JP2017216961A - Non-natural amino acid-containing peptide library - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide chemical modification after peptide translation in which a non-natural amino acid present on a peptide sequence of a cDNA-display molecule and a bulky functional group are subjected to a Huisgen cycloaddition reaction.SOLUTION: According to the present invention, there is provided a method for modifying a peptide after translation, the method comprising: using an aminoacylated tRNA in which a non-natural amino acid and tRNA are bound to translate an mRNA-linker conjugate in which mRNA having a predetermined sequence is bound to a linker in a cell-free translation system without a termination factor; displaying a peptide on the conjugate; and using a Huisgen cycloaddition reaction without using a metal complex to introduce a bulky functional group into the peptide to modify the peptide after translation.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a method for post-translational modification of peptides. More particularly, the present invention relates to a method for post-translational modification of a peptide containing an unnatural amino acid on a cDNA display molecule obtained by using a cDNA display method.

  Conventionally, as pharmaceuticals, secondary metabolites of bacteria having various physiological activities, derivatives of such secondary metabolites, synthetic compounds that have been drug-designed based on their structures, and the like have been used.

  In order to select a medium molecule having physiological activity from a large number of candidate molecules, an efficient screening method is required, and one of such screening methods is a display method using a cell-free translation system. Examples of such display methods include, for example, mRNA display method, cDNA display method and the like (Non-patent Document 1, hereinafter referred to as “Prior Art 1”).

  On the other hand, click chemistry has been established in order to create various functional substances, for example, drug candidate compounds (Non-patent Document 2). Click chemistry, as indicated by the term “Click”, can easily form a strong bond, and is a basic technology based on high-speed reaction with high selectivity and yield. It is used as a feature. As a typical reaction of click chemistry, Huisgen cyclization (Huisgen [3 + 2] cyclization) using azide and alkyne is known (hereinafter referred to as “prior art 2”).

  In fact, Sharpless succeeded in discovering AchE inhibitors by cross-linking two inhibitors in acetylcholinesterase (AChE) using a click chemistry-based approach and searching for linkers. (Non-patent Document 3).

On the other hand, low molecular weight drugs with a molecular weight of about 50-1000 Da can pass through the blood-brain barrier and enter the brain, and can penetrate into the cell membrane and even into the nucleus. Can be expected to exert the effect of the drug.
In addition, antibody drugs and the like for the purpose of reducing side effects have been developed. Antibody drugs are difficult to artificially synthesize due to the use of macromolecules called antibodies, and even if they are produced by living organisms, mass production is difficult, and purification takes time and labor. For this reason, as a next-generation drug, a medium-molecular drug including “middle molecule” such as a peptide and a next-generation antibody has attracted attention (hereinafter referred to as “Prior Art 3”).

J. Yamaguchi, et al. Nucleic Acids Res, Vol.37, e108 (2009) Kolb, H. C .; Finn, M. G .; Sharpless, K. B. Angew. Chem. Int. Ed. 2001 Sharpless, K. B. et al. J. Am. Chem. Soc. 2005, 127, 6686

  The cell-free translation in Prior Art 1 is an excellent method for preparing a peptide library having diversity under mild conditions. However, problems may arise during the process of mRNA being taken up by ribosomes and translated. That is, the ribosome cannot take in amino acids with bulky side chains (hereinafter sometimes referred to as “unnatural amino acids”), and this limits the unnatural amino acids that can be incorporated into peptides. Therefore, there is a problem that a functional peptide library having sufficient diversity cannot be produced.

  Further, the Huesgen cycloaddition reaction in the prior art 2 is an excellent reaction in that it is hardly affected by the surrounding environment and conditions, proceeds under water and under biocompatible conditions, and has high reliability. However, in the above-mentioned Huisgen cycloaddition reaction, since a metal catalyst is used, there is a problem that the peptide generated during the cyclization reaction is cleaved. In addition, since copper ions are rich in reactivity, there is a problem in that unstable molecules such as active oxygen are created and molecules such as DNA that are important for organisms are indiscriminately broken.

On the other hand, among the low molecular weight compounds in the prior art 3, there is a problem that although it has a pharmacological action, its specificity to the target molecule is low, so that it cannot be used effectively.
In addition, in order to obtain candidate drugs that can be low molecular weight drugs, peptides, and candidate compounds that can be medium molecular weight drugs including “middle molecules” such as next-generation antibodies, the candidate peptides are not simply screened. It is necessary to give a new function and to be able to select an excellent candidate. For this reason, it is necessary to make the library size about 10 ¹² larger than the current size, but it is not actually created.

  For this reason, there has been a strong social demand for an efficient and high yield method by modifying the peptide obtained as a translation product by the cDNA display method.

Under such circumstances, the inventors of the present invention have completed the present invention through extensive research.
That is, an embodiment of the present invention includes (1) a linker binding step of binding mRNA having a predetermined sequence to a linker to obtain an mRNA-linker conjugate; (2) a termination factor that removes the termination factor from the cell-free translation system A removal step; (3) an aminoacylation step of preparing an aminoacylated tRNA by binding an unnatural amino acid and tRNA using an unnatural amino acid aminoacylating enzyme; and (4) the mRNA-linker conjugate is converted to the aminoacyl conjugate. A cDNA display molecule production step of translating in a cell-free translation system containing a tRNA containing the terminator and displaying the unnatural amino acid peptide on the mRNA-linker conjugate;

(5) a solid phase immobilization step for binding the cDNA display molecule to a solid phase; (6) a purification step for purifying the cDNA display molecule immobilized in the solid phase immobilization step; and (7) in the purification step. A modification step of modifying the peptide containing the unnatural amino acid by introducing a bulky functional group into the peptide bound to the obtained cDNA display molecule using a Husgen cycloaddition reaction without using a metal complex; (8) a post-translational modification method for a peptide, comprising a cleavage step of cleaving the modified cDNA display molecule from a solid phase.

    The tRNA preferably has an anticodon that recognizes a stop codon or an anticodon for an extended codon of 4 to 6 bases from the viewpoint of arranging unnatural amino acids into a peptide. Also, in the aminoacylation step, it is preferable to use an unnatural amino acid aminoacylase from the viewpoint of efficiently binding an unnatural amino acid to tRNA. Tyrosyl tRNA synthetase, pyrrolylsil tRNA synthetase, tryptophanyl tRNA synthetase, phenylarayl. It is more preferable to use any enzyme selected from the group consisting of nil tRNA synthetase, leucyl tRNA synthetase, lysyl tRNA synthetase, glutamyl tRNA synthetase and mutants thereof, and flexizyme.

  The metal complex is preferably Cu (I) from the viewpoint of suppressing the tendency of decomposing the synthesized peptide, DNA, or RNA during the Husgen cycloaddition reaction. The bulky functional group is preferably contained in the compound represented by the general formula I from the viewpoint of efficiently carrying out the Husgen cycloaddition reaction.

  In the formula, -X represents a side chain composed of a carbon chain or a carbon chain containing at least an oxygen atom, and biotin, a fluorescent dye, a fluorescent protein, a low molecular compound serving as a drug candidate, and a complex metal bonded to the terminal It is a bulky functional group comprising any molecule selected from the group consisting of cyclic compounds containing.

    The non-natural amino acid preferably has an azide in the side chain from the viewpoint of efficiently performing the Husgen cycloaddition reaction with the bulky functional group, and is selected from the group consisting of compounds represented by chemical formulas II to V. It is more preferable that it is suitable for the reaction with both the unnatural amino acid aminoacylating enzyme and the bulky functional group.

  According to the post-translational modification method of the present invention, a peptide library containing unnatural amino acids obtained by using the cDNA display method can be post-translationally modified while suppressing degradation of DNA, RNA and peptides by metal complexes. .

FIG. 1 is a schematic diagram of post-translational peptide modification by Huesgen cycloaddition reaction. FIG. 2A is a diagram (1) showing an example of a bulky functional group. FIG. 2B is a diagram (2) showing an example of a bulky functional group. FIG. 2C is a diagram (3) showing an example of a bulky functional group. FIG. 2D is a diagram (4) showing an example of a bulky functional group.

FIG. 3 is a schematic diagram of a photocrosslinking linker. FIG. 4 is a diagram showing an example of a bond between a photocrosslinkable linker and mRNA. FIG. 5 is a schematic diagram showing an enzyme-type linker. FIG. 6 is an electrophoresis photograph of aminoacylated tRNA.

FIG. 7 is an electrophoretogram of the cDNA display when the Husgen cycloaddition reaction is carried out without using a copper catalyst. FIG. 8 is an electrophoretogram showing the cDNA display state when the Husgen cycloaddition reaction is carried out using a copper catalyst. FIG. 9 is a photograph showing the results of a gel shift assay in which the introduction efficiency of an unnatural amino acid was examined when a Husgen cycloaddition reaction was carried out without using a copper catalyst.

Hereinafter, the present invention will be described in detail with reference to FIG.
As described above, the present invention comprises (1) a linker binding step; (2) a termination factor removal step; (3) an aminoacylation step; (4) a cDNA display molecule production step; (5) an immobilization step. And (6) a purification step; (7) a modification step; and (8) a cleavage step.

  In the linker binding step (1) above, first, DNA having a desired sequence is selected from a DNA library. Here, the “desired sequence” means a DNA sequence encoding a target protein or peptide and a sequence similar thereto, and a DNA sequence having a base sequence complementary to an mRNA having a stop codon and similar thereto. A sequence is preferred.

  MRNA is prepared using the selected DNA, a desired promoter, and other sequences necessary for preparing a full construct DNA. Here, examples of “other sequences necessary for the production of full construct DNA” include sequences complementary to the stop codon of mRNA, tag sequences for purification such as His tags, and the like. A DNA fragment containing the sequence as described above is prepared, and the DNA is amplified by extension PCR to obtain a double-stranded full construct DNA.

Further, the obtained double-stranded full construct DNA can be transcribed according to a conventional method to obtain mRNA. Here, ScriptMAX (R) Thermo T7 Transcription Kit (Toyobo Co., Ltd.), RiboMAX (Registered Trademark) Large Scale RNA Production System-T7 (Promega), T7 Transcription Kit (Cosmo Bio Co., Ltd.) When other commercially available transcription kits are used, mRNA can be prepared by performing transcription quickly, simply and accurately.
The mRNA obtained above is bound to a linker to prepare a linker-mRNA conjugate. As the linker, an enzyme-type linker that ligates the linker and mRNA using T4RNA ligase can be used.

