JP2018033326A - Gene that controls cesium absorption, and cesium low-absorptive plant - Google Patents

Abstract

PROBLEM TO BE SOLVED: To identify a gene associated with the mechanism of cesium taken in by a plant, and provide a more effective and practical cesium reduction technique.SOLUTION: The present invention provides a polynucleotide composed of a base sequence of sequence number 9, a polynucleotide encoding an amino acid sequence of sequence number 11, and the like. The invention also provides a method of inhibiting cesium absorption by a plant, using the polynucleotide. The present invention further provides a cesium low-absorptive plant body or plant variety, a material for its growth, a harvest thereof, or a processed product thereof.SELECTED DRAWING: None

Description

  The present invention relates to genes that control cesium (Cs) absorption in plants. The present invention is useful in fields such as plant breeding.

The Great East Japan Earthquake that occurred in 2011 caused a nuclear power plant accident, and radioactive elements released by vents and hydrogen explosions contaminated a wide range of soils and plants. Radioactive nuclides released into the environment, such as iodine-131 ( ^131I ) with a short half-life, are no longer detected. However, cesium 137 ⁽¹³⁷ Cs) is much amount released from primary and half-life 30. For two years and longer, higher antenna weight over the next in the contaminated area extended period, as well as radioactive cesium contamination of plants and crops problem It becomes. In this way, the Great East Japan Earthquake is causing damage to the affected areas in addition to damage from earthquakes and tsunamis, as well as radioactive material contamination caused by nuclear power plant accidents. For the reconstruction of agriculture in the affected areas, it is currently the most important to establish a technology that reduces the amount of cesium absorbed by major crops (does not absorb cesium) in order to prevent the reputational damage of crops and ensure safety. It has been demanded.

Immediately after the earthquake disaster, ¹³⁷ Cs behavior in the environment has been grasped by intensive research and monitoring by many researchers. Since adsorption of cesium onto soil is much stronger than other monovalent cations, once adsorbed cesium does not easily desorb from clay minerals and eventually accumulates on the surface of the soil. Furthermore, it has been clarified that when cesium is adsorbed on a site called frayed edge of clay minerals in a form accompanied by dehydration of ions, it is fixed almost irreversibly and becomes difficult to be absorbed by plants over time. Reference 1). After the earthquake, the number of crops that exceed standard values, especially rice, has decreased over time, indicating that cesium is being immobilized on the soil. It has also been found that cesium incorporated into crops can be suppressed by a competitive effect by fertilizing a large amount of potassium (Non-patent Document 2).
In addition, the existence of a gene family of high affinity potassium (high affinity K ⁺ , HAK) transporters is known in various plants including rice, and phylogenetic analysis and functional differences have been studied ( Non-patent document 3)

  On the other hand, regarding the absorption of cadmium in plants, a causal gene has been identified, and cadmium absorption-suppressed rice obtained by crossing a cadmium absorption-suppressed rice mutant with an existing rice variety has been proposed (Patent Document 1).

International Publication WO2013 / 065517

Behavior of radioactive cesium in soil plant systems and its variation factors, Agricultural Research Report 31, p75-129 (2012) Zhu et al, Plant uptake of radiocesium: a review of mechanisms, regulation and application.Journal of Experimental Botany.Vol.51 (351), p1635-1645 (2000) Zefeng Yang et al, Molecular evolution and functional divergence of HAK potassium transporter gene family in rice (Oryza sativa L.), J. Genet.Genomics, 36, 161-172 (2009) T. Fujiwara, Cesium uptake in rice: Possible transporter, distribution, and variation.Agricultural Implications of the Fukushima Nuclear Accident, p29-35 (2013) Yuji Ono et al., Varietal Differences Regarding Radioactive Cesium in Rice, Fukushima Agricultural Research Center Research Report, Special Issue on Radioactive Substances 2013, p29-32 (2014)

Currently, in areas where cultivation is resumed, topsoil is stripped for fields with high doses, and other fields with relatively low doses are undertaking efforts to reduce Cs absorption by crops with potassium. However, stripping off the topsoil requires processing (storage) of a huge amount of soil, and the amount of potassium fertilization is that the cost and potassium fertilizer itself contain radioactive potassium 40 ( ⁴⁰ K). It includes many problems such as whether to continue.

  On the other hand, improvement of crops such as low-absorbency varieties only requires the provision of seeds, which can be said to be a very low-cost and environmentally friendly measure. For paddy rice, various varieties of cesium absorbability were tested, but no varieties with extremely low cesium absorption were found in the conventional edible varieties (Non-Patent Documents 4 and 5). In other words, cesium absorption is preferably as low as possible, but existing gene resources cannot incorporate the characteristic that cesium absorption is sufficiently suppressed into main cultivars by crossing or the like.

