JP2018504402A - Olfactory ligand - Google Patents

Abstract

The present invention provides analogs of (S) -germacrene D analogs that have improved insect repellent properties or insect attractant properties compared to (S) -germacrene D analogs. [Selection] Figure 6

Description

  The present disclosure relates to an olfactory ligand, a composition comprising the olfactory ligand, and a method for producing the ligand. Further disclosed are modified enzymes that convert a substrate into the olfactory ligand.

  With the ever-increasing world population and resulting growing demand for agricultural products, there is an increasing need for more effective and improved plant breeding and crop protection methods. Agricultural pests such as insects cause considerable yield loss, and current pest control relies on the application of pesticides. However, the development of resistance to pesticides and their frequent adverse effects on human health and the environment necessitates the development of suitable replacement compounds for currently used compounds.

  Semiochemicals are a class of substances that mediate homologous and heterogeneous transmission between homologous or heterogeneous species. The process by which these signals are recognized is called olfaction, the process by which olfactory signals or ligands are recognized by olfactory recognition proteins, resulting in individual responses. These olfactory recognition proteins are very specific and can distinguish even structurally related compounds. Semiochemicals are important recognition cues in fragrances and cosmetics or foods and beverages and play a role in the control of pests, especially insects, and are therefore highly in demand compounds. However, semi-chemicals are usually very volatile and unstable compounds, and their chemical synthesis is very expensive.

  Terpenes and terpenoids are a large and diverse group of organic compounds commonly found in plants, ranging from essential primary molecules to more complex secondary metabolites, which are known to have semiochemical properties. Pesticide compounds and formulations containing terpenoids are disclosed in WO2013 / 191758. Terpenes and terpenoids are hydrocarbons composed of isoprene subunits that then exhibit a carbon skeleton that undergoes further modification. Utilizing the main building blocks isopentenyl diphosphate (IDP) and dimethylallyl diphosphate (DMADP), the terpenoid precursors geranyl diphosphate (GDP), farnesyl diphosphate (FDP) and geranylgeranyl diphosphate (GGDP) The initial central step in terpenoid biosynthesis leading to the synthesis of) is well characterized. Terpenes are classified into hemiterpenes (one isoprene subunit), monoterpenes (two isoprene subunits), sesquiterpenes (three isoprene subunits), etc. in order according to the number of isoprene subunits.

  Terpenes and terpenoids are interesting targets for synthetic modification, but regulation of their natural properties can lead to new medical and agrochemical compounds with improved and altered functions. The complexity and chemical instability of the hydrocarbon skeleton of many terpenoids, particularly semiterochemical terpenoids, can present challenges to synthetic chemists. Synthetic biology techniques are used to prepare natural terpenoids utilizing the entire biochemical pathway in an organism, or to repel or attract insects or other organisms, such as those disclosed in US Patent Publication 2014/0173771. It focuses on increasing the production of endogenous terpenoids in plants. However, the substrate for enzymes thought to be involved in terpenoid synthesis is limited in the cell and does not cause the production of modified terpenoids with altered properties.

  Germaclen D is known to repel insects, particularly aphids such as the cereal aphids (Sitobion avenae), and therefore, the production of analogs of German magnolia D that may have altered properties is of interest.

  Cascon et al., Chem. Commun. 48, 9702-9704 (2012), describes the synthesis of various germanium D analogs using fluorine and methyl modified FDP as substrates for (S) -germacrene D synthase (GDS). In particular, they synthesized 6-F, 14-F, 15-F and 14-methyl analogs.

  However, it has been found that these German Mclene D analogs have lower activity compared to German Mclene D.

According to one aspect of the invention,
Formula (I):

(Where
R ¹ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ² is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁴ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁵ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl)
Of (S) -germacrene D analog.

Cascon et al. (Chem. Commun., 48, 9702-9704 (2012)) cannot synthesize a compound having a methyl group at the 15-position (that is, the position of R ^{3 in} the aforementioned general formula (I)). Teach that. However, the inventors have now successfully obtained compounds having a substituent at position 15 using a modification of the method described by Cascon et al. And found that they have very surprising properties. Yes.

Suitably in the compound of general formula (I), R ¹ is H, methyl or ethyl, more suitably H or methyl. Even more suitably, R ¹ is H.

In the compounds of general formula (I), R ² is suitably H, methyl or ethyl, more suitably H or methyl.

In the compounds of general formula (I), R ³ is methyl or ethyl, more suitably methyl.

Suitably in the compound of general formula (I) R ⁴ is H, methyl or ethyl, more suitably H or methyl. Even more suitably R ⁴ is H.

Suitably in the compound of general formula (I) R ⁵ is H, methyl or ethyl, more suitably H or methyl. Even more suitably R ⁵ is H.

Compounds of formula (I) wherein R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl and R ¹ , R ² and R ⁴ are hydrogen have insect repellent properties.

Thus, in some suitable compounds of general formula (I):
Each of R ¹ , R ² and R ⁴ is H;
R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁵ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl.

More suitably, in such compounds R ⁵ is H, methyl or ethyl, in particular H or methyl, in particular H.

Even more suitable compounds of the general formula (I) are
Each of R ¹ , R ² , R ⁴ and R ⁵ is H;
A compound in which R ³ is methyl or ethyl.

Compounds of formula (I) where R ³ is methyl and R ¹ , R ² , R ⁴ and R ⁵ are hydrogen have been shown to have much higher insect repellent activity than compounds synthesized by Cascon et al. This compound is therefore very suitable.

Other suitable compounds of formula (I) are those wherein R ² , R ³ and R ⁵ are each independently methyl, ethyl, n-propyl, iso-propyl or cyclopropyl and R ¹ and R ⁴ are H It is a compound which is.

More suitably, in such compounds R ⁵ is H, methyl or ethyl, in particular H or methyl, in particular H.

Even more suitable compounds of the general formula (I) are
Each of R ¹ , R ⁴ and R ⁵ is H;
A compound in which each of R ² and R ³ is independently methyl or ethyl.

Surprisingly, the compounds of general formula (I) in which R ² and R ³ are both methyl and R ¹ , R ⁴ and R ⁵ are hydrogen showed opposite activities and had strong insect attracting properties .

As discussed previously, a very suitable compound of general formula (I) is a compound ((S) -15-methyl) wherein R ³ is methyl and R ¹ , R ² , R ⁴ and R ⁵ are hydrogen. Germacrene D), or a compound ((S) -14,15-dimethylgermacrene D) in which R ² and R ³ are both methyl and R ¹ , R ⁴ and R ⁵ are hydrogen.

The compound of general formula (I) is
General formula (II):

(Wherein R ¹ , R ² , R ³ , R ⁴ and R ⁵ are as defined in formula (I))
Or a salt thereof can be synthesized by incubating with germane D synthase (GDS).

  Suitably the germane D synthase is a recombinant (S) -germacklen D synthase polypeptide, which may be a recombinant polypeptide produced in any suitable organism, for example E. coli.

  The recombinant GDS can include a tag sequence at the N- or C-terminus, specifically a polyhistidine tag. Suitably, the GDS may include a C-terminal polyhistidine tag, such as a hexahistidine tag.