  Moreover, it is preferable to use a photocrosslinking linking linker in that ligation can be performed in a short time. As such a photocrosslinkable linker, use of a photocrosslinkable linker containing a high-speed photocrosslinkable artificial nucleic acid (3-cyanovinylcarbazole) (hereinafter sometimes referred to as “cnvk”) in the main chain, This is preferable in that a linker-mRNA conjugate can be obtained quickly and efficiently.

  In the termination factor removing step (2) above, the termination factors RF1, RF2 and R3 are removed from the cell-free translation system. This prevents translation from being terminated even when the stop codon on the mRNA is decoded by a small subunit of the ribosome. That is, tRNA is aminoacylated with an unnatural amino acid to be described later, and tRNA having an anticodon corresponding to the stop codon is transferred to the stop codon site, the unnatural amino acid is arranged in a peptide, and translation continues thereafter.

The cell-free translation system with the termination factor removed is the initiation factor (IF1, IF2 and IF3), elongation factor (EF-Tu, EF-Ts and EF-G), ribosome regeneration factor (RRF) involved in the translation reaction in E. coli 20 types of aminoacyl-tRNA synthetase (ARS), methionyl-tRNA formyltransferase (MTF), ribosome, T7 RNA polymerase, etc. are purified separately and then reconstituted by mixing with amino acids, NTP, tRNA, etc. be able to.
In addition, a cell-free translation system from which a termination factor has been removed can be purchased from PUREfrex (registered trademark) (manufactured by Gene Frontier Co., Ltd.) or the like.

    In the aminoacylation step (3) above, first, an unnatural amino acid to be sequenced in a peptide is selected to prepare a tRNA. The selected unnatural amino acid is then coupled to the prepared tRNA using chemical aminoacylation methods or unnatural aminoacylation enzymes.

  Aminoacylation of an unnatural amino acid by a chemical aminoacylation method can be performed by a conventional method. For example, when N-Boc-nitrophenylalanine protected with a tert-butoxycarbonyl group is selected as the unnatural amino acid, first, the unnatural amino acid is cyanomethylated, and phosphoric acid-deoxycytosine-phosphoric acid-adenosine (pdCpA) dipeptide. Following the addition of nucleotides, treatment with trifluoroacetic acid removes Boc. Nitrophenylalanyl-pdCpA can then be bound to tRNA to give nitrophenylalanyl-tRNA.

When an unnatural amino acid aminoacylating enzyme is used, a pair of an unnatural amino acid and tRNA that can use the enzyme is selected. For example, when tyrosyl-tRNA synthetase is selected as the unnatural amino acid aminoacylating enzyme, a non-natural amino acid similar to tyrosine such as 3-iodo-L-tyrosine and tRNA ^Try may be selected. Further, when using pyrrolylsyl tRNA synthetase, for example, a non-natural amino acid and tRNA ^Pyl similar in structure to lysine having a pyrroline ring bound to the end of a side chain such as pyrrolysine may be selected.

In order to improve the efficiency of aminoacylation, a mutant of the above-mentioned non-natural amino acid aminoacylating enzyme can also be used. In the present specification, the “variant of an unnatural amino acid aminoacylating enzyme” refers to an enzyme in which some amino acids on the amino acid sequence of the enzyme are substituted with other amino acids. For example, in the case of tyrosyl tRNA synthetase, aminoacylation reaction of 3-iodo-L-tyrosine and tRNA ^Try is compared to L-tyrosine by replacing 37th tyrosine with valine and 195th glutamine with cysteine. Improves nearly 10 times.
Further, by mutating the unnatural amino acid aminoacylating enzyme, aminoacylation between a non-natural amino acid and tRNA different from those before mutation can be performed. For example, aminoacylation of Z-lysine and RNA ^Ply can be performed by substituting the 309th leucine of a pyrrolylsil tRNA synthetase with alanine and the 348th cysteine with valine.

  When flexizyme is used for an unnatural amino acid aminoacylating enzyme, an unnatural amino acid substrate and tRNA are prepared as necessary so that the unnatural amino acid can be recognized, and then tRNA is aminoacylated. Here, it is preferable to use a tRNA having an anticodon corresponding to the stop codon because a desired unnatural amino acid can be easily arranged at the peptide linking site on the mRNA-linker conjugate.

  Non-natural amino acid aminoacylase is tyrosyl tRNA synthetase, pyrrolyl tRNA synthetase, tryptophanyl tRNA synthetase, phenylalanyl tRNA synthetase, leucyl tRNA synthetase, lysyl tRNA synthetase, glutamyl tRNA synthetase and variants thereof And any one selected from the group consisting of flexizyme is preferable in that a desired non-natural amino acid can be efficiently bound to tRNA with high specificity. Examples of variants of the unnatural amino acid aminoacylating enzyme are as described above.

  Since the unnatural amino acid is bonded to the compound having a bulky functional group in the modification step described later by the Husgen cycloaddition reaction, it is preferable to select a compound having an azide in the side chain, which is represented by the following chemical formulas II to V. It is preferable that it is any one selected from the group consisting of the above compounds in terms of enhancing the reactivity with the compound having a bulky functional group.

Here, in the present specification, “bulky functional group” means a side chain composed of a carbon chain or a carbon chain containing at least an oxygen atom, and biotin, a fluorescent dye, a fluorescent protein, a drug candidate at its end. A functional group comprising any molecule selected from the group consisting of a low molecular weight compound and a cyclic compound containing a complex metal.
Here, it is preferable that the side chain has 3 or more carbon atoms, and at least an oxygen atom is contained in the side chain as carbonyl or ether.

  Examples of the fluorescent dye that binds to the side chain include Alexa Fluor (registered trademark) fluorescent dye, fluorescent dyes such as Pacific Blue, Pacifc Green, Pacific Orange, Coumarin, FITC, rhodamine, and the like. The fluorescent protein is a fluorescent protein such as GFP, RFP, CFP, and the like.

  The low molecular weight compound that is a drug candidate is preferably a compound having a molecular weight of 50 to 1000 Da, and more preferably 300 to 500 Da, from the viewpoint of drug absorption. Examples of drug candidates include the following. For example, as cancer molecule targeting drugs, vascular endothelial growth factor receptor, fibroblast growth factor receptor, Janus kinase and other tyrosine kinase targeting drugs; mitogen-activated protein kinase, phosphatidylinositol 3- Drugs that target kinases other than tyrosine kinases such as kinase and protein kinase C; drugs that affect epithetics, telomere control and gene expression targeting histone deacetylase, telomerase, etc .; poly (ADP-ribose) polymerase, These include post-translational modification / degradation / folding of proteins targeting heat shock protein 90 and the like, molecular motors, drugs that act on nuclear transport; and drugs that act on apoptosis and autophagy targeting apoptosis inhibitors and the like. ,

  In addition, as a cyclic compound containing a complex metal, for example, porphyrin, phthalocyanine, corrole, choline, chlorin and analogs thereof are used as ligands, sodium, potassium, magnesium, calcium, zinc, cobalt, iron, copper, nickel And compounds composed of a metal such as molybdenum as a complex metal.

  Specific examples of bulky functional groups are shown in FIGS. 2A to 2D. These are used for searching various drug candidate compounds such as anti-HIV drugs and anti-tuberculosis activating compounds, bioconjugation such as synthesis of functional materials and virus surface modification. Bulky functional groups can be selected from commercially available click chemistry reagents, but they can react quickly and efficiently for biomolecular imaging and labeling, even if they are free of copper (I). It is preferable in that it can be used.

  For example, when flexizyme dFx, which will be described later, is selected as an unnatural amino acid aminoacylating enzyme, a bulky functional group having a 3,5-dinitrobenzyl ester group as a recognition site and a 3,5-dinitrobenzyl group as a substrate site For example, it is preferable to select an unnatural amino acid having an azide group for carrying out a Huisgen cycloaddition reaction with, for example, cyclooctyne or a derivative thereof. For example, it is preferable to select a compound represented by the above chemical formula III in that it can be used for aminoacylation without preparing an amino acid substrate described later.

In addition, when flexizyme eFx described later is selected, it is preferable to select an unnatural amino acid having an aromatic ring as a recognition site and a cyanomethyl group as a substrate site and having an azide group after the Husgen cycloaddition reaction. . For example, it is preferable to select a compound represented by Formula II, and a 4-azido-L-phenylalanine represented by Formula IV or an N-Boc-azido-L-phenylalanine compound represented by Formula V is selected. This is preferable because it can be used for aminoacylation without preparing an amino acid substrate.
Thereby, both can be couple | bonded simply and in high yield by the click reaction between the triple bond part of a functional group, and the azide group of an unnatural amino acid.

  Flexizyme is an artificial aminoacylating enzyme that recognizes a site with a specific structure in an unnatural amino acid and binds the 3 ′ end of tRNA to an activated substrate site. From the viewpoint of highly efficient aminoacylation, mainly dinitrobenzyl flexizyme (hereinafter sometimes referred to as dFx), enhanced flexozyme (hereinafter sometimes referred to as eFx), aminoflexizyme (hereinafter also referred to as aFx) Etc. can be used.

For example, dFx aminoacylates the 3 ′ end of tRNA using a 3,5-dinitrobenzyl ester group as a recognition site and an activated 3,5-dinitrobenzyl group as a substrate site. In addition, eFx is aminoacylated using an aromatic ring as a recognition site and an activated cyanomethyl group as a substrate site. aFx recognizes an aromatic ring as a recognition site and a 4-[(2-aminoethyl) carbamoyl] benzyl ester group as a substrate site.
The flexizyme is prepared by selecting the flexizyme according to the unnatural amino acid used for aminoacylation. Each flexizyme can be obtained by transcription after synthesizing desired primers and preparing DNA by PCR.

  The preparation of the unnatural amino acid substrate is for the purpose of using a specific flexizyme even if the unnatural amino acid selected above does not have a flexizyme recognition site and a substrate site to which tRNA binds. According to the necessity, it prepares so that it may have the above-mentioned recognition part or substrate part. For example, by reacting a non-natural amino acid having an aromatic ring as a recognition site of eFx with 3,5-dinitrobenzyl chloride to synthesize a non-natural amino acid having a 3,5-dinitrobenzyl ester group, dFx Can be used. In addition, when it has an aromatic ring as a recognition site and does not have a cyanomethyl group as a substrate site, for example, react with chloroacetonitrile or cyanomethyl ester to synthesize an unnatural amino acid having a cyanomethyl group. And you can use eFx.