  If a gene related to the mechanism by which cesium is taken into plants can be identified, a more effective and practical Cs reduction technology can be provided. Therefore, the present inventors performed mutagenesis treatment with a chemical mutant on main varieties, created mutants with a new genetic property of Cs low absorption (high), elucidated the control genes of Cs absorption and Using these as breeding materials, we aimed to add Cs low absorption to the main varieties. Then, Cs low-absorption line was selected from the group of mutant lines in which mutations were induced by chemical mutants (sodium azide, MNU), and the low-absorption varieties were developed by identifying the absorption control gene and using that line as breeding material. The present invention has been completed.

The present invention provides the following.
[1] The polynucleotide according to any one of the following (a) to (f):
(A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9;
(B) a polynucleotide having a function of hybridizing under stringent conditions with a polynucleotide comprising a nucleotide sequence complementary to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and controlling plant cesium absorption;
(C) a polynucleotide having a nucleotide sequence of SEQ ID NO: 9 of 90% or more and having a function of controlling plant cesium absorption;
(D) a polynucleotide encoding the amino acid sequence of SEQ ID NO: 11;
(E) a polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption;
(F) a polynucleotide encoding an amino acid sequence having 90% or more identity with the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption.
[2] The polynucleotide according to 1, which is derived from a plant of the genus Rice.
[3] The polynucleotide according to 1 or 2, which is (a) or (d).
[4] A method for suppressing cesium absorption of a plant using the polynucleotide according to any one of (a) to (f) defined in 1.
[5] The method according to 4, wherein the use of the polynucleotide is to reduce the function of a gene comprising the polynucleotide or a protein encoded by the gene.
[6] The method according to any one of 3 to 5, wherein the use of the polynucleotide is to cause mutation in an exon part of the polynucleotide.
[7] Any one of the polynucleotides defined in (a) to (f) defined in 1 has a mutation, and the function of a protein comprising the polynucleotide or an amino acid sequence encoded by the polynucleotide is suppressed. A cesium low-absorption plant or a part thereof.
[8] The plant body according to 6, which is a rice genus plant, or a part thereof.
[9] A cesium low-absorption plant variety bred using the plant according to 6 or 7 or a part thereof.
[10] The cultivar according to 9, wherein the plant is rice.
[11] A breeding material of the variety according to 8 or 9.
[12] A harvest or processed product obtained by using the plant according to 6 or 7, or the plant of the variety described in 8 or 9.
[13] Use of the polynucleotide defined in any one of (a) to (f) defined in 1 as a marker for low cesium absorption.

According to the present invention, a polynucleotide involved in cesium absorbability and a protein comprising the amino acid sequence encoded by the polynucleotide are provided.
According to the present invention, a method of suppressing plant cesium absorption is provided.
According to the present invention, a plant body, a plant variety, a propagation material thereof, a harvested product thereof, and a processed product thereof having low cesium absorption are provided.

Analysis results of brown rice by ICP-MS. 8027 lines were harvested by dividing each individual, and brown rice of each individual was decomposed with nitrate and analyzed for brown rice Cs concentration. A total of 3 low cesium absorption systems were selected by treatment with sodium azide (1 strain (system name; D10-23) and 2 systems (system name; E10-4, F5-136) by MNU treatment (Fig. 1). . The concentration of brown rice ¹³³ Cs in paddy rice grown in the field. The three selected lines were cultivated in paddy fields in Ogata-mura, Minami-Akita-gun, Akita and paddy fields in Fujisato, Yamamoto-gun, Akita. In any field, the Cs concentration of the three lines was kept low compared to the control Akitakomachi. The concentration of brown rice ¹³³ Cs in paddy rice grown in the field. Using a Wagner pot, mutant strains were cultivated under conditions where Cs, which was artificially added with 0.5 ppm and 1.0 ppm of cesium chloride (CsCl) to soil collected from the field, was easily absorbed. As a result, even in pot cultivation, the Cs concentration of the three lines was kept low compared to the control Akitakomachi. K + ion concentration in hydroponics and Cs absorption in the underground. Rice seedlings when the potassium concentration in the hydroponic liquid that is the standard of Mr. Kimura's B solution is x1, and the concentration is changed from 1/2 to 3 times as x0.5, x1.0, x2, x3 The time course of Cs uptake in plant roots was confirmed. By this method, plants with controlled Cs absorption can be identified in a shorter time. Results of F1 generation conflict test. About the F1 generation which crossed three Cs low absorption mutants obtained, the Cs absorption characteristic was investigated by the above-mentioned hydroponics method. As a result, the low absorption of Cs was almost the same as the original three mutants. Results of F2 generation conflict test. For the F2 generation, Cs absorption characteristics were examined by the hydroponics method described above. As a result, the low absorption of Cs was almost the same as the original three mutants. The position of the OsHAK1 gene on the chromosome. The base sequence of the OsHAK1 gene. The solid underline indicates the exon part. The two enclosed Gs represent the bases that were mutated in the examples. The underline of the alternate long and short dash line indicates the 5 prime region, and the underline of the dotted line indicates the 3 prime region. In line 2, it was found that G at position 2171 was replaced with A in this sequence, and glycine (Gly) was replaced with aspartic acid (Asp) as the amino acid of the protein. In lines 1 and 3, G at position 4716 was replaced with A, indicating that it was a stop codon. Complementarity test results. The transformant regenerated in the regeneration medium was hydroponically cultivated with Mr. Kimura B solution and grown to 15 cm, and then a Cs absorption experiment was conducted for 1 day with a hydroponic solution of × 0.5 potassium concentration supplemented with 10 ppbCs. Compared with Akitakomachi and Nipponbare, transformants showed about twice the amount of Cs absorption (Fig. 9).

