JP2019083825A - Tagged antibodies - Google Patents

Abstract

To provide techniques for enhancing Fab antibody forming efficiency and uses thereof.SOLUTION: An antibody H chain gene encoding a VH region and a CH1 region and an antibody L chain gene encoding a VL region and a CL region are co-expressed to obtain a Fab antibody. Alternatively, an antibody H chain gene encoding a VH region and a CH1 region and an antibody L chain gene encoding a VL region and a CL region are separately expressed and the expression products are mixed to obtain a Fab antibody. A first tag sequence encoding one peptide of a peptide pair forming a leucine zipper is added to the H chain gene and a second tag sequence encoding the other peptide of the leucine zipper peptide pair is added to the L chain gene.SELECTED DRAWING: None

Description

  The present invention relates to methods of preparing antibodies. In particular, it relates to a method for preparing a tagged Fab antibody and its use.

  A monoclonal antibody is an antibody obtained from a clone derived from a single B cell and shows high specificity. Taking advantage of this feature, monoclonal antibodies are used as clinical diagnostic and therapeutic agents. Also, the utility value of the monoclonal antibody is high also as a research tool (analysis, quantification, separation, purification, etc.). In recent years, techniques have been developed to reduce the antigenicity to humans by converting monoclonal antibodies into mouse-human chimeric antibodies and humanized antibodies. Along with this, development of monoclonal antibodies as medicaments has been developed. In fact, the spread of antibody drugs is remarkable, and it has begun to light up the medical field where drastic therapeutic and preventive drugs do not exist.

  Various methods using genetic engineering techniques, such as phage display method, yeast surface display method, ribosome display method, as methods for producing monoclonal antibody molecules and derivatives thereof such as Fab antibodies and scFv antibodies (single-chain antibodies) mRNA display methods and the like have been developed. When producing antibody molecules using genetic engineering techniques, animal cells, yeast, E. coli, etc. are used.

  The method using animal cells requires a lot of time and cost to find efficient synthesis conditions. Moreover, the method by E. coli or yeast has the problem that the efficiency of protein folding is poor and the efficiency of formation of active molecules is low. On the other hand, cell-free synthetic systems (cell-free protein synthesis systems) have been developed and used for antibody production. In fact, the research group of the present inventors has made it possible to efficiently and rapidly prepare Fab antibodies by using a cell-free protein synthesis system, which is one of the SICREX (Single Cell RT-PCR Linked in Vitro Expression) methods. It has been successfully developed (Patent Document 1, Non-Patent Document 1).

Patent No. 4686682

Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88. J. Pestic. Sci. 28, 301-309, 2003

The scFv antibody is one in which only the variable regions of H chain and L chain are linked by a short linker, and its molecular weight is about 30 kDa. The low molecular weight has many advantages, such as smooth transition from blood vessels to tissue, and low cost and high-volume production. However, scFv antibodies are susceptible to the order in which the H chain and L chain are joined and the influence of the linker sequence, and there are problems such as a decrease in affinity (Non-patent Document 2). Moreover, when it is made to express in E. coli, refolding is required and it may not show sufficient activity. In contrast, Fab antibodies are excellent in stability because of their structure, and can be prepared in a short time when freshly prepared from B cells (Non-patent Document 1). On the other hand, the efficiency of Fab formation varies depending on the type of antibody, and the desired activity may not be obtained. When preparing a Fab antibody in E. coli, the association between molecules may not be successful, and an antibody exhibiting activity may not be obtained.
The object of the present invention is to focus on the utility of Fab antibodies and to provide a technique for enhancing the efficiency of forming Fab antibodies (association of H chain and L chain), its application and the like.

In the light of the above problems, the present inventors have conceived of utilizing a leucine zipper to assist in the formation of a Fab antibody, that is, the folding of the Fd portion of the H chain and the L chain. That is, considering the strategy of adding a pair of tag peptides forming leucine zipper to H chain (Hc) and L chain (Lc) to increase the heterodimer formation efficiency between Hc and Lc, its effectiveness is cell-free It was decided to investigate in a protein synthesis system and an expression system using E. coli. As a result of examination, it became clear that in any of the expression systems, the efficiency of formation of the active form Fab dramatically increases, and an effect beyond expectation can be obtained. The following inventions are mainly based on these achievements.
[1] The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region After each expressing a gene and an antibody L chain gene encoding a VL region and a CL region, mixing expression products.
Including
Among the pair of peptides constituting the leucine zipper, a first tag sequence encoding one of the peptides is added to the antibody H chain gene, and a second tag sequence encoding the other is added to the antibody L chain gene , Preparation method of Fab antibody.
[2] The first tag sequence described in [1], wherein the addition position of the first tag sequence is the 3 'end of the antibody H chain gene, and the addition position of the second tag sequence is the 3' end of the antibody L chain gene Preparation method.
[3] The preparation according to [1] or [2], wherein the leucine zipper exerts an avidity by electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to the hydrophobic bond between leucine and leucine. Law.
[4] The first tag sequence is added to the antibody H chain gene via a linker sequence, and the second tag sequence is added to the antibody L chain gene via a linker sequence, [1] The preparation method as described in any one of-[3].
[5] The preparation method according to any one of [1] to [4], wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system.
[6] The preparation method according to any one of [1] to [5], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) preparing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a set of primers capable of amplifying the antibody H chain gene comprising the same third tag sequence at the 5 'end and encoding the VH region and the CH1 region, using the cDNA as a template To do;
(iv) PCR is performed using the above-mentioned cDNA as a template, using a primer set consisting of a plurality of primers containing the same fourth tag sequence at the 5 'end and capable of amplifying an antibody L chain gene encoding a VL region and a CL region. To do;
(v) performing PCR using the amplification product of step (iii) as a template, using a single primer containing the third tag sequence;
(vi) performing PCR using the amplification product of step (iv) as a template, using a single primer containing the fourth tag sequence;
(vii) adding the first tag sequence to the antibody heavy chain gene which is the amplification product of step (v);
(Viii) adding the second tag sequence to an antibody light chain gene which is an amplification product of step (vi).
[7] The preparation method according to any one of [1] to [5], wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) preparing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by nested PCR using the cDNA as a template;
(IV) amplifying the antibody L chain gene by nested PCR using the cDNA as a template.
[8] A tagged Fab antibody, wherein one of a pair of peptides constituting a leucine zipper is attached to an H chain and the other is attached to an L chain.
[9] The tagged Fab antibody according to [8], wherein the addition position of the one peptide is the C-terminus of the H chain, and the addition position of the other peptide is the C-terminus of the L chain.
[10] The tag according to [8] or [9], wherein the leucine zipper exerts binding ability by electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to the hydrophobic bond between leucine and leucine. Fab antibody.
[11] Any one of [8] to [10], wherein the one peptide is attached to the H chain via a linker, and the other peptide is attached to the L chain via a linker The tagged Fab antibody according to Item.
[12] The tagged Fab antibody according to [11], wherein the linker comprises a protease cleavage site.
[13] A Fab antibody obtained by removing a tag from the tagged Fab antibody according to any one of [8] to [12].

Outline of SICREX method (example). List of primers used. List of used primers (cont.). Elements that make up a cell-free protein synthesis system. Composition of Fab-LZ (leucine zipper) complex. Results of sandwich ELISA analysis of rabbit IgG Fab-LZ synthesized by cell-free protein synthesis system. In addition, a negative control (without template) in which cell-free protein synthesis was carried out without template DNA and a negative control without immobilized antigen on the plate (without antigen coating) were used for comparison. Results of Western blot analysis of rabbit IgG Fab-LZ. Results of non-reducing SDS-PAGE analysis of mouse Fab (No. 6) and mouse Fab (No. 23). S is culture supernatant, P is precipitation. Antigen binding activity of anti-O-157 mouse Fab-LZ complex (by ELISA). In addition, a negative control (without template) in which cell-free protein synthesis was carried out without template DNA and a negative control without immobilized antigen on the plate (without antigen coating) were used for comparison. Antigen binding activity of anti-Listeria rabbit Fab-LZ complex (by ELISA). Results of ELISA analysis of Fab-LZ complex and Fab expressed in cell-free protein synthesis system. Fab-LZ complex and Fab were synthesized in a cell-free protein synthesis system using the PCR product amplified under the condition of 1 cell per well as a template, and the binding activity was measured. In addition, a negative control (without template) in which cell-free protein synthesis was carried out without template DNA and a negative control without immobilized antigen on the plate (without antigen coating) were used for comparison. Results of non-reducing SDS-PAGE analysis of rabbit Fab-LZ. S is culture supernatant, P is precipitation. List of primers used. List of used primers (cont.). List of used primers (cont.). List of used primers (cont.). List of used primers (cont.). List of used primers (cont.). Construction of Fab-LZ complex using cell-free protein synthesis system. List of primers used. Amplification of antibody genes from single cells. SICREX was performed in the condition of 1 cell / well using peripheral blood of rabbits immunized with L. monocytegenes. The heavy chain and light chain genes from the same cell for which gene amplification was confirmed were used as templates in the cell-free protein synthesis system. Lanes 1 to 13 show gene amplification from a single cell recovered using a micromanipulator, and lane 14 shows gene amplification using a solution after B cell concentration diluted to 1 cell / well as a template And lane 15 was similarly diluted to 5 cells / well as a template for gene amplification. Lane 16 is negative control performed without cells. Example of base sequence encoding Fab-LZ complex. In the upper sequence (SEQ ID NO: 139), a sequence encoding IgG-type VH and CH1, a sequence encoding a linker, a sequence encoding LZA, and an HA tag in this order from the 5 'end toward the 3' end An array coding for is arranged. In the lower sequence (SEQ ID NO: 140), a sequence encoding IgG type VL and CL, a sequence encoding a linker, a sequence encoding LZB, and a FLAG tag in this order from the 5 'end toward the 3' end An array coding for is arranged. Results of SDS-PAGE analysis of Fab-LZ complex and Fab expressed in cell-free protein synthesis system. Fab-LZ complexes and Fabs expressed by the cell free protein synthesis system were analyzed by non-reducing SDS-PAGE. Note that "PC" is a Fab of mouse catalytic antibody 6D9 and a positive control, and "NC" is a sample not containing a template. Also, the arrow on the right side indicates the position of the band of Fab, and the arrow near the center indicates the position where the band is expected to appear when the disulfide bond of the Fab-LZ complex is formed. Results of SDS-PAGE analysis of Fab-LZ complex and Fab expressed in cell-free protein synthesis system. Fab-LZ complexes and Fabs expressed by the cell-free protein synthesis system were analyzed by reducing SDS-PAGE. Note that "PC" is a Fab of mouse catalytic antibody 6D9 and a positive control, and "NC" is a sample not containing a template. Further, the arrow on the right side indicates the band position of Hc or Lc, and the arrow near the center indicates the position of the Hc or Lc band to which LZ is added. Results of ELISA analysis of mouse Fab-LZ complex and Fab expressed in E. coli. It was expressed in E. coli, and the cell lysate was calculated as the activity per culture solution volume. ELISA results when LZ was added to the V region.