A tRNA having an anticodon corresponding to the stop codon is synthesized by synthesizing a primer necessary for tRNA synthesis containing any one of the anticodons AUC, AUU or ACU corresponding to the stop codons UAG, UAA or UGA, and DNA by PCR. Can be obtained by transcription.
The aminoacylation of the tRNA obtained above is carried out by heating a solution obtained by dissolving flexizyme and tRNA in a desired buffer and then allowing to cool, and adding and reacting with an unnatural amino acid substrate on ice.

  In the present specification, the term “extended codon” refers to a codon obtained by artificially extending a codon, which is a nucleotide sequence consisting of three base chains corresponding to amino acids constituting a protein, to a nucleotide sequence consisting of four or more base chains. . The following 4 to 6 base extended codons are preferable in that they can be efficiently decoded by tRNA having a corresponding anticodon and sequence unnatural amino acids into peptides. The 4-base extended codon is, for example, CGGU, CGCU, CCCU, CUAU, and GGGU; CGGCG, CGGGA, CGGGU, CGGGC and CGGGG; As for the 6-base extended codon, for example, CGGUAG can be mentioned.

  A tRNA having an anticodon for the extension codon can be obtained by constructing a plasmid for a desired tRNA, preparing a template DNA by PCR using this and a primer having a desired sequence, and transcribing it.

For example, when preparing a tRNA _ACCU having an anticodon for the extension codon AGGU, first, a plasmid A for tRNA _ACCU is constructed. In preparation of the plasmid, first, two oligonucleotides of SEQ ID NOs: 1 and 2 below are synthesized, and PCR is performed using dNTP and DNA polymerase at predetermined concentrations. After the reaction solution is extracted with a phenol / chloroform solution and chloroform, DNA is obtained by ethanol precipitation. Next, after treatment with EcoRI, phosphorylation is performed using T4 polynucleotide kinase.

[SEQ ID NO: 1]
5'-CTGCAGTGCGAATTCTGTGGATCGAACACAGGACCTCCAGATTACCTAGTCTGGCGCTCT-3 '
[SEQ ID NO: 2]
5'-GGGCTCGAGTAATACGACTCACTATAGCGGATTTAGCTCAGTTGGGAGAGCGCCAGACT-3 '

  The obtained DNA fragments are separated by 8% gel electrophoresis (PAGE), and a 94 bps band is cut out and immersed in an elution buffer for 3 hours. A phenol / chloroform solution and chloroform are added to this solution to extract DNA fragments in the aqueous phase, and then DNA is obtained by ethanol precipitation. Subsequently, the obtained DNA fragment is introduced into a pUC18 plasmid lacking the EcoRI-SmaI fragment using a DNA ligation kit, and E. coli MV1184 is transformed using this. A single colony is cultured in YT medium, and plasmid A is isolated using, for example, a plasmid miniprep kit (GMbiolab).

Subsequently, a PCR mixed solution containing a primer of SEQ ID NO: 3 below, a primer of SEQ ID NO: 4, plasmid A, dNTP and DNA polymerase at a predetermined concentration is prepared. After PCR amplification, separate by 6% PAGE and dissolve in water. PCR is performed again using a PCR mixed solution in which a PCR product is added instead of plasmid A, and the PCR product is purified with a purification kit. Then, transfer in a mixture of NTP, GMP, MgCl ₂ , DTT, spermidine, BSA, inorganic pyrophosphatase, RNase inhibitor, T7 RNA polymerase, and purified PCR product to Tris-HCl (pH 8.0) at the specified concentration. I do. The transcription reaction can be performed at 37 ° C. for 8 to 16 hours, and purified according to a conventional method to obtain the target tRNA _ACCU .

[SEQ ID NO: 3]
5'-CAGACTACCGAATCTGGAG-3 '
[SEQ ID NO: 4]
5'-CTGCGAATTCTGTGGATCGA-3 '

  In addition, non-natural amino acid aminoacyl, which is entrusted to a company that synthesizes peptides, such as Protein Express Co., Ltd., to synthesize tRNA containing an anticodon for the desired extension codon, and to which the desired unnatural amino acid is bound. The synthesis of activated tRNA can also be outsourced.

  In the cDNA display molecule preparation step (4) above, the mRNA-linker conjugate obtained in the mRNA-linker binding step is used with the aminoacyl tRNA bound to the non-natural amino acid obtained in the aminoacylation step, to obtain a desired Under the conditions, translation is performed with a cell-free translation system obtained in the termination factor removal step. As a result, a cDNA display molecule can be obtained in which the mRNA on the mRNA-linker conjugate is translated and a peptide sequence in which an unnatural amino acid is bound is displayed at the peptide binding site on the mRNA-linker linkage.

  In the solid phase immobilization step (5) above, the cDNA display molecule obtained above can be immobilized on a desired solid phase via a linker. Examples of molecules that form a bond with a solid phase with a linker include, for example, biotin when avidin and streptavidin are bound to the solid phase, maltose when a maltose binding protein is bound, and G protein. When is bound, a metal such as Ni or Co is preferred when a guanine nucleotide is bound and when a polyhistidine peptide is bound.

  When glutathione-S-transferase is bound, glutathione, when sequence-specific DNA or RNA binding protein is bound, DNA or RNA, antibody or aptamer having a sequence specific to these When bound, antigen or epitope peptide, when calmodulin is bound, calmodulin binding peptide, when ATP binding protein is bound, ATP, when estradiol receptor protein is bound Examples include estradiol. Among these, it is preferable to use a molecule selected from the group consisting of metal molecules such as biotin, maltose, Ni or Co, glutathione, antigen molecules and epitope peptides, and biotin is used from the viewpoint of easy linker synthesis. It is preferable to do.

  In the purification step (6) above, the immobilized cDNA display molecule can be purified using, for example, His-tag protein purification beads. As such a His-tag protein purification bead, His Mag Sepharose Ni (manufactured by GE healthcare) or the like can be used. First, the His-tag protein purification beads are washed in advance with a His-tag washing buffer, and the recovered cDNA display molecules are added to the washed His-tag protein purification beads, and incubated under desired conditions. Then, after washing the beads with the His-tag washing buffer, a His-tag protein elution buffer is added and stirred under desired conditions to obtain a purified cDNA display molecule.

In the modification step (7) above, the unnatural amino acid in the purified cDNA display molecule and a bulky functional group are bound by a Husgen cycloaddition reaction without using a metal complex to modify the peptide on the cDNA display. . Here, as the bulky functional group, it is preferable to use a molecule represented by the general formula I because the peptide can be modified under mild conditions.
In addition, the fact that the metal complex is Cu (I) can be used to label DNA stability and proteins, etc. by not using copper (I) ions that are toxic to cells. Is preferable in that it can be used.

  In the cleavage step (8) above, a cDNA display can be obtained by separating the solid phase from the linker together with the solid phase binding site using restriction enzymes such as endonuclease V, RNase T1, and RNase A.

  In the following, the present invention will be described in more detail by taking as an example the case of using the unnatural amino acid N-Boc-4-azido-L-phenylalanine.

(I) Synthesis of mRNA-linker conjugate
(i) Preparation of mRNA having a stop codon mRNA having a stop codon is synthesized using a DNA fragment encoding a natural or artificial peptide or protein, a DNA fragment complementary to the mRNA having a stop codon, and a desired primer. . For example, in the DNA sequence (SEQ ID NO: 5) encoding the B domain of the A protein (hereinafter sometimes referred to as BDA protein), the following DNA fragment (hereinafter referred to as “complementary mRNA” having a termination codon UAG, UAA or UGA). Introducing BDA-UAG sequence).

[SEQ ID NO: 5]
5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGATAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCCTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAAGCACCAAAAGCTGACAACAAATTCAACGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA-3 '

[SEQ ID NO: 6]
BDA-UAG sequence: 5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGCTAATGATGATGGCT-3 '
[SEQ ID NO: 7]
BDA-UAA sequence: 5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGTTAATGATGATGGCT-3 '
[SEQ ID NO: 8]
BDA-UGA sequence: 5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGTGAATGATGATGGCT-3 '

One of these sequences is selected, for example, a 25 to 75 μL PCR reaction solution (1 × PrimeSTAR buffer (Mg ²⁺ ), 0.1 to 0.4 mM dNTPs, 0.01 to 0.04 U / μL PrimeSTAR HS DNA polymerase (manufactured by Takara Bio Inc.)) is prepared, and PCR is performed using the following PCR program. PCR programs include, for example, (a) 92-96 ° C. (30 seconds to 3 minutes), (b) 92-96 ° C. (5-45 seconds), (c) 50-70 ° C. (2-30 seconds), ( d) 65 to 80 ° C (10 to 40 seconds), (e) 65 to 80 ° C (1 to 3 minutes), and steps (b) to (d) are performed for 10 to 40 cycles. This is preferable from the viewpoint of availability.

Next, the PCR product contains, for example, a 25 to 75 μL PCR reaction solution (1 × PrimeSTAR buffer (Mg ²⁺ ), 0.1 to 0.4 mM dNTPs, 0.01 to 0.04 U / μL PrimeSTAR HS containing Newleft and NewYtag sequences. DNA polymerase (Takara Bio Inc.) is prepared, and PCR is performed using the following PCR program. PCR programs include, for example, (a) 92-96 ° C. (30 seconds to 3 minutes), (b) 92-96 ° C. (5-45 seconds), (c) 50-70 ° C. (2-30 seconds), ( d) 65 to 80 ° C (10 to 40 seconds), (e) 65 to 80 ° C (1 to 3 minutes), and steps (b) to (d) are performed for 10 to 40 cycles. This is preferable from the viewpoint of availability.

  The double-stranded DNA obtained by the above PCR can be purified using, for example, a spin column. From this eluate, take 50 to 100 μL, add Nuclease-free water at 80 to 180 μL, add 1/20 to 1/5 times the amount of coprecipitate, and precipitate with ethanol. Thereafter, it can be dissolved in 10-30 μL of Nuclease-free water and stocked at −20 ° C.

  For the purification, for example, FavorPrep PCR Clean-Up Mini Kit (manufactured by Favorgen) can be used. Nuclease-free water to be added to the obtained eluate can be, for example, the product attached to the kit, and the coprecipitation agent is, for example, Quick-Precip Plus Solution, EdgeBio. be able to.

