JP2019154346A - Glycoprotein glycosylation - Google Patents

Abstract

To provide means for controlling sugar chains of glycoproteins by sugar chain modification.SOLUTION: Provided is a glycoprotein modified with a sugar chain, comprising: (1) expressing a target glycoprotein linked with a partial peptide recognized by the glycosyltransferase at the time of a glycosyltransferase reaction, which is a part (partial peptide) of a glycosyltransferase substrate glycoprotein, in a cell expressing the glycosyltransferase; and (2) recovering a target glycoprotein that has undergone sugar chain modification by the glycosyltransferase.SELECTED DRAWING: None

Description

  The present invention relates to glycomodification of glycoproteins. Specifically, the present invention relates to a technique for modifying a sugar chain of a glycoprotein and its use.

  Our research group has identified Lewis X [Galβ1-4 (Fucα1-3) GlcNAc] sugar chain, which is involved in maintaining stemness in neural stem cells, on lysosomal membrane protein 1 (LAMP1). It was found that it was expressed exclusively, and it was revealed that the glycosyltransferase responsible for the biosynthesis of Lewis X sugar chains in neural stem cells is fucose transferase 9 (FUT9) (Non-patent Document 1). FUT9 has the ability to transfer fucose residues to a substrate having an N-acetyllactosamine [Galβ1-4GlcNAc] (LacNAc) structure in vitro. Therefore, although it is expected that Lewis X sugar chain modification by FUT9 can occur on a large number of proteins having a LacNAc structure in cells, the Lewis X sugar chain modification is actually observed only in a specific protein.

H. Yagi et al. Glycobiology, 20, 976-981, 2010

  Although glycoproteins are expressed / produced not only for research but also for pharmaceutical use, it is generally difficult to control glycoprotein sugar chains when expressing glycoproteins. However, methods that do not add specific sugar residues by disrupting the glycosyltransferase gene are often used (eg, Niwa R, Shoji-Hosaka E, Sakurada M, Shinkawa T, Uchida K, Nakamura K, Matsushima K, Ueda R , Hanai N, Shitara K. Cancer Res. 2004 Mar 15; 64 (6): 2127-33.), Such methods involve glycosylation (eg, glycosylation of sugar residues such as fucose residues). It cannot be applied to. Then, this invention makes it a subject to provide the means to control the sugar chain of glycoprotein by sugar chain modification.

  As described above, contrary to our expectation, the fact that Lewis X modification by FUT9 was observed only on a specific protein was very interesting. The present inventors have the expectation that there is a characteristic but universal sugar modification mechanism behind the Lewis X modification, and have conducted research aimed at elucidating the FUT9-dependent Lewis X modification mechanism. Proceeded. As a result of various experiments under a detailed and detailed experimental design, FUT9 recognizes part of the amino acid sequence (partial peptide) of LAMP1, which is the main carrier protein (substrate glycoprotein), and adds fucose to the sugar chain As a result, it was suggested that a glycosyltransferase recognizes a specific amino acid sequence (peptide) and sugar-modifies the carrier protein. Skillful use of this sugar modification mechanism makes it possible to control the sugar chains of glycoproteins. That is, if an amino acid sequence derived from a glycosyltransferase substrate (carrier protein) and recognized by the glycosyltransferase is used, a sugar can be added to a sugar chain of any glycoprotein (ie, sugar chain modification). It becomes possible. For example, when FUT9 is employed as a glycosyltransferase, a fucose residue can be added to the target glycoprotein (for example, Lewis X modification) simply by adding the identified partial peptide derived from LAMP1.

As described above, the inventors' original study revealed the existence of a surprising sugar modification mechanism, and a highly versatile and innovative sugar modification (sugar chain control) technology was created. The following invention is based on the results.
[1] A method for preparing a glycoprotein modified with a sugar chain, comprising the following steps (1) and (2):
(1) A glycosyltransferase substrate glycoprotein that is a part (partial peptide) of a glycosyltransferase and a partial peptide that is recognized by the glycosyltransferase during a glycosyltransferase reaction is linked to the target glycoprotein, Expressing in the expressing cell,
(2) A step of recovering a target glycoprotein subjected to sugar chain modification by the glycosyltransferase.
[2] The preparation method according to [1], wherein the glycosyltransferase is fucose transferase.
[3] The preparation method according to [2], wherein the sugar transfer reaction is a method in which fucose is transferred to an N-acetyllactosamine sugar chain to produce a Lewis X sugar chain.
[4] The preparation method according to [2] or [3], wherein the fucose transferase is fucose transferase 9 and the substrate glycoprotein is lysosome-associated membrane protein 1.
[5] The preparation method according to [4], wherein the peptide sequence is IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1).
[6] The preparation method according to any one of [1] to [5], wherein the partial peptide is linked to the carboxy terminal side of the target glycoprotein.
[7] The preparation method according to any one of [1] to [6], wherein a protease recognition sequence is interposed between the target protein and the partial peptide.
[8] The preparation method according to [7], further comprising the following step (3):
(3) A step of treating the recovered glycoprotein with a protease.
[9] A method for preparing a glycoprotein modified with a sugar chain, comprising the following steps (I) and (II):
(I) Reacting the glycosyltransferase to a target glycoprotein linked to a partial peptide of a glycosyltransferase substrate glycoprotein (partial peptide) recognized by the glycosyltransferase during the glycosyltransferase reaction Step to make,
(II) A step of recovering a target glycoprotein that has undergone sugar chain modification by the glycosyltransferase.
[10] A gene encoding a glycoprotein of interest, which is a part (partial peptide) of a glycosyltransferase substrate glycoprotein linked to a partial peptide that is recognized by the glycosyltransferase during a glycosyltransferase reaction.
[11] a promoter;
A part of a glycosyltransferase substrate glycoprotein (partial peptide), and a gene encoding a target glycoprotein linked to a partial peptide recognized by the glycosyltransferase during a glycosyltransferase reaction,
A vector for preparing glycoproteins modified with sugar chains.
[12] The vector according to [11], wherein the partial peptide is linked to the carboxy terminal side of the target glycoprotein.
[13] The vector according to [11] or [12], wherein a protease recognition sequence is interposed between the target protein and the partial peptide.
[14] a promoter;
A cloning site for the gene encoding the target glycoprotein,
Arranged upstream or downstream of the cloning site is a sequence encoding a part of a glycosyltransferase substrate glycoprotein (partial peptide) that is recognized by the glycosyltransferase during the glycosyltransferase reaction. Being
A vector for preparing glycoproteins modified with sugar chains.
[15] The vector according to [14], wherein a sequence encoding a protease recognition sequence is arranged between the cloning site and a sequence encoding the partial peptide.
[16] The vector according to any one of [11] to [15], wherein the glycosyltransferase is a fucose transferase.
[17] The vector according to [16], wherein the transglycosylation reaction transfers fucose to an N-acetyllactosamine sugar chain to produce a Lewis X sugar chain.
[18] The vector according to [16] or [17], wherein the fucose transferase is fucose transferase 9 and the substrate glycoprotein is lysosome-associated membrane protein 1.
[19] The vector according to any one of [11] to [18], wherein the peptide sequence is IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1).
[20] A cell having the vector according to any one of [11] to [19].
[21] The cell according to [20], which is a human, mouse, rat or hamster cell.
[22] A kit for preparing a glycoprotein modified with a sugar chain, comprising the vector according to any one of [11] to [19].
[23] The kit according to [22], further comprising the glycosyltransferase.