  The first aspect of the present invention relates to a method of preparing a Fab antibody. The preparation method of the present invention comprises an antibody H chain gene encoding a VH region (heavy chain variable region) and a CH1 region (heavy chain constant region 1), a VL region (light chain variable region) and a CL region (light chain constant region) And b) expressing the antibody L chain gene encoding. In one embodiment, the antibody H chain gene and the antibody L chain gene are coexpressed (step (A); hereinafter, referred to as “coexpression step”). That is, the antibody H chain gene and the antibody L chain gene are expressed in the same expression system. On the other hand, in another embodiment, the antibody H chain gene and the antibody L chain gene are each expressed. In this embodiment, the expression products are mixed after expression to associate the antibody H chain with the antibody L chain.

  The Fab antibody is a fragment antibody consisting of an H chain comprising a VH region and a CH1 region, and an L chain comprising a VL region and a CL region, and does not contain an Fc region. In the following description, the H chain constituting the Fab antibody may be referred to as Hc, and the gene encoding it may be referred to as the Hc gene, according to the convention. Similarly, the L chain constituting the Fab antibody may be referred to as Lc, and the gene encoding it may be referred to as the Lc gene.

  In the present invention, a leucine zipper is used to improve the formation rate of Fab antibody. Specifically, a Fab antibody with a leucine zipper attached (referred to as "tagged Fab" in the present invention) is prepared. By adding a leucine zipper, the binding force unique to leucine zipper assists in the association of Hc and Lc, and the efficiency of Fab formation is improved.

  The leucine zipper is a characteristic structure found as a motif of the secondary structure of a protein (Science. 1988 Jun 24; 240 (4860): 1759-64.). The structure of the leucine zipper has a basic skeleton in which leucine residues are aligned every 4 to 5 in an amino acid sequence that is likely to adopt an α-helix structure. By this skeleton, leucine residues are aligned approximately in a line in the axial direction of the α-helix, and hydrophobically bind to the alignment of leucine residues in another leucine zipper structure. In the present invention, a pair of peptides (referred to as leucine zipper peptide A and leucine zipper peptide B) containing such characteristic motifs are used. Leucine zipper peptide A and leucine zipper peptide B have high affinity and form leucine zipper. The leucine zipper peptide A contains leucine every seven residues so that it can form a leucine zipper. The leucine zipper peptide B similarly contains leucine every seven residues. These leucines are arranged to correspond to leucine in leucine zipper peptide A (constituting a leucine zipper motif). The length of leucine zipper peptide A and leucine zipper peptide B is not particularly limited, but if it is too short, the desired effect, ie, the binding ability due to the leucine zipper structure can not be sufficiently exhibited, and if too long, steric hindrance etc cause Hc and Lc It may affect the association and antibody binding (antigen recognition). Thus, the lengths of leucine zipper peptide A and leucine zipper peptide B are, for example, 25 to 50 residues, preferably 28 to 35 residues. The lengths of leucine zipper peptide A and leucine zipper peptide B are basically the same, but may be different in length as long as they can form a leucine zipper structure.

Although leucine zippers of various configurations can be used, preferably, in addition to the hydrophobic bond between leucine and leucine, a leucine zipper that exerts binding power by electrostatic interaction between positively charged amino acids and negatively charged amino acids is adopted Do. Such leucine zippers (referred to as "charged leucine zippers" for convenience of explanation) exhibit high binding strength. When charge retaining leucine zippers are used, leucine zipper peptide A and leucine zipper peptide B have the following structural features of (a) or (b):
(a) Leucine zipper peptide A contains positively charged amino acids (basic amino acids). The leucine zipper peptide B contains a negatively charged amino acid (acidic amino acid) at a position corresponding to the positively charged amino acid of leucine zipper peptide A.
(b) Leucine zipper peptide A contains an acidic amino acid. Leucine zipper peptide B contains a basic amino acid at a position corresponding to the acidic amino acid of leucine zipper peptide A.

  Examples of basic amino acids are lysine (K), arginine (R) and histidine (H), but among these, K or R may be selected for reasons of charge strength. Similarly, examples of acidic amino acids are aspartic acid (D) and glutamic acid (E). When the number of charged amino acids in the leucine zipper peptide is increased, electrostatic interaction is enhanced, and the binding strength of leucine zipper can be expected to be improved. Thus, the proportion of charged amino acids in the leucine zipper peptide is, for example, 15% to 50%, preferably 20% to 40%.

In 1993, O'shea et al. Designed peptides called ACID-p1 (LZA) and BASE-p2 (LZB) in which the GCN4 leucine zipper was modified (Oshea, EK, KJ Lumb, and PS Kim, 1993, PEPTIDE VELCRO -DESIGN OF A HETERODIMERIC COILED-COIL: Current Biology, v. 3, p. 658-667.). LZA and LZB are not affected by physical conditions such as pH, ionic strength and temperature, and form heterodimers with high specificity and affinity (Kd = 3 x 10 ^-8 M). LZA and LZB can be used as a pair of leucine zipper peptides rich in charged amino acids. The sequences of LZA and LZB are shown below.
(1) LZA (leucine zipper peptide holding negative charge)
AQLEKELQALEKENAQLEWELQALEKELAQK (SEQ ID NO: 1)
Glutamic acid (E) is disposed at the fourth, sixth, eleventh, thirteenth, eighteenth, twentieth, twenty-fifth, and twenty-seventh positions for electrostatic interaction.
(2) LZB (leucine zipper peptide holding a positive charge)
AQLKKKLQALKKKNAQLKWKLQALKKKLAQK (SEQ ID NO: 2)
For electrostatic interaction, lysine (K) is disposed at the fourth, sixth, eleventh, thirteenth, eighteenth, twentieth, twenty-fifth, twenty-seventh, and twenty-seventh positions.

  In the preparation method of the present invention, in order to obtain a Fab antibody to which a leucine zipper is added, the Hc gene and Lc gene of characteristic structures are subjected to expression. That is, as an antibody gene used in the expression step, an Hc gene to which a base sequence (referred to as “first tag sequence”) encoding one (leucine zipper peptide A) of a pair of peptides constituting a leucine zipper is added And a Lc gene to which a base sequence encoding the other (leucine zipper peptide B) (referred to as "second tag sequence") is added. Such characteristic Hc gene and Lc gene are expressed to obtain a Fab antibody to which a leucine zipper is added.

  The addition position of the first tag sequence is at the 5 'end or 3' end of the Hc gene. The addition position of the second tag sequence depends on the addition position of the first tag sequence. That is, when the first tag sequence is added to the 5 'end of the Hc gene, the second tag sequence is added to the 5' end of the Lc gene so as to construct a leucine zipper that assists in the formation of a correctly assembled Fab antibody. Add to Similarly, when the first tag sequence is added to the 3 end of the Hc gene, the second tag sequence is added to the 3 'end of the Lc gene.

  Preferably, the addition position of the first tag sequence and the second tag sequence is at the 3 'end of the antibody gene. In this way, a Fab antibody is obtained in which a leucine zipper is attached to the C terminus, that is, the side of the constant region. The antibody exhibits specific binding depending on the variable region even when the leucine zipper is added, and can be used for various applications without removing the leucine zipper moiety. However, after removing the leucine zipper portion, it may be used for various uses.

  On the other hand, when the addition position of the first tag sequence and the second tag sequence is at the 5 'end of the antibody gene, the obtained tagged Fab antibody has a leucine zipper added at the N-terminus, ie, the variable region side. Become. Thus, in normal use, the leucine zipper is removed beforehand. A protease can be used to remove the leucine zipper. For example, if a protease cleavage site is included in the linker described later, the leucine zipper is removed by prosthoding the tagged Fab antibody obtained by performing the preparation method of the present invention to obtain an untagged Fab antibody. Be Other than protease treatment, intein may be used to remove leucine zipper.

  The first tag sequence and the second tag sequence are linked to the antibody gene directly or via a linker sequence (sequence encoding the linker). In the latter case, a tagged Fab antibody to which a leucine zipper is linked by a linker will be obtained. By using a linker, the Fab antibody portion and the tag portion (leucine zipper) are linked with appropriate flexibility, and improvement in the association efficiency of Hc and Lc and the formation efficiency of the leucine zipper structure can be expected. For example, a peptide linker is used as the linker. The peptide linker is a linker consisting of a peptide in which amino acids are linked in a linear manner. A representative example of the peptide linker is a linker composed of glycine and serine (GGS linker or GS linker). The GGS linker consists of a sequence in which GGS is repeated one to several times. The number of repetition is not particularly limited, but is preferably 2 to 6 times, more preferably 2 to 4 times. On the other hand, the GS linker is a sequence in which GGGGS (SEQ ID NO: 3) is repeated one to several times. Glycine and serine, which are amino acids that constitute the GGS linker and the GS linker, are small in their own size, and a higher-order structure is less likely to be formed in the linker. Thus, it is less likely to interfere with the association of Hc and Lc, and the formation of the leucine zipper structure.

