JP2019056011A - Exosome regulatory agent containing imidazole dipeptide, and neuronal activation enhancer containing exosome - Google Patents

Abstract

To provide agents having novel applications that utilize a function of imidazole dipeptide by elucidating one end of the function associated with the improving effect of a brain function and the like.SOLUTION: The present invention provides an imidazole dipeptide-containing agent for secreting, from intestinal epithelial cells, exosome having a neuron activating action, and a neuronal activation enhancer containing exosome secreted from intestinal epithelial cells treated with imidazole dipeptide. The content of a specific miRNA in the exosome sometimes fluctuates on the basis of the content of the miRNA in normal exosome.SELECTED DRAWING: None

Description

  The present invention relates to an agent containing an imidazole dipeptide and its use, for example, a food composition or a pharmaceutical composition containing the agent as an active ingredient. More specifically, the present invention relates to an agent for secreting an exosome having an activating action on nerve cells, which contains imidazole dipeptide, from intestinal epithelial cells, and activation of nerve cells containing exosomes thus secreted The present invention relates to agents having an action, and uses of these agents, for example, food compositions and pharmaceutical compositions intended for diseases and conditions in which exosomes as nerve cell activators are effective for prevention and treatment.

  The imidazole dipeptide is a dipeptide (peptide consisting of two amino acids) composed of an amino acid having an imidazole group and another amino acid. Representative imidazole dipeptides include carnosine (a dipeptide composed of histidine and β-alanine) and anserine (a dipeptide composed of methylated histidine and β-alanine).

  In recent years, various bioactive actions possessed by imidazole dipeptides have attracted attention and research and development have been promoted. For example, for carnosine and anserine, skin metabolism promoting action (Patent Document 1), autonomic nerve regulating action (Patent Document 2), stress relaxation action (Patent Document 3), learning function improvement and anxiolytic action (Patent Document 4), etc. Has been studied relatively early.

  Patent Document 5 discloses that imidazole dipeptide and its metabolite improve neuropsychological functions (for example, those related to Alzheimer's disease or aging, or depression), anti-inflammatory effects, and control effects on blood levels of specific cytokines. It has the effect of suppressing or decreasing the blood glucose level or the insulin concentration in the blood, the effect of changing the expression of specific transporter gene, chemokine gene, aging-related gene, nervous system gene, mitochondrial gene or anti-aging gene It is described. This document further uses imidazole dipeptide and its metabolite as an agent for the above-mentioned action and contains the agent as an active ingredient, diabetes, Alzheimer's disease or brain functional aging and / or cognition. Pharmaceutical compositions and nutritional compositions (including so-called health foods, supplements, health functional foods, etc.) have been proposed for treating or treating diseases.

  In recent years, in Japan, where the population is aging, it is said that in 2025, one in three people over the age of 65 will be in the age of dementia, and countermeasures are urgently needed. As a general treatment method for dementia, the initial dementia is delayed using donepezil hydrochloride (trade name "Aricept" (registered trademark)), and hallucinations and Psychiatric symptoms such as delusions and symptoms such as anxiety, insomnia and depression are also relieved. However, such drugs can slow the progression of symptoms or alleviate the symptoms, but cannot cure them completely. Imidazole dipeptides such as carnosine and anserine used in the inventions described in Cited Documents 1 to 5 are abundant in foods such as chicken. It is expected that food components such as imidazole dipeptide that are ingested on a daily basis will exert an effect of preventing dementia and depression.

JP 2000-201649 A International Publication No. 2002/076455 JP 2007-70316 A JP 2000-116987 A JP2015-193582A

  As described above, Patent Document 5 describes that imidazole dipeptides such as carnosine derived from chicken and the like have a preventive effect on dementia and depression and the like. It cannot be explained by the known buffering action for lowering muscle pH, antioxidant action for suppressing active oxygen, anti-glycation action, etc., and the mechanism is almost unknown. Therefore, it is in a state where applied research for further utilizing the function of imidazole dipeptide to develop a more efficient intake method and the like cannot be carried out.

  An object of the present invention is to elucidate one end of a function of an imidazole dipeptide related to an improvement effect on brain function, and to provide an agent having a new use utilizing the function.

  Carnosine, one of the representative imidazole dipeptides, has been known to exist at relatively high concentrations in the brain and muscle in mammals such as humans, and so far it has mainly studied its effects on nerve cells and muscle cells. It was the target of. When the imidazole dipeptide was orally ingested, the present inventors first focused on the intestinal epithelial cells that serve as a barrier to be absorbed into the body. And when imidazole dipeptide was added to Caco-2 cell which is an intestinal epithelial cell model, it discovered that the exosome which has the effect | action which activates a nerve cell is secreted. In addition, the content of some miRNAs encapsulated in the exosome varies compared to the content of exosomes secreted from untreated intestinal epithelial cells, and most of the miRNAs with varied contents are neuronal. They also found that they have information related to cell activation. Exosomes are membrane vesicles that are secreted from almost all cells and are thought to be responsible for the transmission of information by being taken up by other cells. Inside the exosomes are miRNAs and proteins that vary depending on the cell from which they are derived. It contains a lot of information transmission substances such as. Exosomes are very small (40-100 nm in diameter) and are said to be able to cross the blood brain barrier. Such exosomes are secreted from intestinal epithelial cells in the body ingesting imidazole dipeptide, reach the brain in the bloodstream, and activate nerve cells, thereby causing dementia caused by imidazole dipeptide as described above. There may be a preventive effect.

  In addition, a part of the present applicant (the present inventor) previously induced expression of a gene of a specific neurotrophic factor such as BDNF and a factor having a similar function to glial cells by an imidazole dipeptide such as carnosine. Based on this finding, the inventors have invented an agent for inducing the expression of genes such as BDNF in glial cells, and has applied for a patent ( (Japanese Patent Application No. 2006-163639). The action of the imidazole dipeptide in the present invention is different from that of the prior application, but is related to intestinal epithelial cells. It is possible to rationally explain the mechanism such as preventive effect of illness and depression, and to become a means for pursuing more essential and efficient preventive effect.

The present inventors came to make this invention based on the above knowledge. That is, the present invention includes the following matters.
[Claim 1]
An agent for secreting an exosome having nerve cell activation action from intestinal epithelial cells, comprising imidazole dipeptide.
[Section 2]
An agent for activating nerve cells, comprising exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide.
[Section 3]
The content of miRNA in the exosome varies when the content of miRNA in a normal exosome is used as a reference,
The miRNAs are hsa-miR-20a-5p, hsa-miR-24-3p, hsa-miR-26a-5p, hsa-miR-92-5p, hsa-miR-92a-3p, hsa-miR-103a- 3p, hsa-miR-106a-5p, hsa-miR-194-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-619-5p, hsa-miR-937-5p, hsa-miR- 1207-5p, hsa-miR-1227-5p, hsa-miR-1343-5p, hsa-miR-3141, hsa-miR-3162-5p, hsa-miR-3196, hsa-miR-3613-3p, hsa- miR-4281, hsa-miR-4485, hsa-miR-4487, hsa miR-4507, hsa-miR-4532, hsa-miR-4668-5p, hsa-miR-4675, hsa-miR-4741, hsa-6732-5p, hsa-6675-5p, hsa-miR-6769b-5p, hsa-miR-6671-5p, hsa-miR-6775-5p, hsa-miR-679-5p, hsa-miR-6794-5p, hsa-miR-6798-5p, hsa-miR-6682-5p and hsa- is at least one selected from the group consisting of miR-8075,
Item 3. The agent according to Item 1 or 2.
[Claim 4]
Item 4. The agent according to Item 3, wherein the content of hsa-miR-6769-5p in the exosome is increased with reference to the content of miRNA in a normal exosome.
[Section 5]
Item 5. The agent according to any one of Items 1 to 4, comprising carnosine and / or anserine in a state where the imidazole dipeptide is contained in chicken or a chicken extract.
[Claim 6]
Item 6. The agent according to any one of Items 1 to 5, wherein the imidazole dipeptide contains carnosine.
[Claim 7]
Treating intestinal epithelial cells with imidazole dipeptides in an in vitro environment for cultured intestinal epithelial cells or in an in vivo environment for intestinal epithelial cells in a laboratory animal; and Recovering exosomes secreted from the treated intestinal epithelial cells.
[Section 8]
The method according to Item 7, further comprising the step of quantifying the recovered miRNA in the exosome and one or more of miRNA, mRNA or protein expressed in the treated intestinal epithelial cells as necessary. .
[Claim 9]
Furthermore, the collected exosome or the exosome is contained in an in vitro environment for cultured nerve cells or in an in vivo environment for nerve cells in a laboratory animal. Item 9. The method according to Item 7 or 8, which comprises a step of treating with miRNA or a mimic thereof.
[Section 10]
Item 10. The method according to Item 9, further comprising the step of quantifying one or more of miRNA, mRNA or protein in the treated nerve cell.
[Section 11]
Item 11. The method according to any one of Items 7 to 10, wherein the imidazole dipeptide contained in the agent according to any one of Items 1 and 3 to 6 is used as the imidazole dipeptide.