Lewis X glycosylation of LAMP1 with FUT9. Lewis X sugar chain modification of soluble FcγRIIIa (sFcγRIIIa) dependent on FUT9. Glycosylation in an in vivo expression system (top) and glycosylation in an in vitro reaction (bottom). Structure of LAMP1 (reference H. Yagi et al. Glycobiology, 20, 976-981, 2010). FUT9-dependent glycosylation of LAMP1 N-domain (N-terminal domain). Identification of sequences involved in Lewis X expression (bottom) using various mutants of LAMP1 N-domain and C-domain (C-terminal domain) (Mutant N-C, Mutant 1-5) (top). Evaluation of Lewis X expression in a sFcγRIIIa mutant having 22 amino acid residues derived from LAMP1 or a part thereof added to the C-terminus. The sequence of 22 amino acid residues involved in Lewis X expression was divided into three based on the secondary structure. Lewis X glycosylation of erythropoietin (EPO) with 22 amino acid residues derived from LAMP1. A gene encoding a chimeric variant of LAMP1. Mutant N-C: It has a structure in which a sequence in which 317-377 residues are linked to 1-135 of LAMP1 is sandwiched between NotI restriction enzyme site (underlined) and AscI restriction enzyme site (double underlined) (SEQ ID NO: 27). The codon of this mutant has been optimized for humans by FASMAC Co., Ltd. Mutant 1: It has a structure in which a sequence in which 323-377 residues are linked to 1-141 residues of LAMP1 is sandwiched between NotI restriction enzyme sites (underlined) and AscI restriction enzyme sites (double underlined) (SEQ ID NO: 28). A gene encoding a chimeric variant of LAMP1. Mutant 2: Consists of a structure in which a sequence in which 333-377 residues are linked to 1-151 residues of LAMP1 is sandwiched between NotI restriction enzyme sites (underlined) and AscI restriction enzyme sites (double underlined) (SEQ ID NO: 29). Mutant 3: A structure in which a sequence in which residues 339 to 377 are linked to 1-157 residues of LAMP1 is sandwiched between NotI restriction enzyme sites (underlined) and AscI restriction enzyme sites (double underlined) (SEQ ID NO: 30). A gene encoding a chimeric variant of LAMP1. Mutant 4: It has a structure in which a sequence in which 346-377 residues are linked to 1-164 residues of LAMP1 is sandwiched between NotI restriction enzyme sites (underlined) and AscI restriction enzyme sites (double underlined) (SEQ ID NO: 31). Mutant 5: It consists of a structure in which 358-377 residues are linked to 1-176 residues of LAMP1 between NotI restriction enzyme site (underlined) and AscI restriction enzyme site (double underlined) (SEQ ID NO: 32).

In this specification, according to the convention, each amino acid is represented by one letter as follows.
Methionine: M, Serine: S, Alanine: A, Threonine: T, Valine: V, Tyrosine: Y, Leucine: L, Asparagine: N, Isoleucine: I, Glutamine: Q, Proline: P, Aspartate: D, Phenylalanine : F, glutamic acid: E, tryptophan: W, lysine: K, cysteine: C, arginine: R, glycine: G, histidine: H

1. Method for preparing glycoprotein modified with sugar chain The first aspect of the present invention relates to a method for preparing glycoprotein modified with sugar chain. According to the present invention, a glycoprotein modified with a sugar chain (in other words, having a modified sugar chain) can be obtained. Therefore, the preparation method of the present invention can also be regarded as a production method of glycoprotein modified with a sugar chain.

  “Sugar chain modified” means that the sugar chain of the target glycoprotein is different from the original structure due to the addition of sugar. Therefore, when the case where the present invention is applied to a specific glycoprotein is compared with the case where the present invention is not applied, a difference in sugar chain structure is recognized. In the method of the present invention, part or all of the sugar chain of the target glycoprotein is modified.

  The preparation method of the present invention is configured as an in vivo method using a cultured cell expression system or as an in vitro method, as will be described in detail below.

1-1. In vivo preparation method using cultured cell expression system In the preparation method of this embodiment, the following steps (1) and (2) are performed. In addition, the preparation method of the present invention is not a cell constituting an individual, but a cell isolated from an individual or a cell obtained by culturing, processing or the like (passage cell, Using a cell line).
(1) A glycosyltransferase substrate glycoprotein that is a part (partial peptide) of a glycosyltransferase and a partial peptide that is recognized by the glycosyltransferase during a glycosyltransferase reaction is linked to the target glycoprotein, A step of expressing in the expressing cell (2) a step of recovering a target glycoprotein that has undergone sugar chain modification by the glycosyltransferase

  Based on the finding that a glycosyltransferase recognizes a part of a substrate glycoprotein, that is, a partial peptide during the glycosyltransferase reaction, and that the glycosyltransferase reaction proceeds, the present glycoprotein is used in the present invention. In order to modify the sugar chain, a part (partial peptide) of the glycosyltransferase substrate glycoprotein used is used. Specifically, a partial peptide that the glycosyltransferase recognizes during the glycosyltransferase reaction (hereinafter sometimes referred to as “recognition peptide”) is linked in the cell (host) in which the glycosyltransferase used is expressed. The target glycoprotein (hereinafter sometimes referred to as “recognition peptide-linked glycoprotein”) is expressed (step (1)).

  The “substrate glycoprotein” in step (1) is a glycoprotein having the original sugar receptor (sugar chain structure) of the glycosyltransferase used in the present invention. Therefore, if a reaction catalyzed by the glycosyltransferase used in the present invention is performed under appropriate conditions, the sugar is transferred (added) to the sugar chain of the substrate glycoprotein.

  “Glycosyltransferase” is an enzyme that catalyzes a reaction of transferring a sugar moiety from a sugar donor (sugar nucleotide) to a substrate (sugar acceptor). Examples of glycosyltransferases include glucose transferase, galactose transferase, fucose transferase, mannose transferase, sialic acid transferase, N-acetylglucosamine transferase, and N-acetylgalactosamine transferase. If fucose transferase is employed as a glycosyltransferase, sugar chain modification by addition of fucose residues, that is, fucosylation is possible. For example, Lewis X sugar chain modification of a target glycoprotein having an N-acetyllactosamine sugar chain ( Transfer of a fucose residue to an N-acetyllactosamine sugar chain to produce a Lewis X sugar chain). By fucosylation, for example, glycoprotein endocytosis efficiency can be improved and improved, and pharmacokinetics can be localized. On the other hand, if sialyltransferase is employed as a glycosyltransferase, sialylation of the glycoprotein becomes possible, and for example, it can be expected to improve the blood half-life of the glycoprotein.

