JP2018203681A - Vicious hair improvement agent - Google Patents

Abstract

To provide a vicious hair improvement agent, a hair follicle outer structure improvement agent, and a type 14 collagen production acceleration agent based on hair formation mechanism and organization structure which hardly occur rough surface.SOLUTION: It is found out that L-ascorbic acid derivative has production acceleration function of a type 14 collagen that is a component of a coupling structure between epidermis and dermis, a hair follicle outer structure improvement function to improve ununiformity of collagen density around the hair follicle, and a function preventing occurrence of vicious hair. A vicious hair improvement agent, a hair follicle outer structure improvement agent, and a type 14 collagen production acceleration agent which include L-ascorbic acid derivative have excellent vicious hair improvement function, excellent hair follicle outer structure improvement function, and excellent production acceleration function of type 14 collagen, and are used for medicines, quasi drugs, cosmetics, and field of food products corresponding to troubles related to hair in accompany with aging process such as increase of vicious hairs, incoherency of hair, and disorder of hair.SELECTED DRAWING: None

Description

  The present invention relates to a comb hair improving agent, an outer hair follicle structure improving agent, and a type 14 collagen production promoter characterized by containing L-ascorbic acid or an L-ascorbic acid derivative.

  One of the concerns about hair is the fact that the hair becomes unsteady with aging and the hair becomes wavy. As a cause of hair undulation, a mechanism has been proposed in which bent-shaped hair increases with aging, and it has been reported that when the hair changes in shape or has a “string”, the alignment of the hair is disturbed and the gloss decreases. (Non-Patent Document 1). That is, when the number of comb hairs increases, the appearance of the hair is disturbed and the aesthetic appearance is impaired. However, this is considered to cause the hairs to swell, and it is considered that the actual feeling that the hairs swell can be eliminated if the comb hairs can be improved.

  Until now, in order to improve comb hair, it has been common to employ a method of changing and fixing the three-dimensional structure of the protein constituting the hair using chemicals such as perm treatment. However, such a method causes damage to the hair such as a reduction in hair strength, a deterioration in touch feeling, a reduction in firmness and stiffness, and the occurrence of split ends and cut hairs. In addition, there is not a little damage to the scalp. Because of these problems, it has been desired to develop a method for improving comb hair that replaces the permanent treatment.

  A hair follicle is one of the appendages of the skin, and is formed from a hair shaft and a root sheath, a hair matrix cell, a hair papilla cell, and the like that produce the hair shaft. The root sheath is composed of several cell layers that concentrically wrap the hair shaft. The outer cell layer is called the outer root sheath, and the cell layer in contact with the hair shaft is called the inner root sheath. The inner root sheath functions as a path when the hair shaft grows and extends toward the outside of the skin. It is known that when the shape of this passage is deformed, the hair shape is also deformed. Therefore, it has been reported that the hair shape can be controlled by regulating the expression of involucrin and IGFBP-5 involved in the shape of the inner root sheath (for example, Patent Documents 1 and 2).

  The growing follicles forming the hair have a length of about 2 to 6 mm, reach from the pores on the surface of the epidermis to the deep part of the skin, and penetrate the dermis and subcutaneous tissue. The outer side of the hair follicle is wrapped by the basement membrane, but there are many unclear points about the mode of connection between the outer hair follicle and the adjacent tissue. So far, it has been shown that the basement membrane is present in the vicinity of the hair bulb of the hair follicle, but there is no hemidesmosome or anchoring structure, unlike the connection between the epidermis and dermis in the skin. This is considered to be because a firm connection structure is not formed between the hair follicle and the dermis because it is necessary to repeat growth and retraction along with the hair cycle (Non-patent Document 2). On the other hand, type 7 collagen and basement membrane components, which are constituents of anchoring plaque, are located on the epidermal side of the skin (upper hair follicle) rather than the bulge region of the hair follicle where the structure is always maintained without being affected by the hair cycle. Laminin and the like are expressed, and a connecting structure is formed between the hair follicle and the dermis or napped muscle (Non-patent Document 3). This means that in the upper part of the hair follicle, the hair follicle and the dermis tissue are firmly connected and fixed by the above-described connection structure. However, when the connection structure of the hair follicle and dermis observed here becomes unstable, the hair follicle is not fixed by the dermis, and it is considered that the hair follicle is deformed. That is, it has been inferred that the change in the connection mode between the hair follicle and the dermis affects the structure of the hair follicle, thereby causing abnormalities in the shape of the newly born hair, and as a result, the hair becomes conspicuous.