  The exosome-modulating agent of the present invention has an action of secreting exosomes having a specific miRNA content variation from intestinal epithelial cells, which have a nerve cell activation action. And the exosome secreted by the exosome regulator becomes a nerve cell activator which has the effect | action which activates a nerve cell. The exosome regulator and nerve cell activator having such actions can be used experimentally in an in vitro environment for research and development, and formulated as an active ingredient in food compositions and pharmaceutical compositions. Thus, it can be used in an in vivo environment such as prevention, treatment, or improvement of symptoms such as dementia and depression by ingestion by humans or other animals.

  Also, in connection with the present invention, as a part of the mechanism of the brain function improving effect by ingesting imidazole dipeptide, specific miRNA secreted from intestinal epithelial cells treated with imidazole dipeptide (exposed to imidazole) It has been shown that exosomes containing are involved. The exosome in this mechanism can be considered as a secretory factor, which is considered as one of the means of signal transmission, called brain-intestinal correlation, in order for the brain and intestine to influence each other closely through signal transmission. There is sex. In the future, it will be possible to develop imidazole dipeptides in applied research to enable more efficient intake of the imidazole dipeptides and more active use of the effects in vivo.

FIG. 1 is a diagram showing an axon guidance pathway that has been shown to vary according to pathway analysis by KEGG (Kyoto Encyclopedia of Genes and Genomes) for the target gene of hsa-miR-6732-5p. FIG. 2 is a diagram showing a neurotrophic factor signaling pathway that was shown to vary by a KEGG pathway analysis for the target gene of hsa-miR-6732-5p. FIG. 3 is a comprehensive analysis of Caco-2 cell secreted exosomes associated with carnosine treatment in Examples, [2-2] miRNA microarray and Western blotting steps, and the contents in exosomes by carnosine treatment (1 mM). Is a graph showing miRNA in which fold change (fold change (linear) increased or decreased more than 1.3). FIG. 4 is a comprehensive analysis of Caco-2 cell-secreted exosomes associated with carnosine treatment in the Examples, [2-2] Content in exosomes by carnosine treatment (10 mM) in miRNA microarray and Western blotting steps. Is a graph showing miRNA in which fold change (fold change (linear) increased or decreased more than 1.3). FIG. 5 shows the results of [3] hsa-miR-6732-5p expression quantitative analysis and [3-1] Caco-2 cell expression quantitative analysis in Example, when treated with PBS (control) and treated with carnosine (1 mM). Or 10 mM) is a graph showing the results of measuring the expression level of hsa-miR-6732-5p in Caco-2 cells. FIG. 6 shows a case where PBS treatment (control) and carnosine treatment (10 mM) were performed in [3] hsa-miR-6732-5p expression quantitative analysis and [3-2] exosome expression quantitative analysis in Example. It is a graph showing the result of having measured the content of hsa-miR-6732-5p in Caco-2 secretion exosome. FIG. 7 shows the results of [4] hsa-miR-6769-5p expression quantification analysis and [4-1] Caco-2 cell expression quantification analysis in Example, when treated with PBS (ctrl) and with carnosine (10 mM). It is a graph showing the result of having measured the expression level of hsa-miR-6769b-5p in Caco-2 cell in the case of. *** represents a significant difference of p <0.001. FIG. 8 shows the case of PBS treatment (ctrl) and carnosine treatment (10 mM) in [4] hsa-miR-6769-5p expression quantitative analysis and [4-2] exosome expression quantitative analysis in Example. It is a graph showing the result of having measured the content of hsa-miR-6769b-5p in Caco-2 secretion exosome. *** represents a significant difference of p <0.001. FIG. 9 shows [5] Functional analysis of Caco-2 cell secretory exosomes on nerve cells in Example 1-, [5-2] Culture of nerve cells and addition of Caco-2 cell secretory exosomes (1) (A) BDNF addition (100 ng / ml treatment: positive control), (B) PBS-treated Caco-2 cell secretion exosome addition (negative control) and (C) carnosine treatment (10 mM) Caco-2 performed in BDNF-like effect It is an observation image by a fluorescence microscope when immunostaining a neurite about each cell secretion exosome addition. FIG. 10 (FIGS. 10-1 and 10-2) shows [5] Functional analysis of Caco-2 cell-secreted exosomes on neurons in Example 1-, [5-3] Nerve cell culture and Caco- Addition of 2 cell secretion exosome-(2) Addition of retinoic acid-like effect (A) No treatment, (B) Addition of retinoic acid (10 μM treatment: positive control), (C) Addition of exosome secretion of Caco-2 cells treated with PBS (Negative control), (D) Carnosine treatment (1 mM) Caco-2 cell secretion exosome addition, and (E) Carnosine treatment (10 mM) Caco-2 cell secretion exosome addition, fluorescence microscope when nerve cells were immunostained It is an observation image by. FIG. 11 shows [6] Functional analysis of Caco-2 cell secretory exosomes on nerve cells of Example-PBS-treated Caco-2 cell secreted exosome addition (Exo-Crtl) and carnosine treatment (10 mM) performed in Part 2- ) Caco-2 cell secretion exosome addition (Exo0Car), untreated, and retinoic acid addition (RA), respectively, is a graph showing the results of quantification of neurite length. * Represents a significant difference of p <0.05. FIG. 12 shows [6] Functional analysis of Caco-2 cell-secreted exosomes on nerve cells in Example-Part 2--when treated with PBS (Exo-ctrl) and treated with carnosine (10 mM) (Exo-Car) ) Caco-2 secreting exosome is added to SH-SY5Y cells, and the expression level of Nestin, NEFM and Vimentin in the cells is measured. *** represents a significant difference of p <0.001. FIG. 13 shows [6] Functional analysis of Caco-2 cell secretory exosomes on nerve cells in Example-Part 2--when treated with PBS (Exo-ctrl) and treated with carnosine (10 mM) (Exo-Car) Is a graph showing the results of measuring the expression levels of ATXN1 and SLITRK5 in the cells when Caco-2 secreting exosomes of (2) are added to SH-SY5Y cells. ** indicates p <0.01 and *** indicates a significant difference of p <0.001. FIG. 14 shows [6] Functional analysis of Caco-2 cell secretory exosomes on nerve cells in Example-Part 2--when treated with PBS (Exo-ctrl) and treated with carnosine (10 mM) (Exo-Car) Is a graph showing the results of measuring the expression level of has-miR-6769b-5p in the cells when the Caco-2 secreting exosome of (2) is added to SH-SY5Y cells. * Represents a significant difference of p <0.05. FIG. 15 shows the functional analysis of Caco-2 cell secretory exosomes on neurons [6] in Example-hsa-miR-6769-5p mimic addition (6769-5p mimic) and control (mimic) performed in Part 2- ctrl) Each is an image observed with a fluorescence microscope when nerve cells are immunostained. FIG. 16 shows functional analysis of Caco-2 cell-secreted exosomes on neurons [6] neuronal cells in Example-Part 2--hsa-miR-6769-5p mimic addition (6769-5p mimic) and control (mimic) ctrl) is a graph showing the results of quantifying the neurite length for each. ** represents a significant difference of p <0.01.

  The first agent of the present invention (referred to herein as an “exosome-modulating agent”) is an agent for secreting exosomes containing an imidazole dipeptide and having nerve cell activation action from intestinal epithelial cells.

  The second agent of the present invention (referred to herein as a “nerve cell activator”) is for activating neurons containing exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide. It is an agent. In other words, the present invention treats intestinal epithelial cells with an effective amount of imidazole peptide and treats neurons with exosomes secreted from the intestinal epithelial cells in vivo or in vitro (typically And a method of activating nerve cells, including transporting by blood when in vivo, or allowing the nerve cells to absorb the exosome by addition to a culture solution outside the body).

  In each of the invention relating to the exosome-regulating agent and the invention relating to the nerve cell activator, the content of miRNA in the exosome is generally normal (secreted from intestinal epithelial cells not treated with imidazole dipeptide). Fluctuating with reference to the content of the miRNA.

  The miRNA whose content in the exosome varies is, for example, hsa-miR-20a-5p, hsa-miR-24-3p, hsa-miR-26a-5p, hsa-miR-92-5p, hsa-miR-92a. -3p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-194-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-619-5p, hsa-miR -937-5p, hsa-miR-1207-5p, hsa-miR-1227-5p, hsa-miR-1343-5p, hsa-miR-3141, hsa-miR-3162-5p, hsa-miR-3196, hsa -MiR-3613-3p, hsa-miR-4281, hsa-miR-448 , Hsa-miR-4487, hsa-miR-4507, hsa-miR-4532, hsa-miR-4668-5p, hsa-miR-4675, hsa-miR-4741, hsa-6732-5p, hsa-6675-5p Hsa-miR-6769b-5p, hsa-miR-6777-5p, hsa-miR-6775-5p, hsa-miR-6679-5p, hsa-miR-6794-5p, hsa-miR-6798-5p, hsa -At least one selected from the group consisting of miR-6821-5p and hsa-miR-8075.