  A specific example of fucose transferase is fucose transferase 9 (FUT9). When FUT9 is used, a peptide consisting of IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1), which is part of lysosome-associated membrane protein 1 (LAMP1), is usually used as the recognition peptide. As long as the function / effect as a recognition peptide is not impaired, a part of the peptide may be modified, or a small number (for example, 1 to 10) amino acid residues may be added to the N-terminus or C-terminus. Examples of the modification include substitution or deletion of a small number (for example, 1 to 3) of amino acid residues. The substitution here is preferably a conservative amino acid substitution. “Conservative amino acid substitution” refers to substitution of an amino acid residue with an amino acid residue having a side chain of similar properties. Depending on the side chain of the amino acid residue, a basic side chain (eg lysine, arginine, histidine), an acidic side chain (eg aspartic acid, glutamic acid), an uncharged polar side chain (eg glycine, asparagine, glutamine, serine, threonine, tyrosine) Cysteine), non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (eg threonine, valine, isoleucine), aromatic side chains (eg tyrosine, phenylalanine, Like tryptophan and histidine). A conservative amino acid substitution is preferably a substitution between amino acid residues within the same family.

  The “target glycoprotein” is a glycoprotein to which the present invention is applied and undergoes sugar chain modification. Various glycoproteins (for example, those useful as components of pharmaceuticals, foods, research reagents, etc.) can be used as the target glycoprotein. Examples of target glycoproteins include cytokines (interferon (IFN), interleukin (IL)), hormones (eg erythropoietin (EPO), human chorionic gonadotropin (hCG), luteinizing hormone, follicle stimulating hormone, thyroid stimulating hormone) ), Enzymes (tissue-type plasminogen activator (t-PA), α-galactosidase, glucocerebrosidase), antibodies, antibody fragments, lactoferrin, ovalbumin, and thrombomodulin.

  A recognition peptide is linked to the target glycoprotein to be expressed in step (1). In other words, the target glycoprotein in which the recognition peptide is linked, that is, the recognition peptide-linked glycoprotein is expressed. The recognition peptide is directly or indirectly linked to the N-terminus or C-terminus of the target glycoprotein. In the latter case (indirect linkage), typically, one or more (for example, 2 to 30) amino acid residues are interposed between the target glycoprotein and the recognition peptide. As a mode in which a plurality of amino acid residues, that is, peptides are interposed, those in which the target glycoprotein and the recognition peptide are connected by a peptide linker, those in which a protease recognition sequence is provided between the target glycoprotein and the recognition peptide, and recognition in the target glycoprotein 1 to several amino acid residues (for example 1, 2, 3, 4, 5, 6, 7, 8, 9) that have no special function between peptides And those that intervene that do not impair the function / effect expected of the recognition peptide). A peptide linker is a linker consisting of a peptide in which amino acids are linked in a straight chain. A typical example of a peptide linker is a linker composed of glycine and serine (GGS linker or GS linker). On the other hand, the protease recognition sequence is an amino acid sequence that is recognized by a specific protease and necessary for cleavage of the protein by the protease. For example, a sortase recognition sequence, HRV3C recognition sequence, TEV protease recognition sequence, thrombin recognition sequence, PreScission Protease recognition sequence, etc.) can be used as the protease recognition sequence.

  Considering the experimental results (see Examples below) in which good glycosylation was observed when the recognition peptide was linked to the C-terminus of the target glycoprotein, preferably the position where the recognition peptide is linked is the target glycoprotein The C-terminal side of Such ligation is advantageous when the recognition peptide is removed after expression.

In order to express a recognition peptide-linked glycoprotein in a cell, typically, an expression carrying a gene encoding the recognition peptide-linked glycoprotein (hereinafter sometimes referred to as “recognition peptide-linked glycoprotein gene”). A host (cell) transformed with the vector is cultured. Specifically, for example, the recognition peptide-linked glycoprotein is expressed by the following steps (i) to (iii).
(I) a step of preparing an expression vector retaining a recognition peptide-linked glycoprotein gene (ii) a step of introducing the expression vector into a host cell (iii) culturing a transformant into which the expression vector has been introduced, and a recognition peptide Expressing linked glycoproteins

  In step (i), an expression vector that enables expression of a recognition peptide-linked glycoprotein in a host cell is prepared. The expression vector incorporates a promoter that functions in the host cell so that the recognition peptide-linked glycoprotein can be expressed in the host cell. Examples of promoters include CMV-IE (cytomegalovirus early gene-derived promoter), SV40, EF1α, RSV, SRα, β actin promoter, and the like. The promoter is operably linked to a recognition peptide-linked glycoprotein gene. Here, “the promoter is operably linked to the recognition peptide-linked glycoprotein gene” is synonymous with “the recognition peptide-linked glycoprotein gene is placed under the control of the promoter”. The recognition peptide-linked glycoprotein gene is linked directly or via other sequence to the 3 ′ end side of the promoter. When the recognition peptide-linked glycoprotein gene does not contain a signal sequence (leader sequence), the signal sequence is usually incorporated into an expression vector so that the recognition peptide-linked glycoprotein is secreted outside the host cell after expression. The signal sequence is added to the 5 ′ end side of the recognition peptide-linked glycoprotein gene. A signal sequence may be selected so as to correspond to the host cell. Examples of a signal sequence when a mammalian cell is used as a host include a mouse Ig-K chain signal sequence, a LAMP1 signal sequence, and an insulin signal sequence.

  A poly A addition signal sequence is usually arranged downstream of the recognition peptide-linked glycoprotein gene. Transcription is terminated by the use of a poly A addition signal sequence. As the poly A addition signal sequence, SV40 poly A addition sequence, bovine-derived growth hormone gene poly A addition sequence, and the like can be used.

  The expression vector may contain a detection gene (reporter gene, cell or tissue-specific gene, selection marker gene, etc.), enhancer sequence, WRPE sequence, and the like. The gene for detection includes the success or failure of introduction of the recognition peptide-linked glycoprotein gene, the detection of the expression of the recognition peptide-linked glycoprotein gene or the determination of the expression efficiency, the selection and classification of the cells in which the recognition peptide-linked glycoprotein gene is expressed. It is used for taking. On the other hand, the use of an enhancer sequence can improve the expression efficiency. The detection gene includes a neo gene conferring resistance to neomycin, an npt gene conferring resistance to kanamycin and the like (Herrera Estrella, EMBO J. 2 (1983), 987-995) and nptII gene (Messing & Vierra. Gene 1 9: 259-268 (1982)), hph gene conferring resistance to hygromycin (Blochinger & Diggl mann, Mol Cell Bio 4: 2929-2931), dhfr gene conferring resistance to metatrexate (Bourouis et al. , EMBO J.2 (7)), etc. (above, marker gene), luciferase gene (Giacomin, P1. Sci. 116 (1996), 59-72; Scikantha, J. Bact. 178 (1996), 121), β -Glucuronidase (GUS) gene, GFP (Gerdes, FEBS Lett. 389 (1996), 44-47) and its variants (EGFP, d2EGFP, etc.) and other fluorescent protein genes (reporter genes), intracellular domains Using genes such as the epidermal growth factor receptor (EGFR) gene You can. The detection gene can be linked to a recognition peptide-linked glycoprotein gene via, for example, a bicistronic regulatory sequence (for example, a ribosome internal recognition sequence (IRES)) or a sequence encoding a self-cleaving peptide. An example of a self-cleaving peptide is 2A peptide (T2A) derived from Thosea asigna virus, but is not limited thereto. Known as self-cleaving peptides are 2A peptide (F2A) from horseshoe disease virus (FMDV), 2A peptide (E2A) from equine rhinitis virus A (ERAV), 2A peptide (P2A) from porcine teschovirus (PTV-1), etc. It has been.