[Gene, protein]
The present inventors concluded that the gene that controls absorption of cesium absorption in rice is the OsHAK1 gene belonging to the KUP / HAK / KT family of TIGR locus Os04g32920, Gene name OSJNBb0012E08.7. The present invention provides genes or homologues thereof that control cesium absorption in plants, that is, the following polynucleotides (a) to (f).
(A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9;
(B) a polynucleotide having a function of hybridizing under stringent conditions with a polynucleotide comprising a nucleotide sequence complementary to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and controlling plant cesium absorption;
(C) a polynucleotide having a high identity with the nucleotide sequence of SEQ ID NO: 9 and a function of controlling plant cesium absorption;
(D) a polynucleotide encoding the amino acid sequence of SEQ ID NO: 11;
(E) a polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption;
(F) a polynucleotide encoding an amino acid sequence having high identity with the amino acid sequence of SEQ ID NO: 11 and having a function of controlling plant cesium absorption.

  In the sequence listing which is a part of the present specification, the base sequence of the rice OsHAK1 gene (gDNA) is shown as SEQ ID NO: 9. SEQ ID NO: 10 shows the nucleotide sequence of the rice OsHAK1 gene cDNA, and SEQ ID NO: 11 shows the amino acid sequence derived from the cDNA.

The present invention also includes a protein consisting of the amino acid sequence set forth in SEQ ID NO: 11, and a protein that is structurally similar to them and has a function of controlling absorption of cesium in plants, such as the following (D), (E ) Or (F) protein:
(D) a protein consisting of the amino acid sequence of SEQ ID NO: 11;
(E) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 11 and having a function of controlling plant cesium absorption;
(F) A protein comprising an amino acid sequence having high identity with the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption.

  Polynucleotides include gDNA, cDNA and chemically synthesized DNA, including single-stranded and double-stranded.

  Unless otherwise specified, stringent conditions refer to 6M urea, 0.4% SDS, 0.5 × SSC or equivalent hybridization conditions, and the temperature is about 65 ° C.

  The number of amino acids to be substituted when an amino acid sequence in which one or a plurality of amino acids are deleted, substituted or added is determined by the polynucleotide encoding the amino acid sequence or the protein encoding the amino acid sequence having the desired function. Although it is not particularly limited as long as it has, the desired function will not be lost if it is about 1-9, about 1-4, or a substitution that encodes the same or similar amino acid sequence. Means for preparing a polynucleotide according to such a base sequence or amino acid sequence include, for example, the site-directed mutagenesis method (Kramer W & Fritz HJ: Methods Enzymol 154: 350, 1987).

  With respect to the nucleotide sequence, high identity refers to identity of at least 80% or more, preferably 90% or more, more preferably 95% or more, more preferably 97% or more, and further preferably 99% or more. Further, regarding amino acid sequences, high identity refers to identity of at least 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, and most preferably 99% or more. The identity of the base sequence or amino acid sequence is determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993) well known to those skilled in the art. Can be determined. Programs called BLASTN and BLASTX based on the BLAST algorithm have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When analyzing a base sequence using BLASTN, parameters are set to, for example, score = 100 and wordlength = 12. In addition, when an amino acid sequence is analyzed using BLASTX, the parameters are, for example, score = 50 and wordlength = 3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific techniques for these analysis methods are well known to those skilled in the art (http://www.ncbi.nlm.nih.gov/).

  The polynucleotide can be prepared from natural plant tissue material. In order to prepare the polynucleotide of the present invention, hybridization technology (Southern EM: J Mol Biol 98: 503, 1975) and polymerase chain reaction (PCR) technology (Saiki RK, et al: Science 230: 1350, 1985, Saiki RK, et al: Science 239: 487, 1988). For example, the target OsHAK1 gene nucleotide sequence (SEQ ID NO: 9) or a part thereof is used as a probe, and an oligonucleotide that hybridizes to the rice OsHAK1 gene nucleotide sequence is used as a primer from rice or other plants to obtain the desired polynucleotide. Nucleotides can be isolated. The polynucleotide may be derived from a plant belonging to the family Gramineae (Poaceae (Gramineae)), for example, a plant belonging to the genus Oryza.