(ii) Transcription The double-stranded DNA obtained as described above can be transcribed using a commercially available kit. For example, using a kit (RiboMAX® Large Scale RNA Production Systems-T7) manufactured by Promega, according to the attached protocol, using 1 to 5 pmol of double-stranded DNA, an appropriate scale, for example, 20 μL. Transfer with the scale of. For example, after incubation at 35 ° C to 39 ° C for 1 to 3 hours, add 0.5 to 2 μL of DNase supplied with the kit to this system, and further incubate at 35 to 39 ° C for 10 to 30 minutes to synthesize mRNA. can do. The synthesized mRNA can be purified using, for example, After Tri-Reagent RNA Clean-Up Kit (manufactured by Favorgen).

  In addition, transcription can also be performed according to the attached manual using ScriptMAX® Thermo T7 Transcription Kit (manufactured by Toyobo Co., Ltd.) or T7 Transcription Kit (manufactured by Cosmo Bio Co., Ltd.).

(iii) Preparation of linker
As the linker used in the mRNA-linker conjugate, for example, a photocrosslinking linker synthesized by irradiation with UV or an enzyme linker synthesized using ligase can be used. In the present specification, “cDNA display molecule” refers to a molecule in which an mRNA-linker conjugate is translated to display a peptide in the cDNA display method, a molecule in which the molecule is reverse-transcribed and cDNA is linked, and further thereafter Includes molecules that have degraded mRNA. In the present specification, the “linker” refers to a linker used for forming an mRNA-linker conjugate or a cDNA display molecule used in a cDNA display method.

  The linker is mainly composed of DNA, but it is preferable to use a photocrosslinking linker containing cnvk shown in FIG. 4 because it can photocrosslink with mRNA in a short time. Moreover, it may contain DNA analogs such as deoxyinosine, biotin-modified deoxythymine, and fluorescein-modified deoxythymine, and is preferably designed so as to have flexibility and hydrophilicity as a whole.

  The main chain of the photocrosslinking linker is (p1) a solid phase binding site for binding the linker to the solid phase, (p2) a binding site for binding the side chain, and (p3) a main chain having an mRNA binding site; (p4) a cleavage site that cleaves the linker from the solid phase, and the side chain binds (s1) a main chain binding site that binds to the main chain and (s2) a detection label for the mRNA-linker conjugate And (s3) a peptide binding site to which a peptide having a sequence synthesized corresponding to mRNA binds. The side chain label binding site may be composed of one or more spacer sequences, and a fluorescent label is bound thereto. Furthermore, the peptide binding site may be composed of puromycin or an analog thereof (see FIG. 3).

  The solid phase binding site (p1) is a site for binding the cDNA display molecule described above to a solid phase via a linker, and is composed of at least 1 to 10 bases. For example, any compound selected from the group consisting of biotin-modified deoxythymidine (dT), biotin, streptavidin alkyne, azide by click chemistry, amino group, N-hydroxysuccinimide ester (NHS), SH group, and Au And poly A bonded to the compound. In the poly A, it is preferable that at least 10 adenines are bound to each other because it is possible to maintain an appropriate distance from the solid phase, and that separation from the solid phase described later can be performed well. Is more preferably bonded.

  The side chain binding site (p2) located in the vicinity of the 3 ′ end side of the linker is a site to which a side chain described later binds. Further, for example, when the side chain binding site (p2) of the linker is composed of Amino-Modifier C6 dT, the 5 ′ end of the side chain is designated as 5′-Thiol-Modifier C6, and EMCS (N− (6-maleimidocaproyloxy) succinimide) can be crosslinked to bond the main and side chains.

  The primer region (PR) is a region located on the 3 ′ end side of the linker, and functions as a primer for reverse transcription when reverse transcription is performed on the linker, and the side chain binding site (p2) Adjacent to the 3 'side. This region preferably consists of about 1 to 15 bases, particularly 3 to 5 bases. When the number of bases exceeds 15, the binding efficiency as a linker is deteriorated. Therefore, from the viewpoint of the binding efficiency with a linker and the reaction efficiency as a primer, the above base number is preferable.

  The peptide binding site is preferably composed of puromycin or an analogous compound thereof. Examples of the puromycin analogs include 3'-N-aminoacylpuromycin (PANS-amino acid) and 3'-N-aminoacyl adenosine amino acid nucleoside (AANS-amino acid). When the amino acid part is glycine, PANS-Gly, PANS-Val that is valine, PANS-Ala that is alanine, a mixture of PANS amino acids, AANS-Gly that the amino acid part of AANS is glycine, AANS-Val that is valine, More preferably, it is any compound selected from the group consisting of AANS-Ala, which is alanine, and a mixture of AANS amino acids.

  When the side chain has a fluorescent group between the peptide binding site and the side chain binding site, the presence or absence of binding to the linker can be easily detected in the cDNA display method. As the fluorescent group, for example, a free functional group such as a carboxyl group that can be converted into an active ester, a hydroxyl group that can be converted into a phosphoramidide, or an amino group, and a fluorescent compound that can be bound to a linker as a labeled base are used. It is preferable to use it. Examples of such a compound include fluorescein isothiocyanate (FITC), rhodamine, Cy dye, AlexaR Fluor, etc., and it is preferable to use FITC from the viewpoint of cost.

The photocrosslinking linker as described above can be produced as follows.
First, the main chain of the linker (hereinafter referred to as “poly A + cnvk segment”) may be used so that cnvk is in a desired position between the solid-phase binding site and the site where the main chain and the side chain are bonded. ) And perform chemical synthesis of DNA according to conventional methods. Such chemical synthesis of DNA strands can also be obtained by consigning to a synthesis company.

  Such a main chain may be designed to include, for example, a reverse transcription initiation site, a side chain linking site, a high-speed photocrosslinking site consisting of cnvk, and a solid phase binding site as shown in FIG. it can. Of the main chain shown in FIG. 3, the base sequence of the main chain excluding the modified site is shown in the following sequence (SEQ ID NO: 9). The following main chain has BioTEG added to the 5 ′ end. In the following base sequences, R represents inosine, and Y represents amino C6-dT.

  5'-AAAAAAAAAAAAAAAAAAAARTTCCAGCCGCCCCCCGYCCT-3 '... [SEQ ID NO: 9]

  The side chain of the linker (hereinafter sometimes referred to as “puromycin-segment”) is also designed to have a desired sequence, and the chemical synthesis of DNA is performed according to a conventional method in the same manner as the Poly A + cnvk segment. Such chemical synthesis of DNA strands can also be obtained by consigning to a synthesis company.

  Such a side chain is preferably designed to include a side chain linking site, a fluorescent label, and a peptide binding site, for example, as shown in FIG. Of the side chain, the base sequence (SEQ ID NO: 10) excluding the modified site is as follows. Among the following side chains, P (K in the following sequence) serving as a free end is puromycin as a peptide binding site. In the following base sequences, R represents 5'Thiol C6, Y represents FITC-dT, and M represents Spacer18.

  5 'RTCTYMMCCK ... [SEQ ID NO: 10]

  For example, 10 to 20 nmol of the main chain having the above sequence is contained in 0.1 to 0.3 M sodium phosphate (pH 7.0 to 7.4), and EMCS (manufactured by Dojindo Laboratories Co., Ltd.) at a final concentration of 15 Add to ˜18 mM and incubate at about 37 ° C. for 20-40 minutes, followed by ethanol precipitation. Preferably, EMCS is added to a 0.1 to 0.3 M sodium phosphate solution (pH 7.0 to 7.4) containing 10 to 20 nmol of the main chain to a final concentration of about 16.7 mM, and 20 to 40 at about 37 ° C. Incubate for a minute, and then modify by ethanol precipitation using, for example, Quick-Precip Plus Solution (Edge BioSystems).

  Next, the side chain of 30 to 45 nmol is dissolved in 0.8 to 1.5 M sodium hydrogenphosphate aqueous solution containing 40 to 60 mM DTT, and stirred at room temperature for 0.75 to 1.5 hours using a shaker. Subsequently, buffer exchange is performed on this solution. For example, using a NAP column or the like, the buffer is exchanged with 0.1 to 0.2 M sodium phosphate (pH 7.0 to 7.4) containing 0.1 to 0.2 M NaCl to obtain a reduced side chain.

  Subsequently, the solution containing the reduced side chain that has undergone buffer exchange as described above is mixed with the ethanol precipitation product of the above-mentioned EMCS-modified main chain and left at 2 to 6 ° C. overnight. Thereafter, DTT is added to the reaction solution so that the final concentration is 40 to 60 mM, and the mixture is stirred at room temperature for 15 to 60 minutes. Thereafter, ethanol precipitation is performed, and the obtained ethanol precipitate is dissolved in 50 to 200 μL of nuclease-free water for purification.

  Preferably, the solution containing the reduced side chain subjected to buffer exchange in the above-mentioned buffer is mixed with the ethanol precipitation product of the above-mentioned EMCS-modified main chain and left at 3 to 5 ° C. overnight. Thereafter, DTT is added to the above reaction solution so that the final concentration is 40 to 60 mM, and the mixture is stirred at room temperature for 20 to 40 minutes. Then, for example, using Quick-Precip Plus Solution (manufactured by Edge BioSystems) Perform ethanol precipitation. The obtained ethanol precipitation product can be dissolved in about 100 μL of nucleotide-free water and purified by HPLC by gradient elution using a C18 column under the following conditions to obtain a photocrosslinkable linker.

  The eluent used for the gradient elution is, for example, 0.05 to 0.2M trimethylammonium acetate (ultra pure water) for solution A, 75 to 85% acetonitrile for solution B, and the ratio of solution A during the starting elution period. , It may be reduced by about 20% over 40 to 50 minutes. The flow rate can be 0.5-1.5 ml / min and the fraction can be 0.5-1.5 mL. Preferably, liquid A is 0.1 to 0.3M trimethylammonium acetate (ultra pure water), liquid B is 70 to 90% acetonitrile, and the ratio of liquid A during the elution period at the start (80 to 90%) is 40 Reduce to 60-70% over -50 minutes. The flow rate is preferably 1.0 to 1.5 ml / min, and the fraction is preferably 1.0 to 1.5 mL.

  The components in the above fractions are confirmed by fluorescence and ultraviolet absorption (for example, 280 nm), the fractions in which peaks are observed by both detection means are collected, the solvent is evaporated using a vacuum evaporator, and then ethanol precipitation is performed. And the linker of the present invention can be produced by dissolving in nucleotide-free water. For example, when peaks are observed in both the fluorescence and UV in the fraction from 30 to 32 minutes, the fractions from 30 to 32 minutes are collected, and the solvent is distilled off using, for example, a vacuum evaporator. Thereafter, for example, ethanol precipitation is performed using Quick-Precip Plus Solution to obtain a photocrosslinking linker. The obtained photocrosslinking linker may be dissolved in nuclease-free water and stored at about −20 ° C.