  The recognition peptide-linked glycoprotein gene is roughly divided into a portion encoding a target glycoprotein and a portion encoding a recognition peptide. As the sequence encoding the recognition peptide, various sequences can be adopted as long as it encodes the recognition peptide. For example, if the recognition peptide is IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1), the sequence of atcaagactgtggaatctataactgacatcagggcagatatagataaaaaatacagatgtgttagt (SEQ ID NO: 2) can be used.

  The sequence encoding the target glycoprotein and the sequence encoding the recognition peptide are linked in-frame directly or via another sequence (for example, a sequence encoding a peptide linker or a sequence encoding a protease recognition sequence).

The expression vector having the above-described configuration is constructed by, for example, any one of the following methods (a) to (c).
(A) A method of inserting a recognition peptide-linked glycoprotein gene into the cloning site of an expression vector (b) A target glycoprotein upstream or downstream of the expression vector incorporating a sequence encoding the recognition peptide (C) A sequence encoding a recognition peptide is inserted in frame upstream or downstream of an expression vector holding a sequence encoding a target glycoprotein. Method

  The construction method (a) is a construction method using a vector having a cloning site in addition to elements necessary for expression such as a promoter. The cloning site is used for insertion of a recognition peptide-linked glycoprotein gene. A multi-cloning site may be provided as a cloning site. An expression vector used in the preparation method of the present invention is completed by inserting a recognition peptide-linked glycoprotein gene into a cloning site. One of the advantages of this construction method is that a commercially available general-purpose vector can be used.

  In the construction method (b), a vector in which a sequence encoding a recognition peptide is previously incorporated is used. A cloning site for inserting a sequence encoding the target glycoprotein in frame is provided upstream (5 ′ end side) or downstream (3 ′ end side) of the sequence encoding the recognition peptide. An expression vector used in the preparation method of the present invention is completed by inserting a sequence encoding the target glycoprotein into the cloning site. In the case of this construction method, it is not necessary to prepare a sequence encoding a target glycoprotein linked to a recognition peptide (recognition peptide-linked glycoprotein gene) (that is, a sequence encoding the target glycoprotein can be used as it is). Therefore, for example, it can be said that it is particularly effective when expressing various types of target glycoproteins.

  Unlike the above two construction methods, the construction method (c) utilizes a vector that holds a sequence encoding the target glycoprotein in advance. In this construction method, the sequence encoding the recognition peptide is inserted in-frame upstream (5 ′ end side) or downstream (3 ′ end side) of the sequence encoding the glycoprotein of interest, thereby preparing the method of the present invention. The expression vector used for is completed. The insertion of the sequence encoding the recognition peptide causes the sequence encoding the target glycoprotein and the sequence encoding the recognition peptide to be linked in frame. This construction method is used when a vector carrying a sequence encoding a glycoprotein of interest is available (for example, when it is already owned (constructed or obtained) or easily available). It is particularly effective.

  In the construction method (a), a recognition peptide-linked glycoprotein gene in which a sequence encoding a protease recognition sequence is interposed between a sequence encoding a target glycoprotein and a sequence encoding a recognition peptide is used as an insertion sequence. In the construction method of (b), for example, an expression vector in which a sequence encoding a protease recognition sequence is arranged upstream or downstream of a sequence encoding a recognition peptide (a cloning site is provided further upstream or further downstream) is used. In the construction method of (c), for example, by inserting a sequence encoding a protease recognition sequence together with a recognition peptide, between the sequence encoding the target glycoprotein and the sequence encoding the recognition peptide. Expression vector for obtaining an expression product mediated by a protease recognition sequence To become.

  Many expression vectors that can be used for various expression systems (for example, mammalian cell expression systems) have been developed, and the expression vector of the present invention can be constructed using existing expression vectors.

  The expression vector prepared in step (i) is introduced into a host cell (step (ii)). The introduction operation may be performed by a conventional method. Various gene transfer methods can be used to introduce the expression vector into the host cell. For example, infection (when using viral vectors), electroporation (Potter, H. et al., Proc. Natl. Acad. Sci. USA 81, 7161-7165 (1984)), lipofection (Felgner, PL et al , Proc. Natl. Acad. Sci. USA 84, 7413-7417 (1987)) and the like.

  A cell expressing a glycosyltransferase corresponding to a recognition peptide (a glycosyltransferase that recognizes the recognition peptide and catalyzes a glycosyltransferase reaction) is used as a host cell. Cells that originally express the relevant glycosyltransferase may be used as the host cell, but it is preferable to use cells in which the glycosyltransferase is forcibly expressed by introduction of the glycosyltransferase gene. Real sugar chain modification. The glycosyltransferase gene may be introduced before or simultaneously with (ie, co-introduction of) the recognition peptide-linked glycoprotein gene (ie, introduction of the expression vector).

  In addition to the glycosyltransferase corresponding to the recognition peptide, a host cell in which other glycosyltransferase is forcibly expressed can also be used. For example, when N acetylglucosamine transferase IV or V, or both, is used as another glycosyltransferase, it is possible to increase the expression site of Lewis X due to the hyperbranching of the sugar chain.

Considering the mechanism / pattern of glycosylation, preferably a mammalian cell is used as a host cell. Mammalian cells are not particularly limited, for example, CHO cells, BHK cells, COS-7 cells, HeLa cells, Namalva cells, HEK293 cells, HCT116 cells, Jurkat cells, HL-60 cells, PC-12 cells, A431 cells, U2OS cells, K-562 cells, Expi293F ^™ cells and the like can be used. Examples of mammalian cell species are humans, mice, rats, and hamsters.

  Insect cells exhibiting a human-type glycosylation pattern, such as Sf-9 (Kato T, Kako N, Kikuta K, Miyazaki T, Kondo S, Yagi H, Kato K, Park EY. Sci Rep. 2017 May 3; 7 (1): 1409.) And yeast (eg, genetically modified Pichia yeast (Li H, Sethuraman N, Stadheim TA, Zha D, Prinz B, Ballew N, Bobrowicz P , Choi BK, Cook WJ, Cukan M, Houston-Cummings NR, Davidson R, Gong B, Hamilton SR, Hoopes JP, Jiang Y, Kim N, Mansfield R, Nett JH, Rios S, Strawbridge R, Wildt S, Gerngross TU Nat Biotechnol. 2006 Feb; 24 (2): 210-5.Epub 2006 Jan 22.) If necessary, after introducing a glycosyltransferase gene corresponding to the recognition peptide May be used as a host cell.

  In step (iii) following step (ii), a transformed cell (transformant) into which an expression vector has been introduced is cultured to express a recognition peptide-linked glycoprotein. The culture conditions are not particularly limited as long as the transformant can grow and the recognition peptide-linked glycoprotein can be expressed. Corrections may be made as necessary based on standard culture conditions. Moreover, it is possible to set appropriate culture conditions by preliminary experiments.