  The Hc gene and the Lc gene can be prepared by any method. As described above, the research group of the present inventors developed a method for obtaining a Fab antibody called SICREX method (Single Cell RT-PCR Linked in Vitro Expression). The SICREX method makes it possible to obtain a desired antibody from antibody-producing cells in a short time. In a preferred embodiment of the present invention, the SICLEX method is used to prepare the Hc gene and the Lc gene simply and in a short time, and to accelerate the series of operations. In a typical operation of the SICREX method (Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88.), First, non-human animals (eg, mice) immunized against a specific antigen are used. B cells are isolated from spleen, peripheral blood of rats, rabbits) or human peripheral blood. Dilute the solution containing the isolated B cells so that the number of cells is 1 cell / well. Alternatively, B cells are isolated using a micromanipulator or the like. Next, reverse transcription PCR (RT-PCR) is used to synthesize cDNA from mRNA in B cells. Subsequently, the Hc gene and the Lc gene are separately amplified by two-step PCR. In the first step of the two-step PCR, a plurality of cDNA specific primers (first primer set) to which the same tag sequence is added at the 5 'end are used. The second stage PCR is performed using the amplification product of the first stage PCR as a template. In the second stage PCR, a single primer to which the tag sequence identical to the tag sequence used for the first primer set is added at the 5 'end is used to specifically and efficiently amplify the amplification product of the first stage PCR. Amplify. The single primer used for the second step PCR is complementary to the 5 'end portion and the 3' end portion of the amplification product obtained by the first step PCR. Thus, specific amplification with a single primer is possible. Elements necessary for expression in a cell-free protein synthesis system (promoter, terminator, etc.) were linked to the Hc gene and Lc gene obtained by the above operation using overlap PCR, and then necessary reagents were added. In vitro synthesis (transcription and translation) in one container. The binding ability of the Fab antibody synthesized in this manner to the antigen can be confirmed by ELISA or the like. In addition, if necessary, perform sequence analysis on high binding ability. In addition, regarding the operation procedure, conditions, application and the like of the SICREX method, Biotechnol Prog. 2006 Jul-Aug; 22 (4): 979-88., J Biosci Bioeng. 2010 Jan; 109 (1): 75-82, etc. You can refer to it.

When preparing the Hc gene and the Lc gene to be used in the present invention by using the SICREX method, for example, the following steps (i) to (viii) will be performed.
(i) preparing an mRNA derived from a single B cell
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template
(iii) A primer set comprising a plurality of primers containing the same tag sequence (third tag sequence) at the 5 'end and capable of amplifying an antibody H chain gene (Hc gene) encoding the VH region and the CH1 region, Performing PCR using the cDNA as a template
(iv) A primer set comprising a plurality of primers containing the same tag sequence (fourth tag sequence) at the 5 'end and capable of amplifying an antibody light chain gene (Lc gene) encoding a VL region and a CL region, Performing PCR using the cDNA as a template
(v) performing PCR using the amplification product of step (iii) as a template, using a single primer containing the third tag sequence;
(vi) performing PCR using the amplification product of step (iv) as a template, using a single primer containing the fourth tag sequence;
(vii) adding a first tag sequence (a sequence encoding leucine zipper peptide A) to the antibody H chain gene (Hc gene) which is the amplification product of step (v)
(viii) adding a second tag sequence (a sequence encoding leucine zipper peptide B) to the antibody L chain gene (Lc gene) which is the amplification product of step (vi)

  Among the above steps, in particular steps (vii) and (viii) are characteristic of the present invention. The tag sequences in steps (vii) and (viii) can be added by overlap PCR, as in the addition of elements required for expression in a cell-free protein synthesis system in the above-described SICREX method.

  When using a cell-free protein synthesis system for co-expression of Hc gene and Lc gene, addition of elements necessary for expression in a cell-free protein synthesis system is also performed. This operation can be performed before or after steps (vii) and (viii). Alternatively, it may be performed simultaneously with the addition of the first tag sequence / the second tag sequence (ie, the elements necessary for expression in a cell-free protein synthesis system and the tag sequence are added together). The promoter is used as "element necessary for expression in a cell-free protein synthesis system". Preferably, a promoter and a terminator are used in combination. More preferably, a promoter, a terminator and a ribosome binding site are used in combination. As a promoter, T7 promoter, T3 promoter, SP6 promoter or the like can be used. In addition, as a terminator, for example, a T7 terminator can be used.

By the way, the improvement technique of SICREX method of performing two-step PCR in one operation (one-step PCR) by simultaneously using the primers used for the first step PCR and the second step PCR at a predetermined ratio. (J. Biosci. Bioeng., Vol. 101, No. 3, 284-286, 2006). According to this report, in another aspect of the present invention, the antibody gene is amplified by one-step PCR instead of the conventional two-step PCR. In the case of this aspect, the following steps (a) and (b) are performed instead of the above steps (iii) to (vi).
(a) A primer set comprising a plurality of primers containing the same tag sequence (fifth tag sequence) at the 5 'end and capable of amplifying an antibody H-chain gene (Hc gene) encoding a VH region and a CH1 region; Performing PCR using the cDNA as a template, using a single primer containing the fifth tag sequence, which is used at a higher concentration than the primer set
(b) A primer set comprising a plurality of primers containing the same tag sequence (sixth tag sequence) at the 5 'end and capable of amplifying an antibody L chain gene (Lc gene) encoding a VL region and a CL region; Performing a PCR using the cDNA as a template, using a single primer containing the sixth tag sequence, which is used at a higher concentration than the primer set

  The quantitative ratio of primer set to single primer is, for example, 1: 2 to 1:50, preferably 1: 5 to 1:20, and more preferably 1: 8 to 1:15.

Instead of the above method (steps (i) to (viii)), specifically amplifying antibody cDNA by the method of performing two-step PCR using the outer primer and the inner primer (nested PCR method) It is also good. In this case, for example, the following steps (I) to (IV) will be performed.
(I) preparing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by nested PCR using the cDNA as a template;
(IV) amplifying the antibody L chain gene by nested PCR using the cDNA as a template.

  For the L chain, for example, PCR is performed using the 1st PCR (LC) set shown in FIG. 15, and then PCR is performed using the 2nd PCR (LC) primer set (the same applies to the H chain). A tag sequence is added to the 5 'end of each primer, and T7 promoter and T7 terminator can be added by overlapping PCR.

  By the way, the co-expression step of the Hc gene and the Lc gene can be performed in an expression system using a host cell or a cell-free protein synthesis system. In the former case, an expression vector holding expression of Hc gene and an expression vector holding expression of Lc gene are prepared, and the appropriate host is transformed with these expression vectors. Alternatively, the host is transformed with an expression vector capable of co-expressing Hc gene and Lc gene. Then, the obtained transformant is cultured under conditions in which the antibody gene from the expression vector can be expressed, and then a tagged Fab antibody which is a complex of the expression product is recovered from the transformant or the culture solution.

  In the case of an embodiment in which the step of mixing the expression products after expressing each of the Hc gene and the Lc gene, a suitable host is transformed with an expression vector which holds the Hc gene in an expressible manner, The appropriate host is transformed with an expression vector which holds the gene in an expressible manner. After culturing each of the obtained transformants, the expression product is recovered from the transformant or the culture solution. Thereafter, the expression products are mixed and associated to obtain a tagged Fab antibody.

  Hosts include bacterial cells (eg, E. coli), yeast cells (eg, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris), filamentous fungal cells (eg, Aspergillus oryzae, Aspergillus niger), mammalian cells (eg, CHO cells, Sp2 / 0 cells, etc.) NS0 cells) etc. can be exemplified. Preferably, E. coli is employed as a host. E. coli is suitable for the efficient and large-scale preparation of target proteins (in this case, tagged Fab antibodies). The expression vector may be selected in consideration of the relationship with the host. Each operation and conditions such as transformation, culture, recovery and the like may be in accordance with a conventional method. Alternatively, each operation may be performed according to past reports.

  The cell-free protein synthesis system does not use living cells, but uses ribosomes derived from living cells (or obtained by genetic engineering techniques), transcription / translation factors, etc. It means to synthesize in vitro. In cell-free protein synthesis systems, cell extracts obtained by purifying cell lysates as necessary are generally used. Cell extracts generally contain ribosomes necessary for protein synthesis, various factors such as initiation factors, and various enzymes such as tRNA. At the time of protein synthesis, various amino acids, energy sources such as ATP and GTP, creatine phosphate and other substances necessary for protein synthesis are added to the cell extract. Of course, at the time of protein synthesis, separately prepared ribosomes, various factors, and / or various enzymes may be supplemented as necessary.

  Development of a transcription / translation system in which each molecule (factor) necessary for protein synthesis has been reconstructed has also been reported (Shimizu, Y. et al .: Nature Biotech., 19, 751-755, 2001). In this synthesis system, there are 3 types of initiation factors that constitute bacterial protein synthesis system, 3 types of elongation factors, 4 types of factors involved in termination, 20 types of aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and Genes of 31 kinds of factors consisting of methionyl-tRNA formyltransferase are amplified from the E. coli genome, and these are used to reconstitute a protein synthesis system in vitro. In the present invention, such a reconstituted synthetic system may be used.

  The cell-free protein synthesis system has the following advantages. First of all, since there is no need to maintain live cells, the operability is good and the degree of freedom of the system is high. Therefore, it becomes possible to design a synthetic system with various modifications and modifications depending on the nature of the target protein. Second, cell-based synthesis is basically incapable of synthesizing proteins that are toxic to the cells used, but cell-free systems can produce such toxic proteins. Furthermore, high throughput can be easily achieved because many kinds of proteins can be synthesized simultaneously and rapidly. It also has the advantage of easy separation and purification of the protein to be produced, which favors high throughput. In addition, it also has the advantage of being able to synthesize non-naturally occurring proteins, such as by incorporating non-naturally occurring amino acids.

  If a cell-free protein synthesis system is adopted, a series of operations of the preparation method of the present invention can be performed according to SICREX method, and a tagged Fab antibody can be efficiently and rapidly prepared.

  Among the cell-free protein synthesis systems currently widely used are the following. That is, a system of E. coli S30 extract (prokaryotic system), a system of wheat embryo extract (eukaryotic system), and a system of rabbit reticulocyte lysate (eukaryotic system). These systems are also commercially available as kits and can be easily used.

  Historically, the development of a system for E. coli S30 extract has been the oldest, and attempts have been made to synthesize various proteins using this system. The E. coli 30S fraction is prepared through the steps of collecting E. coli, disrupting cells, and purifying. Preparation of E. coli 30S fraction and cell-free transcription-translation coupling reaction are described in Pratt et al. (Pratt, JM: Chapter 7, in "Transcription and Translation: A practical approach", ed. By BD Hames & SJ Higgins, pp. 179-209, IRL Press, New York (1984)) and Ellman et al. (Ellman, J. et al .: Methods Enzymol., 202, 301-336 (1991)) can be used as a reference.

