced in a linearized or circular plasmid, which upon injection into the recipient fish is replicated and wherein the interferon coding sequence is expressed. Preferably, the interferon coding sequence is operably linked to a promoter and contained in a plasmid, such as e.g. an expression plasmid. Suitable expression vectors may be produced using standard recombinant techniques, cf. Sambrook and Russel, Molecular Cloning; A Laboratory Manual or DNA cloning, vol I, II and III Cold Spring Harbor Laboratory Press, 2001 , pp.2344. Suitable expression plasmids adapted for expression of recombinant nucleic acid sequences in fish cells may be used to express IFNb and IFNc coding sequences according to the present invention. Several plasmids that may be useful are known in the prior art. A non- limiting list of plasmid that may be used according to the present invention is pVAXl , pcDNA3.1 , pcDNA3.3-TOPO (Invitrogen), pQE- TriSystem-7 vector (Qiagen), pcDNA™ 3.2/V5-DEST vector (Invitrogen). According to one embodiment of the present invention, the IFNc coding sequence is inserted in pcDNA3.3-TOPO vector.

A plasmid comprising IFNc coding sequence according to the present invention may preferably furthermore comprise one or more marker sequence(s) facilitating the propagation of the plasmid in a suitable host cell. The marker will ensure stable inheritance of plasmids during propagation in host cells. Most markers useful for the selection and propagation of expression plasmids rely on resistance to antibiotics. The marker may e.g. be an ampicillin or kanamycin resistance gene for selection and propagation of the plasmid according to the present invention in E.coli cells. The marker may furthermore e.g. be a neomycin resistance gene for selection of stable cell lines expressing IFNc with Geneticin®.

Also non-antibiotic based markers may be used. For example, a non-antibiotic- based marker useful for propagating an expression plasmid in E.coli is based on the displacement of repressor molecules from the chromosome to the plasmid, allowing expression of an essential gene (Cranenburgh et al, "Escherichia coli strains that allow antibiotic-free plasmid selection and maintenance by repressor titrations", 2001 , Nucleic Acid Res., 29: E26). Another non-antibiotic based marker is based on a biocide triclosan as selective agent and an endogenous growth essential target gene, fabl, as a marker for propagation of plasmid in E.coli (El- Attar et al, "A pest virus DNA vaccine based on a non-antibiotic resistance Escherichia Coli Essential gene marker", 2012, Vaccine, 30(9), pp 1702-1709). Another non- antibiotic based selection marker than may be used according to the present invention is an araD gene encoding L-ribulose-5-pospate-4-epimerase, cf. US patent No. 7,521 ,182. Yet another non-antibiotic selection system is based on complementation of host auxotrophy in the NAD de novo synthesis pathway (Dong et al, Novel antibiotic- free plasmid selection system based on complementation of host auxotrophy in the NAD de novo synthesis pathway, Appl. Environ. Microbiol, 2010, 76(7), pp.2295- 2303).

Expression plasmids according to the present invention may be propagated in any suitable host cell known to the skilled person. For example, the expression plasmid according to the present invention may be propagated in a prokaryotic host cell or eukaryotic host cells. According to one embodiment of the present invention, the expression plasmid is propagated in a prokaryotic host cell, such as E. coli.

In fish farming, the infection of various pathogens constitutes a large economical problem to the fish farming industry. Today, a range of vaccines against various pathogens is available to the fish farmer, in particular useful in combating bacterial pathogens. Commercial vaccines against various viruses are also available, although the effect thereof is heavily debated. Thus, even if vaccines against several viruses are available, virus diseases still represent a threat and results in huge economical loss to the fish farming industry. A non-limiting list of viruses cause diseases that constitute a continuous problem within farming of salmonids, is e.g. infectious pancreas necrosis virus (IPNV), salmonid alpha virus causing pancreas disease (PD), cardiomyopathy syndrome virus (CMSV), infectious salmon anaemia virus (ISAV), viral hemorrhagic septicaemia virus (VHSV), heart and skeletal muscle inflammation virus (HSMIV), infectious haematopoietic necrosis virus (IHNV). Thus, there is a need for alternative means and methods for the treatment and prevention of virus infection in farmed fish. The present invention presents a solution to this problem by using an IFNc coding sequence, or a fragment or variant thereof, as an antiviral agent.

According to one embodiment of the present invention, the IFNc coding sequences SEQ ID No. 1 or a fragment or variant thereof is used as an antiviral agent.