  In the present invention, an enzyme-type linker can also be used. The enzymatic linker is synthesized, for example, by joining two segments of a puromycin segment (PS) and a short biotin segment (SBS) by chemical crosslinking using EMCS. The final construct consists of a ligase-linked mRNA ligation site, a reverse transcription primer region, a biotin site for immobilization on the surface of the solid phase using biotin-streptavidin binding, and a solid phase. It contains four parts, the cleavage site for RNase T1 to release the mRNA / cDNA protein fusion (see FIG. 5). In addition, the linker includes puromycin for covalently binding the expressed protein to the mRNA and FITC for detection and quantification.

  In designing the backbone, various mRNA coding sequences can be referred to. For example, mRNA encoding various receptor proteins with known sequences, mRNA encoding various antibodies or fragments thereof, and other mRNAs can be mentioned. The 3 'terminal analog of aminoacyl-tRNA, such as puromycin and its analogs, is incorporated into the C-terminus of the polypeptide chain generated by translation from the mRNA coding sequence, and the polypeptide chain and the linker-mRNA conjugate bind to each other. To do so, select a sequence that does not contain a stop codon. These mRNAs can be obtained using in vitro transcription reactions, chemical synthesis, extraction from living organisms, cells, and microorganisms, and various other methods. High cell translation reaction efficiency.

 Moreover, it is preferable from the viewpoint of protein synthesis efficiency that it has at least one of a 7-methylated guanosine cap structure at the 5 ′ end or a poly A tail structure at the 3 ′ end. It is more preferable to have a Kozak sequence or Shine-Dalgarno sequence because it promotes the initiation of translation. The length of mRNA used here depends in principle on the length of the coding region defined by the length of the protein or polypeptide to be molecularly evolved using the present invention. A length of 50 to 1,000 bases is preferable from the viewpoint of reaction efficiency, and a length of 200 to 500 bases is more preferable because the highest reaction efficiency can be obtained.

(iv) Ligation In the case of a photocrosslinkable linker, the mRNA obtained by the above transcription and the photocrosslinkable linker are ligated by irradiating UV of 300 to 400 nm with a long wavelength UV for 0.5 to 5 minutes, and the mRNA-linker conjugate Can be obtained. Since it has a long wavelength and a short irradiation time, there is an advantage that a desired peptide corresponding to the used mRNA can be obtained without causing a problem that a thymine dimer is formed in the synthesized cDNA. .

  In the case of an enzymatic linker, a predetermined amount of an enzymatic linker, a predetermined concentration of buffer, for example, 10xT4 RNA ligase buffer, and 0.05-2% BSA are added to the mRNA obtained by the above transcription, and further Nuclease Add -free water to prepare the desired total volume. After incubating at 85-95 ° C. for 0.5-2 minutes, incubate at 65-75 ° C. for 0.5-2 minutes, and decrease the temperature to about 20-27 ° C. at a rate of 0.02-0.06 ° C./second. Add desired amount of T4 polynucleotide kinase and T4 RNA ligase, e.g. 4-6 μl T4 polynucleotide kinase and 8-12 μl T4 RNA ligase and incubate at about 23-27 ° C. for 0.5-2 hours to linker- mRNA conjugates can be obtained.

(II) Removal of terminator The preparation of the cell-free translation mixture from which terminator was removed was carried out by first preparing 20 aminoacyl-tRNA synthetases (ARS), methionyl-tRNA formyltransferase (MTF), T7 PCR of RNA polymerase, nucleoside diphosphate kinase, initiation factors (IF1, IF2 and IF3), elongation factors (EF-Tu, EF-Ts and EF-G), and ribosome regeneration factor (RRF) according to conventional methods Amplify. Next, the obtained gene is inserted into, for example, each vector of pET21a (Novagen), pQE30 or pQE60 (Qiagen) to construct a His-tagged plasmid. Subsequently, for example, E. coli strains BL21 / pREP4 (pQE series) or BL21 / DE3 (pET series) are transformed with this plasmid.

BL21 transformed are cultured until 0.5~0.9xOD ₆₀₀ in LB medium. Next, isopropyl-β-thiogalactopyranoside is added to a final concentration of 0.1 to 0.3 mM, and the cells are cultured at 37 ° C. for 3 to 5 hours. Subsequently, the collected cells were treated with 40-60 mM HEPES-KOH (pH 7.6), 0.5-1.5 M NH ₄ Cl, 5-15 mM MgCl ₂ , 0.2-0.4 mg / ml lysozyme, 0.1-0.3% Triton X-100, Resuspend in buffer containing 0.1-0.3 mM phenylmethylsulfonyl fluoride (PMSF) and 6-8 mM β-mercaptoethanol and dissolve by sonication. After removing contaminants by centrifugation, the supernatant is purified by passing through a 10 ml Ni ²⁺ immobilized His Trap Chelating column (Amersham Pharmacia Biotech Co., Ltd.). Subsequently, it is washed with HT buffer (45-55 mM HEPES-KOH Buffer (pH 7.5), 0.8-1.2 M NH ₄ Cl, 8-12 mM MgCl ₂ , 6-8 mM β-mercaptoethanol) containing 8-12 mM imidazole.

  Each factor is separated from imidazole in HT buffer by linear gradient elution and the fraction containing His-tagged protein is stored in stock buffer by dialysis. Ribosomes can be obtained from, for example, E. coli A19 cells by sucrose density gradient centrifugation.

  From each of the factors obtained above, 12 pmol ribosome, 1-3 μg IF1, 1-3 μg IF2, 1-2 μg IF3, 1-3 μg EF-G, 1-3 μg EF-Tu, 1 ~ 3μg EF-Ts, 0.5 ~ 1.5μg RRF, 30 ~ 300 units of each ARS and MTF, 0.1 ~ 0.3μg creatine kinase (Roche), 0.10 ~ 0.20μg myokinase, 0.03 ~ 0.07μg nucleoside Prepare a factor mix containing 2-phosphate kinase, 0.05-0.15 U pyrophosphatase (both from Sigma-Aldrich) and 0.1-1 μg T7 RNA polymerase.

Factor mix prepared above, 8-10 mM magnesium acetate, 4-6 mM potassium phosphate (pH 7.3), 90-100 mM potassium glutamate, 4-6 mM ammonium chloride, 0.5-1.5 mM spermidine, 6-10 mM putrescine, 0.5-1.5 mM DTT, 1-3 mM ATP, 1-3 mM GTP, 0.5-1.5 mM CTP, 0.5-1.5 mM UTP, 8-12 mM creatine phosphate, 2.8 A280 Unit tRNA mix (Roche), 0.5-1 μg of 10-formyl- A mixed solution for cell-free translation consisting of 5,6,7,8-tetrahydrofolic acid and 0.1 to 0.3 mM of each amino acid from which the termination factor is removed can be prepared.
It is also possible to purchase and use a cell-free translation system in which only the termination factor is removed from PUREfrex (registered trademark) (manufactured by Gene Frontier Co., Ltd.).

(III) Aminoacylation step (i) Preparation of amino acid substrate Amino acid when N-Boc-4-azido-L-phenylalanine is selected as an unnatural amino acid having a bulky functional group and an azide group that undergoes a Husgen cycloaddition reaction The preparation of the substrate is described below.

N-Boc-4-azido-L-phenylalanine does not have a 3,5-dinitrobenzyl group at the recognition site of dFx and a dinitrobenzyl ester group at the substrate site. Therefore, in order to enable aminoacylation with dFx, a substrate site is prepared as follows so as to have a dinitrobenzyl ester group.
First, 8-10 mg N-Boc-4-azido-L-phenylalanine, 4-6 mg 3,5-dinitrobenzyl chloride, 6-8 μL triethylamine and 4-6 μL dimethylformaldehyde are placed in an eppendorf tube at room temperature. Stir for ~ 14 hours.

  Next, add 400-500 μL of dimethyl ether, wash 2-4 times with 100-200 μL of 0.5 M hydrochloric acid, 2-4 times with 100-200 μL of 5% aqueous sodium bicarbonate, and then add 50-150 μL of 4 M hydrochloric acid / acetic acid. Add ethyl and let stand at room temperature for 10-30 minutes. Subsequently, 200 to 400 μL of diethyl ether was added and distilled off under reduced pressure. By repeating this operation 3 to 5 times and then filtering, an unnatural amino acid substrate having a 3,5-dinitrobenzyl group at the carboxy terminus can be obtained.

N-Boc-4-azido-L-phenylalanine has a benzene ring, which is a recognition site for eFx, but does not have a cyanomethyl group as a substrate site. Therefore, in order to enable aminoacylation with eFx, a substrate site having a cyanomethyl group is prepared as follows.
First, put 8-10 mg N-Boc-4-azido-L-phenylalanine, 1-4 mg cyanomethyl ester, 6-8 μL triethylamine and 4-6 μL dimethylformaldehyde into an Eppendorf tube and stir at room temperature for 4-6 hours To do.

  Next, purify by HPLC according to a conventional method, freeze-dry the purified product, add 50-150 μL of 4M hydrochloric acid / ethyl acetate, and react at room temperature for 10-30 minutes, so that the carboxy terminal has a cyanomethyl group. Natural amino acid substrates can be obtained.

(ii) Preparation of flexizyme Flexizyme is prepared by synthesizing necessary primers and by PCR. Primer synthesis can also be obtained by consigning to a synthesis company.
For example, eFx is prepared using the following four primers.

[SEQ ID NO: 11]
Fx-F primer: 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGC-3 '
[SEQ ID NO: 12]
eFx-R1 primer: 5'-ACCTAACGCTAATCCCCTTTCGGGGCCGCGGAAATCTTTCGATCC-3 '
[SEQ ID NO: 13]
eFx-R2 primer: 5'-ACCTAACGCTAATCCCCT-3 '
[SEQ ID NO: 14]
T7-F primer: 5'-GGCGTAATACGACTCACTATAG-3 '

First, a template DNA for dFx is prepared. In a PCR tube, add 0.25-0.75 μL of 200 μM Fx-F primer, 0.25-0.75 μL of 200 μM eFx-R1 primer and 100-150 μL of PCR reaction solution (200-300 mM MgCl ₂ , 2-3 mM dNTP mixture, DNA polymerase) Add and agitate and perform PCR using the following program. The PCR program consists of (a) 90-95 ° C (30 seconds-1 minute 30 seconds), (b) 48-55 ° C (10 seconds-1 minute), and (c) 68-75 ° C (30 seconds-1.5 minutes) Steps (b) to (c) are performed for 3 to 15 cycles.

