KR102285380B1 - Composition and method for inducing differentiation of neuroblast into neural cell comprising inhibitor of microRNA-24-3p - Google Patents

Abstract

The present invention relates to a composition for promoting differentiation of neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p, and a method for inducing differentiation into neurons, comprising treating the inhibitor to neuroblasts. According to the present invention, it is possible to effectively induce differentiation into neurons by down-regulating miR-24-3p, and it is expected that the differentiated neurons will be usefully used for the prevention or treatment of various neurodegenerative diseases. do.

Description

Composition and method for inducing differentiation of neuroblast into neural cell comprising inhibitor of microRNA-24-3p

The present invention relates to a composition for promoting differentiation of neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p, and a method for inducing differentiation from neuroblasts into neurons, comprising the step of treating the inhibitor to neuroblasts will be.

MicroRNA (microRNA or miRNA) is a small, highly conserved, non-coding single-stranded RNA molecule of approximately 22 nucleotides that binds to the 3'UTR of a target mRNA to degrade or inhibit mRNA translation. It is a novel substance that controls gene expression. It is known that miRNA plays an important role in various biological processes such as cell proliferation, cell differentiation, and apoptosis. Based on these biological functions of miRNAs, studies are underway to discover miRNAs involved in neuronal differentiation and to elucidate the mechanism of action (KR10-17228621).

Neurodegenerative disease refers to a disease in which motor control ability, cognitive function, perceptual function, sensory function, and autonomic nerve dysfunction occur due to the decrease or loss of nerve cell function. Neurodegenerative diseases are mainly classified according to clinical features. They are divided based on major symptoms and sites of involvement, and Alzheimer's disease (AD) and Parkinson's disease (PD) are representative, Huntington's disease and Lou Gehrig's disease. (amyotrophic lateral sclerosis; ALS) is also included.

To date, there is no fundamental treatment for neurodegenerative diseases, and most drugs that are being used or developed are drugs that target the neurotransmission process to alleviate symptoms. Fundamental treatment of neurodegenerative diseases requires the development of a fundamental treatment that can either remove the cause of the disease to restore the patient's function to normal, or prevent further progression by diagnosing and treating it at an early stage. Another method is to restore at least part of the function of damaged nerve cells, and cell therapy using neural stem cells in the absence of a fundamental therapeutic agent can provide an alternative to the treatment of various neurodegenerative diseases. Therefore, it is necessary to establish a safe differentiation technology into nerve cells through the study of differentiation mechanisms into various nerve cells during the development of the nervous system.

As a result of research efforts to discover microRNAs capable of regulating differentiation into neurons, microRNA-24-3p can effectively regulate differentiation from neuroblasts into neurons By experimentally confirming the present invention was completed.

Accordingly, an object of the present invention is to provide a composition for inducing differentiation from neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p (miR-24-3p).

Another object of the present invention is to provide a method for inducing differentiation from neuroblasts into neurons, comprising the step of treating the inhibitor of microRNA-24-3p (miR-24-3p) on the neuroblasts.

Another object of the present invention is to provide a neuronal cell differentiated by the above method and a cell therapy product comprising the neuron as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention provides a composition for inducing differentiation from neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p (miR-24-3p).

In one embodiment of the present invention, the inhibitor of miR-24-3p may be an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.

In another embodiment of the present invention, the composition can increase the expression level of synaptophysin (SYP) or the length of a neurite.

In addition, the present invention provides a method for inducing differentiation from a neuroblast to a neuron, comprising the step of treating the neuroblast with an inhibitor of microRNA-24-3p (miR-24-3p).

In an embodiment of the present invention, the method may further include culturing neuroblasts after treatment with the miR-24-3p inhibitor.

In another embodiment of the present invention, the culture may be performed for 5 to 9 days in a medium treated with retinoic acid.

In addition, the present invention provides a neuron, differentiated by the method.

In addition, the present invention provides a cell therapy agent comprising the nerve cell as an active ingredient.

In a specific example, the present inventors confirmed that when the expression of miR-24-3p was increased, differentiation into neurons was inhibited, whereas when the expression of miRNA was suppressed, differentiation into neurons was promoted. By doing so, it was confirmed that miR-24-3p negatively regulates differentiation from neuroblasts to neurons. According to the present invention, it is possible to effectively induce differentiation into neurons by down-regulating miR-24-3p, The differentiated nerve cells are expected to be usefully used for the prevention or treatment of various neurodegenerative diseases.