  Whether a polynucleotide or a protein encoded thereby controls plant cesium absorption is determined, for example, by referring to a plant having an intact gene comprising a target polynucleotide and a gene comprising the target polynucleotide or the gene. Plants obtained by cultivating a plant with a reduced function of the encoded protein and a medium containing a certain amount of cesium (either a solid medium such as soil or a liquid medium) Alternatively, the determination can be made by comparing the amount of cesium contained in a part thereof (for example, a part to be used for food, specifically a seed or the like). At this time, the cultivation method can be based on the prior art, but according to the study of the present inventor, the amount of cesium in the underground part of the young plant is measured using a hydroponic liquid in which cesium is added and the potassium concentration is adjusted. By doing so, it can be evaluated in a shorter time. The cesium concentration in the hydroponic liquid can be 1 to 100 ppb, and preferably 5 to 20 ppb. The potassium concentration in the hydroponic solution can be 0.1 to 1.0 times that of the standard case, and preferably 0.25 to 1.75 times. Specifically, after the seedlings were cultivated in a normal hydroponic solution, the hydroponic solution was replaced with a hydroponic solution in which cesium was added and the potassium concentration was adjusted, and after cultivation for at least 24 hours, It can be evaluated by measuring the amount of cesium. Cesium can be measured by a method well known to those skilled in the art, for example, ICP-MS.

  The degree of control is suppressed to 85% or less, 70% or less, 50% or less, 30% or less, or 25% or less when the amount of cesium absorbed in a plant having the intact polynucleotide as the target is 100 (%). Can be.

[Method of controlling cesium absorption by plants]
The present invention also provides a method of suppressing plant cesium absorption, which utilizes the polynucleotide according to any one of (a) to (f) above.

  Suppressing cesium absorption of a plant means suppressing cesium absorption from the underground part (usually the root) of the plant, unless otherwise specified. When suppressing cesium absorption, absorption of other elements may be suppressed or promoted at the same time. A plant in which cesium absorption is suppressed can be referred to as “low cesium absorption”.

  Inhibition of cesium absorption in plants can be performed by using any one of the polynucleotides (a) to (f) above. It is preferably performed by lowering the function of a gene comprising a polynucleotide or a protein encoded by the gene (reducing the function includes loss of function), more preferably the exon part of the gene More preferably, at least one mutation is caused in the most downstream exon portion. Mutation may be performed by causing at least one mutation in the prime region. The prime region is an important sequence when a gene is transcribed. The 5 prime region is a sequence that binds when RNA polymerase transcribes mRNA from DNA, and the 3 prime region is thought to be involved in the structural stability of mRNA. When there is a mutation in the prime region, the expression level may be reduced, or the gene may not be expressed.

  Examples of the mutation include a mutation that becomes a sequence corresponding to a stop codon, a mutation that becomes a sequence encoding an amino acid having a different property, and insertion or deletion of a base (the amino acid sequence is different because a frame shift occurs). There may be at least one mutation, and 2 to 5 mutations. The method for causing the mutation is not limited, and it is artificially generated, for example, by chemical substances (for example, sodium azide, MNU), UV irradiation, radiation irradiation, ion beam irradiation, high or low temperature, change in atmospheric pressure, etc. It may be naturally occurring.

  Reducing the function of the gene consisting of the polynucleotide of any one of the above (a) to (f) or the protein encoded by the gene can also be achieved by gene knockdown by an antisense method, short hairpin RNA (shRNA ), RNA interference (RNAi) technology that knocks down genes via short interfering RNA (siRNA) can also be used. Alternatively, gene knockout may be induced by genome editing techniques.

  Whether or not cesium absorption is suppressed is determined by, for example, using a medium containing a certain amount of cesium, as described above, for a target plant whose cesium absorption will be suppressed and a plant that is an appropriate control. It can be judged by comparing the amount of cesium contained in the plant body or part thereof obtained after cultivation. The degree of inhibition can be 85% or less, 70% or less, 50% or less, 30% or less, or 25% or less when the amount of cesium absorption in the control plant is 100 (%).

  The target plant for suppressing cesium absorption is not particularly limited as long as it can suppress cesium absorption by using the polynucleotides (a) to (f) described above, but is preferably an angiosperm. More preferably, it is a plant belonging to the monocotyledonous network, more preferably it is a plant belonging to the subfamily nettle, most preferably a plant belonging to the family Gramineae, such as rice (Oryza), barley, rye , Bread wheat, barley, pearl barley, sugar cane, corn, sorghum, millet, millet, and millet. Among the plants belonging to the family Gramineae, the plant is preferably a plant belonging to the genus Graminea, and more preferably rice (Oryza sativa L.). Among rice varieties, many varieties that are widely available for food can be targeted, and such varieties include japonica-type varieties such as Akitakomachi, Koshihikari, Hitomebore, Tenno-mushi, Haenuki, Sasanishiki, Hinohikari, Includes Nanatsuboshi, Kinuhikari, Masagura, Asahi's Dream, Koibuki, Kirara 397, Yume Pirka, Tsugaru Romance, Kaori Aichi, Kinusume, Yumetsushi, Tsuyahime, Shina Kagayaki, Hashishima, Fusako .

