JP2018057322A - Pertussis model animal and its creation method, as well as method using pertussis model animal - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a pertussis animal model that faithfully reproduces prominent cough attack in the Bordetella pertussis infection in humans, has high convenience at an easy rate and can be used in evaluation, manufacture and research of pharmaceutical products.SOLUTION: A pertussis model animal of the present invention is provided for using a mouse having high convenience at an easy rate and faithfully reproducing prominent cough attack in the Bordetella pertussis infection in humans. By using an animal model of the present invention, it is useful for the clarification of a cough attack mechanism and the specification of an inducer of the cough attack, the screening evaluation of pharmaceutical products to the pertussis and the production of the pharmaceutical products. According to the evaluation method of the present invention, an object of an evaluable vaccine is expanded and the evaluation based on the cough attack counts directly related to the suppression of infection expansion becomes possible.SELECTED DRAWING: None

Description

  The present invention relates to a pertussis model animal and a production method thereof, a method for evaluating a pharmaceutical used for prevention or treatment of pertussis using a pertussis model animal, a method for identifying a cough seizure inducing factor, and a method for producing a pharmaceutical.

Pertussis is a highly contagious disease that occurs mainly in children and teenagers and is caused by Bordetella pertussis. Symptoms initially appear to be nonspecific upper respiratory tract infections, followed by paroxysmal or convulsive cough, usually ending with a long, harmonic squeal-like inspiration (flute).
The onset mechanism of cough attacks caused by Bordetella pertussis infection and its inducing factors have not yet been elucidated. One reason for this is that until now, no useful animal model has been developed that faithfully reproduces cough attacks in B. pertussis infection.
So far, infection models using small and easy-to-handle rodents such as mice and rats have been reported. In mice, pertussis nasal administration causes colonization of the upper and lower respiratory tract tissues and leukocytosis caused by pertussis toxin, but it has been reported that an important paroxysmal cough does not occur (Non-patent Document) 1, Non-Patent Document 2).
Rats are the only small animals that have been reported to have cough attacks (Non-patent Documents 3 and 4). In the experimental system used in these reports, it was reported that agarol particles containing Bordetella pertussis were prepared and administered directly to the rat bronchus or lung exposed surgically. In Non-Patent Document 4, a cough attack is observed from 9 days after administration. It has also been reported that cough attacks observed in this experimental system are suppressed by pertussis vaccine (Non-patent Document 5).
However, in the above experimental system, colonization in the respiratory tract etc. has not been observed, and the number of cough attacks in the pertussis infection group is not significant compared to the control group, and the number of cough attacks is the subject of the evaluation. It is not enough as an infection model. Moreover, since the infection method is very complicated, there is no follow-up report from other groups, and there is a problem that it is difficult to say that it is a general-purpose and simple method.
Although swine is a natural host of a related bacterium, bronchial septic bacteria, it has recently been reported that pertussis-like symptoms have been reported by nasal administration of Bordetella pertussis, but paroxysmal cough is not observed (Non-patent Document 6). ).
Currently, baboons (Papio anubis) are attracting attention as an animal model that reproduces cough attacks caused by pertussis infection. By administering pertussis pertussis, a severe cough attack occurs 3 days after infection (Non-patent Document 7). Moreover, it has been reported that the onset of cough attacks is suppressed by the current pertussis vaccination (Non-patent Document 8). However, the baboon pertussis model has a very low universality as an experimental animal, and there is a problem that it is not an animal model that can be easily used in consideration of ethical disorders.

Whooping cough is not expected to receive immunity from the mother (transplacental transfer antibody), so it is affected early in infancy and has a higher risk of dying than infants under 1 year of age, especially those under 6 months of age. . DPT triple vaccine including pertussis vaccine (diphtheria, pertussis, tetanus) or DPT-IPV quadruple vaccine (diphtheria, pertussis, tetanus, inactivated polio) has been carried out around the world including Japan. With the spread, the number of whooping coughs has been drastically decreasing in each country. However, since lifelong immunity against Bordetella pertussis cannot be obtained, the infection rate will increase if the prevalence of pertussis vaccination decreases. In order to maintain the prevalence of pertussis vaccination, the development of a safe and high-titer pertussis vaccine is still an important issue.
The Intracerebral challenge test developed by Kendrick in 1947 is used for the pertussis vaccine titer test in Japan at present (Non-patent Document 9). The use of the mouse brain attack test to evaluate the effectiveness of pertussis vaccine is different from the natural infection and the route of infection, but as a result of a large-scale field experiment conducted by STANDFAST et al. It has been shown that the titer of body pertussis vaccine is parallel to the effect of vaccine against natural infection of Bordetella pertussis (Non-patent Document 10). Thus, the intracerebral challenge test has become widespread because it can quantitatively handle the immune effect of the whole cell pertussis vaccine, and has reached the present day. However, in recent years, the brain attack test does not reproduce the state of natural infection, and is not suitable for the titer test of the current acellular pertussis vaccine, and the pros and cons of this test have been discussed (Non-Patent Document 11, Non-patent document 12, Non-patent document 13, Non-patent document 14). In fact, although the NIBSC working group discussed the acellular pertussis vaccine efficacy test model in 2000, a test method that could replace the intracerebral challenge test has not yet been established.
One of the reasons for the background discussed above is that a pertussis animal model suitable for vaccine evaluation has not been established. As described above, research results of recent evaluation of pertussis vaccine using baboons have been reported (Non-patent Document 7). This research result shows that cough attacks are suppressed in baboons administered with pertussis pertussis, although the cell-free pertussis vaccine immunization group cannot eliminate cells in the upper respiratory tract. For this reason, the baboon pertussis model has attracted attention as a new animal model. However, as described above, using baboons as a pertussis vaccine evaluation system is not practical in view of low universality, ethical problems, and cost as an experimental animal.

Shahin RD et al: Meth Enzymol 235: 47-58, 1994 Widdicombe JG. Eur Respir J 8: 1193-1202, 1995 Woods DE et al: Infect Immun 57: 1018-1024, 1989 Hall E et al: J Med Microbiol 40: 205-213, 1994 Hall E, et al: Vaccine 16 (17): 1595-1603, 1998 Elashi S et al: Infect Immun 73: 3636-3645, 2005 Warfel JM et al: Infect Immun 80: 1530-1536, 2012 Warfel JM et al: Proc Natl Acad Sci USA 111: 787-792, 2014 Kendrick PL et al: Amer. Z. Pub.Health 37: 803, 1947 Standfast AFB: Immunology 1 (2): 135-143, 1958 Cameron J et al, Wardlaw AC, Parton R (Eds.). UK, 1988 Xing DK et al, Vaccine 17 (6): 565-576, 1999 Corbel MJ et al, Expert Rev Vaccines 3 (1): 89-101, 2004 Watanabe M, Expert Rev Vaccines 4 (2): 173-184, 2005

  The development of a pertussis animal model that exhibits remarkable cough attacks seen in humans due to pertussis infection, is inexpensive and highly convenient, and can be used for identification of cough attack-inducing factors, as well as evaluation and production of pharmaceuticals. It was.