  In another aspect, the exosome-modulating agent of the present invention contains an imidazole dipeptide, regulates the content of the specific miRNA in the exosome secreted from the intestinal epithelial cell, and / or the specific in the intestinal epithelial cell. It can also be said to be an agent for regulating the expression level of miRNA (sometimes referred to as “miRNA modulator” in the present specification).

  In yet another aspect, the present invention treats intestinal epithelial cells with an effective amount of an imidazole dipeptide in vivo or in vitro (typically by ingestion in vivo or in vitro). Regulate the content of said specific miRNA in exosomes secreted from intestinal epithelial cells and / or in intestinal epithelial cells, including exposing intestinal epithelial cells to imidazole peptides by addition to culture medium) A method for regulating the expression level of the specific miRNA is provided.

  The following inference does not limit the technical scope and effects of the present invention more than necessary, but the reason for the change in miRNA content in exosome (as a total amount) is as follows: As a result of inducing or suppressing the expression of miRNA in the intestinal epithelial cell and increasing or decreasing the expression level, the content of the specific miRNA in the exosome secreted from the intestinal epithelial cell naturally increases or decreases, or (Ii) The increase or decrease in the amount of exosome secreted increases or decreases the total amount even if the amount of miRNA contained in one exosome is the same, or both (i) and (ii) The possibility of “Content of miRNA in exosome” when referring to the action and effect of the present invention is not necessarily a narrow definition indicating the amount of miRNA contained per exosome, but refers to the total amount of miRNA contained in the entire exosome assembly. It is better to interpret in a broad sense.

  One of the reasons why exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide have a neuronal activation effect is that one or more miRNAs contained in exosomes have such an action. Moreover, it is considered that the content of those miRNAs is increased or decreased compared to exosomes secreted from intestinal epithelial cells not treated with imidazole dipeptide (untreated, normal). However, other possibilities, for example, substances other than miRNA such as proteins encapsulated in exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide, or exosomes encapsulating miRNA and other substances as a whole, The possibility of having a cell activating effect is not denied.

  Whether or not the exosome is secreted from intestinal epithelial cells "treated with imidazole dipeptide" can be determined by whether or not it has an action of activating nerve cells. “Exosomes secreted from intestinal epithelial cells that have not been treated with imidazole dipeptide” (untreated, normal) have no action of activating neurons. From another viewpoint, whether or not an exosome is secreted from an intestinal epithelial cell treated with “imidazole dipeptide” is determined based on one or more of the specific miRNAs contained in the exosome (ideal The content of (all) is variable (increased) as compared to the content for “untreated with imidazole dipeptide” (untreated, normal) intestinal epithelial cells ” It is also possible to discriminate based on whether or not it has decreased. Therefore, “exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide” can be expressed as “exosomes with neuronal activation” or “untreated, normal exosomes”. Compared to “) exosome secreted from intestinal epithelial cells”, the content of one or more (ideally all) of the specific miRNA is varied (increased or decreased) as described above. It can be paraphrased as “exosome”.

(Imidazole dipeptide)
The imidazole dipeptide is a dipeptide composed of an amino acid having an imidazole group and another amino acid, and can be represented by the following formula I or formula II.

In Formulas I and II, R ¹ , R ² and R ³ are each independently H or C _1-6 alkyl, X is H or —COR ⁴ , where R ⁴ is H, C _{1 -6} alkyl, benzyl optionally substituted or -CH = C ₂ H.

In the formula I, it is preferable that ^one of R ¹ and R ² is C _1-6 alkyl and the other is H. In the formula II, it is preferable that one of R ² and R ³ is C _1-6 alkyl and the other is H. One preferred example of C _1-6 alkyl is methyl.

Specific examples of X which is —COR ⁴ include formyl, acetyl, propionyl, benzoyl and acryloyl.

  Regarding the production method of the compound represented by Formula I or Formula II, JP 2003-520221, JP 2006-232686, JP 2006-504701, JP 2008-517911, JP 2009-512459, JP 2010- Reference can be made to 31004, JP-A 2011-37891, JP-A 2011-37892, JP-A 2013-165728, JP-A 2014-12735, and the like.

  Exemplary imidazole dipeptides include carnosine, anserine, valenin and homocarnosine. These imidazole dipeptides are all water-soluble (for example, the solubility of carnosine in water is 1 g / 3.1 ml at 25 ° C.).

  Carnosine is a dipeptide consisting of β-alanine and histidine. Carnosine has L-form and D-form due to the three-dimensional structure of histidine. In the present invention and the description thereof, the term “carnosine” refers to L-carnosine, D-carnosine, or a mixture thereof unless otherwise specified. Natural carnosine is L-carnosine. The structure of L-carnosine (IUPAC name: (2S) -2-[(3-Amino-1-oxopropyl) amino] -3- (3H-imidazol-4-yl) propanoic acid) is shown below. .

  Anserine is a dipeptide consisting of β-alanine and 1-methylhistidine. As in the case of carnosine described above, in the invention and the description thereof, “anserine” simply refers to L-anserine, D-anserine or a mixture thereof unless otherwise specified. The structure of L-anserine (IUPAC name: (2S) -2-[(3-amino-1-oxopropyl) amino] -3- (3-methyl-4-imidazolyl) propanoic acid) is shown below. .

  In addition, valenin (also referred to as ophidine) is a dipeptide composed of β-alanine and 3-methylhistidine, and homocarnosine is a dipeptide composed of γ-aminobutyric acid (GABA) and histidine.

  The imidazole dipeptide may be any of a synthesized product, a product produced by fermentation, or a product obtained from a natural product, and may be isolated or purified as necessary. For example, imidazole dipeptide is abundant in various animals such as cattle, horses, pigs, chickens, whales, fish (eg, bonito, tuna, eel), and extracts, concentrates of these natural products, It is preferable to mix | blend in an agent as a rough refined | purified substance etc. Among them, an extract of chicken (chest meat, fillet, etc.) is rich in carnosine and anserine and is particularly preferable as a raw material for imidazole dipeptide. That is, the imidazole dipeptide used as an exosome regulator (or miRNA regulator) in the present invention is preferably carnosine and / or anserine contained in chicken or chicken extract.

  The imidazole dipeptide used in the present invention may be any one of imidazole dipeptides alone or a mixture of two or more imidazole dipeptides. In addition, when prescribing | regulating content of two or more types of imidazole dipeptide about the prescription | regulation regarding the quantity of imidazole dipeptide in this invention or its description, the said quantity points out those total amounts except the case where it describes separately.

  Among the imidazole dipeptides, carnosine is particularly excellent in the nerve cell activation action by exosomes secreted when intestinal epithelial cells are treated, so the imidazole dipeptide used in the present invention preferably contains at least carnosine, It may contain only carnosine, that is, it may contain no compounds other than carnosine such as anserine, valenine, and homocarnosine.

  The exosome-modulating agent of the present invention may be composed solely of imidazole dipeptide, and similarly, it acts on intestinal epithelial cells to secrete exosomes having neuronal activation activity, or to secreted exosomes. It may further contain other substances having an action of varying the content of the specific miRNA to be encapsulated or the expression level of a predetermined miRNA in the intestinal epithelial cell. In addition, the exosome-regulating agent of the present invention is in an inseparable state of imidazole dipeptide and other substances as a natural product extract such as chicken extract, concentrate, crude product, etc. (prepared composition) (Not a product), a solution dissolved in an appropriate solvent such as water or a buffer, or a dry powdered form.

  A method for preparing an extract of a natural product containing imidazole dipeptide is not particularly limited, and various known techniques can be used, and the extraction conditions can be adjusted as appropriate. Chicken extract is generally minced chicken, hot water is added, pH is adjusted as necessary, and warmed as necessary (for example, 50 to 100 ° C.) for several minutes to several days (for example, 1 to 10). It can be prepared by a procedure such as extraction over time). The part of chicken as a raw material is not particularly limited, but it preferably contains breast meat because it contains a large amount of carnosine and / or anserine. If necessary, the obtained extract can be further subjected to purification / fractionation treatment by diatomaceous earth filtration, ultrafiltration, etc., desalting treatment, protease treatment, and the like. Moreover, the obtained extract can be made into a concentrated solution as needed, dried into a dried product (hot powder) by hot air drying, spray drying, freeze drying, or the like, or granulated into granules. The extract containing imidazole dipeptide may be stored in such a solution until use, or may be stored in the form of a dry powder or granules. According to the study of the present inventor, it has been confirmed that anserine and carnosine are sufficiently stable at room temperature, and are sufficiently stable at 180 ° C. or lower when heated. Furthermore, it has been confirmed that it can be stably stored in solution for at least 2 years and September.

(Exosome)
The exosome used as a nerve cell activator in the present invention is secreted from intestinal epithelial cells treated with imidazole dipeptide. Such exosomes are commercially available after culturing intestinal epithelial cells in a medium supplemented with imidazole dipeptide, and pretreating the cultured medium after centrifugation, ultrafiltration, or the like as necessary. Can be isolated and purified using conventional kits or by means based on equivalent principles, for example, using the phosphatidylserine affinity method.