Figure 1 shows the differentiation of SH-SY5Y cells into neurons in order to verify the effect of microRNA-24-3p (miR-24-3p) on the differentiation of neurons 0, 5, and 7 days (Day) from the start of differentiation. These are the results of measuring the level of miR-24-3p in cells through TaqMan qPCR, respectively.
FIG. 2 shows SH-SY5Y cells were transfected with miR-24-3p mimics (miR-24-3p mimic) and control mimics and induced to differentiate into neurons. As a result of verifying the neuronal differentiation inhibitory effect, FIGS. 2a and 2b show the mRNA ( FIG. 2a ) and protein ( FIG. 2b ) expression levels of the synaptophysin (SYP) gene after 7 days of induction of differentiation into neurons, respectively. is the result of measuring and comparing, and FIGS. 2c and 2d show the results of labeling the SYP protein and observing the length of the neurite through immunofluorescence staining on the differentiation-induced cells, and quantifying it.
Figure 3 shows SH-SY5Y cells were transfected with miR-24-3p inhibitors and control inhibitors, and differentiation into neurons was induced, and then neuronal differentiation by the inhibitors. As a result of verifying the facilitation effect, FIGS. 3A and 3B are results of measuring and comparing the expression levels of mRNA (FIG. 3A) and protein (FIG. 3B) of the SYP gene 7 days after induction of differentiation into neurons, respectively, and FIG. 3c and FIG. 3d shows the results of labeling the SYP protein through immunofluorescence staining on the differentiation-induced cells, observing the length of the neurite, and quantifying it.

The present inventors have confirmed that by down-regulating miR-24-3p, differentiation from neuroblasts to neurons can be promoted, thereby completing the present invention.

Accordingly, the present invention provides a composition for inducing differentiation from neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p (miR-24-3p).

As used herein, the term “neuroblast” refers to a cell included with other types of cells, such as germ cells, central nervous system primordial, and ganglion stages, which will be differentiated into neurons or neurons in the future. The initial form is fusiform, and later, protrusions emerge from both ends. The tip is remarkably elongated during amoeba movement and finally differentiates into neurites.

As used herein, the term “neural cell” is a structural and functional unit of the nervous system and is composed of a single cell body and its projections, dendrites and neurites. In the central nervous system, it is gathered in the gray matter, and in the peripheral nervous system, it is aggregated in the ganglion.

As used in the present invention, the term “differentiation” refers to a process in which cells in an undifferentiated state in the initial stage have characteristics as individual tissues. For the purpose of the present invention, neuroblasts have characteristics as neurons means to be

As used herein, the term “microRNA (microRNA)” refers to a short non-coding RNA consisting of about 22 nucleotide sequences. It is known to function as a post-transcriptional regulator in the process of gene expression. By complementary binding to a target mRNA having a complementary nucleotide sequence, degradation of the target mRNA or translation into a protein is inhibited.

In the present invention, the inhibitor of the microRNA-24-3p (miR-24-3p) refers to a substance capable of inhibiting the expression or activity of the miR-24-3p by targeting it, As long as it has a material, there is no limitation on the type thereof, but it may be preferably an antisense oligonucleotide, and more preferably, may consist of the nucleotide sequence of SEQ ID NO: 1.

The present inventors confirmed that the inhibitor of miR-24-3p according to the present invention effectively induces differentiation from neuroblasts into neurons through specific examples.

Specifically, in one embodiment of the present invention, after differentiation of SH-SY5Y cells into neurons, the expression level of miR-24-3p in the cells was measured. As a result, on the 7th day of differentiation induction, the level of miR-24-3p was 40% It was confirmed that the decrease (see Example 2).

In another embodiment of the present invention, SH-SY5Y cells are transfected with miR-24-3p mimics, and differentiation into neurons is induced, and then the expression level of SYP, a neuron-specific gene, and the length of neurites are measured. As a result, it was confirmed that differentiation into neurons was inhibited by an increase in the expression of miR-24-3p (see Example 3).

In another embodiment of the present invention, after transfection of a miR-24-3p inhibitor into SH-SY5Y cells, differentiation into neurons is induced, and the expression level of SYP, a neuron-specific gene, and the length of neurites are measured. As a result of the measurement, it was confirmed that differentiation into neurons was promoted by suppression of miR-24-3p expression (see Example 4).

Accordingly, as another aspect of the present invention, the present invention provides a method for inducing differentiation from neuroblasts into neurons, comprising the step of treating the inhibitor of microRNA-24-3p (miR-24-3p) in the neuroblasts. .