As a result of intensive studies, the present inventors have succeeded in developing a mouse pertussis model animal exhibiting a remarkable cough attack. Moreover, since it was confirmed that the cough attack of the pertussis model animal of the present invention is suppressed by the DPT-IPV vaccine including the current pertussis vaccine, the present invention is used to evaluate the effectiveness of new drugs such as a pertussis vaccine. The present invention can provide a method, a method for identifying a cough attack inducing factor, and a method for producing a pharmaceutical using the evaluation method.
That is, the present invention is as follows.
[1]
A method for producing a pertussis model mouse comprising inoculating a C57BL / 6 mouse with a bacterial solution containing B. pertussis Bp 18323 or a cell disruption solution containing B. pertussis Bp 18323.
[2]
The method according to [1], wherein the C57BL / 6 mouse is a mature mouse.
[3]
The bacterial solution contains B. pertussis Bp 18323 strain of 0.5 × 10 ⁸ cfu / ml or more, preferably 1 × 10 ⁸ cfu / ml or more, more preferably 2 × 10 ⁸ cfu / ml or less, or disrupting the cells The method according to [1], wherein the liquid contains a bacterial cell component of 0.8 mg / ml or more, preferably 1.0 mg / ml or more, more preferably 1.2 mg / ml or less.
[4]
A test substance evaluation method comprising:
(1) A step of administering a test substance to C57BL / 6 mice,
(2) inoculating mice that have been administered a test substance and C57BL / 6 mice that have not been administered a test substance with a cell disruption solution of B. pertussis Bp 18323 or B. pertussis Bp 18323;
(3) comparing the number of cough attacks in mice administered with the test substance with the number of cough attacks in mice not administered with the test substance and / or mice not inoculated with Bordetella pertussis or Bordetella pertussis, and
(4) Based on the result obtained by the step (3), a step of determining the effectiveness of the test substance in inhibiting cough attacks caused by B. pertussis infection,
Evaluation method including
[5]
The method according to [4], wherein the test substance is a pertussis vaccine.
[6]
A pertussis model mouse, which is a C57BL / 6 mouse infected with Bordetella pertussis Bp 18323 or a C57BL / 6 mouse inoculated with a cell disruption solution of Bordetella pertussis Bp 18323, which exhibits a cough attack.
[7]
A method for identifying a cough attack-inducing factor of Bordetella pertussis,
(1) Step of producing Bordetella pertussis Bp 18323 in which a gene encoding one function or structural factor of Bordetella pertussis Bp 18323 is deleted or modified to suppress expression (2) Obtained by the step (1) above The modified pertussis Bp 18323 strain or the cell disruption solution thereof is administered to C57BL / 6 mice (3) The number of cough attacks in the mice described in (2) above is described in the solvent inoculation group and / or [6] Comparing the number of cough attacks in pertussis model mice, and
(4) A step of identifying a pertussis-inducing factor of Bordetella pertussis based on the result obtained by the step (3),
Specific methods including:
[8]
A method for producing a pertussis vaccine,
(1) Step of producing pertussis protective antigen (2) Efficacy of pertussis protective antigen using C57BL / 6 mice inoculated with B. pertussis Bp 18323 strain or B. pertussis Bp 18323 strain And (3) mixing the pertussis protective antigen with a pharmaceutically acceptable carrier and / or other immunogenic ingredients and formulating into a unit dose formulation,
Manufacturing method.

  The pertussis model animal of the present invention uses a mouse that is inexpensive and highly convenient, and exhibits a cough attack similar to that of humans due to pertussis infection. Therefore, the animal model of the present invention is capable of elucidating the cough attack mechanism and cough attack. It is useful for identifying inducers and screening evaluation of drugs for pertussis. In addition, the evaluation method of the present invention enables an evaluation based on the number of cough attacks directly related to the suppression of the spread of infection, as well as the range of vaccines that can be evaluated, compared to the efficacy evaluation tests of conventional vaccines and the like. .

Change in the number of cough attacks in C57BL / 6 mice infected with B. pertussis Bp 18323 strain (A), comparison of the total number of cough attacks for 6-14 days with the control group (B), the number of colonized cells in the respiratory tract (C), The graph which shows the number of colonization bacteria (D) to a lung (Example 1). ^* P <0.0005, T test. Changes in the number of cough attacks in C57BL / 6 mice infected with various pertussis strains (A), comparison of the total number of cough attacks for 6-14 days with the control group (B), the number of colonized cells in the respiratory tract (C), to the lungs A graph showing the number of colonized cells (D) (comparative example). ^* P <0.05, ^** P <0.005, T test. Changes in the number of cough attacks in Balb / c mice infected with Bordetella pertussis Bp 18323 (A), comparison of the total number of cough attacks for 6 to 14 days with the control group (B), the number of colonized cells in the respiratory tract (C), A graph showing the number of colonized cells (D) in the lung (comparative example). ^* P <0.01, T test. Changes in the number of cough attacks in C57BL / 6 mice infected with Bordetella pertussis Bp 18323 PT gene deletion mutant (A), comparison of the total number of cough attacks for 6 to 14 days with the control group (B), colonized cells in the respiratory tract Graph (comparative example) showing the number (C) and the number of colonized cells (D) in the lung. ^* P <0.0001, T test or Mann-Whitney test. Pertussis Bp 18323 strain, PT gene deletion mutant strain or FHA gene deletion mutant strain-derived cell disruption fluid Transition of nasal inoculation C57BL / 6 mice (A), 6-14 days with control group Comparison of total number of cough attacks (B), Bordetella pertussis Bp 18323, PT gene deletion mutant strain, purified PT or Bordetella pertussis Bp 18323 PT gene deletion mutant strain + purified PT The graph which shows transition (C) of the number of cough attacks of nasal inoculation C57BL / 6 mouse, and comparison (D) of the total number of cough attacks for 6 to 14 days with the control group (Example 2). ^* P <0.05, ^** P <0.01, ^*** P <0.005, ^**** P <0.0005, T test Changes in the number of cough attacks of pertussis Bp 18323 infection in DTP-IPV immunized C57BL / 6 mice (A), comparison of the total number of cough attacks between 6 and 14 days compared to the control and non-vaccine groups (B), to the respiratory tract (Example 3) which shows transition (E) of the number of colonization cells (C), the number of colonization cells to the lung (D), and PT-IgG antibody titer (E). ^* P <0.01, ^** P <0.005, ^*** P <0.0005, T test

(Pertussis model animal)
The pertussis model animal of the present invention is a mouse that produces a significant cough attack by inoculation with pertussis or pertussis disruption fluid.
“Cough attack” means that successive coughs occur repeatedly.
The pertussis model animal of the present invention develops a cough attack after a lapse of a certain period after inoculation. Preferably, the cough attack occurs 5 days or more after the inoculation, and the cough attack continues for about 1 week or more.
“Significant cough attacks” means that the total number of cough attacks in a certain period after inoculation with pertussis or pertussis bacteria is compared to the group of animals not inoculated with pertussis or pertussis bacteria (negative control group). Means a significant increase. Preferably, it means that the total number of cough attacks in a certain period of 6 to 14 days after inoculation is significantly increased compared to the negative control group.
The cough attack of the pertussis model animal of the present invention is significantly suppressed by administration of an effective amount of a pertussis vaccine. Preferably, it means that the total number of cough attacks for a certain period of time after inoculation of pertussis bacteria in the pertussis vaccine administration group, more preferably 6 to 14 days, is significantly smaller than that in the pertussis vaccine non-administration group.