According to the present invention, an expression plasmid is constructed in order to be able to express the IFNc coding sequence SEQ ID No. 1 or a fragment or variant thereof upon administration to the recipient animal. An expression plasmid according to the present invention thus consists of e.g. naked plasmid DNA comprising SEQ ID No. 1 or a fragment or variant thereof operably linked to a promoter and/or other suitable control sequences enabling the expression of said IFNc coding sequences by the cells of the recipient fish after administration thereof. An expression plasmid may alternatively be carried in a live host microorganism being involved in the delivery of the genetic material to the recipient fish. The SEQ ID No. 1 or a fragment of variant thereof may be inserted in any suitable expression plasmid applicable for expressing proteins upon administration in a recipient fish. Thus, expression plasmid commonly used to express antigens, i.e. DNA vaccines, may likewise be useful for expression of the IFNc coding sequence according to the use of the present invention.

DNA vaccines directed towards viral pathogens have been presented as an attractive alternative to traditional vaccines (i.e. inactivated or attenuated strains of the pathogens of interest, or vaccines based on viral proteins or fragments thereof). Several DNA fish vaccines are known. For example, as early as in 1998, Heppel et al. reported that the injection of a DNA comprising viral haemorrhagic septicaemia virus G and N genes present in an expression plasmid exerted protection against a live virus upon administration of said DNA vaccine into rainbow trout (Fish

Shellfish Immunol., 1998, 8 (4), pp. 271 - 286). DNA vaccines against other fish rhabdohoviruses, infectious salmon anaemia virus and infectious pancreatic necrosis virus have also been reported (Lorenzen and LaPatra, Rev. Sci.Tech., Off Int epiz., 2005, 1 , pp. 201-213; Mikalsen et al, Vaccine, 2005, 23 (30), pp. 4895-4905;

Mikalsen et al, Dis Aquat Org, 2004, 60, pp. 1 1-20). Heras et al furthermore reports of an in vitro and in vivo immune response induced by a DNA vaccine encoding the VP2 gene of the infectious pancreatic necrosis virus (IPNV), see Fish Shellfish Immunol., 2009, 27, pp. 120-129.

In EP 1 818 406 Al , a DNA vaccine for vaccination of aquatic animals are disclosed wherein a mammalian cytomegalovirus promoter and a expression enhancing sequence is used to express antigens of interest for obtaining protection against pathogenic infection of farmed fish. WO 2007/031572 discloses antigen coding sequences originating from salmonid alpha virus and their use inter alia in DNA vaccines.

DNA vaccines have also been prepared for carp, cf. e.g. WO 2009/002376 and EP 2 01 1 876 Al disclosing DNA vaccines useful in the prevention of virus infection in carp. Expression plasmids used according to well known DNA vaccine technology in order to express antigens in the recipient animal, may be used according to the present invention in order to express the IFNc encoding sequence or fragment or variant thereof, so as to induce antiviral activity in the recipient fish. Based on his/her common general knowledge and the prior art relating to the preparation of DNA vaccines, the skilled person will be able to identify various expression plasmids that may be used to express the IFNc coding sequences as an antiviral agent according to the present invention. The present inventors have shown that the administration of an expression plasmid comprising an IFNc coding sequence to fish resulted in reduced mortality when exposed Infectious Salmon Anemia virus (ISAV). The present invention should however not be understood to be limited only to the combat of ISAV infections in farmed fish using the IFNc coding sequence of the present invention. The IFNc coding sequence is thus useful in the treatment and prevention of a variety of pathogenic viruses infecting farmed fish. A non-limiting list of such pathogenic viral organisms is e.g. infectious pancreatic necrosis virus (IPNV), salmonid alpha virus (SAV), viral hemorrhagic septicaemia virus (VHSV), infectious

haematopoietic necrosis virus (IHNV), heart and skeletal muscle inflammation virus (HSMIV).

The IFNc coding sequences, i.e. when comprised by suitable expression plasmid according to the present invention, may be administered to the recipient fish by any suitable method enabling the transfer of the plasmid/interferon coding sequence resulting in the expression of said sequence in the recipient fish. For example, the plasmid may be administered by injection into the muscle tissue or peritoneum of the recipient fish or by particle mediated delivery using gene gun technology.