  Contrary to the teachings of Cascon et al., We have found that the native german maclene D synthase from Solidago canadensis SEQ ID NO: 1 (I. Prosser et al., 2002, 60, 691-702; O. Schmidt et al., Chirality, 1999, 11, 353-362; N. Bullow and WA Koning, Phytochemistry, 2000, 55, 141-168) using small amounts of the general formula (I ) Has been found available.

However, by using rational techniques and exploiting the chemistry-biological properties of (S) -germacrene D synthase (GDS), by reducing the specific aspect of steric hindrance for new substrates, improved substrate Docking can be done. Thus, by comparing the sequence alignment of GDS and 5-epi-Aristolochen synthase, and comparison of aromatic residues at or near the active site, we may be in close proximity to the substrate during the catalytic cycle. A residue could be identified. In particular, Y406 of GDS is a conserved residue corresponding to Y404 in 5-epi-Aristolochen synthase and is probably involved in ensuring the correct ring closure, and thus the folding farnesyl chain in the active site. Close to both ends. Thus, since the hydrogen atoms at positions 14 and 15 of (S) -germacrene D are adjacent to YDS of GDS and its ionization orbitals, this tyrosine is sterically small but similar in terms of electron density. Can be substituted by phenylalanine. Indeed, this site-directed mutagenesis enzyme, (S) -germacrene D synthase, Y406F, is even more effective as a synthase, particularly with respect to the formation of compounds of general formula (I), and compounds with R ² being H and R ² Were compounds using the modified enzyme with isolated yields of 45% and 73%, respectively.

  Therefore, it is appropriate that the GDS enzyme used in the production of the compound of general formula (I) is modified to have an alternative residue in place of the tyrosine residue at position 406 of the natural enzyme. Suitably tyrosine residues are substituted by smaller residues such as phenylalanine, leucine, isoleucine, valine or alanine, with phenylalanine being particularly suitable.

  Modified GDS polypeptides form a further aspect of the invention.

In another further aspect of the invention,
A nucleic acid sequence encoding a modified GDS polypeptide;
Vectors comprising the nucleic acid sequences and cells transfected or transformed with the nucleic acid molecules or vectors are provided.

  Suitably the vector is an expression vector adapted to express a nucleic acid molecule according to the invention.

  The cell may be a eukaryotic cell or a prokaryotic cell. For example, the cells can be selected from the group consisting of fungal cells, insect cells, plant cells, bacterial cells.

  Suitable bacterial and fungal cells include E. coli cells and S. cerevisiae cells, with E. coli cells being particularly suitable.

  When microorganisms are used as organisms in the method according to the present invention, they are grown or cultured in a manner familiar to those skilled in the art depending on the host organism. In principle, while supplying oxygen at a temperature between 0 ° C. and 100 ° C., preferably between 10 ° C. and 60 ° C., usually in the form of sugar, nitrogen source, usually an organic nitrogen source such as yeast extract, Alternatively, the microorganisms are grown in a liquid medium containing a carbon source in the form of trace elements such as salts such as ammonium sulfate, iron salts, manganese salts and magnesium salts, and vitamins where appropriate.

  The pH of the liquid medium may be kept constant during the culture period, i.e. may or may not be adjusted. The culture can be grown in batch, semi-batch, or continuously. Nutrients can be provided semi-continuously or continuously early in the fermentation or supply. The product produced is isolated from the organism as described previously by methods known to those skilled in the art, for example by extraction, distillation, crystallization, precipitation with salts, if appropriate, and / or chromatography. can do. For this purpose, it is advantageous that the organism can be destroyed in advance. During this process, the pH value is advantageously kept between pH 4 and 12, preferably between pH 6 and 9, particularly preferably between pH 7 and 8.

  Overview of the known culture methods, didactic book by Chmiel (Bioprozesstechnik1.Einfuhrung in die Bioverfahrenstechnik [Bioprocess technology1.Introduction to Bioprocess technology] (Gustav Fischer Verlag, Stuttgart, 1991)), or in instructional book by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and peripheral equipment] (Vieweg Verlag, Brunswick / Wiesbaden, 1994)).

  The culture medium used must be appropriately matched to the requirements of the strain in question. A description of culture media for various microorganisms can be found in the instructional book “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington DC, USA, 1981).

  As previously described, these media that can be utilized in accordance with the present invention typically contain one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.

  Preferred carbon sources are saccharides such as monosaccharides, disaccharides or polysaccharides. Examples of carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugar can also be added to the medium via complex compounds such as molasses or other by-products from sugar purification. The addition of a mixture of various carbon sources can also be advantageous. Other possible carbon sources are oils and fats such as eg soybean oil, sunflower oil, peanut oil and / or coconut fat, eg fatty acids such as palmitic acid, stearic acid and / or linoleic acid, eg glycerol, methanol and / or Alcohols such as ethanol and / or polyhydric alcohols and / or organic acids such as acetic acid and / or lactic acid. The nitrogen source is usually an organic or inorganic nitrogen compound or a substance containing these compounds. Examples of nitrogen sources are solution or gaseous ammonia, or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, other nitrates, urea, amino acids, or corn steep liquor, soybean powder, soybean Contains complex nitrogen sources such as protein, yeast extract, meat extract and others. The nitrogen sources can be used individually or as a mixture.

  Inorganic salt compounds that may be present in the medium include calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron chlorides, phosphites and sulfates.

  For example, inorganic sulfur-containing compounds such as sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, or other organic sulfur compounds such as mercaptans (thiols) to produce sulfur-containing fine chemicals, especially methionine It can be used as a sulfur source.

  Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate, or the corresponding sodium-containing salt can be used as the phosphite source.

  A chelating agent can be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols such as catechol or protocatechuate, and organic acids such as citric acid.

  The fermentation medium used according to the invention for culturing microorganisms usually also contains other growth factors such as vitamins or growth promoters including for example biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate and pyridoxine. Growth factors and salts are often derived from complex medium components such as yeast extract, molasses and corn steep liquor. In addition, a suitable precursor can be added to the culture medium. The exact composition of the media compounds is highly dependent on the individual experiment and is determined individually for each embodiment. Information on medium optimization can be found in the textbook “Applied Microbiol. Physiology, A Practical Approach” (Editors PM Rhodes, PF Stanbury, IRL Press (1997) 53-73, IS7301). be able to. Growth media such as Standard 1 (Merck) or BHI (for brain heart infusion, DIFCO) can also be obtained from suppliers.

  All media components are sterilized either by heat (1.5 bar and 121 ° C. for 20 minutes) or by filter sterilization. The components can be sterilized either collectively or separately if necessary. All media components may be present at the beginning of the culture, or can be added in a continuous or batch format if desired.

  The culture temperature is usually between 15 ° C and 45 ° C, preferably 25 ° C to 40 ° C and can be kept constant or can be changed during the experiment. The pH of the medium should be in the range of 5-8.5, and is preferably about 7.0. The pH related to the culture can be adjusted during the culture by adding a basic compound such as sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia, or an acidic compound such as phosphoric acid or sulfuric acid. For example, foaming can be controlled by using an antifoaming agent such as a fatty acid polyglycol ester. In order to maintain the stability of the plasmid, an appropriate substance having a selective effect, such as an antibiotic, can be added to the medium. The aerobic state is maintained by introducing oxygen or an oxygen-containing gas mixture, such as ambient air, into the culture. The temperature of the culture is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. Continue culturing until formation of the desired product is maximized. This objective is usually achieved within 10 to 160 hours.