(Method for producing pertussis model animal)
A method for producing a pertussis model animal of the present invention is described below.
1. Animal species Animals that can be used in the present invention are C57BL / 6 strain mice commercially available or available from research institutions. The C57BL / 6 mouse has a further subline of C57BL / 6J and C57BL / 6N, which can be used in the same manner.
The main types and sources of C57BL / 6 substrains available are as follows.
C57BL / 6J: Jackson Laboratory
C57BL / 6JMs: National Institute of Genetics
C57BL / 6JJcl: Clea Japan
C57BL / 6JNrs: National Institute of Radiological Sciences
C57BL / 6JJmsSlc: Nippon SLC
C57BL / 6NJcl: Japan Clare
C57BL / 6NCrlCrlj: Nihon Charles River
C57BL / 6NCrl: Japan Charles River
C57BL / 6NCrSlc: Nippon SLC
C57BL / 6NSea: Kudou
C57BL / 6JBomTac: Taconic Farms
C57BL / 6JEiJ: Jackson Laboratory
C57BL / 6JOlaHsd: Harlan
C57BL / 6JRccHsd: Harlan
C57BL / 6JSca: Scanbur AS
C57BL / 6NTac: Taconic Farms
C57BL / 6NJ: Jackson Laboratory
C57BL / 5NHsd: Harlan
C57BL / 6NCrSim: Simonsen Laboratories
C57BL / 6By: Jackson Laboratory
C57BL / 6ByJ: Jackson Laboratory
C57BL / 6J mice are preferable.
The C57BL / 6 mouse that can be used in the present invention is a mature mouse having a body weight of 10 to 30 g, and preferably a male mouse 7 to 10 weeks old at the time of inoculation with Bordetella pertussis or Bordetella pertussis.
2. Bordetella pertussis The B. pertussis that can be used in the present invention is preferably the WHO reference strain 18323 (hereinafter referred to as Bp 18323 strain). In addition, a pertussis cell disruption solution obtained by disrupting pertussis cells can also be used.
3. Inoculation method of Bordetella pertussis or Bordetella pertussis In the present invention, inoculation of animals with Bordetella pertussis or Bordetella pertussis is performed by spray exposure or local administration, but is not limited thereto. It is not something. Exposure by spraying is, for example, a method in which an animal is placed in an airtight container, a bacterial solution containing Bordetella pertussis, or a pertussis cell disruption liquid is filled in the airtight container by spraying, mist, aerosol, etc. and exposed for the time required for infection Is mentioned. In the case of local administration, it can be carried out by nasal administration, respiratory tract administration, or subcutaneous administration of a bacterial solution containing B. pertussis or a B. pertussis cell disruption solution, but is not limited thereto. For nasal or respiratory tract administration, the inoculum is preferably inoculated by spraying a bacterial solution into the nasal cavity or respiratory tract of a mouse or by dropping a predetermined amount from a syringe needle. Nasal administration is preferred.
Specifically, a concentration sufficient for infection with Bordetella pertussis, for example, in the case of local administration, under anesthesia, 0.5 × 10 ⁸ cfu / ml or more, preferably 1 × 10 ⁸ cfu / ml or more, more preferably 0.5 to A bacterial solution containing 2 × 10 ⁸ cfu / ml Bordetella pertussis is prepared and inoculated. In the case of spraying, a bacterial solution of 0.5 × 10 ¹⁰ cfu / ml or more, preferably 1-2 × 10 ¹⁰ cfu / ml is used. Alternatively, when using a pertussis disruption solution, when administered locally, under anesthesia, preferably 0.8 mg / ml or more, more preferably 1.0 mg / ml or more, and further preferably 0.8 to 1.2 mg / ml. A body crush solution is prepared and inoculated continuously for 3 to 7 days, preferably 5 days. In the case of spraying, inoculation is carried out by using a pertussis cell disruption solution having a concentration of about 2 to 10 times the concentration of local administration and exposing for 5 to 10 days.
4). Evaluation of cough After inoculation, each mouse or several mice are placed in an observation cage, reared in the usual manner, and cough attacks are observed according to the observation procedure. Recording or video shooting equipment will be installed in the observation cage, and the sound in the cage will be recorded or recorded for a certain period of time based on the observation plan, and the number of coughs will be counted. In the observation cage, a soundproof sheet may be provided on the bottom of the cage so as not to pick up sounds other than cough.
Specific procedures are shown below, but are not limited thereto.
(1) Observation procedure A microphone and / or video camera is installed beside the observation cage, and the state of the mouse in the cage is recorded for a certain period of time, one mouse per day. Or you may move the mouse | mouth observed for every observation time to the cage which installed the microphone and / or the video camera, or may move a cage by the recording apparatus for every observation time.
After shooting, play a recording or video, observe cough sounds and / or mouse movements, and count the number of cough attacks.
(2) Observation plan During the observation period, the measurement start time is determined, recording is started at the same time every day, and recording is performed for a fixed time, preferably 5 minutes. Specifically, the observation is performed from the 4th to 6th day after the inoculation until the cough attack disappears or until the 14th day.

The present invention further provides a method for evaluating or screening a pharmaceutical used for prevention or treatment of pertussis using a pertussis model animal.
The pharmaceutical products that can be evaluated by the method of the present invention can be applied to various substances in addition to biological preparations such as pertussis vaccine.
The method for evaluating the pharmaceutical product of the present invention is shown below.
(Evaluation method using pertussis model animals)
(1) Step of producing a pertussis model animal to which a test substance is administered According to the above-mentioned (Method for producing a pertussis model animal), a pertussis model animal is prepared and a test substance is administered. Alternatively, a pertussis model animal to which a test substance is administered is prepared by inoculating an animal to which a test substance has been administered in advance with a pertussis or pertussis cell disruption solution in accordance with (Pertussis model animal production method).
Any known substance or new substance can be used as the test substance. For example, nucleic acids, carbohydrates, lipids, proteins, antibodies, vaccines, peptides, low molecular organic compounds, organic high molecular compounds, compound libraries prepared using combinatorial chemistry technology, solid phase synthesis and phage display methods. Random peptide libraries, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.
The dose of the test substance is appropriately determined according to the properties of the test substance used.
The test substance is administered before or after inoculation with Bordetella pertussis or Bordetella pertussis according to the nature of the test substance. In the case where the test substance acts on the immunity of the living body, it can be administered prior to inoculation with pertussis or pertussis cell lysate in consideration of the time for the desired immunity to be manifested. .
The number of administrations of the test substance is also appropriately determined according to the nature of the test substance, the expected usage, and the like.
The route of administration of the test substance is appropriately selected according to the method in which the test substance is most effective or the planned administration method. As the administration method, systemic administration or local administration is selected in consideration of the properties of the test substance.
As a control, a pertussis model animal not administered with the test substance is prepared in the same manner by administering the solvent or the like used in the test substance administration instead of the test substance.
(2) A step of comparing the number of cough attacks in a pertussis model animal administered with a test substance with the number of cough attacks in a pertussis model animal (control group) and / or a negative control group not administered with a test substance Or after inoculating pertussis bacterial disruption solution (method for producing pertussis model animal). According to cough evaluation, cough attacks were observed for a certain period of time, and the number of cough attacks in the pertussis model animals administered with the test substance was compared with the control group and / or negative control group. Determine whether you are doing.
(3) The step of judging the effectiveness of the test substance based on the result obtained in the comparison step The cough attack in the test substance administration group is significantly reduced compared to the control group by the comparison step (2) In this case, since the test substance can be evaluated as having an effect of significantly suppressing cough attacks caused by inoculation with pertussis or pertussis bacterial crush, the test substance is a drug candidate for treatment or prevention of pertussis. It can be selected as a substance.