  The point to be noted here is that, unlike the situation described in Patent Document 3, the amount of collagen, which is the main component of the dermis structure, affects the structure and hair growth of the hair follicle. The connection between the dermis components is a problem. If an abnormality is observed in this connection structure, the uniformity of collagen fibers around the hair follicle is impaired. Further, the distribution of the connection structure of the hair follicle and the dermis tissue is also lost, and the hair follicle is not stably fixed, resulting in a structurally unstable state. If the hair follicle structure is destabilized, the structure of the inner root sheath that becomes the passage of the hair shaft is likely to be deformed, and it is considered that the hair having an abnormal shape increases. However, by strengthening the action of components such as type 14 collagen that connects type 1 collagen and the epidermis structure, which are present in the dermis, and improving the connection between the hair follicle and the dermis, the collagen around the hair follicle is uniform. It is considered that the sexuality is restored, and as a result, the hair follicle structure is stabilized and the hair is improved.

JP2015-218157 JP2014-1248 JP-A-7-2621

Shinobu Nagase et al. Cosmetic Journal 43, 201-208 (2009) Michael Nutbrown and Valerie A.M. Randall J.H. Invest. Dermatol. 104, 90-94 (1995) Masashi Akiyama, et al. J. et al. Invest. Dermatol. 105, 844-850 (1995)

  In view of this situation, an object of the present invention is to provide a comb hair improving agent, an outer hair follicle structure improving agent, and a type 14 collagen production promoter based on a hair formation mechanism and a tissue structure.

  The present inventors have found that in subjects who are worried about wavy or combed hair, the hair thickness is partially different or bent, and at the same time collagen around the hair follicle of the scalp. The density was found to be non-uniform. In addition, it was clarified that abnormalities in hair shape and non-uniformity of the collagen density in the scalp dermis increased with increasing age. As a result of intensive research based on the idea that the maintenance of the hair follicle structure is related to the generation of comb hairs, L-ascorbic acid and L-ascorbic acid derivatives have been linked to the connection structure of the epidermis and dermis. It has been found that it has the effect of promoting the production of type 14 collagen, which is a constituent component, the effect of improving the outer structure of the hair follicle to improve the non-uniformity of the collagen density around the hair follicle, and the effect of preventing the occurrence of comb hair. It came to.

That is, the present invention includes the following inventions.
(1) A comb hair improving agent comprising L-ascorbic acid or an L-ascorbic acid derivative.
(2) An outer hair follicle structure improving agent comprising L-ascorbic acid or an L-ascorbic acid derivative.
(3) A type 14 collagen production promoter comprising L-ascorbic acid or an L-ascorbic acid derivative.

  L-ascorbic acid is generally referred to as vitamin C. L-ascorbic acid derivatives include L-ascorbic acid phosphate, L-ascorbic acid alkyl ester, L-ascorbic acid sulfate, L-ascorbic acid. Specific examples include L-ascorbic acid-2-phosphate, L-ascorbic acid-3-phosphate, DL-α-tocopherol-2-L-ascorbic acid diester. L-ascorbic acid phosphate ester, L-ascorbyl palmitate, L-ascorbyl isostearate, L-ascorbyl dioleate, etc., L-ascorbic acid alkyl ester, L-ascorbic acid-2-sulfate, L-ascorbic acid -3-L-ascorbic acid sulfate ester such as sulfate , L- ascorbic acid 2-glucoside L- ascorbic acid glycosides such as, and the like.

  The comb hair improving agent, hair follicle structure improving agent, and type 14 collagen production promoter of the present invention have excellent comb hair improving action, hair follicle structure improving action, and type 14 collagen production promoting action. Can be used in the fields of pharmaceuticals, quasi-drugs, cosmetics and foods to cope with aging hair problems such as increase in hair, difficulty in coordinating hair, and hair disturbance

It is a figure of the example of a comb hair improvement by continuous use of the L-ascorbic acid 2-glucoside containing hair tonic which is one of the L-ascorbic acid derivatives.