  In one aspect of the present invention, at least one of the specific miRNAs is artificially introduced into an exosome, for example, and is substantially equivalent to “an exosome secreted from an intestinal epithelial cell treated with an imidazole dipeptide”. It is also possible to create exosomes.

  When producing exosomes as described above, other miRNA mimics (pseudo-compounds) can be used instead of miRNA when miRNA is used in the present invention. The miRNA mimic is an artificial product having a structure similar to miRNA, and various products are commercially available (for example, products of Qiagen).

  The nerve cell activator of the present invention may be composed only of exosomes (purified product), or may further contain other substances having a predetermined activation action on nerve cells in the same manner. Good. The exosome may be in a form suspended in a suitable solvent such as a buffer solution.

(MiRNA)
When treated with an imidazole dipeptide as an exosome-modulating agent of the present invention, miRNAs that vary in exosome content released from intestinal epithelial cells, in other words, with an imidazole dipeptide as a miRNA-modulating agent of the present invention, The miRNAs whose contents in the exosome and / or the expression level in the intestinal epithelial cells are regulated are as follows: hsa-miR-20a-5p, hsa-miR-24-3p, hsa-miR- 26a-5p, hsa-miR-92-5p, hsa-miR-92a-3p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-194-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-619-5p, hsa- iR-937-5p, hsa-miR-1207-5p, hsa-miR-1227-5p, hsa-miR-1343-5p, hsa-miR-3141, hsa-miR-3162-5p, hsa-miR-3196, hsa-miR-3613-3p, hsa-miR-4281, hsa-miR-4485, hsa-miR-4487, hsa-miR-4507, hsa-miR-4532, hsa-miR-4668-5p, hsa-miR- 4675, hsa-miR-4741, hsa-6732-5p, hsa-6675-5p, hsa-miR-6769b-5p, hsa-miR-6671-5p, hsa-miR-6775-5p, hsa-miR-6679- 5p, hsa-miR-6794-5p, hsa- iR-6798-5p, hsa-miR-6821-5p and hsa-miR-8075.

  Any one kind of these miRNAs may be targeted, and two or more kinds may be targeted. Usually, when intestinal epithelial cells are treated with imidazole dipeptide, the content in exosomes of all or part of the above-mentioned miRNA changes, and the expression level in intestinal epithelial cells also changes.

  In the present invention, the miRNA whose expression level varies may vary depending on the type and composition of the imidazole dipeptide used as the exosome regulator.

  For example, when the cultured intestinal epithelial cells are treated with carnosine, when the carnosine concentration in the culture solution is 1 mM, among the above miRNAs, hsa-miR-92-5p, hsa-miR-320b, hsa- miR-1227-5p, hsa-miR-3141, hsa-miR-3196, hsa-miR-4507, hsa-miR-4675, hsa-6732-5p, hsa-miR-6769b-5p, hsa-miR-6671- 5p, hsa-miR-6775-5p, hsa-miR-6794-5p, hsa-miR-6798-5p and hsa-miR-8075 have an increased content in exosomes. Among the miRNAs, hsa-miR -20a-5p, hsa-miR-24-3p, hsa-miR-26 -5p, hsa-miR-92a-3p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-194-5p, hsa-miR-619-5p, hsa-miR-3162-5p Hsa-miR-3613-3p, hsa-miR-4485, hsa-miR-4532 and hsa-miR-4668-5 have a reduced content in exosomes.

  Further, when the cultured intestinal epithelial cells are treated with carnosine, when the carnosine concentration in the culture solution is 10 mM, among the above miRNAs, hsa-miR-106a-5p, hsa-miR-1207-5p, hsa-miR-1343-5p, hsa-miR-3162-5p, hsa-miR-4281, hsa-miR-4487, hsa-miR-4741, hsa-6732-5p, hsa-6675-5p, hsa-miR- 6769b-5p, hsa-miR-6671-5p, hsa-miR-6775-5p, hsa-miR-6679b-5p and hsa-miR-6682-5p are increased in exosome, and among the above miRNAs Hsa-miR-103a-3p, hsa-miR-194-5p, sa-miR-320c, hsa-miR-619-5p and hsa-miR-937-5p is, content in exosomes is reduced.

  Even if the concentration of carnosine in the culture solution is other than 1 mM or 10 mM (preferably in the range of 1 to 10 mM), one or more (ideally all) miRNAs are estimated to show the same increase / decrease as above. Is done. For miRNAs (hsa-miR-106a-5p and hsa-miR-3162-5p) with different carnosine concentrations at 1 mM or 10 mM, depending on the concentration of carnosine in the culture medium (preferably in the range of 1-10 mM), Indicates either increase or decrease. Similarly, when an imidazole dipeptide other than carnosine is used, one or more (ideally all) miRNAs (A) and (B) are presumed to exhibit the same increase and decrease as described above.

As described above, miRNAs whose content in exosomes varies according to the miRNA modulating agent of the present invention can be obtained by searching for target genes by Target Scan, and gene database DAVID (http://david.abcc.ncifcrf.gov/). According to the functional analysis of the target gene used (Annotation Cluster with an Enrichment Score of 1.3 or higher), when attention is paid to the neurological relationship, it is involved in the following functions.
・ Synapse ・ Neural tube formation, development ・ Neurotransmitter secretion, transport ・ Neuron development, differentiation ・ Axon induction, formation ・ Cadherin (a kind of glycoprotein that controls cell adhesion, synapse formation, synaptic plasticity With function)
・ Semaphorin (involved in the control of axon elongation and dendritic morphology / function)
・ Hippocampal development

  According to the pathway analysis by KEGG (Kyoto Encyclopedia of Genes and Genomes), the above-mentioned target gene particularly significantly changes the axon guidance pathway and the neurotrophic factor signaling pathway. As an example, the axon guidance pathway and neurotrophic factor signaling pathway for the target gene of hsa-miR-6732-5p are shown in FIGS. 1 and 2, respectively.

  In addition, as described above, miR-6769b-5p (carnosine concentration 1 mM and 10 mM) increases in the content of exosome secreted by treatment of intestinal epithelial cells with carnosine, and miR-619- decreases in content. 5p (carnosine concentration 10 mM), miR-24-3p (carnosine concentration 1 mM) and miR-937-5p (carnosine concentration 1 mM) each increase or decrease the expression level of the target gene in nerve cells, as shown in the table below. Let It is considered that the change in the expression level of the target gene in these neurons leads to the activation of neurons such as neurite outgrowth.

  As a preferred embodiment of the present invention, it is mentioned that the content of hsa-miR-6769-5p in exosomes is increased with respect to the content of miRNA in normal exosomes.

(Intestinal epithelial cells)
Intestinal epithelial cells are a general term for cells constituting the surface mucosa of the digestive tract such as the small intestine and large intestine. Such intestinal epithelial cells include absorptive epithelial cells, goblet cells, Paneth cells, enteroendocrine cells, tuft cells, M cells and the like. Caco-2 used in the examples is a human colon cancer-derived cell line commonly used as a model of intestinal epithelial cells. When cultured, it forms a monolayer spontaneously, and is cultured for 2-3 weeks. If it continues, it will differentiate and express various small intestine-like functions.

-Use-
Applications of the exosome-modulating agent and nerve cell activator of the present invention are particularly limited as long as they utilize the action of secreting exosomes having nerve cell activating action from intestinal epithelial cells and the action of activating nerve cells, respectively. It is not something.

  As an example of the use, the imidazole dipeptide as the exosome-regulating agent of the present invention searches for (screens for) more excellent compounds with respect to neuronal activation (pharmacological activity) possessed by exosomes secreted from intestinal epithelial cells. It can be used as a lead compound. Lead compounds generally have a clear pharmacological activity profile, which can be chemically modified to improve pharmacological activity, further improve safety (to reduce toxicity if present), physical properties This refers to a compound that can be expected to stabilize. The pharmacological activity as described above may be further improved by chemically modifying the imidazole dipeptide.

  Chemical modification refers to chemically modifying an imidazole dipeptide (compound represented by Formula I or II) as a lead compound in order to optimize in terms of improvement in pharmacological activity. Specific examples of chemical modification include substitution or removal of some amino acids, addition or insertion of at least one amino acid, addition, substitution or removal of a functional group in each amino acid, D-form of each amino acid that is naturally L-form Substitution with an amino acid or an artificial amino acid is exemplified.

  Further, as another example of the use, a compound or substance that can be used in combination in order to further improve the above-described action of the imidazole dipeptide as the exosome-regulating agent of the present invention or to further improve safety. It can also be used for searching. If a compound or the like that can improve the above-mentioned action of the exosome-regulating agent by acting on the intestinal epithelial cells together with the exosome-regulating agent of the present invention is found, such a compound or the like, together with the exosome-regulating agent of the present invention, food There is a possibility that it can be used in a composition or a pharmaceutical composition.

  In the applications shown in the above two examples, or applications based on these, the imidazole dipeptide as the exosome-modulating agent of the present invention can be used in an in vitro environment for cultured intestinal epithelial cells or in humans. Or it will be used in an in vivo environment for intestinal epithelial cells in the body of a laboratory animal.