The evaluation method using a pertussis model animal of the present invention can be used for evaluation of a pertussis vaccine. This will be specifically described below.
(Pertussis vaccine evaluation method)
(1) Step of producing an animal administered with a pertussis vaccine Examples of a pertussis vaccine that can be evaluated by the evaluation method of the present invention include a single pertussis vaccine or a mixed vaccine including a pertussis vaccine. Pertussis vaccine may be whole cell vaccine or acellular vaccine. In addition to pertussis toxin (PT) and filamentous hemagglutinin (FHA) as vaccine components, It may contain cilia, outer membrane protein (69KD antigen) and the like.
Here, the combination vaccine containing a pertussis vaccine contains immunogenic components against viruses or bacteria other than Bordetella pertussis. Specific examples include DPT containing diphtheria toxoid and tetanus toxoid, or DPT-IPV containing diphtheria toxoid, tetanus toxoid and inactivated Sabin strain poliovirus.
The dose of the pertussis vaccine used in the evaluation method of the present invention is determined according to the titer of the pertussis vaccine, and a plurality of dose groups such as a high dose group or a low dose group can be set and administered for each group. Good.
The timing of administration of the pertussis vaccine used in the evaluation method of the present invention can be determined in consideration of the period necessary for acquiring immunity with the pertussis vaccine. Usually, it is 3 to 4 weeks before inoculation with Bordetella pertussis or Bordetella pertussis cell suspension, preferably 4 weeks before.
The frequency of administration of the pertussis vaccine used in the evaluation method of the present invention is preferably 1 to 2 times until the infection with Bordetella pertussis.
The administration method may be systemic administration or local administration as long as immunity can be obtained by vaccine administration, and is usually determined according to the intended usage of the vaccine. In the case of local administration, intraperitoneal administration is preferred.
After the period necessary for obtaining immunity with pertussis vaccine, inoculate pertussis or pertussis cell suspension into the group that received pertussis vaccine and the group that did not receive pertussis vaccine (control group). 4) Observe cough attacks according to cough assessment.
(2) Step of comparing the number of cough attacks in pertussis model animals administered with pertussis vaccine with the number of cough attacks in control group and / or negative control group Comparison of cough attacks in pertussis vaccinated animals administered with vaccine with control group, etc. And determine if the number of cough attacks has decreased significantly.
(3) The step of judging the effectiveness of pertussis vaccine based on the results obtained in the comparison step. The comparison step (2) significantly reduced the number of cough attacks in the test substance administration group compared to the control group. The pertussis vaccine can be evaluated as having sufficient titer.

The present invention further relates to a method for identifying a cough attack-inducing factor of Bordetella pertussis.
The method for identifying a pertussis-inducing factor of Bordetella pertussis according to the present invention is a modified Bordetella pertussis Bp modified by deleting a gene encoding a specific function or structural factor of Bordetella pertussis Bp 18323 or suppressing its expression. 18323 strain is used to infect mice of C57BL / 6 strain, and the number of cough attacks is evaluated according to (Evaluation method using pertussis model animals), and which gene affects the expression of cough attacks is examined. By the identification method of the present invention, a factor that induces cough attacks by Bordetella pertussis can be identified.
This will be specifically described below.
(Method of identifying the cough attack inducing factor of Bordetella pertussis)
(1) Step of producing Bordetella pertussis Bp 18323 in which a gene encoding one function or structural factor of Bordetella pertussis Bp 18323 is deleted or modified so as to suppress its expression Here, the function or structural factor is: PT, FHA, heat-labile skin necrosis toxin, adenylate cyclase, pili, outer membrane protein (69KD antigen) and the like.
Bordetella pertussis Bp 18323, which has a gene encoding a functional or structural factor deleted or modified to suppress expression, can be obtained using known methods such as those described in EP 0,322,115, US 275,376 and Japanese Patent No. 265583. Can be produced.
Specifically, complete mRNA cannot be produced by disrupting or removing the gene encoding the function or structural factor of Bordetella pertussis. As a specific means for deleting a gene encoding a function or structural factor, a target gene (genomic DNA) is isolated according to a conventional method, for example, (1) other coding region (cds) or promoter region A method of destroying the function of cds or promoter by inserting a DNA fragment (e.g., drug resistance gene or reporter gene), (2) excising all or part of the gene and deleting the gene (e.g., (Replace with a drug resistance gene or reporter gene), (3) Insert a stop codon in cds to disable complete protein translation, (4) DNA that terminates gene transcription into the transcription region Inserting a sequence (terminator sequence) to disable complete mRNA synthesis, or (5) Replacing amino acids involved in enzyme activity in cds with any amino acid to inactivate enzyme activity As a result, a DNA strand having a DNA sequence constructed so as to inactivate the gene (hereinafter abbreviated as a targeting vector) is incorporated into the locus responsible for the function of Bordetella pertussis by homologous recombination. Etc. can be used. Preferably, a method of destroying a target gene by inserting a drug resistance gene into cds or a method of replacing or removing all or a part of the target gene with a drug resistance gene can be mentioned. Particularly preferred is a method in which most of the target gene is removed and replaced with a drug resistance gene.
As the drug resistance gene, a kanamycin resistance gene, streptomycin resistance gene, spectinomycin resistance gene, gentamicin resistance gene, chloramphenicol resistance gene, erythromycin resistance gene and the like can be used. These genes can be excised from the plasmid with an appropriate restriction enzyme, or can be amplified by PCR using the plasmid as a template and the upstream and downstream regions of these genes as primers.
(2) A step of administering the modified B. pertussis Bp 18323 strain obtained by the step (1) above or a cell disruption solution thereof to a C57BL / 6 mouse, modified according to the above (Method for producing a pertussis model animal). The B. pertussis Bp 18323 strain or the microbial cell disruption solution thereof is administered to C57BL / 6 mice (modified group).
As a control, instead of the modified B. pertussis Bp 18323 strain or its cell disruption solution, only the solvent used therefor is administered to C57BL / 6 mice (solvent inoculation group). If necessary, C57BL / 6 mice are administered pertussis Bp 18323 strain or its disruption solution without modification (positive control group).
(3) Step of comparing the number of cough attacks in the mouse of (2) According to the above (evaluation method using a pertussis model animal), the number of cough attacks in the modified group, the solvent-inoculated group and, if necessary, the positive control group Compare
(4) Step of identifying a pertussis-inducing factor of Bordetella pertussis Modified group in which no significant difference was found compared to the solvent-administered group regarding the number of cough attacks, or a modified group significantly less than the positive control group Can be identified as a cough-inducing factor. Only in the case of the pertussis nasal administration process, only when the number of B. pertussis colonies in the mouse respiratory tract is not significantly different from that in the positive control group, the adaptive modification group is used.

Another aspect of the present invention relates to a method for producing a drug for preventing or treating pertussis using the pertussis model animal of the present invention.
The pharmaceutical obtained by the production method of the present invention is a pharmaceutical containing as an active ingredient a known substance or a novel substance selected by a screening process using a pertussis model animal.
This will be specifically described below.
(Pharmaceutical production method)
(1) Step of screening a compound using a pertussis model animal According to the above-mentioned (evaluation method using a pertussis model animal), a compound that significantly suppresses cough attacks is selected. Examples of compounds used for screening include nucleic acid, carbohydrates, lipids, proteins, antibodies, vaccines, peptides, low molecular organic compounds, organic high molecular compounds, compound libraries prepared using combinatorial chemistry techniques, and solid libraries. Examples include random peptide libraries prepared by phase synthesis and phage display methods, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.
(2) A step of adding a pharmaceutically acceptable carrier to the compound obtained in (1) above. The “pharmaceutically acceptable carrier” is not particularly limited, and may be a known pharmaceutical method. It can select suitably from the substances used. For example, sterile water and physiological saline, vegetable oil, solvent, base, emulsifier, suspension, surfactant, stabilizer, flavoring agent, fragrance, excipient, vehicle, preservative, binder, diluent, Examples include isotonic agents, soothing agents, extenders, disintegrating agents, buffering agents, coating agents, lubricants, coloring agents, sweeteners, thickeners, flavoring agents, solubilizing agents or other additives. However, it is not limited to these.
The medicament obtained by the production method of the present invention can be administered by, for example, a topical, oral, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route.
As the dosage form for oral administration, powders, fine granules, granules, tablets and capsules are preferable, and they can be produced by a conventional method. Topical dosage forms may be in the form of injections, ointments, creams, lotions, eye ointments, eye drops, ear drops, mouthwashes, and aerosols, for example, preservatives, drug penetration Suitable conventional additives may be included, including accelerating solvents and softeners in ointments and creams.
The dosage of the pharmaceutical product obtained by the production method of the present invention can be appropriately selected according to various conditions such as age and weight of the subject of administration, but the daily dosage of the active ingredient is 0.001 mg / kg to It is used in the range of 1 g / kg, preferably 0.1 mg / kg to 100 mg / kg.