  The fermentation broth thus obtained, in particular a fermentation broth containing polyunsaturated fatty acids, usually contains a dry mass of 7.5% to 25% by weight.

  The fermentation broth can then be further processed. The biomass can be completely or partially removed from the fermentation broth according to requirements, for example by separation methods such as centrifugation, filtration, decanting, etc., or a combination of these methods, or left completely in the broth be able to. The biomass is advantageously treated after its separation.

  However, the fermentation broth can also be enriched or concentrated without separating the cells using known methods such as, for example, rotary evaporator, thin film evaporator, falling membrane evaporator, reverse osmosis, or nanofiltration. it can. Finally, the concentrated fermentation broth can be processed to obtain the fatty acids present therein.

  As discussed previously, compounds of general formula (I) have semiochemical properties and act as either insect repellents or insect attractants.

Thus, in a further aspect of the invention, the compound of general formula (I) is (S) -14,15-dimethylgermacrene D (ie R ² and R ³ are methyl and R ¹ , R ⁴ and R ⁵ are An insect repellent composition comprising a compound of general formula (I) as defined above and a suitable carrier is provided, provided that it is not a compound of general formula (I) which is H.

  The term “carrier” refers to a natural or synthetic organic or inorganic component that, in combination with an active ingredient, facilitates application. The composition according to the present invention may be a solid or a fluid, and the fluid includes gaseous and liquid forms.

Compounds of general formula (I) suitable for use in insect repellent compositions are:
Each of R ¹ , R ² and R ⁴ is H;
R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
A compound wherein R ⁵ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl.

More suitably in insect repellent compositions, R ⁵ of general formula (I) is H, methyl or ethyl, in particular H or methyl, in particular H.

Even more suitable compounds of general formula (I) for use in insect repellent compositions are those in which each of R ¹ , R ² , R ⁴ and R ⁵ is H and R ³ is methyl or ethyl . In the insect repellent composition, the compound of general formula (I) is (S) -15-methylgermacrene D, ie, the general formula where R ¹ , R ² , R ⁴ and R ⁵ are H and R ³ is methyl. Most preferably, it is the compound (I).

  Insect repellent compositions include one or more additional insect repellent compounds such as allethrin, DEET (N, N-diethyl-m-toluamide), p-menthane-3,8-diol (PMD), picaridin, bailepel ( Bayrepel), KBR3023, nepetalactone, citronella oil, neem oil, Bogmyrtle, dimethylcarbate, tricyclodecenyl allyl ether, IR3535 (3- [N-butyl-N-acetyl] -aminopropionic acid, ethyl Ester) or anthranilate insect repellent.

  In one embodiment, the insect repellent composition may be suitable for human or animal application, such as skin application, in which case the carrier is suitable for pharmaceutical or veterinary application to the skin .

In an alternative embodiment, the compound of formula (I) is not (S) -15-methylgermacrene D (ie, the compound of general formula (I) wherein R ² is hydrogen). An insect-attracting composition comprising a compound of the present invention and a suitable carrier is provided.

  The carrier may be as previously described for the insect repellent composition.

Compounds of formula (I) suitable for use in insect attractant compositions are each wherein R ² , R ³ and R ⁵ are independently methyl, ethyl, n-propyl, iso-propyl or cyclopropyl; A compound in which R ¹ and R ⁴ are both H.

For compounds of general formula (I) that are more suitable for use in insect attractant compositions:
Each of R ¹ and R ⁴ is H;
Each of R ² and R ³ is independently methyl, ethyl, n-propyl, iso-propyl or cyclopropyl and R ⁵ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl, but in particular H.

Compounds of general formula (I) that are particularly suitable for use in insect attractant compositions are:
Each of R ¹ , R ⁴ and R ⁵ is H;
A compound in which each of R ² and R ³ is independently methyl or ethyl.

In the insect attractant composition, the compound of general formula (I) is (S) -14,15-dimethylgermacrene D, ie each of R ¹ , R ⁴ and R ⁵ is H and each of R ² and R ³ Suitably the compound is a methyl.

  In some cases, the insect attractant composition also includes an insecticide.

  Insecticides are substances that are toxic to insects and have a wide range of applications in agriculture, public health, industry, and household and commercial uses. Typically, insecticides are classified based on their structure and mode of action. For example, many insecticides act on the insect nervous system (eg, cholinesterase (ChE) inhibition), while other insecticides act as growth regulators or endotoxins.

  In addition, the insect attractant composition is selected from the group consisting of rubber, polyten, hollow fiber, plastic sandwich, plastic membrane and cellulosic material so that the attractant is released over a period of days at a concentration effective to attract insects. Controlled release media may be included.

  The insect attracting composition of the present invention can be used in combination with an insect trapping device, and therefore, in a further aspect of the present invention, an insect trapping device comprising the insect attracting composition of the present invention is provided.

  Insect attracting compositions act as food for insects such as ants, cockroaches, flies, aphids, mosquitoes or moths. In particular, the composition may be an aphid attractant such as a cereal aphid (Sitobion avenae).

  In some cases, the composition may be a sustained release composition containing the sustained release medium described above.

  The insect trapping device can also include an insecticide, which can be included in the insect attractant composition, or alternatively can be provided as a separate composition.

  According to one aspect of the present invention there is provided a composition according to the present invention for use in the treatment of insect infestation in an animal or plant. The composition may be a repellent composition, in which case the composition can be applied to animals or plants. Alternatively, the composition can be an attractive composition, in which case the composition can be applied to a site near a plant, such as an insect trapping device.

  The animal undergoing insect infestation can be a mammal, which can be either a human or a non-human mammal such as a cat, dog, rodent, cattle, sheep, poultry or pig.

  Plants that are subject to insect infestation may be tree plants such as poplar, eucalyptus, Douglas fir, pine, walnut, ash, birch, oak, teak, spruce. Alternatively, the plant may be a cereal plant, such as corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), Alfalfa (Medicago sato). (Oryza sativa), rye (Secale celery), sorghum (Sorghum bicolor), sorghum bulgare, sunflower (helianthus lithu) Estibum (Tritium aestivum)), soybean (Glycine max), ta Coconut (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gothypium hirsatum), sweet potato (mosa eus (plum)) (Manihot esculenta), coffee (Coffea spp.), Coconut (Cocos nucifera), pineapple (Ana comosus), citrus tree (Citrus sp. )), Cocoa (Theobroma cacao), Tea (Chanoki) Camellia senensis), banana (Musa spp.), Avocado (Persea americana), fig (Ficus casica)), guava (Psidium guaj), Mangifer indica), olives (Olea europaea), papaya (Carica paya), cashew (Anacardium occidentale), macadamia incaria Amendow (Prunus amygdalus), Te Sai (sugar beet (Beta vulgaris)), can be selected oats, barley, vegetables and ornamental plants.

