JP2018021010A - Muscular atrophy inhibitory composition - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a composition useful for inhibiting muscular atrophy such as disuse muscular atrophy.SOLUTION: A muscular atrophy inhibitory composition contains a cysteinesulfoxides such as S-methyl-L-cysteinesulfoxide or S-1-propenyl-L-cysteinesulfoxide, as an active ingredient.SELECTED DRAWING: Figure 2

Description

  The present invention relates to a composition for suppressing muscle atrophy, comprising a specific cysteine sulfoxide.

  The muscle tissue is the largest tissue in the human body, and skeletal muscles as voluntary muscles and visceral muscles as involuntary muscles are distributed almost throughout the body. In muscle tissue, protein synthesis and degradation always occur, and the balance of muscle mass is usually maintained, but the phenomenon and symptom that muscle tissue gradually thins out is called muscle atrophy. This muscular atrophy is known to be caused by neurological diseases such as amyotrophic lateral sclerosis, spinal muscular atrophy, Guillain-Barre syndrome, and by muscular diseases such as muscular dystrophy and polymyositis. In addition to the above, it is known that muscle atrophy gradually occurs even when skeletal muscle is not used, and this is called disuse muscle atrophy.

  Japan has entered a super-aging society, and the elderly population over the age of 75 is increasing year by year. In such a society, elderly people are bedridden or have decreased activity, etc., so that disuse muscle atrophy develops, the willingness to move the body decreases, and the amount of activity further decreases, resulting in a vicious circle. This is directly linked to a decline in the quality of life of the person, and is also a social problem such as nursing care problems and increased medical expenses.

  To increase muscle mass, medications and diets are not sure of their effectiveness, and continuous muscle training is the only option. However, it is difficult to continue muscle training in daily life. In addition, the metabolic function declines as the elderly become older, and it is often impossible to maintain sufficient muscle mass simply by training. Therefore, there is a great demand for pharmaceuticals and foods that can prevent disuse muscle atrophy without training.

The mechanism of disuse muscle atrophy is becoming clearer, and the mechanism described in Non-Patent Document 1 has been proposed.
Muscles are balanced by muscle protein synthesis and degradation systems, and different factors are involved in the synthesis and degradation systems. As for the degradation system, a plurality of genes such as Atrogin-1 and MuRF-1 have been identified as the genes related to muscle atrophy. On the other hand, as for the synthetic system, naturally, materials such as amino acids and energy are necessary for the synthesis of muscle protein, and a kind of diet suitable for muscle protein and health care are required. However, the appetite naturally decreases in the elderly, and the nutrients to be consumed are decreasing in the first place. In addition, food intake is often difficult, such as difficulty in swallowing.
Therefore, in order to prevent disuse muscle atrophy in the elderly, it is important to suppress the muscle protein degradation system, and for that purpose, suppressing as much of the above-mentioned muscle atrophy-related genes as possible is highly effective. Conceivable.

  Conventionally, research has been conducted on components that increase muscle, and leucine (Non-patent Document 1), whey protein degradation product (Patent Document 1), and the like are known. In recent years, studies focusing on muscle atrophy have also been made, and it is known that catechins (Patent Documents 2 and 3) and leeks extract (Patent Document 4) have a muscle atrophy inhibitory effect.

In addition, S-methyl-L-cysteine sulfoxide, S-1-propenyl-L-cysteine sulfoxide and cycloaliin are known to be contained in a large amount in allium plants, and testosterone It has been clarified to show an increasing action (Patent Document 5).
However, it is not known that these cysteine sulfoxides show a suppressive action on a gene related to muscle atrophy.

JP 2010-150160 A JP 2008-13473 A International Publication No. WO2011 / 108487 Japanese Patent Laying-Open No. 2015-71584 Japanese Patent No. 4172488

Biochemistry Vol.86 No.3 pp367-371 (2014)

  The problem of the present invention is that it can be safely and inexpensively and easily taken on a daily basis, and has a remarkable inhibitory effect on muscular atrophy-related genes. To develop a natural material effective in improving disuse muscle atrophy and to provide a composition useful for suppressing muscle atrophy such as disuse muscle atrophy.

  The above-described problems can be solved by a composition for suppressing muscle atrophy, which contains cysteine sulfoxides, which are known to be contained in a large amount in allium plants and Brassica plants.