A further aspect of the present invention relates to a method for producing a pertussis vaccine.
The pertussis vaccine obtained by the production method of the present invention includes a pertussis alone vaccine containing only a pertussis protective antigen, and a combination vaccine containing other immunogenic components in addition to a pertussis protective antigen.
This will be specifically described below.
(Method for producing pertussis vaccine)
(1) Step of producing a pertussis protective antigen A pertussis protective antigen can be produced by a known method, for example, the method described in Example 5 of WO 2008/044611. Specifically, the protective antigen of Bordetella pertussis can be obtained by, for example, infecting the culture of Bordetella pertussis I (Higashihama strain) with a physicochemical method such as ammonium sulfate fractionation or sucrose density gradient centrifugation. It can also be obtained by extracting, separating and purifying the fraction and then reducing the remaining toxicity with formalin.
Protective antigens of Bordetella pertussis include PT, FHA, outer membrane protein (69 KD antigen), and pili (FB antigen, also called agglutinogen (FGG)). The pertussis protective antigen does not necessarily need to include all of the antigens described above, and may include one or more, preferably two or more, more preferably three or more of these antigens.
(2) Step of measuring efficacy of pertussis protective antigen According to the above-mentioned (pertussis vaccine evaluation method), the B. pertussis Bp 18323 strain is obtained according to the above-mentioned (pertussis vaccine evaluation method). Alternatively, the efficacy of the pertussis protective antigen is measured using mice inoculated with a cell disruption solution of B. pertussis Bp 18323 strain.
Specifically, the following steps are included.
i) Step of administering Bordetella pertussis protective antigen to C57BL / 6 mice ia) Bordetella pertussis Bp 18323 strain to mice administered with Bordetella pertussis protective antigen and C57BL / 6 mice not administered with Bordetella pertussis protective antigen Or inoculating a cell disruption solution of B. pertussis Bp 18323 strain, or
ii) Bacterium pertussis Bp 18323 or B. pertussis Bp 18323 strain was applied to mice administered the pertussis protective antigen and C57BL / 6 mice administered pertussis vaccine as a standard or reference product. Inoculating step iii) comparing the number of cough attacks in mice administered with the pertussis protective antigen to the number of cough attacks in mice not administered with the pertussis protective antigen (control group) and / or negative control group, Or
iii) comparing the number of cough attacks in mice administered with the pertussis protective antigen to the number of cough attacks in mice administered with a standard or reference pertussis vaccine, and
iv) A step of evaluating the effect of the pertussis protective antigen based on the result obtained by the step iii) or iiib).
Here, as a pertussis vaccine as a standard product, an international standard product or a domestic standard product can be used. International standard products are those with international units (IU / mL). Domestic standard products, if there are corresponding international standard products, match those categories, or there is no corresponding international product. Defines independent national units. As the reference product, a vaccine whose vaccine efficacy is already known can be used, and a pertussis vaccine already on the market can be mentioned.
(3) Step of formulating into a unit dose preparation The pertussis protective antigen having a predetermined efficacy measured by the step (2) above may be appropriately pharmaceutically acceptable carrier and / or other if desired Mix with immunogenic ingredients, etc. to produce unit dose formulations. Alternatively, the above step (2) may be carried out after making a unit dose preparation.
The pharmaceutically acceptable carrier is as described in (2) of (Method for producing pharmaceutical product).
Other immunogenic components include immunogenic components other than Bordetella pertussis. Examples of such immunogenic components include immunogenic components against viruses or bacteria other than Bordetella pertussis. Examples of immunogenic components include toxoids, attenuated viruses, inactivated viruses, proteins, peptides, polysaccharides, lipopolysaccharides, lipopeptides, or combinations thereof. Examples of viruses or bacteria other than Bordetella pertussis include, for example, poliovirus, diphtheria, tetanus, influenza virus, measles virus, parotitis virus, rubella virus, herpes virus, chicken pox virus, rabies virus, human immunodeficiency virus, Examples include hepatitis virus, pneumococcus, meningococcus, Salmonella typhi, and influenza b. Preferably, it is an inactivated Sabin strain poliovirus, diphtheria toxoid, or tetanus toxoid.
The vaccine obtained by the production method of the present invention includes DPT containing diphtheria toxoid and tetanus toxoid in addition to pertussis protective antigen, or diphtheria toxoid, tetanus toxoid and inactivated sabin strain polio A bivalent or higher mixed vaccine such as DPT-IPV containing virus is preferred.
The pertussis vaccine obtained by the production method of the present invention is a preparation containing a single dose in one preparation, and ampoules and syringes are typical forms.
The pertussis vaccine obtained by the production method of the present invention can be formulated as an injection according to conventional means. The injection is prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the above substance in a sterile aqueous or oily liquid usually used for injection. As the aqueous liquid for injection, for example, isotonic solutions containing physiological saline, glucose and other adjuvants are used. The prepared injection solution is usually filled in an appropriate ampoule, syringe or the like.
The pertussis vaccine obtained by the production method of the present invention may contain formulation additives such as preservatives, antioxidants, and chelating agents, if necessary. Examples of preservatives include thimerosal and 2-phenoxyethanol. Examples of chelating agents include ethylenediaminetetraacetic acid and glycol ether diaminetetraacetic acid.
The pertussis vaccine obtained by the production method of the present invention may further contain an adjuvant. Examples of the adjuvant include aluminum hydroxide, aluminum phosphate, and aluminum chloride.
The pertussis vaccine obtained by the production method of the present invention can be administered parenterally, for example, by subcutaneous injection or intramuscular injection, preferably by subcutaneous injection.
The single dose of pertussis vaccine obtained by the production method of the present invention can be appropriately selected according to various conditions such as the age and weight of the administration subject. Usually, pertussis protective antigens in unit dosage form contain 4 international units or more. In unit preparations of mixed vaccines containing other immunogenic components, diphtheria toxoid is about 15 Lf, tetanus toxoid is about 2.5 Lf, inactivated Sabin type I poliovirus is about 2 to 4 units (preferably about 3 units), about 80-120 units (preferably about 100 units) with inactivated Sabin type II poliovirus as D antigen, and about 80-120 units (preferably about 100 units) with inactivated Sabin type III poliovirus as D antigen ) May be contained.
For example, the pertussis vaccine obtained by the production method of the present invention may be administered 2 to 3 times at intervals of 3 to 8 weeks as the first immunization. When the pertussis vaccine of the present invention is administered twice as the initial immunization, it is preferable to administer it once more at an interval of 3 to 8 weeks. As booster immunization, it may be administered once more at an interval of 6 months or more after the first immunization (for example, between 12 and 18 months after the end of the first immunization).

EXAMPLES Hereinafter, although an Example demonstrates this invention concretely, this is an example and this invention is not limited to these specific examples.