  The composition of the medium is not particularly limited. For example, maltose, sucrose, gentiobiose, soluble starch, glycerin, dextrin, molasses, organic acid and the like can be used as the carbon source of the medium. Further, as the nitrogen source, for example, ammonium sulfate, ammonium carbonate, ammonium phosphate, ammonium acetate, peptone, yeast extract, corn steep liquor, casein hydrolyzate, bran, meat extract and the like can be used. As the inorganic salt, potassium salt, magnesium salt, sodium salt, phosphate, manganese salt, iron salt, zinc salt and the like can be used. In order to promote the growth of transformants, a medium supplemented with vitamins, amino acids and the like may be used.

  The recognition peptide-linked glycoprotein expressed in the transformant is subjected to sugar chain modification by a glycosyltransferase expressed by the transformant. That is, when the glycosyltransferase expressed by the transformant recognizes a recognition peptide linked to the target glycoprotein, the glycosyltransferase proceeds to produce the target glycoprotein subjected to sugar chain modification. The target glycoprotein that has undergone this process is recovered (step (2)). Since the recognition peptide-linked glycoprotein is usually expressed as a secreted protein, for example, the culture supernatant is filtered, centrifuged, etc. to remove insolubles, and then concentrated by an ultrafiltration membrane, salting out such as ammonium sulfate precipitation. The target glycoprotein having undergone sugar chain modification can be recovered by separating and purifying by appropriately combining dialysis, various chromatography, and the like. If the expression vector is configured so that the recognition peptide-linked glycoprotein is expressed with a purification tag (His tag, HA tag, FLAG tag, etc.) added, glycosylation can be performed using the purification tag. The target glycoprotein received can also be recovered.

  A recognition peptide is linked to the recovered target glycoprotein. When a protease recognition sequence is used (ie, when an expression vector incorporating a sequence encoding a protease recognition sequence is used), the protease recognition sequence is interposed between the target glycoprotein sequence and the recognition peptide. Expression product is obtained. In this embodiment, the target glycoprotein from which the recognition peptide has been cleaved (separated) can be recovered by subjecting the expression product to prosthesis treatment. For protease treatment, a protease corresponding to the protease cleavage site used is used.

1-2. In vitro preparation method As described above, the present invention can also be configured as an in vitro method. In the following, the in vitro preparation method will be described. However, the same items (substrate glycoprotein, recognition peptide, glycosyltransferase, target glycoprotein, etc.) as in the above embodiment (in vivo preparation method) will not be described in duplicate. The corresponding explanation in the in vivo preparation method is incorporated.

In this embodiment, a glycosyl transfer reaction is performed in vitro to obtain a glycoprotein-modified target glycoprotein. Specifically, the following steps (I) and (II) are performed.
(I) Reacting the glycosyltransferase to a target glycoprotein linked to a partial peptide of a glycosyltransferase substrate glycoprotein (partial peptide) recognized by the glycosyltransferase during the glycosyltransferase reaction (II) a step of recovering a target glycoprotein that has undergone sugar chain modification by the glycosyltransferase

  In this embodiment, a glycosyltransferase is reacted in vitro with a recognition peptide-linked glycoprotein prepared in advance (step (I)). Specifically, a sugar donor, a recognition peptide-linked glycoprotein, and a corresponding glycosyltransferase are allowed to coexist in a suitable container and incubated. The reaction conditions may be set in consideration of the characteristics of the glycosyltransferase used. Optimal reaction conditions can be determined through preliminary experiments.

  The recognition peptide-linked glycoprotein may be prepared as a recombinant protein using an appropriate expression system, for example. The recognition peptide is directly or indirectly linked to the N-terminus or C-terminus of the target glycoprotein. Similar to the above embodiment (in vivo preparation method), a protease recognition sequence may be provided between the target glycoprotein and the recognition peptide.

  Other glycosyltransferases may coexist in the reaction system to cause a glycosyltransferase reaction by the glycosyltransferase. For example, when N-acetylglucosamine transferase IV or V, or both, and galactose transferase are used as other glycosyltransferases, an increase in the expression site of Lewis X due to a high degree of sugar chain branching can be expected. In addition, sialyl Lewis X can be synthesized by using sialic acid transferase derived from marine microorganisms.

  After step (I), ie, the reaction with glycosyltransferase, the target glycoprotein subjected to sugar chain modification is recovered (step (II)). The collection operation may be performed by a conventional method. If a purification tag (His tag, HA tag, FLAG tag, etc.) is added to the recognition peptide-linked glycoprotein used in step (I), simple purification using the purification tag becomes possible.

  A recognition peptide is linked to the recovered target glycoprotein. When a protease recognition sequence is used, a target glycoprotein in which the recognition peptide is cleaved (separated) can be obtained by subjecting the recovered target glycoprotein to protease treatment.

2. Expression Vectors and Kits Expression vectors (particularly those having a cloning site) used in the in vivo preparation method of the present invention are excellent in versatility and have high utility and utility value. Thus, as another aspect, the present invention provides an expression vector that can be used in the in vivo preparation method of the present invention. The structure of the expression vector of the present invention is as described above, and includes elements necessary for the expression of the recognition peptide-linked glycoprotein.

  The present invention further provides a kit for preparing a glycomodified glycoprotein comprising the expression vector of the present invention. According to the kit, the in vivo preparation method of the present invention can be carried out more easily. The kit of the present invention contains the above expression vector as a main component. Other reagents (for example, glycosyltransferase), containers / equipment, culture medium, etc. necessary for carrying out the in vivo preparation method of the present invention may be included in the kit of the present invention. Usually, an instruction manual is attached to the kit of the present invention.

In order to elucidate the FUT9-dependent Lewis X modification mechanism, the following studies were conducted.
<Method>
1. Preparation of protein expression plasmid
1-1. Preparation of FUT9 Expression Plasmid Human FUT9 cDNA was amplified by the polymerase chain reaction (PCR) method using the primers shown below, and the animal cell expression plasmid C-terminal 3 × Flag-CMV14 (Sigma -Aldrich) using restriction enzymes XbaI / HindIII.
FUT9-HindIII-F: cccaagcttatgacatcaacatccaaa (SEQ ID NO: 3)
FUT9-XbaI-R: gctctagaattccaaaaccatttctc (SEQ ID NO: 4)

For the PCR method, KOD plus DNA Polymerase (TOYOBO) was used. Melting, annealing, enzyme reaction time and temperature were performed under the following conditions.
(1) Melting (98 ℃ for 2 minutes)
(2) 35 cycles of melting (98 ° C for 10 seconds), annealing (55 ° C for 15 seconds), extension (68 ° C for 1 minute / kb (70 seconds))
(3) After 5 minutes of reaction at 68 ° C, leave at 4 ° C

(Reaction solution composition)
10xPCR buffer for KOD plus2 5μl
2 mM dNTPs 5 μl
25 mM MgSO ₄ 2 μl
5'-primer (10 pmol / μl) 1.5 μl
3'-primer (10 pmol / μl) 1.5 μl
Template cDNA 1 μl
DMSO 1.5μl
MilliQ® water 31.5μl
Total: 50μl

1-2. Preparation of LAMP1ΔTM expression plasmid A gene encoding the region lacking the transmembrane region of human LAMP1 (29-382) is amplified by PCR using the primers shown below for mammalian expression. It was incorporated into the vector CD4-bio-His (Addgene; 51861) (Sonja et al, 2012 BMC Biology 2012 10:62) at the restriction enzyme site NotI / AscI.
NotI-LAMP1-F: atagaatgcggccgccaccatggcggcccccggcagc (SEQ ID NO: 5)
AscI-LAMP1-R: tttggcgcgccagcgatggggatcagccat (SEQ ID NO: 6)

  The PCR method was performed using KOD plus DNA Polymerase (TOYOBO) with the same composition as the preparation of the FUT9 expression plasmid. Melting, annealing, enzyme reaction time and temperature were performed under the same conditions as in 1-1. The extension reaction was performed in 90 seconds.