  Comb hair in the present invention refers to a state in which the hair is not uniformly aligned and not uniform in appearance, and at the stereomicroscope level, the hair in the hairline is not aligned, the hair is bent, and the thickness is local. The state of abnormal shape such as curling and the difference. A comb hair improving agent means the formulation which improves said hair state. The target of the comb hair improving agent is not limited to hair, but includes eyelashes, eyebrows, and other body hairs.

  The structure outside the hair follicle in the present invention refers to a dermis structure based on the state of collagen fibers in the dermis around the hair follicle, and confocal laser scanning microscope, ultrasonic echography, optical coherence tomography (optical coherence tomography), second harmonic. It can be observed with a Generation (SHG) microscope or the like, and is a dermis structure using the uniformity of collagen density around the hair follicle as an index. It can be said that the higher the uniformity, the better the structure of the hair follicle outer structure.

  In the present invention, promotion of type 14 collagen production refers to promoting expression of type 14 collagen gene and / or promoting expression of type 14 collagen protein by promoting expression of type 14 collagen gene.

  The type 14 collagen in the present invention is a collagen classified into Fibrile Associated Collagen with Interrupted Triple-helix (FACIT), which binds to fibrillar collagen such as type I collagen of the dermis and promotes fibril formation and dermal tissue and epidermis. Involved in the formation of connected structures with organizations. In the case of humans, this gene is represented by a symbol such as COL14A1, UND. It has been reported that dysfunction of this gene causes fibrogenesis and biomechanical abnormalities.

  The content of the L-ascorbic acid derivative used in the present invention is not particularly limited, but it is 0.001 weight in terms of solid with respect to the hair improving agent, outer follicular structure improving agent, and type 14 collagen production promoter. % Or more, preferably 0.01 to 5% by weight. If it is less than 0.0001% by weight, the effect of the present invention may not be sufficiently exerted. The addition method may be added in advance or may be added during production, and may be appropriately selected in consideration of workability.

  For application to the external preparation or internal preparation of the present invention, L-ascorbic acid or L-ascorbic acid derivatives may be used as they are, and cosmetics and quasi-drugs are within the range not impairing these effects. , Oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, antiseptics, perfumes, moisturizers, powders Components such as a body, an ultraviolet absorber, a thickener, a dye, an antioxidant, a whitening agent, a chelating agent, an excipient, a film agent, a sweetener, and a sour agent can be appropriately contained.

  Examples of the dosage form of the present invention include lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, bath preparations, foundations, powders, lipsticks, ointments, poultices, pastes, plasters. Essences, powders, pills, tablets, injections, suppositories, emulsions, capsules, granules, liquids (including tinctures, fluid extracts, spirits, suspensions, limonades, etc.), tablets, A drink etc. are mentioned.

Next, in order to describe the present invention in detail, formulation examples and experimental examples will be given as examples, but the present invention is not limited thereto. Content shown in an Example is weight%.
Below, the formulation example using a L-ascorbic acid derivative is shown.

Formulation Example 1 Hair Tonic Formulation Content (% by weight)
1. Ethanol 60.0
2. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 2.0
3. Glycerin 2.0
4). [Manufacturing method] Component 2 is dissolved in component 4 with purified water to 100. Add component 1 and component 3, and mix well to obtain a product.

Comparative example 1 Conventional hair tonic In the prescription example 1, what replaced L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) with purified water is made into the conventional hair tonic.

Formulation Example 2 Hair Lotion Formulation Content (wt%)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 0.2
2. Stearic acid 5.0
3. Cetyl alcohol 5.0
4). Liquid paraffin 2.0
5. Glycerin monostearate 1.3
6). Sorbitan monooleate 1.5
7). Polyoxyethylene sorbitan monooleate (10E.O.) 0.8
8). Glycerin 6.0
9. Preservative appropriate amount10. [Production method] Components 2 to 7 were heated and dissolved and mixed with purified water to 100. The oil phase was maintained at 70 ° C. Ingredients 1 and 8 to 10 were dissolved by heating and mixed, and kept at 75 ° C. to obtain an aqueous phase. Add the water phase to the oil phase and cool it down while stirring to make the product.