Example 1 (Preparation of a pertussis model animal using C57BL / 6J mice)
(1) Production of pertussis infection model animals
7-week-old male C57BL / 6J mice (source: Claire Japan, 9 / group), 0.5-2 × 10 ⁸ cfu / ml of Bordetella pertussis (Bp 18323 strain, source: Osaka University) (Composition: Stainer-Scholte (SS) liquid medium [Stainer, DW, Scholte, MJ, J. Gen. Microbiol., 63, 211-220 (1971)]) prepared and injected under anesthesia 50 μl was inoculated into the nasal cavity of mice using a needle. As a control group (5 animals / group), a solvent that did not contain Bordetella pertussis (composition: SS liquid medium, amount 50 μl) was similarly inoculated under anesthesia.
After inoculation, the mice were individually placed in observation cages and raised under normal breeding conditions.
(2) Observation of cough attack According to the observation procedure, the state of the mouse in the cage was photographed for 5 minutes per animal per day. The cough attack symptoms were discriminated from the movement of the mouse and the sound of the cough attack by playing the captured video, and the number of cough attacks was counted.
A cough attack occurred on day 6 after infection. The elapsed days and the number of cough attacks were graphed with 0 days at the time of inoculation (A in FIG. 1). The number of 45-minute cough attacks in 6 to 14 days after infection of the infected animals obtained in Example 1 (1) was significantly increased compared to non-infected animals (B in FIG. 1).
<Observation procedure>
A microphone-connected video camera is set up near the observation cage, and the state of the mouse in the cage is recorded for 5 minutes per day. Observations are made from the 6th day to the 14th day after inoculation.
After shooting, play with video editing software (product name: Adobe Premiere Pro, source: Adobe), and measure the number of cough attacks by watching cough and mouse movements.
(3) Bacterial colonization confirmation test During the observation period from day 6 to day 14 after nasal inoculation with Bordetella pertussis, in order to confirm the extent of bacterial colonization in the airways and lungs of the B. pertussis vaccination group A fixed cell count confirmation test was performed.
The test for confirming the number of colonized cells in the respiratory tract and lungs was performed according to the following procedure.
After removing the airways and lungs from mice nasally inoculated with Bordetella pertussis, each tissue is homogenized. After diluting the homogenized solution to an arbitrary dilution ratio, it is inoculated on Bordet-Gengou blood agar medium (manufactured by Kyokuto Pharmaceutical Co., Ltd.) and cultured at 37 degrees for 3-4 days. The number of colonies formed is counted, and the number of cells colonized in each tissue is calculated.
The results are shown in FIG. From this result, a sufficient number of colonized cells could be confirmed in the respiratory tract and lungs.

Comparative example (cough attack of pertussis model animals by nasal inoculation with Bordetella pertussis prepared under various conditions)
(1) Production of C57BL / 6J mice infected with various Bordetella pertussis and cough attack evaluation Various Bordetella pertussis strains (BP140, BP141, BP142, BP144) (obtained from National Institute of Infectious Diseases) and Tohama I strain (obtained from Osaka) University) and pertussis-infected C57BL / 6 mice were prepared in the same manner as in Example 1, and the number of cough attacks for a certain period of time was counted (A in FIG. 2). A comparison was made (FIG. 2B). In addition, a test for confirming the number of colonized cells in the airways and the lungs (C and D in FIG. 2) was performed.
As a result, the mice infected with the clinical isolates had a sufficient number of bacteria in any of the clinical isolates in the respiratory tract and lungs. On the other hand, the number of cough attacks was significant in some clinical isolates compared with the non-infected group, but all were less than the Bp 18323 infected group. No cough attack was observed in C57BL / 6 mice infected with Tohama I strain.
(2) Preparation of Balb / c mice infected with Bordetella pertussis Bp 18323 and evaluation of cough attacks
Bp 18323 strain was inoculated in the same manner as in Example 1 using 7-week-old Balb / c mice (source: Nippon SLC, number of mice: 3 / group) to prepare Bp 18323 strain-infected Balb / c mice. The cough attack was observed (A in FIG. 3) and compared with the cough attack in the Bp 18323 strain-infected C57BL / 6 mouse prepared in Example 1 (B in FIG. 3). Further, a test for confirming the number of colonized cells in the respiratory tract and lungs (C and D in FIG. 3) was conducted.
As a result, the number of cough attacks in the Bp 18323 strain was not significant compared with that in the non-infected group even though sufficient numbers of bacteria were established in the lungs and airways of Balb / c mice.
(3) Preparation of C57BL / 6J mice infected with Bordetella pertussis Bp 18323 PT gene deletion mutant and evaluation of cough attack
Using a Bp 18323 PT gene deficient mutant prepared based on the Bp 18323 strain, pertussis-infected C57BL / 6 mice were prepared in the same manner as in Example 1, and the number of cough attacks during a certain period of time was counted (A in FIG. 4). ) Thereafter, the number of cough attacks was analyzed, and comparison was made for each strain (B in FIG. 4). In addition, a test for confirming the number of colonized cells in the respiratory tract and lungs (C and D in FIG. 4) was performed.
As a result, the number of cough attacks was significantly decreased in the Bp 18323 PT-deficient mutant-infected group compared to the Bp 18323 strain-infected group. On the other hand, mice infected with the Bp 18323 PT gene-deficient mutant had established a sufficient number of bacteria in the respiratory tract and lung, but the number of colonized cells in each tissue was significantly higher than that of B. pertussis Bp 18323. It was decreasing.
<Bp 18323 PT gene deletion mutant production method>
A Bp 18323 gene-deficient mutant was prepared by modifying the method described in Nisikawa S et al, Microbiol Immunol 60: 93-105, 2016. The source of the primers used below is Invitrogen. A region (PT-U and PT-D) from the 5 ′ end and the 3 ′ end of the PT gene operon from S1 to S5 (PT-U and PT-D), and a primer PT-UF (gatccgagctctcccaacccgtcgtggtgcagaa; SEQ ID NO: 1) and PT-UR (ttagcttccttagctagtgcaacgccatcccgtc; SEQ ID NO: 2), PT-DF (cgcgccatttaaatggcgtcgatatgctgagcc; SEQ ID NO: 3) and PT-DR (ttagcttccttagctagtgcaacgcatcccgtc; SEQ ID NO: 4) . Chloramphenicol resistance gene (CmR), pKK232-8 DNA (Osaka University) as a template Primer CmR-F (agctaaggaagctaaaatggag; SEQ ID NO: 5) and CmR-R (catttaaatggcgcgcctt; SEQ ID NO: 6) Amplify by PCR. pABB-CRS2-Gm (Osaka University) as a template, primers pABB-CRS2-GmR-inverse-S (gggaattccacaaattgttatccg; SEQ ID NO: 7) and pABB-CRS2-GmR-inverse-AS (gggagagctcggatccacta; SEQ ID NO: 8 ) Is used as a backbone vector pABB-CRS2-GmR after inverse PCR using DpnI enzyme treatment. The PT-U, PT-D and CmR fragments are inserted and bound to the backbone vector pABB-CRS2-GmR using In-Fusion HD cloning kit (available from Clontech Laboratories). This vector is designated as ΔPT-pABB-CRS2-GmR. Using a triple parental junction transfer method using E. coli DH5α λpir (Osaka University) transformed with ΔPT-pABB-CRS2-GmR and HB101 / pRK2013 plasmid transfer helper strain (Osaka University) By inserting a plasmid of ΔPT-pABB-CRS2-GmR into the 18323 strain, a Bp 18323 PT gene-deficient mutant in which the PT gene is replaced with CmR by homologous recombination is created.
(4) Discussion of the results From these results, the degree of cough attack in B. pertussis-infected mice varies depending on the combination of B. pertussis and mouse strain, and the combination of Bp 18323 strain and C57BL / 6 mice is the most A significant cough attack was found. In addition, the number of colonized cells in the respiratory tract and lungs decreased in the Bp 18323 PT gene-deficient mutant-infected group compared to the Bp 18323-infected group, but the number of cough attacks decreased more remarkably. This suggests that PT may be involved in the development of cough attacks in pertussis model mice.