  Compositions of the present invention include cereal plants (e.g. cereals and beans, maize, wheat, barley, rye, potato, tapioca, rice, sorghum, millet, cassava, barley, peas, e.g. cotton, soybeans, safflowers, sunflowers, More suitable for use in the protection of oilseed plants such as rape, maize, alfalfa, palm, coconut, or legumes and other root systems, tubers or seed grains. Sugar beet, maize, sunflower, soybean, and sorghum.Horticultural plants to which the present invention can be applied include lettuce, endive, and cruciferous vegetables including cabbage, broccoli, and cauliflower, and carnations and sprouts. The present invention provides tobacco, cucurbitaceae, carrot , Strawberry, sunflower, tomato, pepper, chrysanthemum, leguminous plants include common bean and peas, which include guar, locust bean, fenugreek, soybean, garden bean, cowpea, yaenali, Lima beans, faba beans, lentils, chickpeas, etc. are included.

  According to one aspect of the present invention, there is provided a method of repelling insects comprising providing an insect repellent composition according to the present invention to an area affected by insect invasion.

  According to one aspect of the present invention, there is provided a method for attracting insects comprising providing an insect attractant composition according to the present invention to a region affected by insect invasion.

  In this specification, unless the context otherwise requires the vocabulary or the necessary implications, the phrases “comprise” or variations such as “comprises” or “comprising” are used in a comprehensive sense, That is, the presence of the referenced feature is clearly indicated, but does not exclude the presence or addition of additional features in various embodiments of the invention.

  The invention will now be described in more detail with reference to examples and drawings.

Derived from incubation of 14,15-dimethylfarnesyl diphosphate (compound of general formula (II) in which R ¹ , R ⁴ and R ⁵ are H and R ² and R ³ are methyl) with Y406F-GDS-His ₆ FIG. 3 is a gas chromatogram of a pentane extractable product. (S) -14,15-dimethylgermacrene D (compound of general formula (I) in which R ¹ , R ⁴ and R ⁵ are H and R ² and R ³ are methyl) eluting at 32.83 minutes. FIG. 5 is a mass spectrum of the product eluted at 32.83 minutes from incubation of 14,15-dimethylfarnesyl diphosphate and Y406F-GDS-His6. Extraction of pentane from incubation of 15-dimethylfarnesyl diphosphate (compound of general formula (II) wherein R ¹ , R ² , R ⁴ and R ⁵ are H and R ³ is methyl) and Y406F-GDS-His6 It is a figure of the gas chromatogram of a product. 15-Methyl (S) -germacrene D (a compound of general formula (I) in which R ¹ , R ² , R ⁴ and R ⁵ are H and R ³ is methyl) eluting at 29.54 minutes. FIG. 5 is a mass spectrum of the product eluted at 29.54 minutes from incubation of 15-dimethylfarnesyl diphosphate and Y406F-GDS-His6. Gas chroma of pentane extractable product from incubation of 12-methylfarnesyl diphosphate (compound similar to general formula (II) wherein R ² , R ³ , R ⁴ and R ⁵ are H and R ¹ is methyl) FIG. Germacrene D analog eluting at 29.35 minutes (compound similar to general formula (I) where R ² , R ³ , R ⁴ and R ⁵ are H and R ¹ is methyl). It is a figure of coupled gas chromatography electroantenography (GC-EAG) using cereal aphids, Sitbion avenae. Upper trace = EAG response, lower trace = GC response. A- (S) -germacrene D (Comparative Compound Ia), B- (R) -germacrene D (III), C- (S) -14-methylgermacrene D (D- (S) -12-methylgermaclene D, E- (S) -15- methyl germacrene D, F- (S) -14,15- dimethyl germacrene D ^{(R 2} and ^{R 3} are methyl compounds of general formula (I)), G- (S) -1-Fluorogermacrene D, H-germacrene (IV).

Materials and Methods Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich. Unless otherwise stated, all were of analytical quality or better and used as received.

¹ H, ³¹ P and ¹³ C NMR spectra were measured on a Bruker® Avance III 600 NMR spectrophotometer, Bruker® Avance 500 NMR spectrophotometer, or Bruker® Avance DPX400 NMR spectrophotometer, each with tetramethyl Chemical shift value in parts per million from silane, multiplicity (s = singlet, d = doublet, t = triplet, q = quadruple, m = multiplet), (approximately 0.5 Hz Reported as binding constants and assignments. Assignments are limited to COSY, DEPT90 / 135, gradient HSQC and gradient HMBC spectra. CDCl ₃ was filtered through basic alumina prior to use in NMR spectroscopy. EI ⁺ mass spectra were measured with a Micromass ™ LCT Premier ™ XE mass spectrophotometer (Waters Corporation, Milford, Mass., USA). GCMS is a Micromass ™ that detects the range m / z 50-800 in EI ⁺ mode with a J & W Scientific DB-5MS column (30m x 0.25mm ID) and a scan time of 0.9 seconds once a second. Performed on a Hewlett Packard Agilent ™ 6890 GC with GCT Premier ™. Injection was performed in split mode (split ratio 5: 1) at 50 ° C. The chromatogram started at an oven temperature of 50 ° C. (unless otherwise stated) and increased by 4 ° C. per minute (up to 150 ° C.) for 25 minutes and then increased by 20 ° C. per minute for 5 minutes (final temperature 250 ° C.) .

Protein Preparation and Purification Recombinant Germacrene D synthase and mutants were overproduced in E. coli (DE3) Star as C-terminal His-tag fusion proteins, and Cascon, O. Chemoenzymatic preparation of germarine analogs. Chem. Commun. 48, 9702-9704 (2012), and purified by Ni ²⁺ -affinity chromatography.