Several means for administering nucleic acid sequences and expression plasmid to fish recipients are known in the prior art, see e.g. Heppel and Davis, "DNA

Vaccines: methods and protocols" in Methods of Molecular Medicine, 2000, 29 (ISBN 978-0-89603-508-5). The same methods are useful for administering the IFNc coding sequences used according to the present invention.

The plasmid(s) of the present invention may be administered in a pharmaceutical composition comprising the interferon coding sequence, e.g. contained in a suitable expression plasmid, and optionally one or more pharmaceutically acceptable carriers. Suitable pharmaceutically acceptable carriers useful as excipients for formulations comprising nucleotide sequences as the active ingredient, such as expression plasmids, are well known to the skilled person in the art. Suitable carriers may e.g. include aqueous or non-aqueous carriers. A non-limiting list of non-aqueous carriers is propylene glycol, polyethylene glycol, vegetable oils, organic esters, such as e.g. ethyl oleate. An aqueous carrier suitable for the administration of polynucleotide sequences to a fish recipient is e.g. sodium chloride solutions, PBS, Ringer's dextrose and sodium chloride, lactated Ringer's, etc. The composition may further include pharmaceutically acceptable excipients that will ease uptake of the plasmid into the host cells such as calcium phosphate, or by mixing with a cationic lipid to produce liposomes.

The composition according to the present invention may furthermore comprise other adjuvants well known to the skilled person. Such well known adjuvants may e.g. be included in order to further enhance the immune response or to facilitate the administration and up take of the interferon coding sequence in the recipient fish. Such well known adjuvants includes but are not limited to e.g. complete Freud's adjuvant, saponin, aluminium hydroxide, surface active compounds (e.g.

lysolecithin, polyanion, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, etc.). Based on the teaching herein and the common general knowledge, the skilled person will acknowledge that an effective dose may vary dependent on the stage, state and type of the fish recipient and thus be able to adjust the dose accordingly. An effective immunizing amount of an expression plasmid to be administered to a recipient fish may e.g. be in the range of about 0.1 to about 50 μg per fish injected, wherein said expression plasmid is comprised in a composition having a total volume of about 0.01 ml to about 0.1 ml. According to one embodiment of the present invention, about 15 μg of the expression plasmid according to the present invention is injected into the recipient fish. The represent invention furthermore provides a method for treating or preventing virus infections in farmed fish comprising administering to the recipient fish an IFNc coding sequences, or fragments or variants thereof, operably linked to promoters/control sequences enabling the expression of said sequences in the recipient fish. The method comprises administering to the recipient animal an effective dose of an IFNc encoding sequence operably linked to promoters/control sequences enabling the expression of said sequences in the recipient animal.

It is furthermore to be understood that also a recombinant IFNc prepared by using SEQ ID No. 1 and fragments and variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1 may be used as an antiviral agent. A recombinant IFNc protein may be prepared according to methods well known to the skilled person, i.e. by culturing a suitable host comprising an expression construct comprising an interferon coding sequence according to the present invention operably linked to a suitable promoter. The present invention thus also provides a recombinant IFNc protein for the use as an adjuvant. A recombinant IFNc protein may be administered to the recipient fish by methods well known to the skilled person. For example, a recombinant protein may be administered orally or by intramuscularly by injection.

The foregoing description of the various aspects of the present invention reveals the general nature of the invention and the skilled person will by applying the general knowledge within the area of gene expression technology (including inter alia the contents of the references cited herein), readily modify and/or adapt the present invention for various applications without departing from the general concept of the present invention and the scope of the enclosed claims. Such adoptions or modifications are thus intended to be within the meaning of the range of equivalents of the disclosed embodiments, based on the teaching and guidance herein, in combination with the knowledge of the skilled person. The following non- limiting examples will further illustrate the present invention.

Examples Example 1

Cloning of IFNb and IFNc open reading frames (ORFs) into an eukaryotic expression vector

The open reading frame (ORF) of IFNb (Gene bank accession number: JX524152) and IFNc gene (Gene bank accession number: JX524153) were cloned from a head kidney cDNA library of Atlantic salmon made from RNA harvested 12 hours after intraperitoneal (i.p.) injection of 50 g fish with 0.5 mg/ml R848. The primers used for cloning were:

IFNb forward: AACATGGCTGTATTGAAATGGTTGAG

IFNb reverse: TCACAGCTTGACTCTGCTGTCAATG

IFNc forward: AGAATGGCACTTCAGACTATCACTTGG

IFNc reverse: TCATGTTCTGTTGGCCCACAGAAGG

Amplification of ORFs by PCR was done as described by Robertsen et al (2003), and the products (SEQ ID No. 1 and SEQ ID No. 3, respectively) were inserted downstream of the CMV promoter of the eukaryotic expression vector pcDNA3.3- TOPO (Invitrogen) as described in the manual from Invitrogen.