  The wheat germ extract system has the advantage of being able to efficiently synthesize high quality eukaryotic proteins and is often used in synthesizing eukaryotic proteins that are difficult to synthesize in the E. coli S30 extract system Be done. Recently, it has been reported that a highly efficient and stable synthetic system can be constructed by preparing an extract from embryos from which seed endosperm components have been washed out (Madin, K. et al .: Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000). After that, technology development such as mRNA non-translational sequences with high translation promoting ability, protein synthesis method for multi-item functional analysis using PCR, construction of dedicated high expression vector, etc. was performed (Sawasaki, T. et al .: Proc. Natl. Acad. Sci. USA, 99: 14652-14657, 2002), applications to various fields are expected.

  The wheat germ extract can be obtained by grinding and centrifuging the wheat germ and separating the supernatant by gel filtration. The translation reaction can be referred to the method of Anderson et al. (Anderson, CW, et al .: Methods Enzymol., 101, 638-644 (1983)). An improved method is also reported, for example, the method of Kawarazaki et al. (Kawasaki, Y. et al .: Biotechnol. Prog., 16, 517-521 (2000)) or the method of Madin et al. (Madin, K. et al. Proc. Natl. Acad. Sci. USA, 97: 559-564 (2000), etc. can be referred to. In addition, with respect to the system of wheat germ extract, WO 00/68412 A1, WO 01/27260 A1, WO 2002/024939 A1, WO 2005/063979 A1, JP 6-7134 A, JP 2002 529531 A, JP 2005-355513, JP 2006-042601, JP 2007-097438, JP 2008-029203, and the like are referred to.

  The rabbit reticulocyte lysate system is suitable for globulin production. For rabbit reticulocyte lysate, rabbits are intravenously injected with phenylhydrazine for several days to obtain anemia, and blood is collected after a predetermined period of time (for example, on the eighth day), and the hemolyzed solution is then subjected to ultracentrifugation treatment etc. can get. The preparation of rabbit reticulocyte lysate can be carried out with reference to the method of Jackson and Hunt (Jackson, R. J. and Hunt, T .: Methods Enzymol., 96, 50-74 (1983)).

  The cell-free protein synthesis system that can be used in the practice of the present invention is not limited to the above, and for example, extracts of bacteria other than E. coli and plants other than wheat, extracts derived from insects, extracts derived from animal cells It is also possible to use a liquid or a system constructed based on genomic information.

  The generated tagged Fab antibody can be recovered by a conventional method (centrifugation, filtration, affinity chromatography, etc.). If a tag sequence for recovery (for example, a histidine tag) is incorporated into the Hc gene and the Lc gene, it is possible to recover easily and simply using the tag sequence.

  According to the preparation method of the present invention, a Fab antibody having a characteristic structure in which a leucine zipper is added is obtained. Thus, the second aspect of the present invention provides a tagged Fab antibody to which a leucine zipper has been added. In the tagged Fab antibody of the present invention, one of the pair of peptides constituting the leucine zipper (leucine zipper peptide A) is added to the H chain (Hc), and the other (leucine zipper peptide B) is the L chain (Lc) Is attached to. The addition position, structure, and other characteristics of leucine zipper peptides A and B conform to the explanation in the first aspect. The corresponding description in the above first aspect is also used for the use of the linker.

Various modifications can be made to the antibody of the present invention (tagged Fab antibody or Fab antibody from which the tag has been removed). For example, low molecular weight compounds, proteins (eg, enzymes), toxins, labeling substances and the like can be fused or conjugated to add functions or modify properties. Examples of labeling substances include fluorescent dyes such as fluorescein, rhodamine, Texas red, Oregon green, etc., enzymes such as horseradish peroxidase, microperoxidase, alkaline phosphatase, β-D-galactosidase, etc., chemiluminescent or chemiluminescent compounds such as luminol and acridine dye. And radioactive isotopes such as ³ H, ¹³ C, ³² P, ¹³¹ I, ¹²⁵ I, and biotin. On the other hand, when the antibody of the present invention is produced as an antibody of animal species other than human, it may be converted into a humanized antibody, a human chimerized antibody or the like.

  The preparation method of the present invention can be used as a means for obtaining antibodies useful as research tools, diagnostic agents, or drugs. For example, the antibody obtained using the preparation method of the present invention can be applied to various immunological methods (for example, ELISA method) as a reagent for capturing, detecting or measuring a specific target. In addition, it is also possible to prepare an antibody derived from a specific subject (for example, a patient suffering from a specific disease), and use the obtained antibody to perform a diagnosis (e.g. evaluation of a pathological condition or a therapeutic effect). It is possible. On the other hand, an antibody obtained by using the preparation method of the present invention can also be used as a therapeutic antibody. For example, an antibody prepared from immune cells of a person showing resistance to a specific infectious disease may be used as a therapeutic or prophylactic antibody for the infectious disease. In addition, it is preferable to use the antibody from which the tag was removed, when applying to a pharmaceutical.

A. Efficiency of antibody expression using cell-free protein synthesis system Since cell-free protein synthesis system does not use living cells such as various microorganisms and animal cells, complicated operations such as gene transfer and culture are not required, and moreover, It has the advantage of being able to synthesize proteins in just a few hours. In the SICREX method, a Fab antibody is synthesized by cell-free protein synthesis using the obtained antibody gene as a template, and the synthesized Fab antibody is screened by ELISA (FIG. 1). However, there is room for improvement in the expression level of Fab antibody in a cell-free protein synthesis system, and the efficiency of Fab antibody is that the Fab formation efficiency formed by the disulfide bond between Hc and Lc may be low. It is an obstacle to screening. Therefore, LZA and LZB are added to the C-terminal of Hc and Lc constituting the Fab antibody, respectively, and Hc and Lc are paired (hereinafter referred to as "Fab-LZ complex") by the interaction of LZA and LZB, We aimed to improve the efficiency of Fab formation.

1. Method
1-1. Examination of the efficacy in antibody expression using cell-free protein synthesis system of LZA and LZB
1-1-1. Construction of rabbit Fab-LZ fusion protein expression plasmid Plasmid pIDTMSART-KAN carrying an anti-Aβ rabbit IgG Fab antibody gene: Ra_HcLc as a template, RaHc-pRSET-IFC-Fw and RaHc-linker-Rv, The Hc gene and Lc gene were amplified using RaLc-pRSET-IFC-Fw and RaLc-linker-Rv as primers, respectively (25 cycles at 94 ° C 15 seconds, 50 ° C 15 seconds, 68 ° C 30 seconds, Tks Gflex DNA Use polymerase). In addition, LZA gene was amplified using LZA-Fw and LZA-Rv using pLZA as a template (25 cycles of 94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 15 seconds, using Tks Gflex DNA polymerase). Similarly, LZB gene was amplified using LZB-Fw and LZB-Rv using pLZB as a template. The amplified Hc gene and LZA gene, Lc gene and LZB gene were linked by overlapping PCR using RaHc-pRSET-IFC-Fw and LZA-Rv, and RaLc-pRSET-IFC-Fw and LZB-Rv as primers, respectively. (25 cycles of 94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 90 seconds, using Tks Gflex DNA polymerase). Inverse PCR was performed using pRSET-B as a template and pRSET-IFC-Fw and pRSET-IFC-Rv to obtain pRSET linearized vector. The ligated genes were respectively ligated to pRSET linearization vector using In-Fusion-Cloning kit (Clontech) to construct pRSET-Ra-Hc-LZA and pRSET-Ra-Lc-LZB. The constructed vector was transformed into E. coli DH5α strain by heat shock method. The DH5α strain was inoculated on a LB / chloramphenicol plate, colonies were collected, and the plasmid retained by the cells was extracted. Sequence analysis of the extracted plasmid was performed using Big Dye Terminator Ver.3.1 Cycle Sequencing Kit (ABI).

1-1-2. Evaluation of LZ complex formation using sandwich ELISA
50 μl / well of anti-FLAG-tag antibody (Funakoshi) diluted 2000-fold with PBS was aliquoted, incubated overnight at 4 ° C., and immobilized on Nunc immunoplate (Thermo scientific). After washing the plate once with PBS, 400 μl of 4% block ace solution (snow mark) was dispensed and blocking was performed for 45 minutes. Next, the plate is washed twice with PBST, and 50 μl each of rabbit Fab-LZ complex synthesized by cell-free protein synthesis using pRSET-Ra-Hc-LZA and pRSET-Ra-Lc-LZB template as primary antibodies The wells were added and allowed to react at 37 ° C. for 2 hours. After washing the plate three times with PBST, 100 μl each of a 2,000-fold diluted solution of anti-HA-biotin-labeled antibody (Cosmo Bio) as a secondary antibody was added to each well and allowed to react at room temperature for 2 hours. After washing three times with PBST, 100 μl of streptavidin-HRP (GE healthcare) diluted 2000-fold with PBS was added to each well and incubated at room temperature for 2 hours. After washing with PBST three times, 100 μl of OPD substrate solution (2 mg / ml o-phenylenediamine (Wako Pure Chemical Industries, Ltd.), 0.009% H ₂ O ₂ ) was added and reacted at 37 ° C. for 10 to 30 minutes. After stopping the reaction by adding 50 μl of 2M H ₂ SO ₄ , the absorbance at 492 nm was measured. The measurement was performed using a microplate reader (SPECTRA MAX 250 (Wako)).

1-1-3. Evaluation of Fab formation efficiency using Western blot
Rabbit Fab-LZ complex is synthesized under the same conditions as 1-1-2. The reaction solution is separated by non-reducing SDS-PAGE, and the separated protein is transferred to a nitrocellulose membrane (Advantec) as a Trans-blot SD cell ( It was transcribed using Bio-Rad). The transferred membrane was blocked overnight with 4% block ace solution (snow mark). After washing with PBST, the target protein was labeled with the anti-HA-tag antibody and Streptavidin-HRP used in 1-1-2., And detection was performed with ECL chromogenic reagent (Amersham) and light capture.

1-1-4. Template DNA Construction for Expression of Anti-O157 Mouse Fab-LZ Complex With the plasmid encoding the anti-O157 mouse antibody gene as a template, using the primers shown in FIGS. Four types of anti-O157 mouse Fab antibodies, No. 16 IgM, No. 16 IgG, and No. 23, were amplified.