The present invention is characterized by the following points.
(1) A composition for inhibiting muscle atrophy, which contains cysteine sulfoxides as an active ingredient.
(2) Cysteine sulfoxides are S-alkyl-L-cysteine sulfoxide, S-allyl-L-cysteine sulfoxide, S-propyl-L-cysteine sulfoxide, S-alkenyl-L-cysteine sulfoxide. The composition according to the above (1), which is selected from foxide or cycloaliin.
(3) The composition according to (1) or (2) above, wherein the cysteine sulfoxides are selected from S-methyl-L-cysteine sulfoxide or S-1-propenyl-L-cysteine sulfoxide. object .
(4) The composition according to any one of (1) to (3), which suppresses a plurality of muscle atrophy-related genes.
(5) The composition according to any one of (1) to (4) above, which is derived from a heat-treated product of an Allium plant or Brassica plant.
(6) A food, feed or cosmetic for suppressing muscle atrophy, comprising the composition according to any one of (1) to (5) above.

  The composition for suppressing muscle atrophy, containing the cysteine sulfoxides of the present invention as an active ingredient, remarkably suppresses the expression levels of Atrogin-1 and MuRF-1, which are known as muscle atrophy-related genes. Has the effect of suppressing muscle atrophy.

It is a graph which shows the Antrogin-1 expression inhibitory effect, such as a composition of this invention. It is a graph which shows the MuRF-1 expression inhibitory effect of the composition etc. of this invention.

Hereinafter, preferred embodiments of the present invention will be specifically described.
In the present invention, “muscle atrophy suppression” refers to preventing a decrease or decrease in muscle mass, preferably skeletal muscle mass.

The cysteine sulfoxides in the present invention are one kind of sulfur-containing amino acids having a sulfur atom as a sulfoxide, and are abundantly contained in natural products such as leeks and Brassica plants. In the present invention, any of those derived from natural products containing them or those synthesized can be used.
As the cysteine sulfoxides of the present invention, in particular, S-alkyl-L-cysteine sulfoxide, S-alkenyl-L-cysteine sulfoxide or cyclohexane, which can be easily obtained from plants of the genus Allium or Brassica. Alliin is preferred, and particularly preferred S-alkyl-L-cysteine sulfoxide or S-alkenyl-L-cysteine sulfoxide includes S-methylcysteine sulfoxide, S-propylcysteine sulfoxide, S-allyl-L- Examples include cysteine sulfoxide, S-propenyl-L-cysteine sulfoxide, and the like.
Among these, S-methyl-L-cysteine sulfoxide (MCSO) and S-1-propenyl-L-cysteine sulfoxide (PeCSO), which are precursors of the onion tearing component, are particularly preferable. However, when an onion cell is destroyed, it is converted into sulfenic acid by the action of an enzyme, and a lacrimatory component is produced from the sulfenic acid, and is converted into cycloaliin under heating or alkaline conditions. Thus, PeCSO and MCSO are relatively unstable substances and are hardly contained in cooked onions that are eaten on a daily basis. Therefore, PeCSO and MCSO were components that have received little attention until recently.

When using cysteine sulfoxides derived from natural products as the cysteine sulfoxides of the present invention, using the method described in Patent Document 5, allium plants (onion, leek, scallion, chives, leek, garlic, ginger garlic, It is preferable to take it out from plants such as Brassica, Leek, etc.) or Brassica plants (Brassica, cauliflower, cabbage, broccoli, turnip, Nozawana, Mizuna, etc.). Among them, onion, leek, garlic, and rakkyo are more preferable as raw materials for cysteine sulfoxides used in the present invention, particularly PeCSO and MCSO, because they are inexpensive and contain a large amount of PeCSO and MCSO.
The above-mentioned plants contain many S-alkyl-L-cysteine sulfoxides or S-alkenyl-L-cysteine sulfoxides as cysteine sulfoxides, particularly PeCSO and MCSO, together with glutamyl bodies that are precursors thereof. It is. However, in these plants, C-S lyase (allylinase), which is an enzyme that converts PeCSO and MCSO to sulfenic acid, is present, so that when the plant tissue is destroyed by an operation such as extraction or cooking, the enzyme As a result of this action, PeCSO and MCSO in the plant are lost. For this reason, PeCSO and MCSO are hardly contained in the above-mentioned plant extract or cooked food containing the above-mentioned plant obtained by a conventional ordinary method.