Example 2

Recombinant IFNs

Recombinant IFNal , IFNb and IFNc were produced in human HEK293 cells essentially as described for IFNal by Berg et al. (2009). HEK293 cells were grown at 37°C in 5% C0₂ in EMEM containing lx MEM Non-Essential Amino Acid

Solution (Invitrogen), 100 U/ml penicillin, 100 μg/ml streptomycin and 10 % FBS Superior from Biochrom AG. Sub-confluent HEK293 cells were seeded in 24-well plates and transfected in with 500 ng of IFNa, IFNb or IFNc expression plasmid using 7 μΐ FugeneHD Transfection Reagent (Roche Diagnostics) per well. The medium was changed to EMEM with 10% FBS 5 h after transfection. Cell media containing IFNs were harvested 48 h after transfection, centrifuged for 5 min at 3000xg, filtrated through a 0.45 μιη filter and frozen in aliquots at -70°C until use.

Example 3

Measurement of antiviral activity of recombinant IFNb and IFNc in cell culture

Antiviral activity of IFNs was measured by the ability of to protect Atlantic salmon TO cells against lysis mediated by infectious pancreatic necrosis virus (IPNV) as described by Berg et al. (2009). TO cells were cultivated at 20°C in L15 medium containing lx MEM Non-Essential Amino Acid Solution (Invitrogen), 100 U/ml penicillin, 100 μg/ml streptomycin and 8% FBS Superior from Biochrom AG. Medium supernatants from HEK293 cells transfected with IFNb or IFNc expression plasmids prepared according to example 1 , were two-fold serially diluted in L-15 with 4 % FBS and 100 μΐ of each dilution was added to quadruplicate wells of subconfluent Atlantic salmon TO cells grown in 96 well culture plates at 17°C. After 24 h the cell supernatants were removed and the cells were infected with

IPNV at a multiplicity of infection (MOI) of 0.1 in 100 μΐ L-15. Virus was absorbed for 1.5 h before 100 μΐ medium with 4% serum was added. When complete destruction of non-stimulated infected cells occurred after approximately 4 days, all cells were washed with PBS, and fixed and stained by incubation with 1% (w/v) crystal violet in 20% ethanol for 10 min. The cells were then washed 3 times with distilled water and air dried before the stain was dissolved by addition of 100 μΐ 50 % ethanol containing 0.05 M sodium citrate and 0.05 M citric acid and the absorbance read at 550 nm. One unit of IFN is defined as the dilution factor of HEK293 supernatant, which induces 50% of maximal protection of TO cells against IPNV-induced CPE for each IFN.

The results revealed that TO cells transfected with an IFNc coding expression plasmid showed higher cell survival when challenged with IPNV compared with TO cells being transfected with an INFb coding expression plasmid (cf. fig 1 and 2).

Example 4.

Induction of Mx protein by IFNb and IFNc in TO cells.

Induction of Mx protein was studied by seeding TO cells in 24 well plates (1.5xl0⁵/well), and stimulated with 200 U/ml of IFNb or IFNc or left untreated. The cells were harvested in 60 μΐ SDS sample buffer 24 and 48 h post-treatment and subjected to Western blot analysis as described (Sun et al, J. Virol, 2011, pp. 9188-9198) using polyclonal antibody against salmon Mxl protein as primary antibody and antibody against actin as loading control. The results are presented in fig. 3. Example 5

Stimulation of antiviral activity in Atlantic salmon in vivo by intramuscular (i.m.) injection of IFNb and IFNc expression plasmids

Up-regulation of Mx expression in head kidney

Atlantic salmon presmolts (70 g) were injected i.m. approximately 1 cm below the dorsal fin with 10 μg IFN expression plasmid prepared according to example 1 or control plasmid (without insert) dissolved in 50 μΐ PBS. Head kidneys were harvested 7 days after injection and stored in RNAlater (Ambion). Total RNA was isolated with the E.Z.N.A Total RNA Kit I (Omega Bio-Tec). cDNA was synthesized with the