  Sequences necessary for transcription and translation reactions during cell-free protein synthesis, T7P fragment, T7T-LZA fragment (added to Hc gene), and T7T-LZB fragment (added to Lc gene) are added to the amplified antibody gene below. It added in the procedure shown. The T7P and T7T sequences were amplified by PCR using pRSET-LZA and pRSET-LZB as templates (at 94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 30 seconds for 25 cycles, using Tks Gflex DNA polymerase). The T7P fragment was amplified using pRSETb as a template and primers pRSET-T7PFOL-F and pRSET-T7PR. The T7T-LZA fragment and T7T-LZB fragment were amplified using the primers pRSET-T7TF-OL-R and LZAFw, and pRSET-T7TF-OL-R and LZBFw, respectively. Subsequently, T7P fragment and T7T-LZA fragment or T7T-LZB fragment are added to the antibody gene by overlapping PCR (T7T-LZA fragment added to Hc gene and T7T-LZB fragment added to Lc gene), primer OL-F And OL-R (at 94 ° C. for 15 seconds, 50 ° C. for 15 seconds, 68 ° C. for 15 seconds for 25 cycles, using Tks Gflex DNA polymerase).

1-1-5. Expression and activity evaluation of anti-O157 mouse Fab-LZ complex
Cell-free protein synthesis was performed using the DNA for expression of anti-O157 mouse Fab-LZ complex constructed in 1-1-4 as a template. For cell-free protein synthesis, E. coli A19-derived S30 extract and E. coli BL21 Star (DE3) -derived S30 extract were used (FIG. 4). Also, ELISA was performed to evaluate the binding activity to the antigen. As the antigen, O-157 (50 μg / ml) diluted with PBS was used.

1-1-6. Construction of template DNA for expression of anti-Listeria rabbit Fab-LZ complex T7P fragment, T7T-LZA fragment or T7T- in the same manner as in 1-1-4. The LZB fragment was added. The primers used are shown in FIGS.

1-1-7. Expression and activity evaluation of anti-Listeria rabbit Fab-LZ complex
Cell-free protein synthesis was performed using the DNA for expression of anti-O157 mouse Fab-LZ complex constructed in 1-1-6 as a template. The reaction conditions are the same as in 1-1-5. Also, ELISA was performed to evaluate the binding activity to the antigen. As the antigen, Listeria (50 μg / ml) diluted with PBS was used. Moreover, Anti-rabbit IgG (H + L) -poly HRP conjugated (Cosmo Bio) was used as a secondary antibody.

2. Result and consideration
2-1. Examination of the efficacy in antibody expression of LZA and LZB A part of mouse antibody Fab such as catalytic antibody 6D9 shows high Fab formation efficiency when it is synthesized by E. coli cell-free protein synthesis system, but not necessarily all The formation efficiency of mouse antibody Fab is not necessarily high. Also, no examples have been reported where active rabbit antibody Fab was expressed in a cell-free protein synthesis system. Therefore, by adding positively and negatively charged leucine zippers LZA and LZB to the C-terminal of Hc and Lc, respectively (FIG. 5), a heterodimer is formed by the interaction between LZA and LZB, and the Fab formation efficiency is increased. I hoped to be improved. In this section, the effect of LZA and LZB on the formation efficiency of rabbit Fab and the synthetic amount of rabbit and mouse active Fab was evaluated.

2-1-1. Evaluation of LZ complex formation using sandwich ELISA
HA tag and FLAG tag were added to C-terminal of LZA and LZB, respectively, and formation of rabbit IgG Fab-LZ complex was evaluated using sandwich ELISA. When signals were compared with those in which HA tag and FLAG tag were added to Hc of rabbit IgG Fab and C terminus of Lc, respectively, the rabbit IgG Fab-LZ complex showed higher signal (FIG. 6). Thus, it was suggested that a rabbit IgG Fab-LZ complex was formed.

2-1-2. Evaluation of Fab formation efficiency using Western blot Rabbit IgG Fab has a remarkably low Fab formation efficiency due to the low bonding efficiency of disulfide bond between Hc and Lc. Therefore, it was examined whether a disulfide bond between Hc and Lc was formed in the rabbit IgG Fab-LZ complex. First, a rabbit IgG Fab-LZ complex was synthesized by a cell-free protein synthesis system, and cell-free protein synthesis products were analyzed by non-reducing SDS-PAGE and Western blot (FIG. 7). In rabbit IgG Fab, no disulfide bond was detected between Hc and Lc, but in rabbit IgG Fab-LZ complex, disulfide bond between Hc and Lc was detected. This is because the formation of heterodimers of LZA and LZB keeps Hc and Lc positioned close to each other, thus making the environment in which the disulfide bond between Hc and Lc is more likely to be formed. It is thought that.

2-1-3. Evaluation of expression and activity of anti-O157 mouse Fab-LZ complex As described above, even in the mouse Fab synthesized using a cell-free protein synthesis system, the Fab formation efficiency is low, so The amount of synthesis may be low. Therefore, anti-O157 mouse Fab-LZ complex and anti-mouse Fab were synthesized using a cell-free protein synthesis system, and the expression amount and activity were compared using SDS-PAGE and ELISA. Fab formation was observed in the No. 6 IgM Fab and No. 6 IgM Fab-LZ complex (FIG. 8). In addition, although the amount of expression of No. 6 Fab-LZ complex was lower than No. 6 Fab, ELISA showed a high signal (FIG. 9). From this, it is considered that expression as a Fab-LZ complex improved the efficiency of Fab formation and increased the synthesis amount of active Fab. On the other hand, with regard to No. 16 IgM, No. 16 IgG, and No. 23 IgM, neither Fab nor Fab-LZ complex retained binding activity to the antigen. Also, none of these showed Fab formation.

2-1-4. Expression and activity evaluation of anti-Listeria rabbit Fab-LZ complex The rabbit Fab is also expressed as a Fab-LZ complex in the same manner as the mouse Fab, and it is examined whether the synthesis amount of active Fab is increased The The results of ELISA and SDS-PAGE are shown in FIG. 10 and FIG. 11, respectively. In SDS-PAGE analysis, almost no disulfide bond between Hc and Lc was observed in any of the Fab and Fab-LZ complexes, but in ELISA, Fab-LZ showed higher signal in all clones . From this result, it is considered that, by introducing LZ, the rabbit Fab could be heterodimerized regardless of the formation of the disulfide bond between Hc and Lc, and could retain the binding activity to the antigen.

3. Summary By expressing mouse Fab and rabbit Fab as a Fab-LZ complex, we succeeded in improving the efficiency of Fab formation and increasing the synthesis amount of active Fab.

B. Preparation of Rabbit Peripheral Blood-Derived Fab-LZ Complex The variation of the antigen determination site of the rabbit antibody is more abundant than in mice, and immunization and blood collection of rabbits are much easier than in humans and mice. In order to establish the SICREX method using rabbit peripheral blood, the following study was conducted. It should be noted that, by establishing a system targeting rabbit as a target animal, it becomes possible to obtain an antibody gene having high binding activity, and it is considered that experiments etc. can be advanced more efficiently.

1. Method
1-1. Immunization of rabbits
A dead cell of Listeria monocytogenes (hereinafter referred to as L. monocytogenes) was used as an antigen to immunize a rabbit (NZW). A total of 1.5 ml of complete adjuvant was added to 1 ml of a solution of L. monocytegenes (5 × 10 ⁸ CFU) / PBS per animal and sonicated, and then the whole was injected by subcutaneous injection. Two weeks later, 1.5 ml of incomplete adjuvant was added to 1 ml of an antigen 5 × 10 ⁸ CFU / PBS solution, and after sonication, the whole was subcutaneously injected. After another 10 days, 2.5 ml of a 5 × 10 ⁸ CFU / PBS solution of antigen was injected subcutaneously. The above experiments were conducted in accordance with the handling rules for animal experiments at Nagoya University.

  L. monocytogenes is a gram-positive bacillus which widely inhabits humans and animals, and is known as a causative agent causing listeriosis as a zoonotic disease. Listeriosis may progress to encephalomyelitis and sepsis in infants, the elderly, immunocompromised persons, and people with underlying diseases, and it has been reported that mortality is high. In addition, many cases of infection that use food as a route of infection have been reported, so they are regarded as important in food hygiene surveillance. Although inspection of L. monocytogenes from food is generally performed by a culture method, it takes one week for the inspection, and immunochromatographic kits etc. that can quickly confirm the presence or absence of L. monocytogenes simply by flowing the sample are available. It is beginning to be used. Therefore, since the demand for anti-L. Monocytogenes antibodies in the food industry is expected to increase in the future, it is possible to establish a method for producing anti-L. Monocytogenes antibodies with higher affinity at lower cost and faster. It will bring great benefits in ensuring food safety in companies.

1-2. Isolation of Lymphocytes from Rabbit Peripheral Blood Blood was collected from an ear vein from an individual for whom an increase in antibody titer had been confirmed, in accordance with the handling regulations for animal experiments and the like at Nagoya University. The resulting 16 ml blood sample was divided into 4 ml aliquots and suspended by adding 2 ml PBS. After that, 4.5 ml of Pancoll (Funakoshi Co., Ltd.) was placed in a new sample tube, and a suspended blood sample was added thereon to load it. The sample tube was centrifuged (400 × g, 40 minutes, RT). The sample after centrifugation was separated into several layers, but the top layer was a plasma layer (serum layer) of blood, which was collected for antibody titer measurement and stored at 4 ° C. Then, 8 ml of a collection of B cells in the lower layer was collected in a new sample tube. Three volumes of PBS were added to the collected B cell solution, centrifuged at 400 g for 10 minutes, the supernatant was discarded, and resuspended in 1 ml PBS. This was used as a lymph cell solution.