1-3. Preparation of expression plasmid of LAMP1 domain-deficient mutant Next, various domain-deficient LAMP1s were prepared by inverse PCR using the LAMP1 as a template and the primers shown below.
N-domain-F for inverse: ggcgcgccgtcgacctcc (SEQ ID NO: 7)
N-domain-R for inverse: gctcttgggcacgggtga (SEQ ID NO: 8)
Inverse C-domain-F: ccctctgtggacaagtac (SEQ ID NO: 9)
Inverse C-domain-R: tgctgacgcacaatgcat (SEQ ID NO: 10)

For the PCR method, KOD puls DNA Polymerase (TOYOBO) was used. Melting, annealing, enzyme reaction time and temperature were performed under the following conditions. The reaction composition is the same as the preparation of FUT9 expression plasmid.
(1) Melting (95 ° C for 2 minutes)
(2) 35 cycles of melting (95 ° C for 30 seconds), annealing (60 ° C for 30 seconds), extension (68 ° C for 1 minute / kb (12 minutes))
(3) After 15 minutes of reaction at 68 ° C, leave at 4 ° C

1-4. Preparation of expression plasmid for chimeric mutant of LAMP1
Using N-domain constructs, genes encoding various chimeric mutants were purchased from FASMAC Co., Ltd. and incorporated into N-domain constructs using restriction enzymes AscI / NotI. The sequence of the gene encoding each chimeric variant is shown in FIGS.

1-5. Preparation of expression plasmid for model glycoprotein sFcγRIII Human sFcγRIII cDNA was purchased from FASMAC, and using the primers shown below, vector N-terminal 3 × Flag-CMV9 (Sigma-Aldrich Co.) ( The restriction enzyme HindIII / KpnI was incorporated into http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma-Aldrich/Vector/1/p3xflag-cmv-9-10_expression_vector.pdf).
HindIII-FcγRIIIa-F: ggaagcttatgggcatgcggactgaa (SEQ ID NO: 11)
KpnI-FcγRIIIa-R: gcggtaccttaaccttgagtgatggt (SEQ ID NO: 12)

  The PCR method was carried out using KOD plus DNA Polymerase (TOYOBO) with the same composition as the FUT9 expression plasmid purification. Melting, annealing, enzyme reaction time and temperature were performed under the same conditions as the PCR method in the preparation of FUT9 expression plasmid, and the extension reaction was performed in 40 seconds.

1-6. Preparation of sFcγRIII Variant Expression Plasmid Next, various FcR variants were prepared by inverse PCR using sFcγRIII as a template and the primers shown below.
FcR-123-F for inverse: gcagatatagataaaaaatacagatgtgttagttaaggtaccagtcgactctag (SEQ ID NO: 13)
FcR-123-R for inverse: cctgatgtcagttatagattccacagtcttgataccttgagtgatggtgat (SEQ ID NO: 14)
FcR-23-F for inverse: aatacagatgtgttagttaaggtaccagtcgactctag (SEQ ID NO: 15)
FcR-23-R for inverse: tttatctatatctgccctgatgtcagttataccttgagtgatggtgat (SEQ ID NO: 16)
FcR-3-F for inverse: aatacagatgtgttagttaaggtaccagtcgactctag (SEQ ID NO: 17)
FcR-3-R for inverse: accttgagtgatggtgat (SEQ ID NO: 18)

  For inverse PCR, KOD puls DNA Polymerase (TOYOBO) was used. The reaction composition, melting, annealing, enzyme reaction time and temperature are the same as in the preparation of various domain-deficient LAMP1 expression plasmids.

In addition, FcR12 was prepared by inverse PCR using the prepared FcR123 as a template and the primers shown below.
FcR-12-F for inverse: taaaaatacagatgtgttagt (SEQ ID NO: 19)
FcR-12-R for inverse: tttatctatatctgccct (SEQ ID NO: 20)

  For inverse PCR, KOD puls DNA Polymerase (TOYOBO) was used. The reaction composition, melting, annealing, enzyme reaction time and temperature are the same as in the preparation of various domain-deficient LAMP1 expression plasmids.

Furthermore, using FcR123 as a template, the strand of the target DNA was amplified using the following primers, and incorporated into the FcR123 construct using restriction enzymes HindIII / XbaI to prepare FcR1.
HindIII FcR-1-F: taaaaatacagatgtgttagt (SEQ ID NO: 21)
XbaI FcR-1-R: tgctctagattaagattccacagtcttgatacc (SEQ ID NO: 22)

  For the PCR method, KOD puls DNA Polymerase (TOYOBO) was used. The reaction composition, melting, annealing, enzyme reaction time and temperature are the same as in the preparation of various domain-deficient LAMP1 expression plasmids.

1-7. Preparation of EPO Expression Plasmid Human EPO cDNA was purchased from FASMAC, and the vector N-terminal 3 × Flag-CMV9 (Sigma-Aldrich Co.) (http: / /www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma-Aldrich/Vector/1/p3xflag-cmv-9-10_expression_vector.pdf) was incorporated using restriction enzyme HindIII / XbaI.
HindIII EPO-F: cccaagcttgccccaccacgcctcatc (SEQ ID NO: 23)
XbaI EPO-R: ccctctagatcatctgtcccctgtcct (SEQ ID NO: 24)

  For the PCR method, KOD puls DNA Polymerase (TOYOBO) was used. The reaction composition, melting, annealing, enzyme reaction time and temperature are the same as in the preparation of various domain-deficient LAMP1 expression plasmids.

1-8. Preparation of EPO Mutant Expression Plasmid In addition, EPO-22 was prepared by inverse PCR using the prepared EPO as a template and the primers shown below.
EPO-22-F for inverse: gcagatatagataaaaaatacagatgtgttagttgatctagaggatcccgg (SEQ ID NO: 25)
EPO-22-R for inverse: tgcaggacaggggacagaatcaagactgtggaatctataactgacatcagg (SEQ ID NO: 26)

  For inverse PCR, KOD puls DNA Polymerase (TOYOBO) was used. The reaction composition, melting, annealing, enzyme reaction time and temperature are the same as in the preparation of various domain-deficient LAMP1 expression plasmids.

2. Culture of HEK293T cells and CHO-K1 cells
HEK293T cells and CHO-K1 cells were cultured at 37 ° C. in the presence of 5% CO ₂ using Dulbecco's modified Eagle's medium (DMEM; Invitrogen) medium containing 10% FBS.