  Once a plant having a low cesium absorption is obtained by having a mutation in the genome, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to obtain propagation materials (for example, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) from the plant and its descendants or clones, and mass-produce plants based on them. It is.

[Cesium low-absorption plant or parts thereof, cesium low-absorption plant varieties, breeding materials, harvest]
The present invention also provides a function of a protein comprising a mutation in any one of the polynucleotides (a) to (f) defined in claim 1 and comprising the polynucleotide or an amino acid sequence encoded by the polynucleotide. Is provided, or a cesium-low-absorbing plant or a part thereof.

  Unless otherwise specified, the plant body is used in the meaning of a plant individual, and when referring to a “part thereof” with respect to the plant body, unless otherwise specified, seeds (including germinated seeds and immature seeds), Includes organs or parts thereof (including leaves, roots, stems, flowers, stamens, pistils, fragments thereof), plant culture cells, callus, protoplasts. The plant body or part thereof also includes propagation material.

  Low cesium absorption means that cesium absorption is 85% or less, 70% or less, 50% or less, 30% or less, 25% when the amount of cesium absorption in an appropriate control plant is 100 (%) The following can be suppressed.

  In addition, when it is referred to as a cesium low-absorbency plant body, it was obtained from the plant body as well as the plant body obtained through the step of suppressing cesium absorption by the method of the present invention, unless otherwise specified. Progeny (first generation, second generation ...) plants are also included as long as the low absorptive nature of cesium is maintained.

  Plants derived from conventional cultivars and differing only in the absorption of cesium by the method of the present invention and having the same traits as the cultivars derived from other points can be expected to be used as cultivars. Moreover, the plant body of low cesium absorption obtained by this invention can be used as a breeding material, and a new plant variety with low cesium absorption can be bred. Accordingly, the present invention provides a cesium low absorbency plant variety. And providing breeding materials, harvests, and processed products derived therefrom.

  Unless otherwise specified, the propagation material refers to a material that is used for propagation in all or part of the plant body (sometimes referred to as “seed seedling”), for example, seed, seedling, cell, callus. There are young buds. Unless otherwise specified, the term “harvest product” refers to all or part of the plant that is not used for breeding (seed seedling). For example, in the case of rice, , Brown rice, and polished rice are included. For example, when the processed product is a rice plant, rice (cooked rice), rice confectionery, rice cake, rice flour and food using the same are included.

  Examples of plant varieties with low absorption of cesium of the present invention are rice varieties, and examples of varieties from which rice varieties with low absorption of cesium of the present invention are derived include varieties of japonica type, such as Akitakomachi, Koshihikari, Hitomibori, Tenno Tsubu, Haenuki, Sasanishiki, Hinohikari, Nanatsuboshi, Kinuhikari, Shigura, Asahi no Yume, Koishibuki, Kirara 397, Yumepirika, Tsuru Romantic, Kaori Aichi, Kinusume, Yumetsushi, Tsutsuhime, Aya no Kagayaki, Hassimo, Fusakogane.

  From the rice plant of Akitakomachi, which is a conventional cultivar, the present inventors treated 1 line (line name; D10-23) by sodium azide treatment and 2 lines (line name; E10-4, F5-136) by MNU treatment. ) Low-absorption cesium plant. One of these lines has been found to have sufficient characteristics as a cultivar, with other characteristics such as yield, culm length, and maturity being almost the same as the origin of Akitakomachi.

  Traditionally, plant breeding has been carried out by (1) selection of promising lines by crossing, and (2) mutagenesis by radiation or chemical substances. These operations have problems such as requiring a long time and inability to control the degree and direction of mutation. The present invention has identified a gene that controls cesium absorption by plants, so that the cesium absorption of the target plant can be ensured by deleting or suppressing the function in the target plant having this functional gene. Can be reduced. Mutation targeting the identified gene can be achieved in a very short period of time compared to gene transfer through repeated selection based on mating and the desired trait, and without changing other traits. It is possible to introduce only a low cesium-absorbing trait. The present invention is considered to contribute to the cultivation of plant varieties with low cesium absorption.

[Gene marker]
The present invention also relates to identifying a plant based on the difference in base sequence between a wild-type cesium absorption control gene and a mutant cesium absorption control gene. The identification is performed as follows, for example. PCR using a primer set that can amplify target sequences (parts containing mutations) prepared in advance using genomic DNA extracted from plants of conventional rice varieties such as Koshihikari and plants of low-absorption cesium plants To amplify the target sequence. The obtained amplification product is treated with a restriction enzyme, then electrophoresed, and the two are distinguished by comparison of electrophoresis patterns.

  In the case of the mutant strain E10-4 described in the Examples section, a primer set capable of amplifying a base portion including a single base substitution region [eg, [HAK1N2 P1 (5′-CAGGATGATCCCGAACCAGCA -3 ′: SEQ ID NO .: 5)] , HAK1N2 P2 (5'-TCGCCCATGACCATGGAGGTG-3 ': SEQ ID NO .: 6)], amplifying a DNA fragment by PCR reaction and DNA amplification with a restriction enzyme site newly generated (or disappeared) by single nucleotide substitution By cutting the fragment with a specific restriction enzyme (for example, HphI), it can be distinguished from other varieties. For example, when HphI is used as a restriction enzyme, two fragments of 103 bp and 74 bp are detected from the PCR product from a plant having a mutant cesium absorption control gene derived from E10-4.