Formulation Example 3 Shampoo Formulation Content (wt%)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 0.1
2. Alkyl sulfate triethanolamine 18.0
3. Lauric acid diethanolamide 3.0
4). Methylcellulose 0.5
5. Perfume appropriate amount 6. [Manufacturing method] in which component 4 is uniformly dissolved in component 6 with purified water 100, components 1 and 2 are added, heated and dissolved at 70 to 75 ° C, component 3 is added, and cooling is in progress. Add component 5 and cool to 30 ° C. to make the product.

Formulation Example 4 Rinse Formulation Content (% by weight)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 0.1
2. Jojoba oil 0.01
3. Behenyl alcohol 3.0
4.1,3-Butylene glycol 5.0
5. Distearyldimethylammonium chloride (75%) 8.0
6). Citric acid 0.05
7). Perfume appropriate amount 8. [Manufacturing method] Components 1 to 8 are dissolved at 60 ° C. with a total amount of 100 in purified water, stirred and cooled to 30 ° C. to obtain a product.

Formulation Example 5 Eyelash Cosmetics Formulation Content (wt%)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 0.1
2. Carboxyvinyl polymer 1.0
3. Hydroxyethyl cellulose 0.5
4.1,3-Butylene glycol 5.0
5. Potassium hydroxide 0.5
6.95 ethanol 5.0
7). Edetate trisodium 0.02
8). Methylparaben 0.2
9. Perfume appropriate amount10. [Production method] Components 1 to 4 and 6 to 10 are uniformly mixed with purified water to 100, and then component 5 is added to obtain a product.

Formulation Example 6 Body Lotion Formulation Content (wt%)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 0.5
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5. Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Perfume appropriate amount10. Glycerin 2.0
11. Methyl paraoxybenzoate 0.2
12 Propylene glycol 1.0
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 1 and 10-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring.

Formulation Example 7 Tablet Formulation Content (% by weight)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 1.0
2. Dried corn starch 25.0
3. Carboxymethylcellulose calcium 24.0
4). Microcrystalline cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6). Talc 3.0
[Production Method] Components 1 to 5 are mixed, and 10% water is added as a binder, followed by extrusion granulation and drying. Ingredient 6 is added to the molded granules, mixed and compressed into tablets. One tablet is 0.52 g.

Formulation Example 8 Capsule Formulation Content (wt%)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 5.0
2. Microcrystalline cellulose 60.0
3. Corn starch 15.0
4). Lactose 18.0
5. Polyvinylpyrrolidone 2.0
[Manufacturing Method] Components 1 to 5 are mixed and granulated, and then No. 2 hard capsule is filled with 250 mg to form a capsule.

Formulation Example 9 Powder Formulation Content (% by weight)
1. L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd.) 5.0
2. Microcrystalline cellulose 40.0
3. Corn starch 55.0
[Production Method] Components 1 to 3 are mixed to obtain a powder by a conventional method.

  Next, in order to explain the effect of the present invention in detail, an experimental example is given. In addition, this invention is not limited by this.

Experimental Example 1 Type 14 collagen production promotion test in human-derived fibroblasts Using human-derived fibroblasts NB1RGB, the production promotion effect of type 14 collagen by an L-ascorbic acid derivative was measured under the following conditions.

NB1RGB cells were seeded at 1 × 10 ⁵ cells per well of a 12-well plate and cultured for 24 hours. After culture, L-ascorbic acid 2-glucoside (Hayashibara Co., Ltd., hereinafter abbreviated as AS-G) was added as an L-ascorbic acid derivative, and RNA was isolated using RNAiso (Takara Bio) after further incubation for 24 hours. . Using this RNA as a template, cDNA synthesis was performed by reverse transcription using High Capacity RNA-to-cDNA kit (ABI), and then real-time PCR analysis for type 14 collagen was performed using SYBR Select Master Mix (ABI). . For the reaction, a StepOnePlus real-time PCR system (ThermoFisher Scientific) was used, and after initial denaturation at 95 ° C. for 2 minutes, the PCR reaction was carried out for 40 cycles with 95 ° C., 20 seconds, 60 ° C. and 30 seconds as one cycle. . In other operations, the type 14 collagen gene expression level was determined as a ratio with respect to the expression level of GAPDH as an internal standard, and the gene expression ratio with respect to the control group was calculated according to a predetermined method. The primers used for measuring the expression level of each gene are as follows.