  When imidazole dipeptide as an exosome-modulating agent is allowed to act on intestinal epithelial cells in vitro, or when exosome as a neuronal activator is allowed to act on neurons in vitro, the same as in conventional drug tests using cultured cells In addition, after adding the exosome regulating agent or nerve cell activator of the present invention to a predetermined concentration in the cell culture medium, the intestinal epithelial cells or nerve cells may be cultured for a predetermined period. The treatment concentration and treatment time at that time are set to a concentration and time at which the action of the exosome-modulating agent or nerve cell activator of the present invention is appropriately exerted, or experimentally for analyzing the degree of action, etc. The concentration and time of various stages can be adjusted or adjusted according to the purpose.

  For example, the exosome-modulating agent of the present invention exerts the desired action on cultured intestinal epithelial cells, that is, the action of secreting exosomes having nerve cell activation action, and cytotoxicity at that time. In order to confirm, the concentration of imidazole dipeptide as an exosome regulator in the culture solution is usually in the range of about 1 μM to 100 mM, and the culture period of intestinal epithelial cells in the culture solution to which the miRNA regulator is added is usually 1 It can be adjusted within a range of about 2 days. When it is desired to achieve a condition that balances the strength of the action of the exosome regulator and the weakness of cytotoxicity, the concentration of the exosome regulator in the culture solution is preferably 100 μM to 10 mM, for example, 1 mM to 10 mM.

  When the nerve cell activator of the present invention exerts an intended action on cultured neurons, and when it is desired to confirm the cytotoxicity at that time, culture of exosomes as nerve cell activators The concentration in the solution is usually 5 to 500 ng / mL (for example, 5 to 500 ng / mL as a solution of exosomes purified by the procedure shown in the Examples), and in the culture solution to which the nerve cell activator is added. The culture period of nerve cells can usually be adjusted in the range of about 1 to 5 days. When it is desired to achieve a condition that balances the strength of the action of the nerve cell activator and the weakness of cytotoxicity, the concentration of the nerve cell activator in the culture solution is preferably 1 to 100 ng / mL.

  When acting on intestinal epithelial cells in vivo, a predetermined amount of the exosome-modulating agent of the present invention may be administered to the experimental animal over a predetermined period, as in a conventional drug test using an experimental animal. . The dosage and administration period at that time are also set to a dosage and administration period that appropriately exert the action of the expression-inducing agent of the present invention, and at various stages on a trial basis in order to analyze the degree of action. The dosage and administration period can be adjusted according to the purpose.

  For example, the exosome-modulating agent of the present invention exerts the desired action on intestinal epithelial cells in the mouse in vivo, that is, the action of secreting exosomes having nerve cell activation action, side effects at that time, etc. In general, the dosage of exosome-modulating agent is in the range of 0.1 to 2 g / kg body weight, the number of administrations per day is in the range of 1 to 3, and the administration period is 7 to 180 days. Can be adjusted within a range of, or a single dose is contemplated. Regarding the setting of such a dosage, the description of the specification described later regarding the food composition and the pharmaceutical composition can also be referred to. Examples of the types of experimental animals include mice, rats, rabbits, guinea pigs, gerbils, hamsters, ferrets, dogs, minipigs, monkeys, cows, horses, sheep and the like.

  The matter relating to the imidazole dipeptide as the exosome regulator as described above can be appropriately read as the matter relating to the imidazole dipeptide as the miRNA regulator.

  The neuronal cell activation effect of the exosome secreted by intestinal epithelial cells treated with the exosome-modulating agent of the present invention, that is, the effect exhibited by the neuronal cell activator of the present invention is neurite (axon) extension. , Dendritic elongation, suppression of decrease in the number of neurons (induction of differentiation into neurons), and the like. These actions can be confirmed using known techniques.

  In general, after treating nerve cells with exosomes as active ingredients of nerve cell activators, compared to before treatment, or compared to untreated control, fluorescent immunostaining method etc. Increase in the number of neurites (axons) and dendrites, or the number of cells differentiated from human neuroblasts, preferably statistically significant differences. It can be said that the above-mentioned expected effects were achieved.

  In addition, the effect which the miRNA regulator of this invention show | plays, ie, the content of the specific miRNA in the exosome secreted from an intestinal epithelial cell, and / or the expression level of the specific miRNA in an intestinal epithelial cell are adjusted. The action to be performed can also be confirmed using a known technique.

  Generally, after intestinal epithelial cells are treated with imidazole dipeptide as an active ingredient of a miRNA modulator, they are secreted from intestinal epithelial cells compared to before treatment or compared to a control corresponding to no treatment. The content of exosomes varies (increases or decreases) and / or the expression level of specific miRNA in intestinal epithelial cells varies, preferably with statistically significant differences. Therefore, it can be said that the above-mentioned desired effects were achieved.

  For miRNA in cells or exosomes, samples are collected from cultured intestinal epithelial cells or culture media thereof, intestinal tissues of experimental animals, etc., and are obtained using a known measurement system and measurement member (commercially available kit, etc.) Can be quantified with accuracy.

  Another preferred example of the use of the exosome-modulating agent or nerve cell activator of the present invention is to incorporate them as an active ingredient of a food composition or a pharmaceutical composition. However, since imidazole dipeptide as an exosome-regulating agent targets intestinal epithelial cells, it is difficult to expect its efficacy as an active ingredient even if it is used in a pharmaceutical composition for parenteral administration. Conversely, since exosomes as nerve cell activators target nerve cells, their efficacy is unlikely to be expected even when used as a food composition or in a pharmaceutical composition for oral administration.

  Diseases or symptoms for which the exosome-modulating agent or nerve cell activator of the present invention can be an active ingredient are prevention, treatment, improvement, etc. (reduction of onset risk, delay of onset, progression of progression, etc.) by exosomes secreted from intestinal epithelial cells. Stop and delay included). In particular, exosomes including miRNA (as described above, the content of at least one of the specific miRNAs varies as compared to normal), proteins, etc. reach brain tissue and act on nerve cells and the like. Thus, a disease or symptom that can be prevented, treated, improved, etc. is preferable. Representative examples of the above diseases include dementia, depression and epilepsy. Specific examples of the above symptoms include brain atrophy, a decrease in brain function (such as functional connection with the hippocampus), and neuronal damage due to inflammation.

  That is, the present invention, in one aspect, is a food composition that contains the exosome-modulating agent or nerve cell activator of the present invention as an active ingredient, such as the prevention, treatment, and symptom improvement of the specific disease or symptom. Alternatively, a pharmaceutical composition is provided. In other words, the present invention relates to the above-mentioned specific disease or symptom comprising feeding or administering a food composition or a pharmaceutical composition containing an effective amount of the exosome modulating agent or nerve cell activator of the present invention. Prophylactic methods, therapeutic methods, improvement methods, etc. are provided. The above food composition or pharmaceutical composition may be referred to herein as “the food composition of the present invention” or “the pharmaceutical composition of the present invention”, respectively.

  The food composition or pharmaceutical composition of the present invention is a human (patient) or non-human mammal (patient) who is currently suffering from or suffering from the above-mentioned specific disease, It is possible to treat experimental animals, pets, etc.).

  Actions for “treatment” include medical actions performed by doctors for the purpose of treating diseases, and those other than doctors (for example, nutritionists, registered dietitians, public health nurses, midwives, nurses, clinical technologists, Non-medical actions performed by beauty staff, estheticians, food manufacturers, food sellers, etc.). Treatment also includes recommendations for the administration or consumption of specific foods, dietary guidance, health guidance, nutritional guidance (nutrition guidance necessary for medical treatment for the disabled, and nutritional guidance for health maintenance and promotion. .), Including guidance necessary for improving nutrition related to school lunch management and school lunch.

(Food composition)
The food composition is known in the art, for example, by mixing imidazole dipeptide as an exosome-regulating agent or an extract containing the same with various additives acceptable as food and other components at a predetermined mixing ratio. It can be manufactured using technology. In addition, although it contains an imidazole dipeptide, the natural raw material which is not manufactured as a composition, or its cooking / processed goods, for example, chicken itself, does not correspond to a food composition.

  Food compositions are health functional foods (nutrient functional foods, foods for specified health use and functional labeling foods), health foods, supplements, and therapeutic foods that serve the purpose of treatment. Can be manufactured as a dietary meal, nursing food, etc. Examples of the form of the food composition include beverages, confectionery, processed meat products, processed seafood products, processed vegetable products, side dishes, seasoning compositions, and food additives.

(Pharmaceutical composition)
The pharmaceutical composition consists of imidazole dipeptide as an exosome-modulating agent or exosome as a neuronal activator (respectively, purified products that satisfy the level of pharmaceuticals), various pharmaceutically acceptable additives, and other It can manufacture using a well-known technique, such as mixing a component with a predetermined | prescribed compounding ratio.

  Examples of pharmaceutical composition forms (dosage forms) containing an exosome-modulating agent include powders, fine granules, granules, tablets, capsules, liquid preparations (elixirs, limonades, syrups) for oral administration. Agents, emulsions, suspensions, solutions and drinks), gel preparations and the like.