Site-directed mutagenesis of recombinant GDS The desired mutation was introduced using the Quickchange site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. The primers used for mutagenesis were as follows:
5 ′ CTGGTAGAGCTGTACTTTGCGGTACTGGGCGTTATTTTTC 3 ′ (SEQ ID NO: 2) and 5 ′ GAAATAAACGCCAGTACCCGCAAAGTACAGCTCTACCAGAG 3 ′ (SEQ ID NO: 3) to W275A;
5 ′ CTGGTAGAGCTGTACTTTCTGGTACTGGGCGTTTATTTC 3 ′ (SEQ ID NO: 4) and 5 ′ GAAATAAAACCCCCAGTACCAGAAAAGTACAGCTCTACCAGAG 3 ′ (SEQ ID NO: 5) to W275L;
5′GGTAGAGCTGTACTTTTTCGTACTGGGCGTTTTATTTC 3 ′ (SEQ ID NO: 6) and 5′GAAATAAACGCCAGTACGAAAAAAGTACAGCTCTACC 3 ′ (SEQ ID NO: 7) to W275F;
5′CGTGATCGACATGCTGGCGAAGAATGACGACAACC 3 ′ (SEQ ID NO: 8) and 5 ′ GGTTGTCGTCATTCTTCGCCAGCATGTCGATCACG 3 ′ (SEQ ID NO: 9) to Y524A;
5′GCGTGATCGACATGCTGCTGAAGAATGACGACAACC 3 ′ (SEQ ID NO: 10) and 5 ′ GGTTGTCGTCATTTCTCAGCAGCATGTCGATCACGC 3 ′ (SEQ ID NO: 11) to Y524L;
5 ′ GTGATCGACATGCTGTTCAAGAATGACGACAAC 3 ′ (SEQ ID NO: 12) and 5 ′ GTTGTCGTCATTCTTGAACAGCATGTCGATCAC 3 ′ (SEQ ID NO: 13) to Y524F;
5′GAATCTGACGGGTGGCAGCAAAATGCTGGAGACG 3 ′ (SEQ ID NO: 14) and 5 ′ CGTCGTCAGCATTTTGCTGCCCACCCGTCAGATTC 3 ′ (SEQ ID NO: 15) to Y406S;
GAATCTGACGGGTGGGCGCAAAATGCTGGAGACG 3 ′ (SEQ ID NO: 16) and 5′CGTCCGTCAGCATTTTGCCGCCCACCCGTCGAATTC 3 ′ (SEQ ID NO: 17) to Y406G;
5′GAATCTGACGGGTGGCCGGAAAATGCTGACGACG 3 ′ (SEQ ID NO: 18) and 5 ′ CGTCGTCAGCATTTTCCGGCCCACCCGTCAGATTC 3 ′ (SEQ ID NO: 19) to Y406A;
5′GAATCTGACGGGTGGGCGGAAAATGCTGACGACG 3 ′ (SEQ ID NO: 20) and 5 ′ CGTCGTCAGCATTTTCACGCCCACCCGTCAGATC 3 ′ (SEQ ID NO: 21) to Y406V;
5′GAATCTGACGGGGTGGCATTAAAATGCTGGAGACG 3 ′ (SEQ ID NO: 22) and 5 ′ CGTCGTCAGCATTTTAATGCCCCCCGTCAGATTC 3 ′ (SEQ ID NO: 23) to Y406I;
5′GAATCTGACGGGTGGCCCGAAAATGCTGACGACG 3 ′ (SEQ ID NO: 24) and 5 ′ CGTCGTCAGCATTTTCAGGCCCACCCGTCAGATTC 3 ′ (SEQ ID NO: 25) to Y406L;
5′GAATCTGACGGGTGGCTTTAAAATGCTGGAGACG 3 ′ (SEQ ID NO: 26) and 5′CGTCGTCAGCATTTTAAAGCCCCCCGTCAGATTC 3 ′ (SEQ ID NO: 27) to Y406F;
5 ′ CTGACGGGTGGCTGGAAAATGCTGGAGAC 3 ′ (SEQ ID NO: 28) and 5 ′ GTCGTCAGCATTTCCAGCCACCCGTCAG 3 ′ (SEQ ID NO: 29) to Y406W.

  The plasmid was purified from an overnight culture (10 mL LB medium containing 50 μmol / mL ampicillin) using the QIAGEN miniprep kit as described by the manufacturer. Mutations were confirmed by DNA sequence analysis using an internal Walesbiogrid facility (School of Bioscience, Cardiff University, UK).

Synthesis of 14,15-dimethylfarnesyl diphosphate (IIg) The title compound was prepared from β-ketoester V according to Reaction Scheme 1.

A. (2E, 6E) ethyl 3,7-diethyl-11-Mechirudodeka 2,6,10-trienoate Synthesis dried _CH 2 _Cl 2 (38mL) solution of V (CASCON et al (VII), pp ChemPlusChem78,1334～1337 ( 2013)), (0.35 g, 1.50 mmol) and lithium trifluoromethanesulfonate (0.78 g, 5.0 mmol) in triethylamine (0.7 mL, 5.0 mmol) at 0 ° C. under argon. ), Then trifluoromethanesulfonic anhydride (0.32 mL, 1.90 mmol) was added. The mixture was stirred at 0 ° C. for 2 hours before being quenched by the addition of saturated NH ₄ Cl solution (20 mL). The mixture was diluted with CH ₂ Cl ₂ (20 mL) and the separated aqueous phase was extracted with CH ₂ Cl ₂ (2 × 10 mL). The pooled organic extracts were washed with water (30 mL) and brine (30 mL) before drying under reduced pressure (MgSO ₄ ), filtration and concentration. This gave enol triflate VI as a black oil that was used directly without further purification (0.58 g, 83%).

To a stirred suspension of Cul (0.95 g, 5.00 mmol) in THF (12 mL) at 0 ° C. is a drop of ethylmagnesium bromide (3.0 M solution, 3.33 mL, 10.0 mmol in diethyl ether). Added one by one. The solution was stirred for 30 minutes, resulting in the formation of an opaque black color. The stirred reaction was then cooled to −78 ° C. and a solution of VI (0.58 g, 1.25 mmol) in anhydrous THF (4 mL) was added by needle and quenched with saturated aqueous NH ₄ Cl (20 mL). The reaction was stirred at this temperature for 2.5 hours. The resulting emulsion was dissolved by adding concentrated aqueous NH ₄ OH and stirred overnight. The separated aqueous layer was extracted with ethyl acetate (3 × 10 mL), and the combined organic extracts were dried (MgSO ₄ ) under reduced pressure, washed with water (2 × 30 mL) and brine (30 mL) before filtration and concentration. . The residual oil was purified by flash chromatography on silica gel (19: 1 hexanes; ethyl acetate). The title compound was isolated as a colorless oil (185 mg, 52%).

HRMS (m / z ES ⁺ ): calcd for C ₁₉ H ₃₂ O ₂ 292.2402, found 292.2407;
δ _H (400 MHz, CDCl ₃ ) 0.95 (3H, t, J = 7.5 Hz, C = CHCH ₂ CH ₃ ), 1.07 (3H, t, J = 7.5 C = CHCH ₂ CH ₃ ) _{, 1.27 (3H, t, J} = 7.0Hz, OCH 2 CH 3), 1.59 (3H, s, CH 3 C = CH), 1.67 (3H, s, CH 3 C = CH) , 1.98-2.05 and 2.03-2.04 (12H, m, 2 × CH 2 CH 2 and _{2 × CH = CCH 2 CH 3} ), 4.25 (2H, q, J = 7. 0 Hz, OCH ₂ CH ₃ ), 5.01-5.20 (2H, m, 2 × C═CH), 5.72 (1H, s, C═CHCO ₂ Et);
δ _C (62.5 MHz, CDCl ₃ ) 12.97, 13.18, 14.29, 17.68 and 23.15 (CH ₃ ), 25.34, 25.67, 25.78, 26.84, 36.43, 38, 27 and 59.13 (CH ₂ ), 114.79, 122.51 and 124.31 (3 × C═CH), 131.33 141.91 and 165.53 (3 × C = CH), 166.45 (C = O).

B. Synthesis of (2E, 6E) 3,7-diethyl-11-methyldodeca-2,6,10-trienol (VIII) Stirred suspension of VII (0.18 mg, 0.60 mmol) in toluene (3.1 mL) Was added DIBAL-H (1.5 M in toluene, 1.30 mL, 1.80 mmol) at −78 ° C. and the solution was stirred at this temperature for 2 h. The reaction was quenched by the addition of 2M HCl (10 mL), diluted with CH ₂ Cl ₂ (10 mL) and stirred at room temperature for 1 hour. The aqueous layer was extracted with CH ₂ Cl ₂ (2 × 10 mL) and the pooled organic layers were washed with saturated aqueous NaHCO ₃ (3 × 10 mL), brine (2 × 15 mL), dried over MgSO ₄ and then under reduced pressure Concentrated. The crude product was purified by flash chromatography on silica gel (eluting with 3: 1 hexane-ethyl acetate) to give the title compound as a colorless oil (0.16 mg, 73% yield).