Primer set Forward GATCAGTGGGCGCGCAAGT for type 14 collagen (SEQ ID NO: 1)
Reverse GCTGGGAATCTGGTTGAGGAT (SEQ ID NO: 2)
Primer set for GAPDH Forward TGCACCACCAACTGCCTTAGC (SEQ ID NO: 3)
Reverse TCTTCTGGGGTGCAGTGATG (SEQ ID NO: 4)

  The test results are shown in Table 1. The expression of type 14 collagen was significantly increased when 0.1 and 1.0 mg / ml of AS-G was added (p <0.05). Therefore, production of type 14 collagen by AS-G was promoted. It has been shown.

Experimental Example 2 Improvement test of hair follicle structure of scalp by continuous use of L-ascorbic acid derivative-containing scalp external preparation The effect of hair follicle external structure improvement by L-ascorbic acid derivative-containing scalp external preparation on female subjects was as follows. It was measured.

  The hair tonic shown in Formulation Example 1 or Comparative Example 1 was continuously used for 12 months for 12 healthy female subjects (average age: 38.8 years). Before and 1 month after continuous use, tomographic images of the skin in the parietal region were taken at 1.95 μm intervals using an in vivo confocal laser microscope Vivascope 3000 (Caliber ID). Using image processing software ImageJ, a three-dimensional construction of the dermis structure was performed based on the confocal image. The luminance per fixed area around the hair follicle was used as the amount of collagen, and the standard deviation of luminance was used as a non-uniformity index of collagen density. That is, when the numerical value calculated as a non-uniformity index of collagen density increases here, it evaluated that the distribution of collagen was non-uniform, and when it decreased, it was uniform. The value was calculated as a ratio after one month of continuous use with respect to the value before continuous use, assuming the value before continuous use as 1.

  As shown in Table 2, when the prescription example 1 was used continuously for 1 month, the non-uniformity index of collagen density of all six subjects decreased, but in the case of six subjects using comparative example 1 continuously There was no change in the heterogeneity index of collagen density. From this result, the collagen state around the hair follicle became uniform, and the structure outside the hair follicle of the scalp was improved.

Experimental example 3 Examination of comb hair improvement effect by continuous use of L-ascorbic acid derivative-containing scalp external preparation For 12 healthy female subjects (average age 38.8 years), hair tonic shown in prescription example 1 or comparative example 1 Used continuously for one month. Before continuous use and 1 month after continuous use, the hair follicle opening area was observed with a microscope (Keyence, VHX-500) for the hair at the top of the head, and a questionnaire was conducted after 1 month of continuous use to investigate improvement of comb hair.

  As shown in Table 3, when the hair tonic of Formulation Example 1 was used continuously, an excellent combing hair improving effect was shown.

  FIG. 1 shows an example of comb hair improvement. Before use, the hair grows in various directions. By using Formulation Example 1 continuously for one month, the direction in which the hair grows matches. A decrease in abnormally shaped hair (indicated by arrows) observed before use was also observed. From the above results, it was considered that comb hair was improved by using a hair tonic containing an L-ascorbic acid derivative.

  The comb hair improving agent, the hair follicle outer structure improving agent, and the type 14 collagen production promoting agent characterized by containing L-ascorbic acid or an L-ascorbic acid derivative as an active ingredient according to the present invention are the purposes of each agent. Exhibits an excellent improvement effect. Therefore, cosmetics, pharmaceuticals, and quasi-drugs intended for hair styling can be provided.

Claims (3)

  A comb hair improving agent comprising L-ascorbic acid or an L-ascorbic acid derivative.   An outer hair follicle structure improving agent comprising L-ascorbic acid or an L-ascorbic acid derivative. A type 14 collagen production promoter comprising L-ascorbic acid or an L-ascorbic acid derivative.