  On the other hand, examples of the form (dosage form) of a pharmaceutical composition containing a nerve cell activator include injections, drops, suppositories and the like for parenteral administration.

  It is appropriate to carry out the production process of the food composition and the pharmaceutical composition under appropriate conditions, particularly considering the solubility and stability of the imidazole dipeptide or exosome as an active ingredient. As the imidazole dipeptide, one prepared in advance by the method as described above, for example, one obtained as an extract of chicken or the like may be used. As the exosome, a purified product prepared in advance by the method described above, for example, a secreted product of cultured intestinal epithelial cells may be used.

  Examples of additives that can be incorporated into a food composition or pharmaceutical composition include excipients, antioxidants (antioxidants), flavorings, seasonings, sweeteners, colorants, thickening stabilizers, and coloring. Agent, bleaching agent, fungicide, gum base, bittering agent, enzyme, brightener, acidulant, emulsifier, strengthening agent, production agent, binder, tonicity agent (isotonic agent), buffer, dissolution aid Agents, preservatives, stabilizers, coagulants and the like.

  Other components that can be incorporated into the food composition or pharmaceutical composition include imidazole dipeptides as exosome modulators or functional components other than exosomes as nerve cell activators of the present invention, such as branched chain amino acids ( Amino acids such as valine, leucine and isoleucine) and ornithine, unsaturated fatty acids (such as EPA and DHA), vitamins, trace metals, glucosamine and chondroitin.

  The amount of active ingredient per serving or daily of the food composition, and the amount of active ingredient per dose or daily of the pharmaceutical composition are determined by the age, weight, sex, and the disease or condition to which it is applied or administered. It can be set appropriately according to the above, or based on non-clinical or clinical test results. The period of ingestion or administration of the food composition or pharmaceutical composition can also be set as appropriate, but for the prevention of a specific disease, etc., it is repeated over a long period of time, and is ingested or administered daily. It would be preferable.

  The intake or dose of the active ingredient contained in the food composition of the present invention or the pharmaceutical composition for oral administration, that is, the imidazole dipeptide as an exosome regulator, can be, for example, 200 mg / day, 400 It is preferably mg / day, more preferably 500 mg / day or more, and even more preferably 750 mg / day or more. Also, it may be 1,000 mg / day or more, 2,000 mg / day or more, 5,000 mg / day or more, or 7,500 mg / day or more. In any case, the above intake or dose can be 50,000 mg / day or less, preferably 30,000 mg / day or less, more preferably 20,000 mg / day or less. More preferably, it is 10,000 mg / day or less. The active ingredient may be ingested or administered in the above-mentioned daily amount, or may be ingested or administered in multiple portions.

  The content or content of imidazole dipeptide used as an active ingredient in the food composition of the present invention or the pharmaceutical composition for oral administration is the amount of active ingredient per serving or administration as described above, or the food composition. Alternatively, it may be set as appropriate in consideration of the form of the pharmaceutical composition and the like, further considering ease of manufacture and ease of use. The content (mass of active ingredient per 100 g of food composition or pharmaceutical composition) can be, for example, 1,000 mg / 100 g or more, preferably 1,500 mg / 100 g or more, 2,000 mg / It is more preferably 100 g or more, more preferably 2,500 mg / 100 g or more, more preferably 3,000 mg / 100 g or more, and further preferably 3,500 mg / 100 g or more. In any case, the content can be 50,000 mg / 100 g or less, preferably 40,000 mg / 100 g or less, more preferably 30,000 mg / 100 g or less, More preferably, it is 20,000 mg / 100 g or less. The content (the ratio of the mass of the active ingredient to the total mass of the food composition or pharmaceutical composition) is adjusted in the range of, for example, 0.1 to 99.9%, 1 to 95%, 10 to 90%, 51 to 90%, etc. be able to. In addition, the content of carnosine among active ingredients can be adjusted within a range of 21% or more, for example.

  In addition, when exosomes as nerve cell activators are used as the active ingredient of the pharmaceutical composition, the content or content is determined by the dose of the exosome-regulating agent described above (the exosomes secreted from the intestinal epithelial cells thereby) It is possible to set appropriately with reference to the strength of the nerve cell activating action of.

  The use of the food composition or pharmaceutical composition of the present invention, or the use of the exosome regulating agent or nerve cell activator of the present invention can be indicated directly or indirectly. Examples of direct display are descriptions on tangible items such as products themselves, packages, containers, labels, tags, etc. Examples of indirect display are websites, storefronts, exhibitions, signboards, bulletin boards, newspapers, magazines , Including advertising and promotional activities by location or means such as television, radio, mailing, e-mail, etc. When the food composition of the present invention is produced as a functionally labeled food, the exosome-modulating agent or nerve cell activation of the present invention contained as an active ingredient, for example, “maintaining memory ability”, “suppressing memory decline” The functionality of the food based on the effect of the agent can be displayed. Alternatively, as in “enhancement of brain-intestinal correlative function”, the exosome-modulating agent of the present invention contained as an active ingredient acts on intestinal epithelial cells (intestine), and further indirectly through exosomes secreted from intestinal epithelial cells. It is possible to display the functionality of food based on the relevance of acting on nerve cells (brain).

  The description relating to the use of imidazole dipeptide as an exosome regulator in the food composition or pharmaceutical composition described above can be appropriately read as the description relating to the use of imidazole dipeptide as a miRNA regulator.

  In another aspect of the present invention, imidazole dipeptide is allowed to act on intestinal epithelial cells to secrete exosomes having nerve cell activating action, and such exosomes are passed to the nerve cells of brain tissue via blood flow or the like. Prevent or treat specific diseases or symptoms by delivering or delivering exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide to nerve cells in brain tissue by injection or other parenteral route Or provide a way to improve. Such exosome-mediated brain-intestinal correlation has not been reported so far, and is a novel mechanism for preventing, treating, or ameliorating a specific disease or symptom. As for the above method, in this specification, as the use of imidazole dipeptide, the description items related to in vivo action on intestinal epithelial cells and when used as an active ingredient of a pharmaceutical composition are similarly applied. be able to.

  From the description of the present specification, particularly the description and examples regarding the use, for example, as one embodiment of the present invention, in an in vitro environment for cultured intestinal epithelial cells or in the body of a laboratory animal. A method comprising a step of treating an intestinal epithelial cell with an imidazole dipeptide under an in vivo environment for a certain intestinal epithelial cell, and a step of recovering an exosome secreted from the treated intestinal epithelial cell. Is understood. The method can further comprise quantifying the recovered miRNA in the exosome and optionally one or more of miRNA, mRNA or protein expressed in the treated intestinal epithelial cells.

  As one of further embodiments of the present invention, in the above method, in an in vitro environment for cultured neurons, or an in vivo environment for neurons in a laboratory animal body Below, it is also understood that the method includes the step of treating a nerve cell with the recovered exosome or miRNA contained therein or a mimic thereof. The method can further comprise quantifying one or more of the miRNA, mRNA or protein in the treated neuronal cell.

  In the embodiment according to the above method, as the imidazole dipeptide, one contained as an active ingredient of the exosome regulating agent described in the present specification can be used.

[1] Preparation of Carnosine Solution All carnosine in the present invention is L-carnosine (Wako Pure Chemical Industries, Ltd. Cat. 032-11031), DPBS (Dulbecco's phophate buffered saline) (Thermo Fisher Scientific Cat. 14190- 144) was prepared to 1M, and then diluted to the final concentration of each.

[2] Exhaustive analysis of Caco-2 cell secreted exosomes associated with carnosine treatment [2-1] Exosome purification process using ExoQuick-TC
Caco-2 cells were seeded in a 100 mm dish at 1 × 10 ⁶ cells / dish. After 24 hours, PBS (control), carnosine 1 mM or carnosine 10 mM was added. After 24 hours, 10 mL of the culture supernatant was collected and centrifuged at 3000 g for 15 minutes to remove cells in the supernatant. The supernatant was transferred to a sterilized 15 mL tube, 2 mL of “ExoQuick-TC” (SBI, exosome concentration reagent) was added, and the mixture was mixed thoroughly by inversion. The mixture was allowed to stand overnight at 4 ° C, and then centrifuged at 1500 g for 30 minutes. The supernatant was removed and the remaining liquid was centrifuged at 1500 g for 5 minutes. At this time, a whitish pellet was confirmed at the bottom of the tube. 1 × RIPA buffer was added to suspend the pellet. After vortexing for 15 seconds, the mixture was allowed to stand at room temperature for 15 minutes to completely dissolve the exosomes.

[2-2] miRNA microarray and Western blotting process Exosome extraction was confirmed by detecting exosome marker proteins (CD9, CD81 and CD63) by Western blotting. After confirmation, exosomes released from Caco-2 cells treated with PBS (control), carnosine 1 mM, or carnosine 10 mM using microarray for miRNA analysis (Agilent, GeneChip miRNA4.0 Array) Analysis of the encapsulated miRNA was performed. Analysis was requested from Cell Innovator.