QuantiTect® Reverse Transcription Kit (Qiagen) starting with 200 ng total RNA following standard protocol. qPCR was performed using 6.1 μΐ 1 : 10 dilution of cDNA (except for detection of 18 S rRNA, which was performed with 1 : 1000 dilution) in 15 μΐ reaction mixture containing 7.5 μΐ 2X SYBR green PCR Master Mix (Applied

Biosystems) and 230 nM of Mx forward (TGCAACCACAGAGGCTTTGAA) and reverse primers (GGCTTGGTCAGGATGCCTAAT). Each sample was run in triplicate wells on a 7500 Fast Real Time PCR system (Applied Biosystems). The mixtures were incubated at 95°C for 20 sec followed by 40 cycles of 95°C for 3 sec and 60°C for 30 sec. The relative expression values were normalized against the levels of 18S rRNA and analyzed as described by Kileng et al (2007). Fold up-regulation of the representative genes was calculated by comparison of gene expression in treated vs. untreated cells. The results are presented in figure 4. The injection of IFNa encoding plasmid resulted in an increase in Mx expression comparable with the levels obtained with PBS and the control plasmid. The injection of IFNb and IFNc encoding plasmids resulted in an increased Mx expression, see figure 4. Protection against infection by infectious salmon anemia virus (ISA V)

Groups of 50 Atlantic salmon presmolts (40 g) were injected i.m. approximately 1 cm below the dorsal fin with 15 μg of the following plasmids: IFNa plasmid (pCR3.1 SasaIFN-al prepared as described in Robertsen et al, 2003, J Interferon Cytokine Res, 2003, pp. 601-612), IFNb plasmid, IFNc plasmid as prepared according to example 1 or control plasmid (without insert) dissolved in 50 μΐ PBS. The fish were kept in fresh water at 10 °C, and each fish was seven weeks later injected i.p. with 10⁵ virus of the ISAV Glesvaer/2/90 isolate obtained from the Norwegian Veterinary Institute in Oslo. The ISAV isolate was propagated and titrated in ASK-cells (Atlantic Salmon Kidney cells) obtained from ATCC

(lgcstandards-atcc.org) grown on L15 Glutamax medium containing lx MEM Non- Essential Amino Acid Solution (Invitrogen), 100 U/ml penicillin, 100 μg/ml streptomycin and 10 % FBS.

Cumulative mortality was recorded. The results are presented in figure 5 and figure 6. The results shows that the cumulative mortality in fish injected with an IFNb encoding expression plasmid when challenge with ISAV is the same as for fish injected with the control plasmid. The same is seen for fish injected with IFNa encoding expression plasmid.

Surprisingly, fish injected with an IFNc encoding expression plasmid showed significantly reduced cumulative mortality compared with the control plasmid and fish injected with IFNa encoding expression plasmid. Example 6

Stimulation of antiviral activity in Atlantic salmon in vivo by intramuscular (i.m.) injection of IFNa and IFNc expression plasmids-cohabitation challenge with ISAV

Groups of 50 Atlantic salmon presmolts (40 g) were injected i.m. approximately 1 cm below the dorsal fin with 15 μg IFNa plasmid (pCR3.1 SasaIFN-al prepared as described in Robertsen et al, 2003, J Interferon Cytokine Res, 2003, pp. 601-612), IFNc plasmid as prepared according to example 1 or control plasmid (without insert) dissolved in 50 μΐ PBS. The fish were kept in fresh water at 10 °C. After 8 weeks, the fish were cohabitated with shedder fish injected i.p. with 10⁵ virus of the ISAV Glesvaer/2/90. The ISAV isolate was obtained and propagated as described in Example 5.

Cumulative mortality was recorded up to 60 days after the introduction of the shedder fish.

The results are presented in figure 7. The results shows that the cumulative mortality in fish injected with an IFNa encoding expression plasmid when challenge with ISAV infected shedder fish is the same as for fish injected with the control plasmid. Similar to what is shown in example 5 and figure 5, fish injected with an IFNc encoding expression plasmid showed significantly reduced cumulative mortality compared with the control plasmid and fish injected with IFNa encoding expression plasmid. Example 7