  In the case of the mutant strains D10-23 and F5-136 described in the Examples section, a primer set that can amplify a base portion including a single base substitution region [for example, [HAK1N13 P1 (5′-GTACGAGCTGGACCACATCGTC -3 ′: SEQ ID NO .: 7), HAK1N13 P2 (5'-TGCGGGATGGGGAGGTGCTTG-3 ': SEQ ID NO .: 8)] etc., a DNA fragment is amplified by PCR reaction and newly generated (or disappeared) by single base substitution A DNA amplified fragment having an enzyme site can be distinguished from other cultivars by cleaving with a specific restriction enzyme such as VpaK11BI (Ava II) or Hae III. The primer may be any base sequence that can amplify the target sequence including the mutated portion. Moreover, the restriction enzyme should just be a thing which can recognize and cut | disconnect the area | region containing a variation | mutation part.

  For any mutant strain, the DNA amplification fragment is purified by spin column method, glass bead adsorption method, etc., and the DNA base sequence of the amplified portion is read by a sequencer, so that the mutation contained in the sequence of the cesium absorption control gene can be detected. Plants can be identified by detecting and developing markers based on this information.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

[Selection of Cs low absorption system]
(1) Induction of mutation Two kinds of chemical mutation sources, sodium azide and MNU, were used as a method of inducing mutation. In the sodium azide treatment, Akitakomachi seeds were treated for 6 hours with aeration in 1.5 mM sodium azide solution (pH 3.0 phosphate buffer). Akitakomachi fertilized eggs were treated with mutagenesis by marking the flowered flowers and immersing the flowered flowers in a 1.5 mM MNU solution at 12 o'clock on the evening of the flower for 1 hour. After treatment, the ears were washed with running water for about 10 hours, and then normal cultivation management was performed to harvest M1 seeds. M1 seeds from each treatment were cultivated in the field, and M2 generation seeds were harvested in bulk to form a mutant population.

(2) Screening for mutants of cesium absorption
After seedling M3 generation seeds, planted in a field with a high concentration of water-soluble cesium (stable isotope ¹³³ Cs) in the soil, harvested 8027 strains individually, and decomposed the brown rice of each individual to nitrate, The brown rice Cs concentration was analyzed by ICP-MS (ThermoFisher Scientific co, X Series II).

  As a result, a total of 3 cesium low-absorption lines were selected by treatment with sodium azide, 1 line (line name; D10-23), and 2 lines (line names; E10-4, F5-136) by MNU treatment ( Figure 1).

(3) Confirmation of low cesium absorption of selected mutant strains
Three lines selected in 2014 were cultivated in paddy fields in Ogata Village, Minami Akita County, Akita Prefecture and Fujisato Town, Yamamoto County, Akita Prefecture. As a result, the brown rice Cs concentration of each line cultivated in Ogata Village was lower than 10% below 0.36, 0.70 and 0.31μg / kg for the control Akitakomachi, which was cultivated in Fujisato Town. The brown rice Cs concentration was 2.49, 3.41, 2.61 μg / kg, which was about 20-27% lower than that of the control Akitakomachi 12.66 μg / kg (FIG. 2).

  Cesium dissolved in soil solution in the form of ions is absorbed by plants. Cesium newly supplied to the soil as ionic water by irrigation water, etc. is taken in and fixed in an interlayer structure called the frayed edge of the clay particles of the soil over time. For this reason, it has been suggested that cesium newly supplied to soil is more easily absorbed by plants. So, using a Wagner pot, mutant strains under conditions where Cs is easily absorbed by adding 0.5 ppm and 1.0 ppm of cesium chloride (CsCl) to the soil collected from the two fields of Ogata and Fujisato. Cs concentration in the brown rice harvested and harvested was measured. As a result, in the pot cultivation, the three lines were compared with the Cs concentration in the brown rice of the control Akitakomachi, and in the soil of Ogata village, it was reduced to 11% or less even when Cs was newly added. % Or less (Figure 3).

[Development of simple identification method (hydroponic cultivation method) for strains with altered Cs absorption]
For identification of Cs absorption control genes, introduction of the control genes into other cultivars by mating and genetic recombination, a simple method for identifying strains with Cs absorption mutations is required. The Cs absorption characteristics of the seedlings grown by hydroponics for 2 weeks were investigated. Specifically, after seed seed disinfection for 3 days after seed disinfection, hydroponics was started in a growth chamber at 28 ° C, 16 hours light period / 8 hours dark period, replanted 3 days after germination, and then 2 Grown weekly. As the hydroponic solution, one with a partial modification of the composition of Mr. Kimura B solution was used with a normal potassium concentration (Table 1). After 2 weeks of cultivation, the seedlings were transferred to Kimura B liquid (Table 2) adjusted to different potassium concentrations in several stages to which Cs (cesium chloride) was added to 10 ppb, and the plants were grown over time until 5 days later. The body was sampled and analyzed for Cs concentration in the underground.