_{^{HRMS (m / zAPCI [M +}} H + -H 2 O]): C 17 H 29 Calculated for 233.2269, found 233.2275;
δ _H (400 MHz, CDCl ₃ ) 0.94-1.01 (6H, m, 2 × CH ₂ CH ₃ ), 1.60 (3H, s, CH = CCH ₃ ), 1.68 (3H, s, CH = CCH ₃ ) 1.97-2.13 (12H, m, 6 × CH ₂ ), 4.16 (2H, d, J = 7.0 Hz, CH ₂ O), 5.09 (2H, m, 2 × C = CH), 5.38 (1H, t, J = 7.0 Hz, C = CHCH ₂ O).
δ _C (62.5 MHz, CDCl ₃ ) 13.20, 13.65, 17.68 and 23.21 (CH ₃ ), 23.54, 25.65, 26.22, 26.96, 36.51 and 36.75 (CH ₂ ), 59.09 (CH ₂ OH), 122.89, 123.43 and 124.46 (C═CH), 131.26, 141.25 and 145.69 (C═CH)

C. Synthesis of tris ammonium (2E, 6E) -3,7-diethyl-11-methyldodeca-2,6,10-trienyl diphosphate 14,15-dimethylfarnesyl diphosphate (IIg) in anhydrous DMF (5.3 mL) A stirred suspension of LiCl (0.27 g, 6.4 mmol) was cooled to 0 ° C. (ice bath), then S-collidine (0.3 mL, 2.4 mmol) and methanesulfonyl chloride (50 μL, 0.64 mmol). ) Was added. The solution was stirred for 15 minutes during which time a cloudy white precipitate formed. Alcohol VII (100 mg, 0.40 mmol) was added dropwise as a solution in anhydrous DMF (1 mL) and the reaction was stirred at 0 ° C. for 3 hours. The mixture was diluted with cold pentane (4 mL) and then poured into ice (25 g) and the resulting aqueous layer was extracted with pentane (3 × 10 mL). The pooled organic layers were washed with saturated CuSO ₄ solution (3 × 10 mL), saturated NaHSO ₄ solution (2 × 10 mL) and brine (2 × 10 mL) before drying (MgSO ₄ ) and filtration. The solution was concentrated under reduced pressure and the resulting crude allyl chloride was used directly without further purification.

To a solution of allyl chloride the crude in anhydrous _CH 3 CN (1 mL), tris - diphosphate hydrogen (tetrabutylammonium) (0.7 g, 1.8 mmol) was added and the mixture was stirred at room temperature for 15 hours. The solvent was removed under reduced pressure and the residue was dissolved in ion exchange buffer (25 mM NH ₄ HCO ₃ , 1 mL containing 2% i-PrOH). This solution is slowly applied to a column containing 30 equivalents of DOWEX 50W-X8 (100-200 mesh) cation exchange resin (NH ₄ ⁺ form), previously equilibrated with 2 column volumes of ion exchange buffer. I passed. The column was eluted with 2 × column volume of ion exchange buffer at a flow rate of 1 × column volume per 15 minutes. After the ion exchange is completed, the product-containing fraction (i-PrOH: c.NH ₃ : H ₂ O 6: 3: 1, stained with a Hanetian stain as judged by TLC) is lyophilized to dryness I let you. The white solid was triturated with MeOH (3 × 10 mL) and the organic extract was concentrated to dryness to give a yellow solid that was purified with Et ₂ O (3 × 3 mL) to give the title compound as a white solid ( 64 mg, 36%). The residue from the grinding was further purified by reverse phase HPLC (150 × 21.2 mm Phenomenex Luna ™ column, 10% B for 20 minutes, then linear gradient to 60% B for 25 minutes, and finally 100% B for 5 minutes. Elution with a linear gradient, solvent A: 25 mM NH ₄ HCO ₃ aqueous solution, solvent B: CH ₃ CN, flow rate 5.0 mL / min, detection at 220 nm, retention time 39.3 min). After purification was complete, the solution was again lyophilized to dryness to give another batch of the title compound as a white fluffy solid (34 mg, 18.9% yield).

HRMS (m / zES ⁻ ): calculated for C ₁₇ H ₃₁ O ₇ P ₂ 4099.245, found 409.2539;
δ _H (400 MHz, D ₂ O) 0.8-0.91 (6H, m, 2 × CH ₂ CH ₃ ), 1.50 (3H, s, C = CCH ₃ ), 1.56 (3H, s , C = CCH ₃ ) 1.92-2.03 (12H, m, 6 × CH ₂ ), 4.37 (2H, m, CH ₂ O), 5.07 (2H, t, J = 6.0 Hz) , 2 × C = CH), 5.32 (1H, t, J = 6.5 Hz, C = CHCH ₂ O);
_{^{δ P (202.5MHz, 2 H 2}} O) -10.41 (d, J PP = 22.5Hz), -8.30 (d, J PP = 22.5Hz).

  Other compounds of general formula (II) can be synthesized by similar methods, starting from alternative β-ketoesters.

Preparation of (S) -germaclene D analogs Germacrene analogs were generated from the appropriate farnesyl diphosphate according to Scheme 2 by enzymatic conversion using GDP or modified GDP.

GDS-His ₆ and Y406FGDS as previously described (Cascon et al., Chem. Commun., 48, 9702-9704 (2012) and Cascon et al., ChemPlus Chem 78, 1334-1337 (2013)). -Incubation of His ₆ and FDP analogs was optimized to yield maximum conversion.

Results of Enzyme Kinetic Experiments Kinetic parameters for conversion of farnesyl diphosphate and its analogs to (S) -germacrene D and its analogs using different mutant GDS enzymes are shown in Tables 1-3.

  Optimal conversion was performed for both compounds (If) and (Ig) using a modified GDS-Y406F enzyme. However, for natural (S) -germacrene D and other analogs, the native GDS enzyme was used rather than the modified enzyme.

A. Preparation of (S) -14,15-dimethylgermacrene D (Compound Ig) To produce (S) -14,15-dimethylgermacrene D, 14,15-dimethyl-FDP (IIg) (19 mg, 0. 40 mM final concentration) and Y406F-GDS-His ₆ (12 μM final concentration), incubation buffer overlaid with pentane (10 mL) (20 mM Tris, 5 mM βME, and 10 mM MgCl ₂ , pH 7.5, for GDS) 10% glycerol, 50 mL final volume). The mixture was stirred gently at room temperature for 5 days, then the separated aqueous layer was extracted completely with additional portions of pentane until no product could be detected by GCMS. The pooled pentane extracts were concentrated to dryness and the residue was purified by preparative thin layer chromatography on silica gel impregnated with 1% AgNO ₃ and eluted with 5% acetone in pentane. The title compound was isolated as a colorless oil (14 mg, 73%).