3. Protein expression and purification
3-1. Protein expression by HEK293T cells and CHO-K1 cells
HEK293T cells and CHO-K1 cells were cultured in a 10 cm ² cell dish under the conditions described in 2., and 20 μg of various plasmids for protein expression were introduced using 30 μg of polyethylenimine (PEI). After transfection, the cells were cultured for 72 hours and purified by the following purification methods.

3-2. Purification of FLAG-tag fusion protein Anti-FLAG M2 Affinity Gel (SIGMA) was added to the collected lysate and culture medium, and incubated at 4 ° C for 1 hour to bind the FLAG-tag fusion protein to the gel. The gel was washed with PBS and eluted with PBS containing 100 μg / ml FLAG peptide.

3-3. Purification of His-tag fusion protein Complete His-tag Pulification Resin (Roche) was added to the collected lysate and culture medium, and incubated at 4 ° C for 1 hour to bind the His-tag fusion protein and the beads. The beads were washed with PBS or PBS containing 10 mM imidazole and eluted with PBS containing 500 mM imidazole.

3-4. Western blotting The prepared electrophoresis sample was fractionated by SDS-PAGE and transferred to a PVDF membrane (Millipore). The PVDF membrane was blocked using Blocking-one (Nacalai Tesque), then added with the primary antibody and permeated at 4 ° C. overnight. Further, after washing the PVDF membrane with TBST, a secondary antibody solution was added and incubated at 4 ° C. for 1 hour. Thereafter, the PVDF membrane was washed with TBST, and then the target protein and sugar chain were detected using Immobilon Western Chemiluminescent HRP Substrate (Millipore).

3-5. Immunoprecipitation with anti-Lewis X antibody
CHO cells or HEK293T cells were cultured in a 10 cm ² cell dish under the conditions described in 2., and 12 μg of FUT9 expression plasmid was introduced into the gene using PEI. After transfection, the cells were cultured for 72 hours, the cells were collected, the protein fraction was extracted, and Western blotting was performed using an anti-Lewis X antibody.

3-6. Immunoprecipitation with anti-Flag antibody
CHO cells or HEK293T cells were cultured in a 10 cm ² cell dish under the conditions described in 2., and 12 μg of FUT9 expression plasmid was introduced into the gene using PEI. After transfection, the cells were cultured for 72 hours, the cells were collected, the protein fraction was extracted, and Western blotting was performed using an anti-Flag antibody.

3-7. Immunoprecipitation with anti-His-tag antibody
CHO cells or HEK293T cells were cultured in a 10 cm ² cell dish under the conditions described in 2., and 16 μg of FUT9 expression plasmid was introduced into the gene using PEI. After transfection, the cells were cultured for 72 hours, the cells were collected, the protein fraction was extracted, and Western blotting was performed using an anti-His-tag antibody.

3-8. Lewis X modification in vitro
FUT9, LAMP1 or sFcγRIII expression plasmids were respectively introduced into the CHO-K1 cells cultured in 2, and the respective proteins were purified by the method 2-7-2 from the culture solution after 72 hours of culture. FUT9, LAMP1 or sFcγRIII isolated and purified was reacted overnight at 37 ° C in the presence of 0.05 unit neuraminidase and 1 mg / ml GDP-fucose, and examined for the presence of Lewis X glycosylation using Western blotting. .

<Result>
1. Glycosylation of endogenous LAMP1 by overexpression of FUT9
When FUT9 was overexpressed in CHO cells, only specific proteins were modified by sugar chains containing the Lewis X structure (FIG. 1). The major carrier protein was found to be LAMP1, which was identified as a Lewis X sugar chain expression protein in neural stem cells. On the other hand, when FUT9 was overexpressed in HEK293T cells, Lewis X sugar chain modification of LAMP1 was observed, suggesting that LAMP1-specific Lewis X modification by FUT9 occurs in general mammalian cells.

2. Glycosylation of exogenous LAMP1 by overexpression of FUT9 and glycosylation of LAMP1 by in vitro reaction
When LAMP1 expression plasmid and soluble FcγRIIIa (sFcγRIIIa) plasmid as a control protein were introduced into FUT9 overexpressing cells as an external gene, specific modification by Lewis X sugar chain was observed on exogenous LAMP1. In addition, Lewis X sugar chain modification was not observed in sFcγRIIIa (FIG. 2 top).

  As a result of overexpression of FUT9 as an enzyme and LAMP1 and sFcγRIIIa as substrates in CHO cells, isolation and purification, and in vitro reaction in the presence of GDP-fucose, Lewis X modification was observed only in LAMP1. (Bottom of FIG. 2).

  From the above results, it was assumed that FUT9 has a mechanism for reading information on a specific peptide chain of LAMP1 and forms Lewis X sugar chain.

3. Co-expression of FUT9 and LAMP1 N-domain (N-terminal domain) or C-domain (C-terminal domain)
LAMP1 is composed of a transmembrane region and two highly homologous N-domain and C-domain (FIG. 3). In order to identify domains important for Lewis X modification by FUT9, FUT9 and LAMP1 domains were co-expressed. As a result, Lewis X modification was mainly observed in the N-domain (FIG. 4).

4). Identification of recognition sites in FUT9-dependent Lewis X modification
In order to identify the FUT9 recognition site, various fusion mutants of LAMP1 N-domain and C-domain were prepared (FIG. 5) and expressed in CHO cells overexpressing FUT9. Mutant NC does not express Lewis X, but Lewis X was expressed by extending the N-domain region (Mutant 3, 4, 5) (bottom of FIG. 5). In order to narrow down the region related to Lewis X expression, when Lewis X expression was evaluated using Mutant 1,2,3, the amount of Lewis X expression decreased with the shortening of the N-domain region (FIG. 5 bottom). It was revealed that the 22-amino acid residue sequence IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1) present in the domain is required for FUT9-dependent Lewis X modification. It is speculated that FUT9 recognizes this 22 amino acid residue sequence and transfers the fucose residue to the N-type sugar chain existing in the vicinity, thereby realizing sugar chain modification specific to carrier protein. .

5). Co-expression of sFcγRIIIa and FUT9 fused with LAMP1-derived sequence
Using CHO cells, sFcγRIIIa fused with the identified LAMP1-derived recognition sequence (22 amino acid residues) or a part thereof was coexpressed with FUT9. When the LAMP1-derived recognition sequence was fused, Lewis X modification was observed in sFcγRIIIa (FIG. 6). That is, it has been clarified that FUT9-dependent Lewis X modification can be applied to sFcγRIIIa, in which Lewis X expression is not observed, by fusing LAMP1-derived recognition sequences. This result shows that Lewis X modification of the target glycoprotein can be achieved by using the LAMP1-derived recognition sequence (22 amino acid residues).

6). Glycosylation of EPO fused with LAMP1-derived recognition sequence
In order to verify the versatility of the LAMP1-derived recognition sequence, erythropoietin (EPO) fused with the LAMP1-derived recognition sequence and FUT9 were co-expressed in CHO cells (upper FIG. 7). When the LAMP1-derived recognition sequence was fused, FUT9-dependent Lewis X modification was observed in EPO, in which Lewis X expression was not originally observed (FIG. 7 bottom). This result confirms that the LAMP1-derived recognition sequence has high versatility or generality as a sugar chain modification tool.