  The amount of Cs absorbed when the concentration of potassium in the hydroponic liquid that is the standard for Mr. Kimura's B solution is x1, and the concentration is changed from 1/2 to 3 times x0.5, x1.0, x2, x3. The change with time was confirmed. The Cs concentration of the root of the mutant line relative to the control Akitakomachi one day later was 25.4%, 23.8%, and 18.4% for the standard potassium concentration (× 1.0) hydroponic liquid, but the hydroponic culture with × 0.5 potassium concentration In the case of liquid, it becomes 14.1%, 11.3%, 11.7%, the concentration ratio becomes large, and more accurate discrimination becomes possible. On the other hand, as the potassium concentration of the hydroponic solution increased, the amount of Cs absorbed by the control Akitakomachi decreased rapidly, and the amount of Cs absorbed by the three mutants obtained in the present invention was 82.1% of that of the control Akitakomachi, It became clear that the concentration ratio was 75.5% and 65.3%, making it difficult to distinguish (Table 3, Figure 4).

  From the above results, by adding Cs and measuring the amount of Cs absorbed into the roots of rice seedlings using a hydroponic solution adjusted for potassium concentration, a plant having the trait of the Cs absorption control gene of the present invention Can be identified in a shorter period of time without producing brown rice. Specifically, young plants cultivated with Mr. Kimura B for 2 weeks were transferred to a hydroponic solution with a potassium concentration of 0.5 with Cs (10 ppb) added, and the amount of Cs absorbed in the underground after 24 hours was ICP-MS Cs low absorption individual can be selected by measuring with.

[Identification of causative gene]
(1) Confrontation test
The Cs absorption characteristics of the F1 and F2 generations obtained by crossing three Cs low-absorption mutants were examined by the hydroponics method described above. As a result, both F1 generation and F2 generation showed low absorption of Cs, which was almost the same as the original three strains (Figs. 5 and 6). This revealed that the three Cs absorption control genes are the same.

(2) Gene mapping When Cs absorptivity was analyzed by the above-mentioned hydroponic cultivation method of Kasalath of the Indica line used for gene mapping, Kasalath was Cs superabsorbent like Akitakomachi. The Cs low-absorption line was crossed with Kasalath, the Cs absorption amount to the roots was analyzed by hydroponics for the F2 generation, and Cs low-absorption individuals were selected as homozygous individuals. Genomic DNA was extracted from these plants and rough mapping was performed to narrow down the chromosomes and positions of Cs absorption control genes.

  As a result, it was clarified that the causative gene is a gene located between 52.6 and 58.9 cM at a genetic distance on chromosome 4.

(3) Next-generation sequence analysis
Three mutant strains were hydroponically cultivated with 10 each of Mr. Kimura B solution for 2 weeks. Genomic DNA was extracted from these three strains of young plants. As a control, DNA was also extracted from the parent cultivar Akitakomachi. The whole genome sequence was obtained using HiSeq1000 (Illumina) under the conditions of 100 bp read length and both end analysis. For the whole genome analysis, 1/3 lanes of each mutant strain and 1 lane of Akitakomachi were used. The lead sequence was aligned with the reference sequence (IRGSP1.0) under the initial conditions of BWA. The chromosomal region revealed by gene mapping was visualized by IGV, and the causative gene was identified by comparing the nucleotide sequences of the mutant strain and Akitakomachi.

  As a result, although there were many single-base substitutions in each mutant line, the only gene that had mutations common to the three lines was the OsHAK1 gene. Therefore, it was concluded that the causative gene of the Cs low-absorption mutation is the OsHAK1 gene belonging to the KUP / HAK / KT family of TIGR locus Os04g32920, Gene name OSJNBb0012E08.7. FIG. 7 shows the position of the OsHAK1 gene on the chromosome.

(4) Sequence analysis of mutant OsHAK1 gene
As a result of sequencing the OsHAK1 gene region by Sanger sequencing using the cDNA of the three strains as a template, a single base substitution mutation was detected in the exon part of all strains. Two lines (D10-23 and F5-136) are replaced with the same base, and one amino acid substitution (Gly is replaced with Asp) occurs in the amino acid sequence, and the remaining one line (E10-4) stops halfway It was replaced with a codon (FIG. 8).

(5) Complementarity test Nipponbare was hydroponically cultivated with Mr. Kimura B solution for 2 weeks, and total RNA was extracted from the roots using NucleoSpin® RNA Midi (Machalai Nagel). Then ^{SuperScript (R) III First-Strand} Synthesis SuperMix (ThermoFisher Scientific co.,) Was used to synthesize cDNA from mRNA in Oligo dT primer. Then the following primer set:
HAK1_5primeF CCAGCCGGCGAGAGAGAGC (SEQ ID NO .: 1)
HAK1_3primeR AGCATGGACAACACACCACCAGTG (SEQ ID NO .: 2)
Was used to amplify the full length of the OsHAK1 gene by PCR using KOD-Plus-Neo (TOYOBO).