1-3. Removal of Nonspecific Binding Lymphocytes In order to remove lymphocytes that bind nonspecifically to magnetic beads, nonspecific binding lymphoid cells were removed using magnetic beads. In addition, the magnetic beads are NH beads Sepa-Max (registered trademark), which are magnetic beads to which a goat polyclonal antibody against E. coli O157 is bound. O157 (hereinafter, NH beads) (Cosmo Bio Inc.) or DynaBeads M-280 Streptavidin (hereinafter, SA beads) (Invitogen) in which streptavidin is bound to the surface of magnetic beads was used. 1-2. 1 ml of the prepared lymph cell solution and 5 μl of NH beads or SA beads were mixed and allowed to stand at room temperature for 2 minutes, and then set on a magnetic stand to collect the supernatant, which was used for the subsequent experiments .

1-4. Enrichment of antibody-presenting B cells (IgM-presenting B cells) Enrichment of cells that present on the cell surface antibodies that specifically bind to an antigen was performed. After complexes of antigen and magnetic beads were formed, antigen-specific IgM-displaying B cells were isolated by collecting B cells bound to the antigen-bead complexes using a magnetic stand. SA beads were used for magnetic beads, and live cells of L. monocytogenes were used for antigens.

Preparation of bacterial solution L. monocytogenes used as an antigen was shake-cultured for 15 hours each on Brain Heart Infusion (Bacto). The culture was centrifuged at 3,000 rpm for 10 minutes to remove the supernatant, and PBS was added to wash. After repeating the same operation, it was suspended in 100 μl of PBS and used for the following operation.

1-4 (b). Antigen L. monocytogenes Biotinylation Antigen L. monocytogenes 50 μl (2.0 × 10 ⁹ ) and 100 mM biotin 1 μl (final concentration 1 mM) are mixed, 50 mM MES buffer (pH = 5.0) is added and 100 μl is added. The mixture was stirred at room temperature for 15 minutes (about 7 to 8 revolutions per minute) using a rotary disc (Microtube rotator MTR-103 (As One Corporation)). Further, 3 mg of EDC was added and stirred at room temperature for 2 hours using a rotary disc. Then, it was centrifuged (3000 rpm, 5 minutes, RT), the supernatant was discarded, and the precipitate was suspended in 100 μl of PBS. This was used as a biotinylated antigen solution.

1-4 (c). Complex formation of biotinylated antigen and SA beads 100 μl of biotinylated antigen solution and 100 μl of SA beads (6 × 10 ⁷ beads) were mixed, and stirred at room temperature for 1 hour using a rotating disk. Washing with 200 μl of PBS solution was performed and suspended in 100 μl of PBS solution. The solution containing the complex of antigen and beads was set on a magnetic stand, allowed to stand on ice for 10 minutes, the supernatant was removed, and the beads were washed with 100 μl of PBS solution. The sample was again set on a magnetic stand, allowed to stand on ice for 5 minutes, the supernatant was removed, and suspended in 100 μl of PBS. Common staining was used to confirm that antigen-bead complexes were formed.

1-4 (d). Isolation of antigen specific antibody presenting B cells (IgM presenting B cells)
100 μl of a solution containing the complex of antigen and beads obtained in 1-4 (c) and 100 μl of a solution containing B cells were mixed, and stirred at room temperature for 1 hour using a rotating disk. The sample was set on a magnetic stand, allowed to stand on ice for 10 minutes, the supernatant was removed, and washed with 200 μl of PBS solution. It was again set on a magnetic stand, allowed to stand on ice for 5 minutes, the supernatant was removed, and suspended in 200 μl of PBS. The cell concentration of the solution containing the cells was measured using a Bürker-Turk hemocytometer (Nippon Clinical Instruments Industry Co., Ltd.) and a microscope (OLYMPUS M021).

1-5. Isolation of one cell using a micromanipulator
Antigen-specific IgM-displaying B cells were isolated one by one from the lymph cell solution obtained in 1-4 (d) under a microscope using a micromanipulator. Lymphocyte solution was diluted with PBS to 1.0 × 10 ⁴ cells / ml, and 100 μl was added to a petri dish. Confirm bead-antigen-B cell complex with a microscope, isolate by aspirating cells using Pasteur filled with 2.5 μl of PBS at the tip, DEPC water (Invitrogen) and RNase OUT (Invitrogen) The tip of Pasteur was folded into a microtube contained to collect the cells.

1-6. Redesign of Primers In order to further streamline the SICREX method using rabbit peripheral blood, primers that associate with rabbit antibody genetic sequences were redesigned. These primers collect sequence data from the “Sequences of Proteins of Immunological Interest” (Kabat et al., 1991) and the database of IMGT, rearrange and compare all sequences using Multalin, and compare antibody sequences. We designed a primer that can be covered.

1-7. Amplification of antibody gene by single cell reverse transcription PCR and two-step PCR The sequences of the primers used are shown in FIGS. PCR was used Veriti ^TM (Applied Biosystem, USA) or C1000TM Thermal Cycler (Bio-Rad) . Preparation of cDNA was performed according to the protocol of the product using SUPERSCRIPT III First-Strand Synthesis System for RT-PCR (Invitrogen, USA) (90 minutes at 47 ° C., 15 minutes at 70 ° C., left at 4 ° C.). At that time, in order to confirm the presence or absence of contamination, a well containing no cells was used as a control. Next, in order to separately amplify the H chain and L chain genes, two-step PCR was performed using the synthesized cDNA as a template. After 1 ^st PCR in LA Taq HS ^TM DNA polymerase (Takara Bio Inc.) was used (94 ° C. 3 min, 94 ° C. 30 seconds, 55 ° C. 45 seconds, 25 cycles at 72 ° C. 45 seconds, 72 ° C. 7 minutes Leave at 4 ° C). Subsequently, 2 ^nd PCR was performed using Tks Gflex DNA polymerase (Takara Bio Inc.) using the 1 ^st PCR product as a template (after 1 minute at 94 ° C., 98 ° C. for 10 seconds, 50 ° C. for 15 seconds, 68) 25 cycles in 30 seconds, 68 ° C for 7 minutes, left at 4 ° C). In addition, all the above-mentioned PCR operation was performed using a 96 well plate.

1-8. Sequence analysis
To perform the TA cloning, by PCR using LA Taq ^TM DNA polymerase (Takara Bio Inc.) was added to A at the end of the sequence of 2 ^nd PCR product. Subsequently, TA cloning was performed on the PCR product using pGEM-T easy vector and DNA Ligation Kit (Mighty Mix) (Takara Bio Inc.). Transform E. coli DH5α competent cells by the heat shock method, and apply 50 μl / ml of final concentration of ampicillin, 40 μl / ml of IPTG, 4% X-gal aseptically onto an LB plate, and keep at 37 ° C for 15 hours Cultured. The resulting white colonies were collected with a toothpick, suspended in 20 μl of NaOH and subjected to alkaline lysis, and PCR was performed using 1 μl of the suspension as a template (94 ° C. for 5 minutes, 94 ° C. for 10 seconds, 50 ° C. for 20 seconds) , 72 ° C. for 1 minute and 30 seconds for 25 cycles, 72 ° C. for 7 minutes, leaving at 4 ° C.). The primers shown in FIG. 16 were used in this PCR. The solution after PCR was purified by Fast Gene gel / PCR extraction kit (Fast Gene). Among them, 1 μl was used as a template and sequencing reaction was performed according to the protocol attached to the kit, using Big Dye Terminator Ver.3.1 Cycle Sequencing Kit (Applied Biosystems). After the reaction, ethanol precipitation was performed to recover DNA. To the recovered DNA, 15 μl of Hi-Di Formamide (Applied Biosystems) was added, and sequence analysis was performed with ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) at Nagoya University Genetic Experiment Facility.

1-9. DNA construction for Fab expression
To the antibody gene obtained in 1-7, T7P and T7T, which are sequences necessary for transcription and translation reaction in cell-free protein synthesis, were added in the following procedure. The T7P and T7T sequences were amplified by PCR using pRSET-B vector (Invitrogen) as a template (25 cycles of 94 ° C for 5 minutes, 96 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 30 seconds, 72 ° C for 7 minutes, left at 4 ° C). The T7P sequence was amplified using primers pRSET-T7PF and pRSET-T7PR. The T7T sequence was amplified using primers pRSET-T7TF-OL-R and pRSET-T7TR. Subsequently, a gene fragment containing a promoter and a terminator was amplified using In-F and In-R by overlapping PCR (after 1 minute at 94 ° C., 98 ° C. for 10 seconds, 50 ° C. for 15 seconds, 68 ° C. for 45 seconds 25 cycles, 68 ° C for 7 minutes, left at 4 ° C). The primers used for these PCRs are shown in FIG.

1-10. Synthesis of antibody molecule in cell-free protein synthesis system The cell-free protein synthesis reaction was previously developed by Jiang et al. (Jiang, XP, Y. Ookubo, I. Fujii, H. Nakano, and T. Yamane) , 2002, Expression of Fab fragment of catalytic antibody 6D9 in an Escherichia coli in vitro coupled transcription / translation system: Febs Letters, v. 514, p. 290-294. Using the overlap PCR product as a template, the cell-free protein synthesis reaction solution shown in FIG. 4 was added and reacted at 30 ° C. for 1 hour. At this time, a cell-free protein synthesis reaction solution containing no template was incubated as a control. After the reaction, the cell-free protein synthesis reaction solution was transferred to ice to stop the reaction.

1-11. Enzyme-linked immunosorbent assay (ELISA)
First, 50 μl of L. monocytogenes dead cell solution diluted to 10 μg / ml with PBS was aliquoted, and the antigen was fixed to the plate by incubating overnight at 4 ° C. After washing the plate once with PBS, 400 μl of 4% skimmed milk solution was dispensed for blocking for 45 minutes. Next, the plate was washed twice with PBST, and 50 μl each of antibody molecules prepared in 1-10 (solution obtained by diluting the cell-free reaction solution with PBS) were added to the wells and reacted at 37 ° C. for 2 hours. After washing the plate three times with PBST, 100 μl of a 2,000-fold diluted solution of the secondary antibody Anti-rabbit IgM + IgG (H + L) -poly HRP conjugate (Funakoshi Co., Ltd.) is added to wells and reacted for 2 hours at room temperature I did. After washing with PBST three times, 100 μl of OPD substrate solution (2 mg / ml o-phenylenediamine (Wako Pure Chemical Industries, Ltd.), 0.009% H ₂ O ₂ ) was added and reacted at 37 ° C. for 10 to 30 minutes. After stopping the reaction by adding 50 μl of 2 MH ₂ SO ₄ , the absorbance at 492 nm was measured. The measurement was performed using a microplate reader (SPECTRA MAX 250 (Wako)).