  The present invention enables glycoprotein control of glycoproteins by addition of sugars. For example, it is envisaged that the present invention is used to improve or improve the properties of glycoproteins used as pharmaceuticals (for example, the efficiency of introduction (uptake) into cells and pharmacokinetics). Therefore, the present invention can be expected to contribute to the development of highly effective biopharmaceuticals and the preparation of standard samples of sugar chain binding proteins. In addition, the present invention provides a highly versatile sugar chain modification technique and can be used in various fields (research, drug development, health foods, etc.).

  Unlike protein synthesis based on genome information, sugar chains are not gene products and are generally considered not to be precisely controlled. On the other hand, the decoding of the human genome has been completed, and how to control the post-translational modification of proteins, especially the transfer of sugar chains, has become a major issue for life science and the industries that apply its results. The present invention is expected to play a part in developing a custom-made artificial glycoprotein production technology. Glycoprotein production techniques represented by biopharmaceuticals such as antibody drugs are extremely important, and the social contribution of the present invention is extremely high.

  The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims. The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

Sequence number 3: Description of artificial sequence: FUT9-HindIII-F
Sequence number 4: Artificial sequence description: FUT9-XbaI-R
SEQ ID NO: 5: Description of artificial sequence: NotI-LAMP1-F
SEQ ID NO: 6: Description of artificial sequence: AscI-LAMP1-R
SEQ ID NO: 7: Description of artificial sequence: N-domain-F for inverse
Sequence number 8: Description of artificial sequence: N-domain-R for inverse
SEQ ID NO: 9: Description of artificial sequence: C-domain-F for inverse
SEQ ID NO: 10 Description of artificial sequence: C-domain-R for inverse
SEQ ID NO: 11 Description of artificial sequence: HindIII-FcγRIIIa-F
SEQ ID NO: 12: Description of artificial sequence: KpnI-FcγRIIIa-R
SEQ ID NO: 13 Description of artificial sequence: FcR-123-F for inverse
SEQ ID NO: 14: Description of artificial sequence: FcR-123-R for inverse use
SEQ ID NO: 15: Description of artificial sequence: FcR-23-F for inverse
SEQ ID NO: 16: Description of artificial sequence: FcR-23-R for inverse
SEQ ID NO: 17: Description of artificial sequence: FcR-3-F for inverse
SEQ ID NO: 18: Description of artificial sequence: FcR-3-R for inverse
SEQ ID NO: 19: Description of artificial sequence: FcR-12-F for inverse
SEQ ID NO: 20: Description of artificial sequence: FcR-12-R for inverse
SEQ ID NO: 21: Description of artificial sequence: HindIII FcR-1-F
SEQ ID NO: 22: Description of artificial sequence: XbaI FcR-1-R
SEQ ID NO: 23: Description of artificial sequence: HindIII EPO-F
SEQ ID NO: 24: Description of artificial sequence: XbaI EPO-R
Sequence number 25: Description of artificial arrangement | sequence: EPO-22-F for inverse
SEQ ID NO: 26: Description of artificial sequence: EPO-22-R for inverse use
SEQ ID NO: 27: Description of artificial sequence: Mutant NC
SEQ ID NO: 28: Description of artificial sequence: Mutant 1
SEQ ID NO: 29: Description of artificial sequence: Mutant 2
SEQ ID NO: 30: Description of artificial sequence: Mutant 3
SEQ ID NO: 31 Description of artificial sequence: Mutant 4
Sequence number 32: Description of artificial sequence: Mutant 5

Claims (23)

A method for preparing a glycoprotein modified with a sugar chain, comprising the following steps (1) and (2):
(1) A glycosyltransferase substrate glycoprotein that is a part (partial peptide) of a glycosyltransferase and a partial peptide that is recognized by the glycosyltransferase during a glycosyltransferase reaction is linked to the target glycoprotein, Expressing in the expressing cell,
(2) A step of recovering a target glycoprotein subjected to sugar chain modification by the glycosyltransferase.   The preparation method according to claim 1, wherein the glycosyltransferase is a fucose transferase.   The preparation method according to claim 2, wherein the sugar transfer reaction transfers fucose to an N-acetyllactosamine sugar chain to produce a Lewis X sugar chain.   The preparation method according to claim 2 or 3, wherein the fucose transferase is fucose transferase 9 and the substrate glycoprotein is lysosome-associated membrane protein 1.   The preparation method according to claim 4, wherein the peptide sequence is IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1).   The preparation method according to any one of claims 1 to 5, wherein the partial peptide is linked to the carboxy terminal side of the target glycoprotein.   The preparation method according to any one of claims 1 to 6, wherein a protease recognition sequence is interposed between the target protein and the partial peptide. The preparation method according to claim 7, further comprising the following step (3):
(3) A step of treating the recovered glycoprotein with a protease. A method for preparing a glycoprotein modified with a sugar chain, comprising the following steps (I) and (II):
(I) Reacting the glycosyltransferase to a target glycoprotein linked to a partial peptide of a glycosyltransferase substrate glycoprotein (partial peptide) recognized by the glycosyltransferase during the glycosyltransferase reaction Step to make,
(II) A step of recovering a target glycoprotein that has undergone sugar chain modification by the glycosyltransferase.   A gene that encodes a glycoprotein of interest, which is a part (partial peptide) of a glycosyltransferase substrate glycoprotein linked to a partial peptide that is recognized by the glycosyltransferase during a glycosyltransferase reaction. A promoter,
A part of a glycosyltransferase substrate glycoprotein (partial peptide), and a gene encoding a target glycoprotein linked to a partial peptide recognized by the glycosyltransferase during a glycosyltransferase reaction,
A vector for preparing glycoproteins modified with sugar chains.   The vector according to claim 11, wherein the partial peptide is linked to the carboxy terminal side of the target glycoprotein.   The vector according to claim 11 or 12, wherein a protease recognition sequence is interposed between the target protein and the partial peptide. A promoter,
A cloning site for the gene encoding the target glycoprotein,
Arranged upstream or downstream of the cloning site is a sequence encoding a part of a glycosyltransferase substrate glycoprotein (partial peptide) that is recognized by the glycosyltransferase during the glycosyltransferase reaction. Being
A vector for preparing glycoproteins modified with sugar chains.   The vector according to claim 14, wherein a sequence encoding a protease recognition sequence is arranged between the cloning site and a sequence encoding the partial peptide.   The vector according to any one of claims 11 to 15, wherein the glycosyltransferase is a fucose transferase.   The vector according to claim 16, wherein the sugar transfer reaction transfers fucose to an N-acetyllactosamine sugar chain to produce a Lewis X sugar chain.   The vector according to claim 16 or 17, wherein the fucose transferase is fucose transferase 9 and the substrate glycoprotein is lysosome-associated membrane protein 1.   The vector according to any one of claims 11 to 18, wherein the peptide sequence is IKTVESITDIRADIDKKYRCVS (SEQ ID NO: 1).   A cell carrying the vector according to any one of claims 11 to 19.   21. The cell of claim 20, which is a human, mouse, rat or hamster cell.   A kit for preparing a glycoprotein modified with a sugar chain, comprising the vector according to any one of claims 11 to 19.   The kit according to claim 22, further comprising the glycosyltransferase.

Images