Example 2 (Identification of Cough Attack Inducing Factor Using Pertussis Model Animal)
(1) Preparation of pertussis cell disruption solution
Bp 18323 strain (Osaka University) and Bp 18323 strain PT gene-deficient mutant and Bp 18323 FHA gene-deficient mutant prepared based on Bp 18323 strain are used. Bp 18323 strain (pathogenic mode, Bvg ⁺ ), Bp 18323 strain PT gene-deficient mutant strain, and Bp 18323 strain FHA gene-deficient mutant strains cultured in SS liquid medium are prepared. As a negative control group, a bacterial solution of Bp 18323 strain (non-pathogenic mode, Bvg ⁻ ) cultured in an SS liquid medium containing 40 mM MgSO ₄ is used. Bordetella pertussis cultured in Bvg ⁺ produces PT and FHA, but those factors are not produced in Bordetella pertussis cultured in Bvg ⁻ . After centrifuging various bacterial solutions (8,000 × g), the supernatant was removed, and 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na ₂ HPO ₄ , and 1.5 mM KH ₂ PO ₄ buffer, pH 7.4 (D-PBS (- )), The precipitated cells are suspended, and pertussis cells are crushed with an ultrasonic crusher. After centrifugation (8,000 × g) of various cell disruptions, the supernatant is recovered and the cells are completely removed with a 0.22 μm filter. This is designated as pertussis cell disruption solution.
<Bp 18323 FHA gene deletion mutant production method>
The Bp 18323 strain FHA gene-deficient mutant was prepared according to the <Method for preparing Bp 18323 PT gene-deficient mutant> in Comparative Example (3). The source of the primers used below is Invitrogen. The region (FHA-U and FHA-D) from the 5 ′ end and the 3 ′ end of the FHA gene to about 1000 bp, the primer FHA-UF (gatccgagctctcccaagaacggcacctggac; SEQ ID NO: 9) using the genomic DNA of the Bp 18323 strain as a template FHA-UR (ttagcttccttagctaaataggtagtcgcggcc; SEQ ID NO: 10), and FHA-DF (cgcgccatttaaatgattccgaccagcgaagtg; SEQ ID NO: 11) and FHA-DR (atttgtggaattccctcagcttctgcagcagg; SEQ ID NO: 12) were amplified by PCR using HA and F. -D fragment is prepared. A CmR fragment and a backbone vector pABB-CRS2-GmR are prepared in the same manner as in Comparative Example (3). FHA-U, FHA-D and CmR fragments are inserted and bound to the backbone vector pABB-CRS2-GmR using In-Fusion HD cloning kit (available from Clontech Laboratories). This vector is designated as ΔFHA-pABB-CRS2-GmR. Bp using a three-parental junction transfer method using E. coli DH5α λpir (Osaka University) transformed with ΔFHA-pABB-CRS2-GmR and HB101 / pRK2013 plasmid transfer helper strain (Osaka University) By inserting a plasmid of ΔFHA-pABB-CRS2-GmR into the 18323 strain, a Bp 18323 FHA gene-deficient mutant in which the FHA gene is replaced with CmR by homologous recombination is created.
(2) Preparation of purified PT
PT was purified according to the method described in Skelton SK et al, J. Clin. Microbiol 28: 1062-1065,1990. Specifically, the culture solution of Bp18323 strain cultured in liquid culture (37 degrees, 48 hours) in CL liquid medium (Imaizumi A et al, Infect. Immun 41: 1138-1143, 1983) was centrifuged (12,000 × g) and the supernatant Collect the solution and add ammonium sulfate to a final concentration of 1 M. Equilibrate butyl-Sepharose 4 Fast Flow (source: Amersham) with 1 M ammonium sulfate solution and add the collected supernatant. After washing the column with 10 mM sodium phosphate-3 M sodium chloride (pH 7.4) solution, the adsorbed fraction is eluted and collected with 5 mM sodium phosphate-50 mM sodium chloride solution (pH 7.4). Fetuin-Agarose (source: Sigma) was equilibrated with 10 mM sodium phosphate-0.15 M sodium chloride (pH 7.4) solution, and the recovered elution fraction was added, and 50 mM Tris-HCl-1 M sodium chloride (pH 7.4) was added. ) After washing the column with the solution, the adsorbed fraction is eluted and collected with a 50 mM Tris-HCl-4 M magnesium chloride (pH 7.4) solution. The elution fraction was dialyzed against D-PBS (−) and then concentrated by centrifugation using Vivasvin Turbo 15 (source: Sartorius) having a ultrafiltration size of 3.0 kDa.
(3) Production of pertussis inoculated animal
7-week-old male C57BL / 6J mice (source: Claire Japan, 3 / group) were anesthetized with 1.0 mg / ml of various cell disruptions (composition: D-PBS (-)). Below, 50 μl was administered into the nasal cavity of mice using an injection needle. As a control group (3 animals / group), a solvent containing no pertussis bacterial component (composition: D-PBS (−), amount 50 μl) was similarly administered under anesthesia (A and B in FIG. 5). .
7-week-old male C57BL / 6J mice (source: CLEA Japan, 5 / group), 1.0 mg / ml of various cell disruptions (composition: D-PBS (-)), purified PT (200 ng, composition: D-PBS (-)), or 1.0 mg / ml Bordetella pertussis PT gene-deficient cell disruption solution (composition: D-PBS-)) + purified PT (200 ng, composition: D-PBS (-) )) Was administered into the nasal cavity of mice using an injection needle under anesthesia. As a control group (5 animals / group), a solvent (composition: D-PBS (−), amount 50 μl) containing no pertussis cell component was similarly administered under anesthesia (C and D in FIG. 5). .
After inoculation, the mice were individually placed in observation cages and raised under normal breeding conditions.
(4) Observation of cough attack According to (2) of Example 1, Bp 18323 strain (Bvg ⁺ ) cell disruption fluid inoculation group, Bp 18323 strain (Bvg ⁻ ) cell disruption fluid inoculation group, Bp 18323 FHA gene deletion mutation The number of cough attacks for a certain period of time was counted for the strain disruption group inoculation group, the Bp 18323 PT gene-deficient mutant strain disruption group inoculation group, and the solvent inoculation group (A in FIG. 5). The number of cough attacks 6 to 14 days after the nasal inoculation of the sample was compared between the Bp 18323 strain (Bvg ⁺ ) bacterial cell disruption group and the solvent inoculation group or various bacterial cell disruption group inoculation groups (FIG. 5). B).
As a result, the number of cough attacks increased significantly in the Bp 18323 strain (Bvg ⁺ ) cell disruption group-inoculated group compared with the solvent-inoculated group (B in FIG. 5). In the group inoculated with Bp 18323 strain (Bvg ⁻ ), the number of cough attacks was significantly reduced as compared to the group inoculated with Bp 18323 strain (Bvg ⁺ ) (B in FIG. 5). Compared with the Bp 18323 strain (Bvg ⁺ ) cell disruption group inoculation group, the Bp 18323 FHA gene-deficient mutant cell disruption group inoculation group showed no significant difference in the number of cough attacks. In the group inoculated with PT gene-deficient mutant cells, the number of cough attacks was significantly reduced (B in FIG. 5).
According to Example 1 (2), Bordetella pertussis 18323 (Bvg ⁺ ) cell disruption group, Bp 18323 PT gene deletion mutant cell disruption group, purified PT inoculation group, Bp 18323 PT gene deletion mutant The number of cough attacks for a certain period of time was counted for the microbial cell disruption solution + purified PT inoculated group and the solvent inoculated group (C in FIG. 5). The number of cough attacks 6 to 14 days after the nasal inoculation of the above specimens was determined by solvent inoculation group, purified PT inoculation group, Bp 18323 PT gene-deficient mutant cell disruption solution + purified PT inoculation group, and other cell disruption solutions. Comparison was made in the inoculated group (D in FIG. 5).
As a result, compared with the solvent-inoculated group, the number of coughing episodes significantly increased in the purified PT-inoculated group and the Bp 18323 PT gene-deficient mutant cell disruption solution + purified PT-inoculated group (D in FIG. 5).
(5) Discussion of results Until now, the role of PT in pertussis infection, that is, the relationship between PT and disease state, remains unclear, but the relationship between cough attack and PT has been clarified by the method for identifying cough seizure-inducing factors of the present invention. PT was shown to be an important factor in causing cough attacks. In addition, the number of cough attacks in pertussis model mice in the nasal inoculation group of purified PT was significantly increased compared to that in the solvent group, but it was suggested that the induction was insufficient with purified PT alone. Bp 18323 Considering that cough attacks were sufficiently induced in the PT gene-deficient mutant cell disruption fluid + purified PT inoculation group, stimulation reactions including inflammation of the host tissue by the bacterial cell components inducing cough attacks It may be important.