In the present invention, the treatment of the miR-24-3p inhibitor may preferably be transfection into neuroblasts, and the transfection is appropriately selected by a person skilled in the art according to methods and conditions commonly used in the art. can be done by

In the present invention, the method may further include culturing neuroblasts after the miR-24-3p inhibitor treatment, specifically for 5 to 9 days, preferably 6 to 9 days in a medium treated with retinoic acid (RA). It may be cultured for 8 days, more preferably about 7 days, but is not limited thereto as long as it is a culture condition capable of differentiating neuroblasts into neurons.

As another aspect of the present invention, the present invention provides a nerve cell differentiated according to the differentiation method and a cell therapy product comprising the nerve cell.

In the present invention, the cell therapy agent is a drug (US FDA regulations) used for the purpose of treatment, diagnosis, and prevention with cells and tissues manufactured through separation, culture, and special masturbation from humans, and restores the function of cells or tissues. It refers to a drug used for the purpose of treatment, diagnosis and prevention through a series of actions such as proliferating or selecting living autologous, allogeneic, or xenogeneic cells in vitro or changing the biological properties of cells in other ways. Cell therapy products are largely classified into somatic cell therapy and stem cell therapy according to the degree of cell differentiation.

In the present invention, the cell therapy agent can be used for the prevention or treatment of neurodegenerative diseases, and neurodegenerative diseases typically include Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, etc., but differentiated nerve cells If it is a disease that can exhibit a therapeutic effect by using it as a cell therapy agent, it is not limited to the above type.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental materials and methods

1-1. experimental material

DMEM (Dulbecco's modifed Eagle medium) containing L-glutamine required for cell culture, high-concentration glucose, pyruvate, and fetal bovine serum (FBS) were obtained from Gibco (Grand Island, NY, USA). All-trans retinoic acid (ATRA) was purchased from Sigma-Aldrich (St Louis, MO, USA), and penicillin/streptomycin and trypsin/EDTA were purchased from WelGENE, Inc. (Daegu, Korea). Purchased. Anti-synaptophysin (SYP) antibody (#ab32127) from Abcam (Cambridge, UK), anti-calnexin antibody (#ADI-SPA-860-F) from Enzo Life Sciences (Farmingdale, NY) , USA), and the secondary antibody, Alexa Fluor® 488-conjugated secondary goat anti-rabbit IgG (H+L) antibody (#A-11008), was purchased from Invitrogen (Carlsbad, CA, USA). All other compounds were prepared as analytical grade.

1-2. Cell culture and differentiation conditions

SH-SY5Y cells were cultured in DMEM medium supplemented with heat-inactivated 10% FBS and 1% penicillin/streptomycin at 37° C., 5% CO ₂ condition, and the culture medium was replaced once every 2 days. For differentiation into neurons, SH-SY5Y cells were treated with 50 μM retinoic acid (RA) for 5 or 7 days, and the culture medium was replaced with a 50 μM RA-containing one every other day.

1-3. Transfection of microRNA (miRNA) mimics and inhibitors

Mimic and negative control miRNAs of microRNA-24-3p (miR-24-3p) were synthesized by Genolution, and a sequence-specific miR-24-3p inhibitor (cat. no. IH-) 300497-05-0005, miRIDIAN microRNA Human hsa-miR-24-3p-Hairpin Inhibitor) and a complementary non-specific control (cat. no. IN-001005-01-20, miRIDIAN microRNA Hairpin Inhibitor Negative Control #1) were obtained from Dharmacon purchased from the company. The sequences of miR-24-3p mimics and inhibitors are shown in Table 1 below. For transfection of the mimics or inhibitors, SH-SY5Y cells were aliquoted one day before transfection, and each of the mimics or inhibitors was transiently transfected into the cells using Lipofectamine RNAiMAX transfection reagent.

designation sequence (5'-3') SEQ ID NO: miR-24-3p inhibitor CUGUUCCUGCUGAACUGAGCCA One miR-24-3p mimic UCGCCUAAUGGUCUCUGAGCCAUU 2 Mimic negative control UUGUACUACACAAAAAGUACUGUU 3