HRMS (m / z, EI ⁺ ): Calculated 232.2191 for C ₁₇ H ₂₈ , found 232.2191;
_{δ H (600MHz, CDCl 3)} 0.79 (3H, d, J = 7.0Hz, (CH 3) 2 CH), 0.85 (3H, d, J = 7.0 Hz, (CH 3) 2 _{CH), 0.86-0.90 (2H, m} , (CH 3) 2 CHCHCH 2), 0.94 (3H, t, J = 7.5Hz, CH 3 CH 2), 1.37-1. 42 (1H, m, (CH ₃ ) ₂ CH), 1.68 (3H, d, J = 6.0 Hz, CH ₃ CH = C), 1.70-1.75 (2H, m, CH ₂ CEt ), 1.85-1.90 (1H, m, 1 × CH 2 CH = CEt), 1.97-2.02 (1H, m, 1 × CH 2 CH = CEt), 2.02-2. 09 (1H, m, (CH ₃ ) ₂ CHCH), 2.14-2.20 (1H, m, 1 × CH ₃ CH═CCH ₂ ), 2.25 2.32 (2H, m, CH ₃ CH ₂ ), 2.36-2.43 (1H, m, 1 × CH ₂ C = CEt), 2.44-2.52 (1H, m, 1 × CH ₃ CH = CCH ₂ ), 5.03 (1H, dd, J = 6 and 11 Hz, CH ₃ CH ₂ C═CH), 5.08 (1H, dd, J = 10 and 16 Hz, CH ₃ CH = CCH = CH), 5.38 (1H, q, J = 6.0 Hz, CH ₃ CH = C), 5.72 (1H, d, J = 6.0 Hz, CH ₃ CH = CCH = CH);
δ _C (150 MHz, CDCl ₃ ) 12.66 (CH ₃ CH ₂ ), 13.18 (CH ₃ CH═C), 14.13 (1 × (CH ₃ ) ₂ CH), 19.28 (1 × ( CH ₃ ) ₂ CH) 20.75 ((CH ₃ ) ₂ CHCHCH ₂ ) 21.30 (CH ₃ CH ₂ ), 22.70 (CH ₂ CEt), 27.09 (CH ₂ CH═CEt), 32. 83 ((CH ₃ ) ₂ CH), 36.96 (CH ₃ CH═CCH ₂ ), 52.57 ((CH ₃ ) ₂ CHCH), 120.0 (CH ₃ CH═C), 130.1 (CH _{= CEt), 133.6 (CH =} CHCHCH (CH 3) 2), 136.1 (CH = CHCHCH (CH 3) 2), 139.4 (CH = CEt), 140.2 (CH 3 CH = C );
^{m / z (EI +),} 232.2 (22%, M +), 203.2 (8, [M-Et] +), 189.2 (100, [M- (CH 3) 2 CH] + ), 175.2 (2), 161.1 (11), 147.1 (30), 133.1 (31), 119.1 (33), 105.1 (25), 91.1 (29) 79.1 (18), 67.1 (7), 55.1 (4).

B. Preparation of (S) -15-methylgermacrene D (If) The title compound was produced in a similar manner to compound (Ig). 15-methyl-FDP (IIf) (19 mg, 0.40 mM final concentration) and Y406F-GDS-His ₆ (12 μM final concentration) were added to incubation buffer (20 mM Tris, 5 mM βME) overlaid with pentane (10 mL). And 10 mM MgCl ₂ , pH 7.5, 10% glycerol for GDS, 200 mL final volume). The mixture was stirred gently at room temperature for 5 days, then the separated aqueous layer was extracted completely with additional portions of pentane until no product could be detected by GCMS. The pooled pentane extracts were concentrated to dryness and the residue was purified by preparative thin layer chromatography on silica gel impregnated with 1% AgNO ₃ and eluted with 5% acetone in pentane. The title compound was isolated as a colorless oil (8 mg, 45%). HRMS (m / z, EI ⁺ ): Calculated 232.2191 for C ₁₇ H ₂₈ , found 232.2191;
δ _H (600 MHz, CDCl ₃ ) 0.72-0.80 (3H, m, (CH ₃ ) ₂ CHCHCH ₂ ), 0.83 (3H, d, J = 7.0 Hz, (CH ₃ ) ₂ CH) , 0.90 (3H, d, J = 7.0 Hz, (CH ₃ ) ₂ CH), 1.56 (3H, s, CH ₃ C = CH), 1.71 (3H, d, J = 7. _{0Hz, CH 3 CH = C)} , 1.95-2.05,2.16-2.18,2.21-2.25,2.30-2.37 and 2.52-2.54 (7H , m, CHs _{allylic), 5.14-5.18 (2H, m,} CH 3 CH = CCH = CH and _{CH 3 C = CH), 5.42} (1H, q, J = 7.0Hz, CH ₃ CH = C), 5.76 (1H, d, J = 6.0 Hz, CH ₃ CH = CCH = CH);
^{m / z (EI +),} 218.2 (28%, M +), 203.2 (10, [M-CH 3] +), 189.2 (9), 175.1 (100), 143. 1 (18), 133.1 (20), 119.1 (22), 105.1 (25), 91.1 (20), 79.1 (10), 67.1 (4), 55.1 (3).

Electrophysiology Electroantenogram (EAG) recordings [Maddrell et al., J. MoI. Exp. Biol. 51, 71 (1969), but without glucose] was performed using an Ag-AgCl glass electrode filled with saline solution. The heads of parthenogenetic rodent aphids, Sitbion avenae, were excised and placed in an indifferent electrode, and the tips of both antennal were removed before inserting them into the recording electrode. The signal was passed through a high impedance amplifier (UN-06, Syntech, Hilversum, The Netherlands) and analyzed using a customized software package (Syntech).

  A combined gas chromatography electrophysiology system (GC-EAG) in which the effluent from the GC column is simultaneously directed to the antennal preparation and the GC detector has been previously described (Wadhams, The use of Coupled Gas Chromatographic Electrotechnical Technology). Identification of Insect Pheromones.Chromatographic Society Symposium, Reading, England, UK, March 21-23, 1989, XIV + 376P, Plenum Press: New York, USA, 289-298 (1990). Separation of the required Germacrene D analog and any contaminants in the sample was performed using HP-1 (50 m × 0.32 mm, OD × 0) using helium as the carrier gas (at a flow rate of 2.5 ml / min). .52 μm, phase thickness) column and performed on an Agilent® 6890 GC equipped with a cool on-column inlet and FID. The oven temperature was maintained at 30 ° C. for 2 minutes and then increased to 250 ° C. at 15 ° C. per minute.

  The outputs from the EAG amplifier and FID were monitored simultaneously and analyzed using the Syntech software package. Peaks eluted from the GC column were considered active when they induced EAG activity in three or more pairs of experiments.