After confirming the amplified PCR product by agarose gel electrophoresis, using this PCR product as a template, the following primer set:
Hind3-HAK1_5prime_F AAGCTTCCAGCCGGCGAGAGAGA (SEQ ID NO .: 3)
HAK1_3prime_R-Hind3 AAGCTTAGCATGGACAACACACCACCAGTG (SEQ ID NO .: 4)
And KOD-Plus-Neo (TOYOBO) was used for PCR amplification, and HindIII restriction enzyme sites were added to both ends of the PCR product. The amplification product was inserted into the pTA2 vector by TA cloning after A addition reaction at both ends of the blunt end using the TArget Clone ™ -Plus-kit (TOYOBO). This vector was introduced into Escherichia coli (DH-5α), and after culture, the plasmid was extracted, treated with restriction enzyme with HindIII, electrophoresed on an agarose gel, and the inserted sequence was excised and purified. This DNA fragment was inserted into pBUH3 vector cut with HindIII and treated with alkaline phosphatase by ligation, introduced into E. coli, and the plasmid was extracted after culture. This plasmid can forcefully express the OsHAK1 gene with the ubiquitin promoter.

  Transform Agrobacterium with the obtained plasmid, infect the callus of Cs low-absorption mutant F5-136 with Agrobacterium carrying the vector, and transform F5-136 with the functioning OsHAK1 gene Created the body.

  The transformant regenerated in the regeneration medium was hydroponically cultivated with Mr. Kimura B solution and grown to 15 cm, and then a Cs absorption experiment was conducted for 1 day with a hydroponic solution of × 0.5 potassium concentration supplemented with 10 ppbCs. Compared with Akitakomachi and Nipponbare, transformants showed about twice the amount of Cs absorption (Fig. 9). From this result, it was confirmed that the Cs low-absorption mutant was restored to the Cs absorption capacity by transformation of the OsHAK1 gene, and it was revealed that the three Cs absorption control genes found in the present invention are the OsHAK1 gene. It was.

  The present invention can be used to develop new rice varieties.

SEQ ID NO.:1 PCR primer HAK1_5primeF
SEQ ID NO.:2 PCR primer HAK1_3primeR
SEQ ID NO.:3 PCR primer Hind3-HAK1_5prime_F
SEQ ID NO.:4 PCR primer HAK1_3prime_R-Hind3
SEQ ID NO.:5 PCR primer HAK1N2 P1
SEQ ID NO.:6 PCR primer HAK1N2 P2
SEQ ID NO.:7 PCR primer HAK1N13 P1
SEQ ID NO.:8 PCR primer HAK1N13 P2
SEQ ID NO.:9 OsHAK1 gDNA
SEQ ID NO.:10 OsHAK1 cDNA
SEQ ID NO.:11 deduced protein OsHAK1

Claims (13)

The polynucleotide of any one of the following (a) to (f):
(A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9;
(B) a polynucleotide having a function of hybridizing under stringent conditions with a polynucleotide comprising a nucleotide sequence complementary to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 9 and controlling plant cesium absorption;
(C) a polynucleotide having a nucleotide sequence of SEQ ID NO: 9 of 90% or more and having a function of controlling plant cesium absorption;
(D) a polynucleotide encoding the amino acid sequence of SEQ ID NO: 11;
(E) a polynucleotide encoding an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption;
(F) a polynucleotide encoding an amino acid sequence having 90% or more identity with the amino acid sequence of SEQ ID NO: 11, and having a function of controlling plant cesium absorption. The polynucleotide according to claim 1, which is derived from a rice genus plant. The polynucleotide according to claim 1 or 2, which is (a) or (d). A method for suppressing cesium absorption of a plant using the polynucleotide according to any one of (a) to (f) defined in claim 1. The method according to claim 4, wherein the use of the polynucleotide is to reduce the function of a gene comprising the polynucleotide or a protein encoded by the gene. The method according to any one of claims 3 to 5, wherein the use of the polynucleotide is to cause mutation in an exon part of the polynucleotide. The polynucleotide of any one of (a) to (f) defined in claim 1 has a mutation, and the function of the protein comprising the polynucleotide or an amino acid sequence encoded by the polynucleotide is suppressed. , Cesium low-absorption plant or parts thereof. The plant body of Claim 6 which is a rice genus plant, or its part. A cesium low-absorbency plant variety bred using the plant according to claim 6 or 7 or a part thereof. The cultivar according to claim 9, wherein the plant is rice. A breeding material of the variety according to claim 8 or 9. A harvest or a processed product thereof obtained by using the plant according to claim 6 or 7, or the plant of the variety according to claim 8 or 9. Use of the polynucleotide defined in any one of (a) to (f) as defined in claim 1 as a marker for low cesium absorption.