  Compared with PBS treatment (control), the content of miRNA contained in each exosome of carnosine 1 mM treatment and carnosine 10 mM treatment increased or decreased when the fold change (linear) was 1.3 or more. (T test, p <0.05). The results are shown in FIG. 3 and FIG. Carnosine 1 mM treated exosomes are hsa-miR-6798-5p, hsa-miR-92-5p, hsa-miR-8075, hsa-6732-5p, hsa-miR-6794-5p, hsa-miR-3141, hsa-miR-6771-5p, hsa-miR-6775-5p, hsa-miR-4507, hsa-miR-1227-5p, hsa-miR-6769b-5p, hsa-miR-320b, hsa-miR-3196, Increased content of hsa-miR-4674, hsa-miR-619-5p, hsa-miR-3162-5p, hsa-miR-92a-3p, hsa-miR-103a-3p, hsa-miR-4532, hsa -miR-106a-5p, hsa-miR-4485, hsa-miR-20a-5p, hsa-miR-194-5p, hsa-miR-24-3p, hsa-miR-26a-5p, hsa-miR-3613 -3p, hsa-miR-4668-5p content decreased. On the other hand, exosomes treated with carnosine 10 mM are hsa-miR-6769b-5p, hsa-miR-6775-5p, hsa-miR-4487, hsa-miR-3162-5p, hsa-miR-6752-5p, hsa- miR-4281, hsa-miR-6821-5p, hsa-miR-6779-5p, hsa-miR-6732-5p, hsa-miR-1207-5p, hsa-miR-106a-5p, hsa-miR-6771- 5p, hsa-miR-1343-5p, hsa-miR-4741 content increased, hsa-miR-103a-3p, hsa-miR-937-5p, hsa-miR-619-5p, hsa-miR-194 The content of -5p, hsa-miR-320c was decreased. MiRNAs whose contents varied with the treatment concentration of carnosine were not identical. MiRNAs whose content varies at either concentration are hsa-miR-194-5p, hsa-miR-619-5p, hsa-miR-103a-3p, hsa-miR-6771-5p, hsa-miR-106a- It is 9 miRNAs of 5p, hsa-miR-6732-5p, hsa-miR-3162-5p, hsa-miR-6775-5p, hsa-miR-6769b-5p (see the table below). There were also those that increased in content and decreased in content (hsa-miR-106a-5p and hsa-miR-3162-5p).

[3] Quantitative expression analysis of hsa-miR-6732-5p In the analysis using the microarray of [2] above, among the miRNAs in which the expression level in the exosome was increased by carnosine treatment (1 mM and 10 mM) For hsa-miR-6732-5p, the expression level in Caco-2 cells and exosomes was measured by quantitative real-time PCR according to the following procedure.

[3-1] Quantitative expression analysis in Caco-2 cells
Caco-2 cells were seeded in a 60 mm dish at 3 × 10 ⁵ cells / dish. After 24 hours, PBS (control), carnosine 1 mM or carnosine 10 mM was added. After 24 hours, total RNA in Caco-2 cells was extracted using ISOSPIN Cell & Tissue RNA (NIPPON GENE) according to the prescribed procedure. The extracted total RNA solution was measured for RNA concentration by NanoDrop2000 (Thermo Fisher Scientific) based on the absorbance at 260 nm.

  2 μg of total RNA is subjected to Poly A addition treatment (Poly A polymerase; abm), and miRNA cDNA synthesis kit (abm) is used to synthesize cDNA of miRNA site according to the specified procedure, followed by quantitative real-time PCR It was used as a template.

  For quantitative real-time PCR, each of the forward and reverse primers at a final concentration of 300 nM, template cDNA of 500 ng or less, EvaGreen miRNA qPCR Master Mix (abm) 10 μl, sterilized water and 1 well of a 96-well PCR plate A reaction solution was used. SNORD44 primer was used as an internal standard control, and the primer was commissioned and synthesized by abm together with the target miRNA. The PCR program was carried out for 40 cycles in 3 steps of 95 ° C., 10 seconds; 63 ° C., 15 seconds; 72 ° C., 12 seconds. Samples were analyzed in triplicate. Each primer used was synthesized by abm. In addition, the ΔΔCt method was used for numerical analysis after PCR, and the target miRNA expression level was divided by the internal standard miRNA expression level.

  The results are shown in FIG. The expression level of hsa-miR-6732-5p in Caco-2 cells was significantly higher when treated with carnosine (1 mM or 10 mM) than when treated with PBS (control). In addition, the expression level was significantly higher in the 10 mM carnosine treatment than in the 1 mM carnosine treatment.

[3-2] Quantitative analysis of expression in exosomes Extract Caco-2 cell-derived exosomes as described in [2-1], and use SeraMir Exosome RNA Amplification Kit (SBI) as per the prescribed procedure. Exosome RNA was extracted. Thereafter, the experiment proceeded in the same procedure as the quantitative expression analysis in Caco-2 cells.

  The results are shown in FIG. It was suggested that the content of hsa-miR-6732-5p in exosome tends to be higher in the carnosine treatment (10 mM) than in the PBS treatment (control).

[4] Quantitative expression analysis of hsa-miR-6769-5p Among the miRNAs in which the expression level in the exosome was increased by carnosine treatment (1 mM and 10 mM) in the analysis using the microarray of [2] above. For hsa-miR-6769-5p, the expression level in Caco-2 cells and exosomes was measured by quantitative real-time PCR according to the following procedure.

[4-1] Quantitative analysis of expression in Caco-2 cells In the same procedure as [3-1], 10 mM of carnosine was added to the Caco-2 cell culture medium, and cultured for 24 hours. The expression level of hsa-miR-6769-5p was measured. The results are shown in FIG. The expression level of carnosine treatment (10 mM) was significantly higher than that of PBS treatment (control).

[4-2] Quantitative analysis of expression in exosomes In the same manner as in [3-2], Caco-2 cell-derived exosomes cultured in a medium supplemented with carnosine 10 mM were extracted, and hsa-miR in the exosomes was extracted. The content of -6769-5p was measured. The results are shown in FIG. The content of hsa-miR-6769-5p in the exosome was also significantly higher in the carnosine treatment (10 mM) than in the PBS treatment (control).

[5] Functional analysis of Caco-2 cell secretory exosome for neurons-1
[5-1] Purification of Caco-2 cell-secreted exosomes added to nerve cells CaCap-2 cell-secreted exosomes added to neurons are MagCapture Exosome Isolation PS Kit (Wako), which can purify exosomes with the highest purity. ).

First, as in the case of exosome purification using ExoQuick-TC, Caco-2 cells were seeded in a 100 mm dish at 1 × 10 ⁶ cells / dish. After 24 hours, PBS (control), carnosine 1 mM, or carnosine 10 mM was added. After 24 hours, 10 mL of the cell culture solution was collected in a 15 mL tube, and the cells in the culture supernatant were separated by centrifugation at 300 g for 5 minutes. Next, centrifugation was performed at 1200 g for 20 minutes to separate cell fragments. Furthermore, centrifugation was performed at 10,000 g for 30 minutes to separate extracellular vesicles larger than exosomes.

  The culture supernatant from which cells and large extracellular vesicles were removed was concentrated 10-fold by performing ultrafiltration. Thereafter, exosomes were purified according to the procedure specified in MagCapture Exosome Isolation PS Kit.

[5-2] Nerve cell culture and addition of Caco-2 cell secretory exosome (1) BDNF-like effect SH-SY5Y cells (human neuroblastoma), which is a neuron model cell, were used. It seed | inoculated to 96 well black plate so that it might become 6 * 10 < ³ > cells / well. One day later, cell differentiation was induced by treating retinoic acid with a final concentration of 10 μM. After 5 days, 1 μL of exosome purified as described above was added. As a positive control, BDNF was treated with 50 ng / ml. After culturing for 6 days, it proceeded to the immunostaining process. The cells were fixed with 4% paraformaldehyde for 15 minutes, washed 3 times with PBS, and then blocked at 4 ° C. for 1 hour. Thereafter, the primary antibody β3-Tubulin (Cell Signaling Technology) diluted to 1/200 was reacted overnight. After the completion of the primary antibody reaction, the plate was washed 3 times with PBS, the fluorescently labeled secondary antibody Alexa 555 (Molecular Probe) diluted to 1/1000 was reacted for 1 hour and a half, and washed again with PBS three times. After that, Hoechst33342 (Dojindo Laboratories) diluted 1/500 in DMEM medium was treated for 15 minutes to stain the cell nucleus, replaced with PBS, and observed and photographed neurite outgrowth with a confocal laser microscope. .

  A photographed image is shown in FIG. It was suggested that exosomes secreted by Caco-2 cells with carnosine treatment (10 mM) have the same effect of extending neurites as BDNF.