  Next, after stirring the PCR product, 0.5-1.0 μL of 200 μM T7-F primer, 0.5-1.0 μL of 200 μM eFx-R2 primer, 300 μL of the PCR reaction solution and 1.5 μL of the PCR product, the following program was used. The template DNA for flexizyme eFx can be obtained by PCR. PCR program is (a) 90-95 ° C (30 seconds-1 minute 30 seconds), (b) 93-95 ° C (20-1 minutes), (c) 48-55 ° C (10 seconds-1 minute), And (d) 68 to 75 ° C. (30 seconds to 1.5 minutes), and steps (b) to (d) are performed for 5 to 15 cycles.

  A template DNA for dFx can also be prepared in the same manner as described above. In this case, a dFx-R1 primer having the following sequence is used instead of the eFx-R1 primer, and a dFx-R2 primer having the following sequence is used instead of the eFx-R2 primer.

[SEQ ID NO: 15]
dFx-R1 primer: 5'-ACCTAACGCCATGTACCCTTTCGGGGATGCGGAAATCTTTCGATCC-3 '
[SEQ ID NO: 16]
dFx-R2 primer: 5'-ACCTAACGCCATGTACCCT-3 '

Transcription of the template DNA for eFx or the template DNA for dFx prepared above can be performed according to a conventional method. First, 10-100 μL T7 buffer, 50-150 μL 100 mM DTT, 60-120 μL 250 mM MgCl ₂ , 100-200 μL 25 mM NTPs, 10-15 μL 2 M KOH, 25-75 μL 100 mM GMP, 75-125 μL flexi The template DNA for zyme eFx or the template DNA for dFx and 10 to 30 μL of T7 RNA polymerase are dissolved in 240 to 350 μL of RNasae free water to prepare a mixture for transcription. The mixture is then incubated at 37 ° C. for 3-6 hours, after which 10-30 μL of 100 mM MnCl ₂ and 3-5 μL of DNaseI are added and incubated at 37 ° C. for 20-40 minutes.

  Thereafter, 50 to 100 μL of 500 mM EDTA (pH 8), 75 to 125 μL of 3M NaCl and 0.5 to 1.5 mL of isopropanol are added and stirred well, and the mixture is allowed to stand at room temperature for 1 to 10 minutes. After standing, centrifuge at 15,000 xg for 5-15 minutes at room temperature. The supernatant can be completely removed, the lid opened, and dried at room temperature for 10 minutes to obtain flexizyme eFx or dFx.

(iii) Preparation of tRNA
A tRNA having an anticodon complementary to each stop codon of UAG, UAA, and UGA is prepared by PCR by synthesizing necessary primers for each. For example, when synthesizing a tRNA having an anticodon complementary to UAG, first, the following primers are synthesized. Primer synthesis can also be obtained by consigning to a synthesis company.

[SEQ ID NO: 17]
UAG-F primer: 5'-GTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGA-3 '
[SEQ ID NO: 18]
UAG-T7-F primer: 5'-GGCGTAATACGACTCACTATAG-3 '
[SEQ ID NO: 19]
R1 primer: 5'-GAACCAGTGACATACGGATTTAGAGTCCGCCGTTCTACCGACT-3 '
[SEQ ID NO: 20]
R2 primer: 5'-TGGCGGCTCTGACTGGACTCGAACCAGTGACATACGGA-3 '
[SEQ ID NO: 21]
R3 primer: 5'-TGGCGGCTCTGACTGGACTC-3 '

Next, in a PCR tube, 0.3-0.7 μL of 20 μM UAG-F primer, 0.3-0.7 μL of 20 μM R1 primer and 90-130 μL of PCR reaction solution (200-300 mM MgCl ₂ , 2-3 mM dNTP mixture, DNA polymerase) ) And agitate and perform PCR using the following program. The PCR program consists of (a) 93-95 ° C (30 seconds-1 minute 30 seconds), (b) 47-53 ° C (30 seconds-1 minute 30 seconds), and (c) 70-74 ° C (30 seconds- 1 minute and 30 seconds), and steps (b) to (c) are performed for 3 to 10 cycles.

  Next, add 0.3-0.7 μL of 200 μM UAG-T7-F primer, 0.3-0.7 μL of 200 μM R2 primer, 150-250 μL of PCR reaction solution and 5-15 μL of PCR product, and stir the following program. PCR is performed. PCR programs are (a) 93-95 ° C (30 seconds-1 minute 30 seconds), (b) 93-95 ° C (30 seconds-1 minute), (c) 47-53 ° C (30 seconds-1 minute 30) Seconds), and (d) 70 to 74 ° C. (30 seconds to 1 minute 30 seconds), and steps (b) to (d) are performed for 3 to 10 cycles.

Next, after adding 2.0 to 3.0 μL of 200 μM UAG-T7-F primer, 2.0 to 3.0 μL of 200 μM R3 primer, 800 to 1200 μL of PCR mixture A and 3 to 10 μL of PCR product, the following program was performed. PCR can be performed to obtain a template DNA for tRNA. The PCR program
(a) 93 to 95 ° C. (30 seconds to 1 minute 30 seconds), (b) 93 to 95 ° C. (30 seconds to 1 minute), (c) 47 to 53 ° C. (30 seconds to 1 minute 30 seconds), and (d) 70-74 ° C. (30 seconds to 1 minute 30 seconds), and steps (b) to (d) are performed for 5 to 15 cycles.

The template DNA for tRNA can be purified according to the manual using, for example, the FavorPrep PCR Clean-Up Mini Kit manufactured by Favorgen. The target tRNA is obtained by transcribing the obtained template DNA for tRNA.
The transfer can be performed as follows. First, 50-150 μL 10 × T7 buffer, 50-150 μL 100 mM DTT, 60-120 μL 250 mM MgCl ₂ , 100-200 μL 25 mM NTPs, 5-15 μL 2 M KOH, 25-75 μL 100 mM GMP, 50-150 μL tRNA A template mixture for transcription and 10-30 μL of T7 RNA polymerase are dissolved in 250-350 μL of RNasae free water to prepare a transcription mixture.

Next, the transcription mixture is incubated at 37 ° C. for 2-8 hours, 10-30 μL of 100 mM MnCl ₂ and 2-6 μL of DNase I are added, and incubated at 37 ° C. for 15-45 minutes.
Thereafter, 50 to 100 μL of 500 mM EDTA (pH 8), 75 to 125 μL of 3M NaCl and 1 mL of isopropanol are added and stirred well, and the mixture is allowed to stand at room temperature for 1 to 10 minutes. After standing, centrifuge at 15,000 xg for 3-10 minutes at room temperature, remove the supernatant completely, open the lid, dry at room temperature for 5-15 minutes, and anticodon complementary to UAG of stop codon Can be obtained.

  A tRNA having an anticodon complementary to the stop codon UAA can be similarly prepared using the following two primers and a desired primer.

[SEQ ID NO: 22]
UAA-F primer: 5'-GTAATACGACTCATTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGA-3 '
[SEQ ID NO: 23]
UAA-T7-F primer: 5'-GGCGTAATACGACTCATTATAG-3 '

  Similarly, a tRNA having an anticodon complementary to the stop codon UGA can be prepared using the following two primers and a desired primer.

[SEQ ID NO: 24]
UGA-F primer: 5'-GTAATACGACTCATGATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGA-3 '
[SEQ ID NO: 25]
UGA-T7-F primer: 5'-GGCGTAATACGACTCATGATAG-3 '

(iv) Aminoacylation tRNA is aminoacylated using the unnatural amino acid prepared above and the corresponding flexizyme. As the tRNA, a tRNA having an anticodon corresponding to the stop codon arranged in the mRNA on the mRNA-linker conjugate is selected.

First, 1-5 μL of 500 mM HEPES-KOH Buffer (pH 7.5), 1-5 μL of flexizyme eFx or dFx (50 pmol), 1-5 μL of tRNA (50 pmol) and 1-5 μL of ultrapure water are put into an Eppendorf tube. After heating at 95 ° C. for 1-5 minutes, the mixture is allowed to cool to room temperature to form a three-dimensional structure of tRNA. Then 1-5 μL of 0.6M MgCl ₂ is added and allowed to react for 1-10 minutes at room temperature. Next, N-Boc-4-azido-L-phenylalanine prepared by adjusting the substrate so as to react with 1 to 5 μL of 5 mM eFx or dFx is added and reacted on ice for 2 to 5 hours. Subsequently, 20 to 60 μL of 0.3 M sodium acetate (pH 5.2) and 75 to 125 μL of ethanol are added and centrifuged at 15,000 × g for 10 to 20 minutes at room temperature.

  After centrifugation, the supernatant is completely removed, and 25-75 μL of 70% ethanol containing 0.1 M sodium acetate (pH 5.2) is added, followed by centrifugation at 15,000 × g for 1-10 minutes at room temperature. Next, after completely removing the supernatant, 25-75 μL of 70% ethanol containing 0.1 M sodium acetate (pH 5.2) is added again and centrifuged at 15,000 × g for 1-10 minutes at room temperature. Subsequently, 25-75 μL of 70% ethanol is added, centrifuged at 15,000 xg for 1-10 minutes at room temperature, the supernatant is removed, and then dried at room temperature for 1-10 minutes to obtain aminoacylated tRNA. it can.

(IV) Preparation of cDNA display molecule The mRNA-linker conjugate obtained above is translated by a cell-free translation system excluding the termination factor, and the peptide binding site on the mRNA-linker conjugate is translated into a non-corresponding mRNA. Display peptide sequences containing natural amino acids. Translation is performed by preparing a reaction solution containing an mRNA-linker conjugate, a cell-free translation mixture excluding the termination factor, and an aminoacylated tRNA, and reacting at 37 ° C. for 20 to 40 minutes. For example, when PUREflex (registered trademark) is used in a mixed solution for cell-free translation, a reaction solution is prepared according to the product manual. Next, 5 to 15 μL of 3M KCl and 1 to 5 μL of 1M MgCl ₂ are added to the reaction solution, and the mixture is further reacted at 37 ° C. for 45 minutes to obtain a cDNA display molecule.