Example 3 (Evaluation of DTP-IPV vaccine)
As a vaccine administration group, DTP-IPV vaccine (product name: Tetrabic, source: Osaka University Microbial Disease Research Society) dose: 0.16 IU / mL to 1 IU / mL, 3 weeks old C57BL / 6J mice ( Obtained from: Japan Claire Co., Ltd., 5 mice / group). Three weeks after administration, the same dose of DTP-IPV vaccine was intraperitoneally administered.
As a control, similarly to 3-week-old C57BL / 6J mice (CLEA Japan, number / group), aluminum adjuvant (product name: Imject (registered trademark) Alum, source: Thermo scientific) dose of 100 μl peritoneally It was administered internally (non-vaccine group). Three weeks after administration, the same dose of aluminum adjuvant was intraperitoneally administered.
On the seventh day after the final administration of the vaccine, according to (1) of Example 1, the bacterial solution (composition: SS liquid medium) containing the Bp 18323 strain (0.5-2 × 10 ⁸ cfu / ml) was administered to the vaccine administration group and the non-vaccine Pertussis model animals were prepared by inoculating 50 μl of mice in the nasal cavity of 4 to 5 animals / group. In the non-infected group, 50 μl of a solvent (composition: SS liquid medium) was inoculated intranasally.
(1) Observation of Cough Attacks According to (2) of Example 1, the number of cough attacks for a certain period of time was counted for the vaccine administration group, the non-vaccine administration group, and the non-infection group (A in FIG. 6).
The number of cough attacks 6 to 14 days after nasal inoculation with Bordetella pertussis was compared between the non-infected group, the non-vaccine-administered group, and the vaccine-administered group (B in FIG. 6).
As a result, the DTP-IPV vaccine significantly suppressed cough attacks occurring in C57BL / 6 mice infected with the Bp 18323 strain. This suppression was also dose-dependent for the inoculated DTP-IPV vaccine.
(2) Infection protection confirmation test
In order to confirm the extent to which pertussis infection was protected in the respiratory tract and lungs by DPT-IPV vaccine administration, according to the method of Example 1 (2), the vaccine administration group was examined on the 14th day after infection. The number of colonized cells in the airways and lungs was measured (C and D in FIG. 6).
As a result, the number of colonized bacteria of Bordetella pertussis in the vaccine administration group significantly decreased. There was no significant difference in the number of colonized cells in the respiratory tract.
(3) Measurement of antibody titer In the vaccine administration group, the anti-PT antibody (anti-PT-IgG antibody) titer of the mouse in the serum on the seventh day after the final administration of the vaccine was measured by the following method (E in Fig. 6).
PT (1.0 μg / ml) was added to a 96-well plate and reacted at 4 degrees for 18 hours or longer. After washing the 96-well plate with a washing buffer (composition: D-PBS (-)-0.05% Tween20), blocking buffer (composition: D-PBS (-)-0.5% BSA) was added to each well at 37 degrees. The reaction was carried out for 1 hour. After washing the 96 well plate with washing buffer, add mouse antiserum before immunization diluted to any dilution ratio (100, 1,000, 10,000, 100,000 times dilution) and DPT-IPV immunized mouse antiserum to each well, The reaction was carried out at 37 degrees for 1 hour. After washing the 96-well plate with a washing buffer, anti-mouse IgG-HRP (source: Cappel) diluted 5,000 times was added to each well and reacted at 37 degrees for 1 hour. After washing the 96-well plate with washing buffer, add a solution containing TMB (3,39, 5, 59-tetramethylbenzidine) peroxidase enzyme substrate (source: Wako Pure Chemical Industries, Ltd.) to each well and react at room temperature for 30 minutes I let you. 1.0 NH ₂ SO ₄ was added to each well to stop the reaction, and then the absorbance at 450 nm wavelength was measured using a 96-well plate using Multi-Detection Microplate Reader (Source: DS Pharma Biomedical Co., Ltd.) Anti-PT-IgG antibody titers in DPT-IPV immunized mouse antiserum were calculated.
As a result, sufficient antibodies against PT, the main component of pertussis vaccine, were present in the serum on the seventh day after the final vaccine administration.
(4) Discussion of the results From these results, a substance capable of remarkably suppressing cough attacks, which is a major factor in the spread of infection, even if it does not have the effect of suppressing colonization of Bordetella pertussis in mice, is a human. It has been confirmed that it is useful in preventing pertussis infection. In addition, when combined with the description in Example 2 (4), anti-PT-IgG antibody produced in the mouse body by pertussis vaccine administration binds to PT produced by nasal inoculated Bordetella pertussis and inhibits toxic function. This suggests the possibility of suppressing cough attacks.

  The pertussis model animal of the present invention is inexpensive and highly convenient, and exhibits a remarkable cough attack as seen in pertussis infection in humans. Therefore, elucidation of the cough attack mechanism, identification of the cough attack inducing factor, and screening evaluation of drugs for pertussis Useful for. The evaluation method of the present invention can evaluate various test substances and is useful for drug development.

Claims (8)

  A method for producing a pertussis model mouse comprising inoculating a C57BL / 6 mouse with a bacterial solution containing B. pertussis Bp 18323 or a cell disruption solution containing B. pertussis Bp 18323.     The method of claim 1, wherein the C57BL / 6 mouse is a mature mouse. The method according to claim 1, wherein the bacterial solution contains 0.5 × 10 ⁸ cfu / ml or more of Bordetella pertussis Bp 18323 strain, or the bacterial cell disruption solution contains 0.8 mg / ml or more of bacterial cell components. A test substance evaluation method comprising:
(1) A step of administering a test substance to C57BL / 6 mice,
(2) inoculating mice that have been administered a test substance and C57BL / 6 mice that have not been administered a test substance with a cell disruption solution of B. pertussis Bp 18323 or B. pertussis Bp 18323;
(3) comparing the number of cough attacks in mice administered with the test substance with the number of cough attacks in mice not administered with the test substance and / or mice not inoculated with Bordetella pertussis or Bordetella pertussis, and
(4) Based on the result obtained by the step (3), a step of determining the effectiveness of the test substance in inhibiting cough attacks caused by B. pertussis infection,
Evaluation method including     The method according to claim 4, wherein the test substance is a pertussis vaccine.   A pertussis model mouse, which is a C57BL / 6 mouse infected with B. pertussis Bp 18323 strain or a C57BL / 6 mouse inoculated with a cell disruption solution of B. pertussis Bp 18323 strain, exhibiting cough attack. A method for identifying a cough attack-inducing factor of Bordetella pertussis,
(1) Step of producing Bordetella pertussis Bp 18323 in which a gene encoding one function or structural factor of Bordetella pertussis Bp 18323 is deleted or modified to suppress expression (2) Obtained by the step (1) above 7. The step of administering the modified B. pertussis Bp 18323 strain or the microbial cell disruption solution thereof to C57BL / 6 mice (3) The number of cough attacks in the mice of (2) above is determined according to the solvent inoculation group and / or claim 6. Comparing the number of cough attacks in pertussis model mice, and
(4) A step of identifying a pertussis-inducing factor of Bordetella pertussis based on the result obtained by the step (3),
Specific methods including: A method for producing a pertussis vaccine,
(1) Step of producing pertussis protective antigen (2) Efficacy of pertussis protective antigen using C57BL / 6 mice inoculated with B. pertussis Bp 18323 strain or B. pertussis Bp 18323 strain And (3) mixing the pertussis protective antigen with a pharmaceutically acceptable carrier and / or other immunogenic ingredients and formulating into a unit dose formulation,
Manufacturing method.