Therefore, when preparing PeCSO and MCSO from the above-mentioned Allium plant or Brassica plant, it is preferable to subject the plant to an extraction treatment after heat-treating and inactivating C-S lyase before cutting the plant. . As such a method, a method of preparing cysteine sulfoxide from a genus Allium plant or a Brassica plant described in Patent Document 1 can be employed. More specifically, a sulfur-containing amino acid contained in the plant is obtained by heat-treating the genus Allium plant that has not been cut for 5 to 120 minutes under the conditions of a pressure of 1 to 5 atmospheres and a temperature of 40 to 150 ° C. Inactivates C-S lyase that degrades. Subsequently, the heat-treated product of the genus Allium plant or Brassica plant is obtained by alcohol extraction and concentration under reduced pressure, whereby a post-heat treatment extract containing an L-cysteine sulfoxide derivative can be obtained.

  Preferably, the cysteine sulfoxides used in the present invention, in particular PeCSO and MCSO, heat (i) an allium plant or Brassica plant, and (ii) heat the allium plant or Brassica plant γ- It can be prepared by treating with a glutamyl bond-cleaving enzyme and then subjecting the obtained enzyme-treated product to ion exchange chromatography (iii). Below, the detailed procedure of this method is demonstrated taking an allium plant as an example.

  The above steps (i) to (iii) are preferably carried out under acidic pH conditions in order to prevent deterioration of PeCSO and MCSO unless it is required for enzyme reaction or the like. The preferred pH is pH 5.5 or less, more preferably pH 4.5 or less.

  As the genus Leek plant used as a raw material, bulbs, scallions, chives, leeks are used for edible parts, for example, onions, garlic, and rakyo, and leaves and pseudostems are used for leeks. Moreover, since the outer skin of the genus Leek does not contain PeCSO and MCSO, it is preferable to remove in advance.

  In the step (i), the Allium plant is heated. By the heating, the enzyme C-S lyase that degrades PeCSO and MCSO contained in the genus Allium is inactivated. The heating conditions are not particularly limited as long as the C-S lyase can be deactivated without altering the target PeCSO and MCSO. For example, the pressure is 1 to 5 atm, and the temperature is 40 to 150 ° C. Is preferably 5 to 120 minutes, more preferably 1 to 2 atm, and 80 to 120 ° C. for 15 to 40 minutes.

  When the interior of an Allium plant is exposed to the air by cutting, crushing, drilling or the like, the contained PeCSO and MCSO are decomposed and the content thereof is reduced. Therefore, the heating is preferably performed on undivided Allium plants. Here, “non-subdivided” leek plants are not processed such as cutting, splitting, crushing, perforation, scratching, etc., or the processing is performed, but the sulfur-containing amino acid is processed by the processing. It means that the content is not greatly reduced, for example, the final yield of sulfur-containing amino acids can achieve 80% or more with respect to intact plants.

  Step (ii) is a step of treating the Allium plant heated in the above step (i) with a γ-glutamyl-binding cleavage enzyme. Since part of PeCSO and MCSO in the genus Allium plant exists as a glutamyl body, glutamic acid is cleaved from the glutamyl body by enzyme treatment to release PeCSO and MCSO. In order to allow the enzyme reaction to proceed sufficiently, it is preferable to cut, crush, shred, etc. the Allium plant heated in the step (i) before the enzyme treatment. The subdivided Allium plant is further diluted by about 2 to 20 times with an aqueous liquid such as water, acidic water, or alkaline water. The pH of the aqueous liquid is adjusted to an optimum pH of a γ-glutamyl bond cleaving enzyme used later or a pH in the vicinity thereof.

Examples of the γ-glutamyl bond cleaving enzyme used for the enzyme treatment include γ-glutaminase, γ-glutamyltransferase, γ-glutamyl transpeptidase, γ-glutamyl peptidase and the like. These enzymes may be extracted from animals, plants, microorganisms or the like, or may be commercially available products. Examples of commercially available products include Amano Enzyme's glutaminase SD-C100S. The conditions for the enzyme treatment may be appropriately set according to the optimal conditions for the enzyme, the type of the genus Leek plant to be used, the site to be used, the size and the subdivision status, and the like. In general, the amount of enzyme added is 0.001 to 1% by mass, preferably 0.01 to 0.1% by mass, based on the total amount of allium plants. The reaction conditions may be an optimum pH of the enzyme and a temperature of 15 to 65 ° C. for about 1 to 24 hours, preferably 35 to 60 ° C. for about 2 to 6 hours. After completion of the enzyme treatment, it is preferable to deactivate the γ-glutamyl bond cleaving enzyme by heating or pH adjustment. If necessary, the reaction product obtained by the enzyme treatment may be subjected to filtration, centrifugation, squeezing, etc. to separate a solution containing PeCSO and MCSO. Further, the obtained solution may be concentrated.