  After the translation reaction, the translation product peptide and the linker-mRNA conjugate are, for example, in the presence of about 0.3 to about 1.6 M potassium chloride and about 40 to about 170 mM magnesium chloride (the concentrations are both final concentrations). When the reaction is performed at about 27 to about 47 ° C. for about 30 minutes to about 1.5 hours, the peptide can be efficiently bound to the above conjugate.

(V) Solid phase immobilization The cDNA display molecule obtained above can be immobilized using a desired solid phase. Examples of the solid phase include beads such as styrene beads, glass beads, agarose beads, sepharose beads, and magnetic beads; substrates such as glass substrates, silicon (quartz) substrates, plastic substrates, and metal substrates (for example, gold foil substrates); Examples thereof include containers such as glass containers and plastic containers; membranes made of materials such as nitrosulrose and polyvinylidene fluoride.

  When the solid phase is composed of a plastic material such as styrene beads or a styrene substrate, a part of the linker may be directly covalently bonded to the solid phase using a known method, if necessary ( (See Qiagen, LiquidChip Applications Handbook, etc.) When biotin or an analog thereof is bound to the cDNA display molecule, the cDNA display can be easily bound to the solid phase by binding avidin to the solid phase.

  For example, when using Streptavidin (SA) Magnetic beads, which are magnetic beads, as the solid phase, 8 to 15 times the volume of the cDNA display concentration of the magnetic beads is used for a Protein LoBind tube (Eppendorf) of the desired size. Place on a magnetic stand and discard the supernatant. Here, the binding buffer is added and resuspended, and then left on a magnetic stand and the supernatant is discarded, whereby the magnetic beads can be washed and made RNase-free.

  The cDNA display molecule is then added and incubated at 20-30 ° C. for 75-135 minutes with rotator agitation to bind the magnetic beads to the cDNA display.

  In addition, after the immobilization, the cDNA display molecule can be reverse-transcribed to bind the cDNA corresponding to the mRNA to the cDNA display molecule. First, the tube containing the immobilized cDNA display molecule obtained above is allowed to stand on a magnetic stand and the supernatant is discarded. The operation of adding a desired amount, for example, 50 to 150 μL of binding buffer, resuspending the magnetic beads in this tube, and discarding the supernatant is repeated a desired number of times.

  Thereafter, cDNA is synthesized using a desired solution, and the cDNA is bound to the cDNA display molecule. For such cDNA synthesis, for example, commercially available products such as ReverTra Ace (manufactured by Toyobo Co., Ltd.) can be used. For example, a reaction solution for cDNA synthesis containing ReverTra Ace attached buffer, dNTP mixture, Rever Tra Ace (100 U / μL), and ultrapure water is used as a magnetic bead on which the washed mRNA-peptide conjugate is immobilized. In addition to the contained tube, the cDNA display fixed on the magnetic beads is referred to as “magnetic substance-bound cDNA display molecule” by incubating with a rotator at about 40 to 45 ° C. for about 60 to 120 minutes. Sometimes).

(VI) Purification The magnetic substance-bound cDNA display molecule is purified using, for example, His-tag protein purification beads. As such beads for purifying His-tag protein, His Mag Sepharose Ni (manufactured by GE healthcare) and the like can be used. First, the His-tag protein purification beads previously contain 1xHis-tag wash buffer (10-30 mM sodium phosphate (pH 7.4), 0.25-0.75 M NaCl, 10-30 mM imidazole, 0.025-0.1% Tween-20. ).

  Next, the recovered cDNA display molecule is added to the washed His-tag protein purification beads, incubated under desired conditions, and the beads are washed with the His-tag washing buffer. Elution buffer can be added and stirred under desired conditions to obtain purified cDNA display molecules. As the His-tag protein elution buffer, a composition containing 10-30 mM sodium phosphate (pH 7.4), 0.25-0.75 M NaCl, 100-500 mM imidazole, 0.025-0.1% Tween 20 can be used.

  Subsequently, to His Mag Sepharose Ni washed with 1 × His-tag washing buffer, about 1/5 of the collected magnetic substance-bound cDNA display molecules, for example, when the collected amount was 50 to 200 μL, Add ~ 40 μL and stir at 20-30 ° C for 0.5-2 hours using a cooled thermoblock rotator. Then, for example, it is washed 2 to 4 times using 50 to 200 μL of 1 × His-tag washing buffer, 5 to 20 μL of His-tag protein elution buffer is added, and a microtube mixer (MT-360, Tommy Seiko Co., Ltd.) And stirred at room temperature for 10-20 minutes. By the above operation, a purified magnetic substance-bound cDNA display molecule can be obtained.

(VII) Introduction of bulky functional group Using the Huesgen cycloaddition reaction, the azide group of the unnatural amino acid on the magnetic substance-bound cDNA display molecule is reacted with the bulky functional group to modify the peptide. Examples of bulky functional groups are shown in FIGS.

  The Husgen cycloaddition reaction is performed, for example, by adding a bulky functional group dissolved in a solvent such as methanol or DMSO to a tube containing magnetic substance-bound cDNA display molecules, and reacting at 4 ° C. to room temperature for 30 minutes to 24 hours, for example. By doing so, a magnetic substance-bound cDNA display molecule having a peptide containing an unnatural amino acid bound to a bulky functional group (hereinafter sometimes referred to as “functional group-magnetic substance-bound cDNA display molecule”) can be obtained.

(VIII) Cleavage from the solid phase A cDNA display molecule obtained by removing the magnetic beads from the functional group-magnetic substance-bound cDNA display molecule obtained above (hereinafter sometimes referred to as “functional group-bound cDNA display molecule”). ). First, it is washed with a desired buffer, and then a release agent is added and incubated to release the cleaved functional group-bound cDNA display molecule from the cleavage site in the linker. As such a washing buffer, for example, the above 1 × His-tag washing buffer can be used. The release agent includes a predetermined concentration of RNase, for example, 1 × His-tag washing buffer containing 500 to 1,500 U RNase T1, and 5 to 15 U endonuclease V (manufactured by New England Laboratories). A 1 × NE buffer can be used.

  For example, after washing the functional group-magnetic substance-bound cDNA display molecule once with 1 × NE buffer, add 40 μL of 1 × NE buffer containing 10 U endonuclease, and incubate at 37 ° C. for 60 minutes. Display molecules can be obtained.

(Example 1) Preparation of mRNA-linker conjugate (1) Preparation of DNA library DNA complementary to mRNA having anticodon AUC corresponding to UAG of stop codon was converted to B domain (SEQ ID NO: 5) of A protein. And adjusted as follows.

[SEQ ID NO: 5]
5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGATAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCCTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAAGCACCAAAAGCTGACAACAAATTCAACGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA-3 '

  First, a DNA fragment having the following sequence (hereinafter referred to as BDA-UAG fragment) was synthesized by commissioning Eurofin Genomics.

[SEQ ID NO: 6]
5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGCTAATGATGATGGCT-3 '

  Next, PCR reaction solution 1 shown in Table 1 below was prepared, and PCR was performed using the following program. The PCR program was (a) 95 ° C (30 seconds), (b) 95 ° C (10 seconds), (c) 63 ° C (5 seconds), and (d) 72 ° C (10 seconds), step (b) ˜ (d) was performed 30 cycles.

  The resulting PCR product was purified using the FavorPrep PCR Clean-Up Mini Kit manufactured by Favorgen according to the attached manual. Thereafter, a PCR reaction solution 2 shown in Table 2 below was prepared, and PCR was performed using the following program. The PCR program was (a) 95 ° C (30 seconds), (b) 95 ° C (10 seconds), (c) 69 ° C (5 seconds), and (d) 72 ° C (10 seconds), step (b) ˜ (d) was performed 25 cycles.

The obtained PCR product was purified using the FavorPrep PCR Clean-Up Mini Kit manufactured by Favorgen according to the attached manual.
(2) Transcription of DNA library Transcription of the DNA library obtained above was carried out in accordance with the protocol attached to the Promega kit (RiboMAX (registered trademark) Large Scale RNA Production Systems-T7). went. After incubation at 37 ° C. for 2 hours using an aluminum block thermostat (Anatech, Cool Stat 5200), 2 μL of DNase (RQ1 DNase) included in the kit was added, and further incubated at 37 ° C. for 15 minutes. The synthesized mRNA was purified using the After Tri-Reagent RNA Clean-Up Kit manufactured by Favorgen.

(3) Preparation of linker Puromycin linker (see Fig. 5) was prepared by the method described in the following literature.
Mochizuki Y, Biyani M, Tsuji-Ueno S, Suzuki M, Nishigaki K, Husimi Y, and Nemoto N. (2011) One-pot preparation of mRNA / cDNA display by a novel and versatile puromycin-linker DNA.ACS Comb. Sci ., 13, 478-485

First, “Puromycin Segment (PS)”, which is a modified oligonucleotide used to make a short biotin-segment Puromycin (SBP) -linker, and “Short Biotin-segment Puromycin (SBP) -linker” SBS) "was obtained from Gene World. This PS has the following structure.
5 '-(S) -TC (F)-((Spc18) x 4) -CC- (Puro) -3'

  Here, (S) represents 5′-thiol modifier C6, and (F) represents fluorescein-dT. (Puro) represents puromycin CPG, and (Spc18) represents spacer phosphoramidite 18. The SBS has the following structure.

[SEQ ID NO: 28]
5'-CCRCYCRACCCCGCCGCCCCCCGMCCT-3 '

Here, M represents the amino modifier C6 dT, and Y represents biotin-dT.
R represents riboG. EMCS was purchased from Dojindo Laboratories (Kumamoto, Japan). The B domain of protein A was obtained from pEZZ 18 protein A gene fusion vector (GE Healthcare). The forward primer included the T7 promoter, the “omega” 5′-untranslated region of tobacco mosaic virus, the Kozak sequence, and the ATG start codon. The reverse primer is a hexahistidine tag, a spacer sequence (GGGGGAGGCAGC: SEQ ID NO: 29), and a complementary sequence (AGGACGGGGGGCGGGGAAA: SEQ ID NO: 3) that can be ligated between mRNA and puromycin linker DNA at the 3 ′ end of puromycin linker DNA. 30). In the case of Oct-1 Pou-specific DNA binding domain of Oct-1 (PDO), the template was generated by replacing the B domain with PDO.