Behavioral Assays The responsiveness of individual cereal aphids, Cytobion avenae, to test compounds was determined using the Perspex 4-arm olfactometer (Pettersson, J .; Ent. Scand. 1, 63-73 (1970); 79, 451-457 (2010)), which was maintained at 23 ° C. and lined up from above. A filter paper disc was placed on the bottom of the olfactometer to attract aphids, and the middle and top were attached very tightly and sealed well. Four arms consisting of a cylindrical disposable 10 mL syringe (Plastipak) are firmly attached to the hole in the middle part, and the filtered air passes through them and through a tube inserted into the hole in the upper center and connected to the pump. I sucked into the main body of the meter. The total flow rate measured was 200 mL / min and the flow rate through each arm was considered to be 50 mL / min. Each of the three control arms contained a piece of filter paper to which 10 μL of hexane was applied and evaporated in 30 seconds. The treatment arm contained a piece of filter paper where the test compound in 10 μL of hexane (20-200 ng μL ⁻¹ ) was applied and allowed to stand for 30 seconds to evaporate the hexane. One aphid was placed in the center hole and the suction tube was quickly reinserted. The time spent in each arm and central zone was recorded using dedicated software (OLFA, Udine, Italy) for the next 16 minutes. The olfactory meter was rotated 90 ° every 2 minutes to eliminate any directional bias. Each assay included 10 replicates and the average time spent in the treatment and control arms was compared using a paired t-test (Genstat).

  The results for the compounds of formula (I) and comparative compounds together with (R) -germacrene D (III) and germanocrene (IV) are shown in Table 5 below.

  Data were recorded as mean time spent in control (solvent only) or treatment arms (± SE) and analyzed using Student's t-test.

GC-MS analysis Gas chromatograms for products isolated from turnover of 14-methylfarnesyl diphosphate, 14-fluorofarnesyl diphosphate, 15-fluorofarnesyl diphosphate and 6-fluorofarnesyl diphosphate were previously It was similar to what was published (Cascon et al., Chem. Commun., 48, 9702-9704 (2012)).

Claims (32)

Formula (I):
(Where
R ¹ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ² is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁴ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁵ is H, methyl, ethyl, n-propyl, iso-propyl or cyclopropyl)
(S) -germacrene D analog. Independently or in any combination
R ¹ is H, methyl or ethyl;
R ² is H, methyl or ethyl,
R ³ is methyl or ethyl;
R ⁴ is H, methyl or ethyl,
R ⁵ is H, methyl or ethyl, A compound according to claim 1. Each of R ¹ , R ² and R ⁴ is H;
R ³ is methyl, ethyl, n-propyl, iso-propyl or cyclopropyl;
R ⁵ is H, methyl, ethyl, n- propyl, iso - propyl, or cyclopropyl A compound according to claim 1 or 2. The compound according to claim 3, wherein R ⁵ is H.   The compound according to claim 4, which is (S) -15-methylgermacrene D. R ^{2, R 3} and methyl each ^{R 5} is independently ethyl, n- propyl, iso - propyl or cyclopropyl, each of ^{R 1} and ^{R 4} are H, according to claim 1 or 2 Compound. The compound according to claim 6, wherein R ⁵ is H.   The compound according to claim 7, which is (S) -14,15-dimethylgermacrene D. A process for preparing a compound according to any one of claims 1 to 8, comprising
General formula (II):
(Wherein R ¹ , R ² , R ³ , R ⁴ and R ⁵ are as defined in formula (I))
Incubating a farnesyl diphosphate analog of or a salt thereof with germane D-synthase (GDS).   10. The method according to claim 9, wherein the gelmacrene D synthase is a recombinant (S) -germacrene D synthase polypeptide.   11. A method according to claim 10, wherein the recombinant GDS comprises a tag sequence at the N or C terminus, in particular a polyhistidine tag.   12. A method according to claim 10 or 11, wherein the GDS comprises a C-terminal polyhistidine tag, such as a hexahistidine tag.   13. The method according to any one of claims 9 to 12, wherein the GDS is a natural germane magnolia D synthase derived from SEQ ID NO: 1 of Selenidae. GDS is SEQ ID NO: 1 of a native german maculene D synthase, such as Sequoia spp. And one or more modifications:
A tyrosine residue at position 406 substituted by phenylalanine, leucine, isoleucine, valine or alanine,
Phenylalanine, leucine, isoleucine, valine or alanine, but in particular a tryptophan residue at position 275 substituted by phenylalanine,
13. A method according to any one of claims 9 to 12, having a tyrosine residue at position 524 substituted with phenylalanine, leucine, isoleucine, valine or alanine, but in particular phenylalanine.   15. The method of claim 14, wherein the GDS has one or more of tyrosine at position 406, tryptophan at position 275, tyrosine at position 524, substituted with phenylalanine. Natural SEQ ID No. 1 of German McLaren D synthase, for example, Sequoia spp., With the following modifications:
A tyrosine residue at position 406 substituted by phenylalanine, leucine, isoleucine, valine or alanine,
Phenylalanine, leucine, isoleucine, valine or alanine, but in particular a tryptophan residue at position 275 substituted by phenylalanine,
A modified GDS polypeptide having one or more of the tyrosine residue at position 524 substituted with phenylalanine, leucine, isoleucine, valine or alanine, but in particular phenylalanine.   17. The modified GDS polypeptide of claim 16, wherein the GDS has one or more of tyrosine at position 406, tryptophan at position 275, tyrosine at position 524, substituted with phenylalanine.   A nucleic acid sequence encoding the modified GDS polypeptide of claim 16 or 17.   A vector comprising the nucleic acid sequence of claim 18.   A cell transfected or transformed with the nucleic acid molecule of claim 18 or the vector of claim 19. An insect repellent composition comprising a compound according to any one of claims 1 to 5 and a suitable carrier, wherein the compound of general formula (I) is (S) -14,15-dimethylgermacrene D ( That is, an insect repellent composition that is not a compound of general formula (I) wherein R ² is methyl.   The insect repellent composition according to claim 21, wherein the compound of the general formula (I) is the compound according to any one of claims 3 to 5.   One or more additional insect repellent compounds, such as allethrin, DEET (N, N-diethyl-m-toluamide), p-menthane-3,8-diol (PMD), picaridin, Bayrepel, KBR3023, nepetalactone Citronella oil, Neem oil, Bog Myrtle, Dimethylcarbate, Tricyclodecenyl allyl ether, IR3535 (3- [N-butyl-N-acetyl] -aminopropionic acid, ethyl ester) or anthranilate The insect repellent composition according to claim 21 or 22, further comprising a system insect repellent.   24. Insect repellent according to any of claims 21 to 23, comprising a carrier suitable for human or animal application. An insect attractant composition comprising a compound according to any one of claims 1, 2 or 6 to 8 and a suitable carrier, wherein the compound is (S) -15-methylgermacrene D (ie R ² An insect-attracting composition which is not a compound of general formula (I) wherein is hydrogen.   26. The insect attractant composition according to claim 25, wherein the compound of general formula (I) is (S) -14,15-dimethylgermacrene D.   27. The insect attractant composition of claim 25 or 26, further comprising an insecticide.   A sustained release medium selected from the group consisting of rubber, polyten, hollow fiber, plastic sandwich, plastic membrane and cellulose material is further provided so that the attractant is released at a concentration effective to attract insects over a period of days. 28. An insect attractant composition according to any one of claims 25 to 27, comprising:   Insect trapping device comprising the insect attractant composition according to any one of claims 25 to 28.   29. An insect repellent composition or insect attractant composition according to any one of claims 21 to 28 for use in the treatment of insect infestation in animals or plants.   25. A method of repelling insects comprising providing an insect repellent composition according to any one of claims 21 to 24 to an area affected by insect infestation.   29. A method of attracting insects comprising providing an insect attractant composition according to any one of claims 25 to 28 to an area affected by insect invasion.