1-12. DNA construction for anti-L. Monocytogenes rabbit Fab-LZ complex expression
The DNA construction for expressing the antibody gene obtained in 1-7 as a Fab-LZ complex was carried out according to the following procedure (FIG. 18). The primer raV-Lc-1F was amplified with a primer that specifically binds to the C-terminus of the constant region of H chain and L chain (after 94 ° C. for 1 minute, 98 ° C. for 10 seconds, 55 ° C. for 15 seconds, 68 ° C. for 30 seconds For 25 cycles, 68 ° C for 7 minutes, 4 ° C). The primers used for these PCRs are shown in FIG. After T7P and LZ-T7T are added by overlapping PCR in the same manner as described in 1-1-4. Using the amplified gene fragment as a template (T7T-LZA fragment in Hc gene, T7T-LZB in Lc gene) The fragment was added) and expressed by cell-free protein synthesis system.

2. Result and consideration
2-1. Examination of concentration of antibody-displayed B cells (IgM-displayed B cells) using magnetic beads
A complex of SA beads and L. monocytogenes and a magnetic stand were used to concentrate cells presenting antibody specific for the antigen. As a result, about 10,000 cells were obtained. In addition, when observed with a microscope, it was possible to observe that SA beads and B cells were bound via the antigen L. monocytogenes. Since this concentration selects for the complex of the antigen L. monocytogenes and magnetic beads, in principle, cells presenting an antibody that recognizes L. monocytogenes are specifically selected. In addition, since the operation for removing non-specifically binding B cells to magnetic beads was performed in advance, it was judged that cells presenting antibody specific to the antigen could be concentrated using this method. A total of 13 cells were isolated one by one using a micromanipulator while confirming the magnetic bead-antigen-B cell complex under a microscope while concentrating the concentrated B cell solution. One cell RT-PCR was performed using the isolated 13 cells as a template for RT-PCR.

2-2. Amplification of single cell-derived antibody gene by RT-PCR and two-step PCR
Amplification of a single cell-derived antibody gene was attempted using the antigen-specific antibody-displayed B cells isolated in 1-5. The antibody gene was amplified by reverse transcription reaction and 2-step PCR using 13 cells isolated by a micromanipulator, and electrophoresis was performed (FIG. 20). As a result, in the L chain, a band was observed around 700 bp in 6 of 13 cells. From this, it was suggested that the designed primer could not completely cover the antibody gene sequence of the rabbit L chain in the case of the L chain. Therefore, it is considered necessary to further improve primer design, PCR conditions and the like for gene amplification of L chain. On the other hand, in the H chain, amplification of the antibody gene of IgM type was confirmed in about 700 bp in all cells. From this, it was suggested that the designed primers could cover antibody gene sequences of IgM type. In addition, it was possible to confirm gene amplification in 2 cells in all cells of the IgG type H chain. Although No. 16 was used as a negative control without cells as a template, antibody gene amplification in that well could not be confirmed. This suggests that the possibility of contamination is low. Sequence analysis of six pairs (IgM: No. 1, No. 6, No. 9, No. 12 and IgG No. 4, No. 9) whose amplification could be confirmed in H chain, L chain and both genes (experiment Method: 1-8.).

2-3. Sequence analysis
Sequence analysis was performed on six pairs (IgM: No. 1, No. 6, No. 9, No. 12 and IgG No. 4, No. 9) whose amplification could be confirmed in the H chain, L chain, and both genes. . The obtained base sequence was searched for a similar base sequence using a data bank of BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and as a result, No. 1, No. 6, No. .9 and No. 12 were confirmed to be IgM type antibody genes, and No. 4, No and 9 were confirmed to be IgG type antibody genes. At this time, cells used as templates for RT-PCR were considered to be antibody-displayed B cells, but IgG type antibody genes could also be amplified. As the reason, it is considered that the memory cell-derived antibody gene is amplified because the memory cell presenting the IgG type antibody is also present in the concentrated lymphoid cell solution.

2-4. Expression of rabbit Fab using cell-free protein synthesis system and measurement of its activity
Of the antibody genes of H chain and L chain obtained by RT-PCR and two-step PCR carried out under the condition of 1 cell / well, wells No. 1 in which genes were amplified and sequenced in both H chain and L chain. Overlap PCR was performed using six pairs of No. 1, No. 4, No. 6, No. 9M, No. 9G, and No. 12 as a template to add promoter and terminator sequences necessary for a cell-free protein synthesis system. When ELISA was performed using the overlapping PCR product as a template to confirm the binding ability of Fab synthesized by the cell-free protein synthesis system to L. monocytogenes, no significant binding activity could be confirmed in any sample The It was thought that the low efficiency of Fab formation by the disulfide bond between the H chain and the L chain as this cause may affect the binding activity. Therefore, analysis of Fab expression by SDS-PAGE was performed.

2-5. Expression analysis of rabbit Fab by SDS-PAGE Overlap of antibody genes of obtained 6 pairs (wells No. 1, No. 4, No. 6, No. 9M, No. 9G, No. 12) Using the PCR product as a template, the antibody was expressed in a cell-free protein synthesis system, and SDS-PAGE using fluorescent lysine was performed to determine the presence or absence of Fab expression. Although expression of the antibody was confirmed in both the H chain and L chain, no formation of Fab was observed. As a factor of this result, the intramolecular and intermolecular H chain L chain disulfide bonds are complex in the positional relationship of cysteines, so the efficiency of Fab formation by disulfide bond in expression using a cell-free protein synthesis system Was considered low. Since the binding activity can be measured because the disulfide bond is not formed, the cell-free protein is a single chain antibody (scFv) in which the variable regions of H chain and L chain but not Fab are linked via a polylinker. It was expressed using a synthetic system, and it was decided to examine its binding activity.

2-6. Examination of effectiveness based on expression and activity measurement of rabbit Fab-LZ complex Leucine zipper (hereinafter, LZ) is known to have a function to form a protein dimer. By its function, it was hypothesized that the association of H chain and L chain by LZ would contribute to the formation efficiency of disulfide bond. The following experiments were conducted to examine its effectiveness. First, H chain and L of antibody genes of No. 9M and No. 9G in addition to wells No. 1 and No. 4 whose binding activity could be confirmed when expressed as single chain antibody (scFv) The sequences of promoter, terminator, and LZ necessary for the cell-free protein synthesis system were added to the strands using overlap PCR. When ELISA was performed to confirm the ability of Fab and Fab-LZ complexes synthesized by the cell-free protein synthesis system to bind to L. monocytogenes, all Fab-LZ complex samples bound approximately five times as much as Fab It was confirmed to have activity. In order to confirm whether this increase in binding activity was due to an increase in the efficiency of Fab formation due to LZ α-helix adhesion, expression of Fab-LZ complex was analyzed by SDS-PAGE using fluorescent lysine . A representative example (clone No. 4) of the nucleotide sequence encoding the Fab-LZ complex is shown in FIG.

2-7. Expression analysis of rabbit Fab-LZ complex complex by SDS-PAGE Express Fab-LZ complex in cell-free protein synthesis system, conduct SDS-PAGE with fluorescent lysine, and validate LZ It was investigated. As a result of non-reducing SDS-PAGE (FIG. 22) and reducing SDS-PAGE (FIG. 23), although both the H chain and the L chain could be confirmed to be expressed, the formation of Fab was not seen. From this, it was found that the association of H chain and L chain by LZ does not contribute to the increase in formation efficiency of disulfide bond. However, even if the formation of the disulfide bond is insufficient, if the H-chain and L-chain are adjacent due to the adhesion of α-helix between LZ, the binding activity is increased by forming the original conformation. It is thought that there is. From this, it was suggested that the fusion of LZ to the C-terminus of Fab contributes to the increase in the binding activity of Fab.

3. Summary The use of a microscope and a micromanipulator has made it possible to isolate cell-by-cell from concentrated antibody-displayed B cells. In addition, by expressing it as a Fab-LZ complex, it was possible to confirm the binding activity that could not be measured with Fab.

C. Recombinant expression by E. coli
In order to examine whether the interaction of LZA and LZB works effectively also in in vivo antibody preparation, Fab of mouse anti-E. Coli O157 antibody No. 6 (similar to the experiment of 1-1-4.) And Fab-LZ was expressed by E. coli Shuffle T7 express E. coli (New England Biorabs) for protein expression and evaluated by ELISA.

1. Construction of Expression Plasmid The expression plasmid was constructed as follows. First, in the construction of a Fab expression vector, Fab regions of Hc and Lc of anti-O 157 antibody No. 6 are respectively primer 1F (TTAAGAAGGAGAttatacatATGGAGGTCCAGCTGCAACAGTC (SEQ ID NO: 125)) and 17R (TCCTTC ATTATTAGACGTAATCTGGAACATCGTATGGGTACATGGTACGCCTGGAATG) TAATAATCTAGAAGGAGATATCATATGGATGTTTTGATGACCCAAAC (SEQ ID NO: 127) and 18R (CATCGTCGTCCTTGTAGTCGGAACCGCCACACTCTTCTCTGTTGAAGCTC (SEQ ID NO: 128)) amplified (set at 30 seconds at 94 ° C., 30 seconds at 55 ° C., 25 cycles at 72 ° C. for 2 minutes, KOD plus) Similarly, pET22b vector (Novagen) was amplified with a set of primers pET22b-F (ccGACTACAGGACGACGATGACAAATAATAAGATCCGGCTGCTAACAAAAGC (SEQ ID NO: 129)) and pET22b-R (CATATGTATATCTCCTCTCTTAA (SEQ ID NO: 130)) (94 ° C. for 30 seconds, 55 ° C. for 30 seconds) Second cycle at 72 ° C for 4 minutes, using KOD plus). These were treated with a restriction enzyme DpnI (Takara Bio), then purified using a DNA purification kit FastGene Gel / PCR Extraction Kit (Nippon Genetics), and ligated using a Gibson Assembly system (New England Biorabs). Thus, DH5alpha heat shock competent cells were transformed and applied to LB agar medium containing 50 μg / mL of ampicillin to obtain colonies having the desired plasmid.