1-4. RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from the cultured cells using RNAiso Plus (Takara Bio Inc., Ohtsu, Japan). Then, 300 ng of purified total RNA was subjected to reverse transcription using GoScript™ reverse transcriptase and random primers (Promega Corporation, Madison, WI, USA) to synthesize cDNA for qPCR. PCR conditions were 10 min at 95°C, followed by 40 repetitions of 15 s at 95°C and 1 min at 60°C, each sample was tested in duplicate and at least three samples were analyzed in independent experiments. Relative quantification was performed using the 2- ^ΔΔCt method, gene expression was corrected with GAPDH as an internal control, and primer sequences specific for the SYP and GAPDH genes used are shown in Table 2 below.

gene direction sequence (5'-3') SEQ ID NO: SYP Forward CAACACCTCGGTGTGTGTTCG 4 Reverse CCTGAGGCCCGTAGGAATC 5 GAPDH Forward CAAGATCATCAGCAATGCC 6 Reverse CTGTGGTCATGAGTCCTTCC 7

1-5. Western blotting

Cells were lysed with cold hypotonic lysis consisting of 10 mM Tris-HCl (pH 7.5), 10 mM NaCl, 10 mM EDTA, 0.5 % Triton X-100 and Complete™ EDTA-free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, USA). It was dissolved with a lysis buffer. Protein samples of 15-30 μg were electrophoresed using NEXT GEL® 15% polyacrylamide gel (Amresco, Solon, OH, USA) and then transferred to a PVDF membrane (Merck Millipore, Darmstadt, Germany). Next, the membrane was treated with 5% non-fat dried milk and blocked for 1 hour, and rabbit anti-SYP antibody (1:20,000) and anti-calnexin (1:2000) antibody were treated and reacted, respectively. . Thereafter, the HRP-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA) was diluted 1:2000 and reacted, using enhanced chemiluminescence (Thermo Fisher Scientifc, Rockford, IL, USA) specific protein band was detected and the protein expression level was quantified using Image J software.

1-6. Immunofluorescence staining

Cells were cultured on coverslips in each well of a 24-well plate, fixed with 0.1% (w/v) picric acid/PBS containing 4% (w/v) para-formaldehyde, and then anti-SYP Antibody (1:200) was treated and incubated overnight at 4°C. After incubation with Alexa Fluor® 488-conjugated goat anti-rabbit IgG secondary antibody diluted 1:2000, cells were mounted on slides with Vectashield, and SYP-positive cells were photographed under a fluorescence microscope. Neurite outgrowth was assessed by measuring the neurite length in all positively identified neurite-containing cells, and the average neurite length per cell was calculated using Image J software.

The length of the primary neurite was defined as the distance from the cell body (soma) to the end of the branch, and for this analysis, it was arbitrarily defined as the neurite having the cell body when it was 25 μm or more (average diameter of the cell body). In each graph, neurite length measurements were generated from randomly selected regions in at least 5 independent cultures from 3 independent experiments, and more than 100 cells were measured for each condition in each experiment.

1-7. TaqMan RT-qPCR of miRNAs

To measure endogenous miRNA expression levels, 10 ng of purified total RNA was reverse transcribed using TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The resulting cDNA was amplified by PCR using TaqMan® MicroRNA Assay (Applied Biosystems) according to the manufacturer's instructions. cDNA amplification and detection was performed using the CFX Connect™ real-time PCR detection system under the following conditions: Initial denaturation at 95°C for 10 minutes, followed by 40 repetitions of the process for 15 seconds at 95°C and 1 minute at 60°C. The threshold cycle (Ct) value for miR-24-3p was automatically determined within the linear amplification step, and the ΔCt value was calculated by correcting it with the control U6 snRNA value. The relative difference between miR-24-3p expression levels (ΔΔCt) in isolated cells was calculated and expressed as fold induction (2 ^-ΔΔCt ).

1-8. statistical analysis

All quantitative data are presented as mean±standard error of the mean (SEM). In each experiment, all measurements were performed at least three times, data were analyzed using a two-tailed, unpaired Student's t test, and a P value of <0.05 was considered statistically significant.

Example 2. Verification of the regulation of differentiation of miR-24-3p into neurons

As a result of research to discover microRNAs that can affect the differentiation of neurons, the present inventors determined that miR-24-3p has the potential to regulate the differentiation of neuroblasts into neurons and tried to verify its effect. .

First, in order to examine the change in the expression level of miR-24-3p during differentiation into neurons, SH-SY5Y cells were differentiated into neurons according to the method of Example 1-2, and then described in Examples 1-7. The levels of miR-24-3p were quantified via TaqMan qPCR analysis. As a result, as shown in FIG. 1 , it was confirmed that on the 7th day (Day 7) after differentiation induction, the miR-24-3p level was reduced by about 40% compared to the start of differentiation (Day 0). Through this, it was found that miR-24-3p negatively regulates neuronal differentiation and can promote differentiation into neurons by inhibiting the expression of miR-24-3p.