Protection against infection by infectious salmon anemia virus (ISAV) after stimulation of antiviral activity in Atlantic salmon in vivo by intramuscular (i.m.) injection of IFNa, IFNb and IFNc expression plasmids. Groups of 45 Atlantic salmon presmolts (47 g) were injected i.m. approximately 1 cm below the dorsal fin with 50 μΐ PBS or 15 μg of one of the following plasmids: IFNa plasmid, IFNb plasmid, IFNc plasmid or control plasmid (pcDNA3.3-TOPO without insert) and dissolved in 50 μΐ PBS. IFNa plasmid was prepared as described in except that pcDNA3.3 was used as vector instead of pcDNA3.1. IFNb and IFNc plasmid was prepared according to example 1. The fish were kept in fresh water at 10 °C, and each fish was eight weeks later injected i.p. with 10⁴ virus of the ISAV Glesvaer/2/90 isolate obtained from the Norwegian Veterinary Institute in Oslo. The ISAV isolate was propagated and titrated in ASK-cells (Atlantic Salmon Kidney cells) obtained from ATCC (lgcstandards-atcc.org) grown on L15 Glutamax medium containing lx MEM Non-Essential Amino Acid Solution (Invitrogen), 100 U/ml penicillin, 100 μg/ml streptomycin and 10 % FBS.

Cumulative mortality was recorded. The results are presented in figure 8 and show that the cumulative mortality of fish injected with the control plasmid and the IFNa encoding expression plasmid when challenge with ISAV, developed relatively rapidly and reached 80 % at day 26 after injection of the virus. Fish injected with IFNb encoding expression plasmid showed somewhat lower mortality and reached a cumulative mortality of 60% at day 26. Surprisingly, fish injected with an IFNc encoding expression plasmid did not show mortality at all until day 26 after injection when 1 dead fish was recorded.

Claims

1. An interferon c coding sequence for the use as an antiviral agent, wherein the sequences is SEQ ID No. 1 and fragments and variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1.

An interferon c coding sequence according to claim 1 for use as an antiviral agent in the treatment or prevention of viral infections in farmed fish, wherein the virus is selected from the group consisting of infectious pancreas necrosis virus (IPNV), salmonid alpha virus (SAV), cardiomyopathy syndrome virus (CMSV), infectious salmon anaemia virus (ISAV), viral hemorrhagic septicaemia virus (VHSV), heart and muscle inflammation virus (HSMIV).

An interferon c coding sequence according to claim 1 for use in the treatment and prevention of viral infections in farmed fish caused by ISAV.

Plasmid comprising a polynucleotide sequence according to any of the claims 1 3, for use as an antiviral agent, wherein said polynucleotide sequence is operably linked to a promoter sequence.

Plasmid according to claim 2, wherein the promoter sequence is selected from the group consisting of cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, simian virus 40 (SV-40) promoter, and muscular β-actin promoter.

Plasmid according to claim 3, wherein the promoter is CMV promoter.

Plasmid according to any of the claims 1-4, wherein the plasmid comprises at least one selection marker.

8. Plasmid according to claim 5, wherein the at least one selection marker is

selected from the group consisting of a kanamycin, ampicillin and neomycin resistance gene.

9. A host cell comprising a plasmid according to any of the claims 1-6, such as a prokaryotic or eukaryotic host cell.

10. A host cell according to claim 9, wherein said host cell is E.coli.

1 1. A composition comprising a plasmid according to any of the claims 2-6, comprising an interferon c coding sequence according to claim 1 operably linked to a promoter, and optionally one or more pharmaceutically acceptable excipients.

12. A method for the treatment or prevention of viral infections in farmed fish, wherein said method comprises the steps of administering composition comprising an interferon c coding sequence represented by the sequence SEQ ID No. 1 and fragments and variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1 to the recipient fish.

13. A method according to claim 1 1 , wherein the interferon coding sequence is comprised in a plasmid according to claim 4-8.

14. A method according to claim 12-13, wherein the viral infection is caused by a virus selected from the group consisting of infectious pancreas necrosis virus (IPNV), salmonid alpha virus (SAV), cardiomyopathy syndrome virus (CMSV), infectious salmon anaemia virus (ISAV), viral haemorrhagic septicaemia virus (VHSV), heart and muscle inflammation virus (HSMIV).

15. A recombinant interferon c, encoded by SEQ ID No. 1 and fragments and

variants thereof having at least 70% sequence identity with the sequences SEQ ID No 1 , for use as an antiviral agent.

16. The use of SEQ ID No. 1 or a fragment or variant thereof having at least 70 % sequence identity with SEQ ID No. 1 as an antiviral agent.