  In the construction of the Fab-LZ expression vector, a set of primers 1F and 19R (AGCTGGGCGCTCCCACCACCGCCTGGAATGGGCACATGCAGATCTTTG (SEQ ID NO: 131)) and Fabs of anti-O157 antibody No. 6 Hc and Lc, respectively, and 2F and 20R (the same). Amplified with a set of CTGGGCGCTCCCACCACCGCCACACTCTTTCCTGTTGAAGCTC (SEQ ID NO: 132) (94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 2 minutes, 25 cycles, using KOD plus). In PCR for amplifying LZA and LZB regions using pRSET-LZA and pRSET-LZB as a template, primer sets 15F (GGCGGTGGTGGGAGGCGCCCAGCTGAAAAGAG (SEQ ID NO: 133)) and 16R (TGATATCTCCTTCTAGATTATTAGCGTAATCTGGAACATCC (SEQ ID NO: 134)) and 8F (GGGGGTGGTGG ) And r9R (ATCGTCGTCCTTTGTAGTCGGAACCGCCCTCTTGGGCAGCCTTCTTCTC (SEQ ID NO: 136)) (94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 20 seconds for 25 cycles, using KOD plus)). Amplified Hc and LZA were ligated by overlapping PCR, and Lc and LZB were similarly ligated (94 cycles 30 seconds, 55 cycles 30 seconds, 72 cycles 1 minute for 25 cycles, using KOD plus). The overlapping PCR product and linear pET22b amplified with the same set of pET22b-F and pET22b-R as described above were ligated by the Gibson Assembly system to obtain the desired plasmid.

  Shuffle T7 express E. coli was transformed by the heat shock method with the Fab expression vector (hereinafter, pET22b-m6 Fab) and Fab-LZ expression vector (hereinafter, pET22b-m6 Fab-LZ) obtained by the above method. In addition, what was similarly transduced in pET22b was used hereafter as a negative control.

2. Antibody Expression Experiment The transformant was inoculated into 3 mL of LB medium (hereinafter, LBA medium) containing 50 μg / mL of ampicillin, and shake culture was carried out at 37 ° C. overnight. Among them, 100 μL was inoculated into 20 mL of LBA medium, and shake culture was performed at 30 ° C. until OD 600 = 0.5. To this was aseptically added 1 M IPTG to a final concentration of 1 mM and ice-cooled, and then cultured with shaking at 16 ° C. for 24 hours. The cells were collected by centrifugation at 8000 G for 10 minutes, suspended in PBS, and centrifuged again to remove the medium components. Several tens of mg of 1.5 mL PBS and 0.1 mm diameter zirconia beads were added to the cells, transferred to a 2 mL tube, and the cells were disrupted by ice crusher (Tomy SEIKO Micro Smash, MS-100R) (5000 rpm, repeat 30 seconds 5 times). This was centrifuged at 13000 rpm for 5 minutes, and the supernatant was used as a cell-disrupted soluble fraction. Each portion was stored at 4 ° C. and used for the subsequent experiments.

3. ELISA
Except for the following changes, the method described in 1-1-5. Was followed. First, a suspension of E. coli O157 (GTC 03904, obtained from National BioResource Project) suspended in PBS in a Nunc polysoap 96 well plate so as to have an OD600 of 0.1 or 0.4% BSA (in PBS) 50 μL of the solution was added dropwise, and each was coated by standing overnight at 4 ° C. As a primary antibody, the above-described cell disruption soluble fraction was used, and as a secondary antibody, HRP-labeled anti-mouse Fab antibody (BETA90-100P) was used. In addition, 0.4% BSA was used as a blocking agent. In the detection reaction, 50 μL of BM Blue POD substrate soluble (Roche) was added, reacted at room temperature for 10 minutes, and then the reaction was stopped by adding 50 μL of 1 M sulfuric acid solution. The absorbance at 450 nm was measured by a plate reader (Tecan, M200). By this method, antibody activity per E. coli culture solution can be known.

  As a result, as shown in FIG. 24, Fab-LZ exhibited a signal about 7.5 times higher than Fab when O157 was used as the antigen. From this, it was found that Fab-LZ was produced in an active state also in vivo, and showed a significantly higher signal as compared with Fab as in the case of preparation with a cell-free protein synthesis system. From the above, it was shown that the addition of LZ is effective not only in vitro (cell-free system) but also in vitro.

D. Comparative Experiment As comparative controls, those obtained by adding LZA and LZB to the variable regions (V regions) of Hc and Lc were recombinantly produced by E. coli in the same manner as described above, and evaluated by ELISA. First, the Hc and V regions were amplified with a set of primers 1F and 21R (CTGGGCGCTCCCCACCACCGCCGTAAAGCAACCAGTCCTCGTC (SEQ ID NO: 137)) and a set of 2F and 12R (GCTCCCACCACCGCCAGCATCAGCCCGTTTCAGCTCC (SEQ ID NO: 138)). This is ligated with the LZA and LZB fragments respectively by overlapping PCR in the same manner as when producing the Fab-LZ expression plasmid, and finally, the fragments of VH-LZA, VL-LZB and the linear pET22b by the Gibson Assembly system They were ligated (the constructed plasmid is hereinafter referred to as pET22b-m6V-LZ). Although the expression conditions and the ELISA conditions were the same as described above, PBS alone was also used as a negative control for the primary antibody, in addition to the soluble fraction of the pET22b transformant. In addition to HRP-labeled anti-mouse Fab antibody, an antibody against FLAG tag (HRP-labeled anti-FLAG tag antibody: GTX 77454, GeneTex) was used as a secondary antibody. A Flag tag sequence is added to the C-terminal side of Lc in all expression plasmids of m6 Fab, m6 Fab-LZ and m6 V-LZ.

  The results of the ELISA are shown in FIG. A is an HRP-labeled anti-mouse Fab antibody as a secondary antibody, and B is an HRP-labeled anti-FLAG tag antibody as a secondary antibody. The signal of m6Fab-LZ was found to be the highest when compared to the negative control, m6Fab, and m6V-LZ. m6V-LZ did not differ from the negative control and was considered to be nonfunctional as an antibody. From this, even when LZ is added to the V region, the effect of LZ may not be obtained, and the effectiveness of adding LZ to the end of the Fab is supported.

  According to the preparation method of the present invention, active Fab antibodies can be efficiently prepared. In particular, when a cell-free protein synthesis system is used as an expression system, the manipulation can be simplified and speeded up, and Fab antibodies can be prepared in a short time. The antibodies obtained by the preparation method of the present invention are expected to be used in various applications such as research tools, diagnostic agents, and medicines.

  The present invention is not limited to the description of the embodiments and examples of the above-mentioned invention. Various modifications are also included in the present invention as long as those skilled in the art can easily conceive of the claims without departing from the scope of the claims. The contents of articles, published patent publications, patent publications, etc. specified in the present specification are incorporated by reference in their entirety.

Sequence number 1: Description of artificial sequence: LZA
Sequence number 2: Description of artificial sequence: LZB
SEQ ID NO: 3: Description of artificial sequence: linker SEQ ID NO: 4-138: Description of artificial sequence: primer SEQ ID NO: 139: Description of artificial sequence: Hc-LZA complex SEQ ID NO: 140: Description of artificial sequence: Lc-LZB complex

Claims (10)

The following steps:
(A) co-expressing antibody H chain gene encoding VH region and CH1 region and antibody L chain gene encoding VL region and CL region, or (B) antibody H chain encoding VH region and CH1 region After each expressing a gene and an antibody L chain gene encoding a VL region and a CL region, mixing expression products.
Including
Of the pair of peptides constituting the leucine zipper, a first tag sequence encoding one of the peptides is added to the antibody H chain gene, and a second tag sequence encoding the other is added to the antibody L chain gene ,
A method of preparing a Fab antibody, wherein the addition position of the first tag sequence is the 3 'end of the antibody H chain gene, and the addition position of the second tag sequence is the 3' end of the antibody L chain gene.   The preparation method according to claim 1, wherein the leucine zipper exerts an avidity by electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to the hydrophobic bond between leucine and leucine.   The first tag sequence is added to the antibody H chain gene via a linker sequence, and the second tag sequence is added to the antibody L chain gene via a linker sequence. Preparation method described.   The preparation method according to any one of claims 1 to 3, wherein the step is performed using an expression system using a host cell or a cell-free protein synthesis system. The preparation method according to any one of claims 1 to 4, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (i) to (viii):
(i) preparing mRNA derived from a single B cell;
(ii) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(iii) PCR is performed using a set of primers capable of amplifying the antibody H chain gene comprising the same third tag sequence at the 5 'end and encoding the VH region and the CH1 region, using the cDNA as a template To do;
(iv) PCR is performed using the above-mentioned cDNA as a template, using a primer set consisting of a plurality of primers containing the same fourth tag sequence at the 5 'end and capable of amplifying an antibody L chain gene encoding a VL region and a CL region. To do;
(v) performing PCR using the amplification product of step (iii) as a template, using a single primer containing the third tag sequence;
(vi) performing PCR using the amplification product of step (iv) as a template, using a single primer containing the fourth tag sequence;
(vii) adding the first tag sequence to the antibody heavy chain gene which is the amplification product of step (v);
(viii) adding the second tag sequence to an antibody light chain gene which is an amplification product of step (vi). The preparation method according to any one of claims 1 to 4, wherein the antibody H chain gene and the antibody L chain gene are prepared by the following steps (I) to (IV):
(I) preparing mRNA derived from a single B cell;
(II) preparing cDNA by reverse transcription PCR using the mRNA as a template;
(III) amplifying the antibody H chain gene by nested PCR using the cDNA as a template;
(IV) amplifying the antibody L chain gene by nested PCR using the cDNA as a template.   A tagged Fab antibody, wherein one of a pair of peptides constituting a leucine zipper is attached to the C-terminus of the CH1 region of the H chain, and the other is attached to the C-terminus of the CL region of the L chain.   8. The tagged Fab antibody according to claim 7, wherein the leucine zipper exerts an avidity by electrostatic interaction between positively charged amino acids and negatively charged amino acids in addition to the hydrophobic bond between leucine and leucine.   The tag according to any one of claims 7 or 8, wherein said one peptide is attached to said H chain via a linker and said other peptide is attached to said L chain via a linker. Fab antibody. 10. The tagged Fab antibody of claim 9, wherein the linker comprises a protease cleavage site.