Example 3. Verification of the inhibitory effect on neuronal differentiation by miR-24-3p increase

In order to verify the results obtained in Example 2, the present inventors investigated the effect on differentiation into neurons using miR-24-3p mimics.

For this, SH-SY5Y cells were transfected with miR-24-3p mimics (miR-24-3p mimic) and control mimics according to the method of Example 1-3, followed by RA treatment and induced differentiation into neurons for 7 days. As a result of measuring the expression level of synaptophysin (SYP), a neuron-specific gene, in the differentiation-induced neurons after 7 days, miR-24-3p mimics were produced as shown in FIGS. 2a and 2b, respectively. When transfected, the mRNA and protein levels of SYP were significantly reduced compared to the control.

In addition, according to the method described in Example 1-6, the differentiation-induced neurons were immunostained using an anti-SYP antibody, and the length of the neurites was measured by observing it under a fluorescence microscope. As a result, as shown in FIG. 2c , when the miR-24-3p mimic was transfected, neurite growth was significantly reduced compared to the control group. could also be verified through . Through the above results, it was found that when the expression of miR-24-3p was increased, differentiation into neurons was inhibited.

Example 4. Verification of neuronal differentiation promoting effect by miR-24-3p inhibition

In addition to the results of Example 2, the present inventors, on the contrary, tried to verify whether differentiation into neurons is promoted when the miR-24-3p inhibitor is treated.

To this end, according to the method of Example 1-3, miR-24-3p inhibitor (miR-24-3p inhibitor) and control inhibitor (Control inhibitor) were transfected into SH-SY5Y cells and then treated with RA and 7 Differentiation into neurons was induced for one day. As a result of measuring the expression level of SYP, a neuron-specific gene, in the differentiation-induced neurons after 7 days, as shown in FIGS. 3a and 3b, respectively, when transfected with an inhibitor of miR-24-3p, SYP mRNA and It was found that the protein level was significantly increased compared to the control.

In addition, as a result of immunostaining the differentiation-induced neurons using an anti-SYP antibody and observing them under a fluorescence microscope, as shown in FIG. 3c , when the miR-24-3p inhibitor was transfected, the growth of neurites was reduced compared to the control group. was significantly increased, and this result could also be confirmed through the quantitative result of neurite length in FIG. 3D . From the above results, it was found that when the expression of miR-24-3p was suppressed, differentiation into neurons was promoted.

Collectively, these results demonstrate that miR-24-3p negatively regulates neuronal differentiation, and can promote neuroblast-to-neuronal differentiation by inhibiting the miRNA.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> IUCF-HYU (Industry-University Cooperation Foundation Hanyang University) <120> Composition and method for inducing differentiation of neuroblast into neural cell comprising inhibitor of microRNA-24-3p <130> PD19-255 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-24-3p inhibitor <400> 1 cuguuccugc ugaacugagc ca 22 <210> 2 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> miR-24-3p mimic <400> 2 ucgccuaaug gucucugagc cauu 24 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> mimic negative control <400> 3 uuguacuaca caaaaguacu guu 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SYP_Forward <400> 4 caacacctcg gtggtgttcg 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SYP_Reverse <400> 5 cctgaggccc gtaggaatc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_Forward <400> 6 caagatcatc agcaatgcc 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_Reverse <400> 7 ctgtggtcat gagtccttcc 20

Claims (9)

A composition for inducing differentiation from neuroblasts into neurons, comprising an inhibitor of microRNA-24-3p (miR-24-3p),
The inhibitor is an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, the composition for inducing differentiation.
delete According to claim 1,
The composition is synaptophysin (synaptophysin; SYP), characterized in that increasing the expression level or the length of the neurite, the composition for inducing differentiation.
A method for inducing differentiation from neuroblasts into neurons in vitro , comprising the step of treating the inhibitor of microRNA-24-3p (miR-24-3p) on the neuroblasts,
The method for inducing differentiation, characterized in that the inhibitor is an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.
delete 5. The method of claim 4,
Method for inducing differentiation, characterized in that it further comprises the step of culturing neuroblasts after the miR-24-3p inhibitor treatment.
7. The method of claim 6,
The culture is characterized in that made in a medium treated with retinoic acid for 5 to 9 days, differentiation induction method.
delete delete

Images