  In step (iii), the reaction product obtained by the enzyme treatment in step (ii) is subjected to ion exchange chromatography. The ion exchange resin for the ion exchange chromatography may be a cation exchange resin, but is preferably a strong acid cation exchange resin, and more preferably a sulfonic acid type strong acid cation exchange resin. The ion exchange resin can use a commercial item, for example, Diaion (registered trademark) UBK-550, Diaion (registered trademark) SK1B (manufactured by Mitsubishi Chemical Corporation), Amberlite (registered trademark) IR120B, Amber. Light (registered trademark) 200C, Dowex (registered trademark) MSC-1 (The Dow Chemical Company), Duolite C26 (Rohm and Haas), LEWATIT (registered trademark) SP-112 (LANXESS Distribution GmbH), etc. are preferably used. Can be done. The ion exchange chromatography may be performed according to a normal procedure. The eluate containing PeCSO and MCSO obtained by ion exchange chromatography may be used in the present invention as it is, but it is preferable to concentrate or further desalinize it because the purity of PeCSO and MCSO increases. Furthermore, you may perform processes, such as drying, freeze-drying, solidification, liquefaction, granule, or powderization, as needed.

By the above-described method, a fraction containing a high amount of PeCSO and MCSO can be obtained from the Allium plant. The obtained fraction can be directly contained in the composition for suppressing muscle atrophy of the present invention.
The procedure described above can be similarly applied to a case where a Brassica plant is used as a raw material.

  The content of cysteine sulfoxides in the composition for suppressing muscle atrophy of the present invention is preferably 5 to 100 mg, more preferably 7 based on the daily intake amount for adults, for example, the content of PeCSO and MCSO. -50 mg, more preferably 9-25 mg. When the content of PeCSO and MCSO in the composition for suppressing muscle atrophy of the present invention is less than 5 mg, the desired effect of the composition for suppressing muscle atrophy may not be sufficiently obtained. On the other hand, when the content exceeds 100 mg, a taste and odor may be generated. Therefore, it is desired that the composition for suppressing muscle atrophy is subjected to a treatment for preventing the taste and odor.

The composition for suppressing muscle atrophy of the present invention can also be contained in food, feed or cosmetics.
When used as food or feed, it is preferable to contain the composition for suppressing muscle atrophy of the present invention so that the daily intake is within the above range. The content may be less than 5 mg per day.
When used as a cosmetic, for example, a face or body emulsion, cosmetic liquid, cream, lotion, essence, pack, sheet or the like is preferable. The content of the composition for suppressing muscle atrophy of the present invention in cosmetics is not particularly limited, but is 0.001 to 60% by mass, preferably 0.01 to 40% by mass, based on the weight of the cosmetic base material. A range of% is suitable.

  Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited by the following examples.

Example 1
After washing and peeling off 5000 g of onion (North Maple 2000), the whole was heat-treated in a 95 ° C. water bath for 20 minutes without cutting. The onion after heat treatment was crushed using a mixer (manufactured by Oster), and 1 mL of water per 1 g of onion was added and dispersed therein. To the obtained dispersion, glutaminase (glutaminase SD-C100S; manufactured by Amano Enzyme) was added in an amount of 0.025% by mass with respect to the total amount of onion in the solution, and reacted at 60 ° C. for 2 hours to complete the reaction. Thereafter, the enzyme was inactivated by heating at 90 ° C. for 15 minutes. The resulting reaction solution was centrifuged at 6,000 rpm for 30 minutes, suction filtered, and then lyophilized to obtain about 500 g of an onion crude heat-treated extract containing about 3% by mass of a sulfur-containing amino acid.
Distilled water was added to the extract after the above onion crude heat treatment to obtain a 30% (w / v) aqueous solution. 1000 mL of this aqueous solution was used as a sample solution and passed through 500 mL of a strongly acidic cation exchange resin (Diaion SK1B, manufactured by Mitsubishi Chemical) regenerated with hydrochloric acid. Next, the sample solution remaining in the column was washed out with 3000 mL of distilled water. Thereafter, 1000 mL of 5% sodium hydroxide solution (pH = 14) was passed through the column to elute the sulfur-containing amino acid adsorbed on the ion exchange resin. Further, 2000 mL of distilled water was added to elute the liquid remaining in the column. The eluate eluted with the sodium hydroxide solution and the eluate eluted with distilled water were combined, concentrated with an evaporator (manufactured by Tokyo Science and Technology), and then desalted to obtain a sulfur-containing amino acid-containing solution. This solution contained about 2.2% by weight of PeCSO and about 0.72% by weight of MCSO.