[5-3] Nerve cell culture and Caco-2 cell secretion exosome addition-(2) Retinoic acid-like effect As in [5-2], SH-SY5Y cells are adjusted to 6 × 10 ³ cells / well. It seed | inoculated to 96 well plate. One day later, 10 μL of the exosome purified as described above was added. As a positive control, retinoic acid was treated at a final concentration of 10 μM. After culturing for 5 days, it proceeded to the immunostaining process. Immunostaining was carried out in the same manner as in [5-2], but a Pan Neuronal Marker (Merck Millipore) diluted to 1/200 was used as the primary antibody. Subsequent processing was performed in the same manner as [5-2].

  A captured image is shown in FIG. It was suggested that exosomes secreted by Caco-2 cells with carnosine treatment (1 mM, 10 mM) have the effect of inducing differentiation into neurons similar to retinoic acid.

[6] Functional analysis of Caco-2 cell secretory exosome for neurons
Carnosine 10 mM (Exo-Car) or PBS (Exo-ctrl) as a control was added to Caco-2 cells in the same procedure as [5-1], and the culture supernatant was collected 24 hours later. Was isolated and purified (phosphatidylserine affinity method). The recovered exosomes confirmed that both Exo-Car and Exo-ctrl expressed CD9, CD63 and CD81, which are known as exosome markers (not shown). Moreover, it confirmed that the diameter of those exosomes was about 100 nm (not shown).

  Purified exosomes (Exo-Car, Exo-ctrl) are fluorescently (red) labeled with a fluorescently labeled secondary antibody, and then added to SH-SY5Y cells in the same manner as in [5-2]. Observed at. Both exosomes were confirmed to be taken up by SH-SY5Y cells (not shown).

  Purified exosomes (Exo-Car, Exo-ctrl) were added to SH-SY5Y cells in the same manner as [5-2]. After culturing for 24 hours, neurites were stained by immunostaining and examined with a fluorescence microscope. Observed. As in [5-2], when the exosome derived from Caco-2 cells treated with carnosine (Exo-Car) was added, the neurites of SH-SY5Y cells were elongated as in the case of adding retinoic acid as a control. (Not shown). In addition, the length of neurites was quantified by IN Cell Analyzer 1000 (GE Healthcare Japan). Image capture was performed based on the protocol “Aging IF Alexa555”, and image data was digitized according to the analysis protocol “Neural dendrite” included with the IN Cell Analyzer 1000 Developer software. The results are shown in FIG. The neurite outgrowth of SH-SY5Y cells by the addition of Exo-Car was also quantitatively supported.

Further, purified exosomes (Exo-Car, Exo-ctrl) were added to SH-SY5Y cells in the same procedure as [5-2], and cultured for 24 hours, followed by quantitative RT-PCR for Nestin, Vimentin and NEFM. The expression level was measured. Details are shown below. Total RNA was extracted from SH-SY5Y cells using High Pure RNA Isolation Kit (Roche, Indianapolis, IN, USA) according to the protocol. Subsequent cDNA synthesis was performed according to the protocol using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Waltahm, MA, USA), using 1.0 μg of total RNA and Oligo (dT) ₂₀ primer. For quantitative RT-PCR using the synthesized cDNA, THUNDERBIRD SYBR qPCR Mix (Toyobo) was used, and it was performed according to the protocol using the Thermal Cycler Dice Real Time PCR System. The relative gene expression level was determined by dividing by the expression value of the internal standard GAPDH. PCR primers include Nestin (5'-GAGAGGGAGGACAAAGTCCC-3 ', 5'-TCCCTCAGAGACTAGCGCAT-3'), Vimentin (5'-GTTTCCAAGCCTGACCTCAC-3 ', 5'-GCTTCAACGGCAAAGTTCTC-3'), NEFM (5'- AGACATCCACCGGCTCAAGG-3 ′, 5′-CGACGCCTCCTCGATGTCTT-3 ′) and GAPDH (5′-CGTGGAAGGACTCATGAC-3 ′, 5′-CAATTCGTTGTCATACCAG-3 ′) were used. The results are shown in FIG.

  Similarly, the expression levels of ATXN1 and SLITRK5, which are target genes of has-miR-6769b-5p, were also measured by quantitative RT-PCR. The results are shown in FIG. The addition of Exo-Car is thought to have caused neurite outgrowth by reducing the expression of ATXN1 and SLITRK5 and increasing the expression of Nestin, Vimentin and NEFM in SH-SY5Y cells.

  Similarly, the expression level of has-miR-6769b-5p in SH-SY5Y cells was also measured by quantitative RT-PCR. The results are shown in FIG. It was shown that the expression level of has-miR-6769b-5p is increased in SH-SY5Y cells by adding Exo-Car.

  In [4], it was revealed that the content of hsa-miR-6769-5p in exosomes secreted from Caco-2 cells by carnosine treatment increased, but hsa-miR-6769 was used instead of exosomes. -5p mimic (UGGUGGGUGGGGAGGAGAAGUGC, MSY0027620, Qiagen) was added to SH-SY5Y cells in the same procedure as [5-2], neurites were stained by immunostaining, and observed with a fluorescence microscope, IN Cell The neurite length was quantified with Analyzer 1000 (GE Healthcare Japan). FIG. 15 shows an image taken with a fluorescence microscope, and FIG. 16 shows a quantification result of the neurite length. It was shown that neurites can be extended by direct neuronal treatment with hsa-miR-6769-5p mimic rather than exosomes.

  From the results of the above examples, particularly due to the relationship between [4] and [6], the expression of one or more specific miRNAs increased in intestinal epithelial cells treated with carnosine (exosome regulator in the present invention). Or decreased (eg, increased expression of has-miR-6769b-5p in intestinal epithelial cells), and the content of the miRNA in exosomes secreted from intestinal epithelial cells also increased or decreased (eg, within exosomes) The content of has-miR-6769b-5p is increased), and the expression level of the miRNA is similarly increased or decreased in neurons that have incorporated the exosome (for example, the expression of has-miR-6769b-5p in neurons) Resulting in increased or decreased expression of the miRNA target gene and related genes (for example, decreased expression of ATXN1 and SLITRK5 in neurons) , As a whole, such as neurites extended, nerve cells are activated, it has been speculated that the relevant exists that. Therefore, when carnosine (the exosome-modulating agent in the present invention) is ingested and absorbed by intestinal epithelial cells, exosomes secreted from the intestinal epithelial cells move through the body and are transported to nerve cells, and receive the exosomes. It was speculated that there exists a brain-intestinal correlation that nerve cells are activated.

Claims (11)

  An agent for secreting an exosome having nerve cell activation action from intestinal epithelial cells, comprising imidazole dipeptide.   An agent for activating nerve cells, comprising exosomes secreted from intestinal epithelial cells treated with imidazole dipeptide. The content of miRNA in the exosome varies when the content of miRNA in a normal exosome is used as a reference,
The miRNAs are hsa-miR-20a-5p, hsa-miR-24-3p, hsa-miR-26a-5p, hsa-miR-92-5p, hsa-miR-92a-3p, hsa-miR-103a- 3p, hsa-miR-106a-5p, hsa-miR-194-5p, hsa-miR-320b, hsa-miR-320c, hsa-miR-619-5p, hsa-miR-937-5p, hsa-miR- 1207-5p, hsa-miR-1227-5p, hsa-miR-1343-5p, hsa-miR-3141, hsa-miR-3162-5p, hsa-miR-3196, hsa-miR-3613-3p, hsa- miR-4281, hsa-miR-4485, hsa-miR-4487, hsa miR-4507, hsa-miR-4532, hsa-miR-4668-5p, hsa-miR-4675, hsa-miR-4741, hsa-6732-5p, hsa-6675-5p, hsa-miR-6769b-5p, hsa-miR-6671-5p, hsa-miR-6775-5p, hsa-miR-679-5p, hsa-miR-6794-5p, hsa-miR-6798-5p, hsa-miR-6682-5p and hsa- is at least one selected from the group consisting of miR-8075,
The agent according to claim 1 or 2.   The agent according to claim 3, wherein the content of hsa-miR-6769-5p in the exosome is increased with reference to the content of miRNA in a normal exosome.   The agent according to any one of claims 1 to 4, wherein the imidazole dipeptide contains carnosine and / or anserine in a state of being contained in chicken or a chicken extract.   The agent according to any one of claims 1 to 5, wherein the imidazole dipeptide contains carnosine.   Treating intestinal epithelial cells with imidazole dipeptides in an in vitro environment for cultured intestinal epithelial cells or in an in vivo environment for intestinal epithelial cells in a laboratory animal; and Recovering exosomes secreted from the treated intestinal epithelial cells.   The method further comprises quantifying the recovered miRNA in the exosome and, if necessary, one or more of miRNA, mRNA or protein expressed in the treated intestinal epithelial cells. Method.   Furthermore, the collected exosome or the exosome is contained in an in vitro environment for cultured nerve cells or in an in vivo environment for nerve cells in a laboratory animal. The method according to claim 7 or 8, comprising a step of treating with a miRNA or a mimic thereof.   10. The method of claim 9, further comprising quantifying one or more of miRNA, mRNA or protein in the treated neuronal cell.   The method as described in any one of Claims 7-10 using the imidazole dipeptide contained in the agent as described in any one of Claims 1 and 3-6 as said imidazole dipeptide.