(Comparative Example 1)
A leek extract was produced according to US Pat. That is, a green onion (manufactured by Kodama Foods) was dried and pulverized into a powder form, and 300 g of the green onion was immersed in 3 L of a 50% ethanol aqueous solution and allowed to stand for 1 week for extraction. The solid content was removed by filtration, and the filtrate was concentrated to obtain about 14 g of a leek extract.

  When muscle cells are cultured in the presence of hydrogen peroxide (H 2 O 2), they resemble muscle atrophy. Using this, the effect on the expression level of the muscle atrophy-related genes Atrogin-1 and MuRF-1 in the muscle atrophy state was examined.

(Test Example 1) Atrogin-1 expression inhibitory activity Extract after onion heat treatment containing PeCSO and MCSO of Example 1, reagents PeCSO (manufactured by Nagara Science), MCSO (manufactured by Funakoshi), cycloaliin (manufactured by Wako Pure Chemical Industries, Ltd.) ) And the onion extract of Comparative Example 1 were measured for Atrogin-1 expression inhibitory activity. The result is shown in FIG.

Method: Mouse skeletal muscle-derived cell line C2C12 4 × 10 4 cells / mL (10% FCS / DMEM) 1 mL was seeded on a 24-well plate and cultured in an atmosphere of 37 ° C., 5% CO 2, 95% air. After removing the medium, 1 mL of differentiation medium (2% horse serum / DMEM) was added, and the culture was further continued for 4 days. After removal of the medium, 900 μL of a test sample-containing differentiation medium was added, and culturing was performed for 2 hours and 30 minutes. 100 μL of 1 mM hydrogen peroxide-containing differentiation medium was added and cultured for 3 hours. After removing the culture solution, it was washed once with 1 mL of D-PBS (−), and then total RNA was extracted according to a standard protocol using Nucleospin RNA (Takara Bio, product code 740955.10). CDNA was prepared from RNA using PrimerScript RT Reagent kit (Takara Bio, cat. RP03A), and then real-time PCR was performed by an intercalator method using SYBR Green I. The expression level of Atrogin-1 was evaluated by a relative quantification method (ΔΔCt method) using GAPDH as a housekeeping gene.
The following primers were used in the RTPPCR reaction.

Gene Sequence (5'-3 ')
GPDH TGTGTCCGTCGTGGATCTGA (Forward)
TTGCTGTTGAAGTCGCAGGAG (Reverse)

Atrogin1 AACATGTGGGTGTATCGGATGG (Forward)
TGATGTTCAGTTGTAAGCACACAGG (Reverse)

(Test Example 2) MuRF-1 Expression Inhibitory Activity MuRF-1 Expression Inhibitory Activity of the Extract after Heat Treatment of Onion Containing PeCSO and MCSO of Example 1, PeCSO, MCSO, Cycloallyin of Reagents, and Leek Extract of Comparative Example 1 Was measured. The result is shown in FIG.

Method: It was performed in the same manner as the method for measuring the activity of inhibiting Atrogin-1 However, the following were used as Primers.

MuRF1 TGTCTCACGTGTGAGGTGCTA (Forward)
CACCAGCATGGAGATGCAGTTAC (Reverse)

  Results: As shown in FIG. 1 and FIG. 2, Example 1 (extract after onion heat treatment), PeCSO, MCSO and cycloallyin suppressed both muscle atrophy-related genes Atrogin-1 and MuRF-1, Example 1 (leek) did not inhibit MuRF-1.

Claims (6)

  A composition for suppressing muscle atrophy, comprising cysteine sulfoxides as an active ingredient. Cysteine sulfoxides are S-methyl-L-cysteine sulfoxide, S-allyl-L-cysteine sulfoxide, S-propyl-L-cysteine sulfoxide, S-1-propenyl-L-cysteine The composition according to claim 1, wherein the composition is one or more selected from sulfoxide or cycloaliyne.   The composition according to claim 1 or 2, wherein the cysteine sulfoxide is one or more selected from S-methyl-L-cysteine sulfoxide or S-1-propenyl-L-cysteine sulfoxide. object .   The composition according to any one of claims 1 to 3, which suppresses a plurality of muscle atrophy-related genes.   The composition according to any one of claims 1 to 4, wherein the composition is derived from a heat-treated product of an Allium plant or Brassica plant.   A food, feed or cosmetic for suppressing muscle atrophy, comprising the composition according to any one of claims 1 to 5.

Images