(4) Ligation of mRNA and linker To 5 μL of 5.9 μM mRNA obtained by transcription, 2 μL of 10 μM SBP puromycin linker, 2 μL of 10 × T4 RNA ligase buffer (Takara Bio Inc.), 1.2 μL of 0.1% BSA and A ligation solution was prepared by adding 8.3 μL of Nuclease-free water (Promega). After incubating at 90 ° C for 2 minutes, it was incubated at 70 ° C for 1 minute, and the temperature was lowered to 25 ° C at a speed of 0.02 ° C / second. Subsequently, 0.5 μL of T4 polynucleotide kinase (manufactured by Takara Bio Inc.) and 1 μL of T4 RNA ligase (manufactured by Takara Bio Inc.) were added and incubated at 25 ° C. for 1 hour to obtain an mRNA-linker conjugate. .

(Example 2) Aminoacylation of tRNA by flexizyme (1) Preparation of tRNA having anticodon AUC complementary to stop codon UAG The following five sequences of primers were synthesized by commissioning Eurofin Genomics Co., Ltd. .

[SEQ ID NO: 17]
UAG-F primer: 5'-GTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGA-3 '
[SEQ ID NO: 19]
R1 primer: 5'-GAACCAGTGACATACGGATTTAGAGTCCGCCGTTCTACCGACT-3 '
[SEQ ID NO: 20]
R2 primer: 5'- TGGCGGCTCTGACTGGACTCGAACCAGTGACATACGGA -3 '
[SEQ ID NO: 21]
R3 primer: 5'-TGGCGGCTCTGACTGGACTC-3 '
[SEQ ID NO: 18]
UAG-T7-F primer: 5'-GGCGTAATACGACTCACTATAG-3 '

  Place 2 μL of 20 μM F primer, 0.5 μL of 20 μM R1 primer, and 10 μL of PCR mixture A in Table 3 below into two 200 μL PCR tubes, stir, and perform PCR using the following program. It was. The PCR program was (a) 95 ° C. (30 seconds), (b) 60 ° C. (5 seconds), and (c) 72 ° C. (10 seconds), and steps (b) to (c) were performed for 5 cycles. Thereafter, the two tubes were combined into a single extension product.

  Next, in each 200 μL PCR tube, add 0.3 μL of 200 μM T7-F primer, 0.3 μL of 200 μM R2 primer, 95 μL of PCR mixture A in Table 3 and 5 μL of the extension product, and stir. PCR was performed using. The PCR program was (a) 95 ° C (30 seconds), (b) 95 ° C (10 seconds), (c) 60 ° C (5 seconds), and (d) 72 ° C (10 seconds), step (b) ˜ (d) was performed 5 cycles. Thereafter, the two tubes were combined into one PCR product.

0.75 μL of 200 μM T7-F primer, 0.75 μL of 200 μM R3 primer, 300 μL of PCR mixture A in Table 3 and 1.5 μL of PCR product were stirred and then dispensed into three 200 μL PCR tubes. PCR was performed using the program to obtain template DNA for tRNA. The PCR program was (a) 95 ° C (30 seconds), (b) 95 ° C (10 seconds), (c) 60 ° C (5 seconds), and (d) 72 ° C (10 seconds), step (b) ˜ (d) was performed 22 cycles.
The template DNA for tRNA was purified by ethanol precipitation according to the manual using the FavorPrep PCR Clean-Up Mini Kit manufactured by Favorgen.

Transcription of the obtained template DNA for tRNA was performed as follows. First, 100 μL 10 × T7 buffer, 100 mM 100 mM DTT, 90 μL 250 mM MgCl ₂ , 150 μL 25 mM NTPs, 11.25 μL 2 M KOH, 50 μL 100 mM GMP, 100 μL tRNA template DNA and 20 μL T7 RNA polymerase in 303 μL RNasae A mixture I for transfer was prepared by dissolving in free water.
Subsequently, the prepared mixture I for transcription was incubated at 37 ° C. for 5 hours, 20 μL of 100 mM MnCl ₂ and 4 μL of DNase I were added, and the mixture was incubated at 37 ° C. for 30 minutes.

  The transcription mixture I was applied to 12% PAGE and electrophoresed, and then the tRNA band was excised from the gel. Thereafter, 75 μL of 500 mM EDTA (pH 8), 100 μL of 3M NaCl and 1 mL of isopropanol were added and stirred well, and the mixture was allowed to stand at room temperature for 5 minutes. After standing, it was centrifuged at 15,000 xg for 5 minutes at room temperature. When the supernatant was completely removed, the lid was opened and the tRNA was dried at room temperature for 10 minutes. The obtained tRNA pellet was stored at −20 ° C.

(2) Preparation of flexizyme eFx Primers having the following three sequences were synthesized by commissioning Eurofin Genomics.
[SEQ ID NO: 11]
Fx-F primer: 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGC-3 '
[SEQ ID NO: 12]
eFx-R1 primer: 5'-ACCTAACGCTAATCCCCTTTCGGGGCCGCGGAAATCTTTCGATCC-3 '
[SEQ ID NO: 13]
eFx-R2 primer: 5'-ACCTAACGCTAATCCCCT-3 '

  In a 200 μL PCR tube, add 0.5 μL of 200 μM Fx-F primer, 0.5 μL of 200 μM eFx-R1 primer, and 100 μL of PCR mixture B shown in Table 4 below, stir, and perform PCR using the following program. went. The PCR program was (a) 95 ° C. (30 seconds), (b) 60 ° C. (5 seconds), and (c) 72 ° C. (10 seconds), and steps (b) to (c) were performed for 5 cycles.

Add 0.75 μL of 200 μM T7-F primer, 0.75 μL of 200 μM eFx-R2 primer, 300 μL of PCR mixture B in Table 4 and 1.5 μL of PCR product, and then dispense two 200 μL PCR tubes. PCR was performed using the following program to obtain a template DNA for flexizyme eFx. The PCR program was (a) 95 ° C (30 seconds), (b) 95 ° C (10 seconds), (c) 50 ° C (5 seconds), and (d) 72 ° C (10 seconds), step (b) ˜ (d) was performed 12 cycles.
The template DNA for flexizyme eFx was purified by ethanol precipitation according to the manual using the FavorPrep PCR Clean-Up Mini Kit manufactured by Favorgen.

Transcription of the obtained template DNA for flexizyme eFx was performed as follows. First, 303 μL of 100 μL 10 × T7 buffer, 100 mM 100 mM DTT, 90 μL 250 mM MgCl ₂ , 150 μL 25 mM NTPs, 11.25 μL 2 M KOH, 50 μL 100 mM GMP, 100 μL flexizyme eFx template DNA and 20 μL T7 RNA polymerase Was dissolved in RNasae free water to prepare a mixture 2 for transcription.
Next, the prepared transcription mixture 2 was incubated at 37 ° C. for 5 hours, 20 μL of 100 mM MnCl ₂ and 4 μL of DNase I were added, and the mixture was incubated at 37 ° C. for 30 minutes.

  The transcription mixture I was applied to 12% PAGE and electrophoresed, and then the tRNA band was excised from the gel. Thereafter, 75 μL of 500 mM EDTA (pH 8), 100 μL of 3M NaCl and 1 mL of isopropanol were added and stirred well, and the mixture was allowed to stand at room temperature for 5 minutes. After standing, it was centrifuged at 15,000 xg for 5 minutes at room temperature. When the supernatant was completely removed, the lid was opened and flexizyme eFx was dried at room temperature for 10 minutes. The resulting flexizyme eFx pellet was stored at −20 ° C.

(3) Preparation of amino acid substrate In an Eppendorf tube, 9.4 g of Boc-4-azido-Phe-OH (manufactured by SIGMA-ALDRICH), 1.8 mg of cyanomethyl ester, 7 μL of triethylamine, and 5 μL of dimethylformamide were added. Stir at room temperature for 5 hours. This reaction solution was purified by HPLC according to a conventional method, freeze-dried, 100 μL of 4M hydrochloric acid / ethyl acetate was added, and the mixture was incubated at room temperature for 20 minutes to prepare an amino acid substrate for flexizyme eFx.

(4) Aminoacylation of tRNA First, 1 μL of 500 mM HEPES-KOH Buffer (pH 7.5), 1 μL of flexizyme eFx (50 pmol), 1 μL of tRNA (50 pmol) and 3 μL of ultrapure water were placed in an Eppendorf tube at 95 ° C. Then, the mixture was allowed to cool to room temperature to form a three-dimensional structure of tRNA. Next, 2 μL of 0.6M MgCl ₂ was added and allowed to react for 5 minutes at room temperature. Furthermore, after reacting on ice for 3 minutes, 2 μL of 5 mM flexizyme eFx amino acid was added and reacted on ice for 3 hours. Subsequently, 40 μL of 0.3 M sodium acetate (pH 5.2) and 100 μL ethanol were added, and the mixture was centrifuged at 15,000 × g for 15 minutes at room temperature.

  After completely removing the supernatant, 50 μL of 70% ethanol containing 0.1 M sodium acetate (pH 5.2) was added, and the mixture was centrifuged at 15,000 × g for 5 minutes at room temperature. After completely removing the supernatant, 50 μL of 70% ethanol containing 0.1 M sodium acetate (pH 5.2) was added again, followed by centrifugation at 15,000 × g for 5 minutes at room temperature. Further, 50 μL of 70% ethanol was added, and the mixture was centrifuged at 15,000 × g for 3 minutes at room temperature. After removing the supernatant, it was dried at room temperature for 5 minutes to obtain aminoacylated tRNA.

(5) Confirmation of acylation by electrophoresis To the aminoacylated tRNA obtained above, add 3.5 μL of 7.5 mg / mL sulfosuccinimidyl-D-biotin (in 0.4 M HEPES-K (pH 8.0)) solution. The mixture was reacted on ice for 1 hour to selectively biotinylate the aminoacylated tRNA. Subsequently, ethanol precipitation was performed according to a conventional method, and then the RNA pellet was dissolved using 10 mM sodium acetate (pH 5.2).

  In an Eppendorf tube, dissolve 0.5 μL of the biotinylated tRNA obtained above in 1.5 μL of 0.2 mg / mL streptavidin solution (37 mM piperazine (pH 6.1), 37 mM EDTA and 6 M urea). Electrophoresis was performed by PAGE (200 V, application time 1.5 hours). RNA staining was performed with Syber Green II (Molecular Probe), and a band indicating tRNA acylated with an unnatural amino acid was confirmed (see FIG. 6).

(Example 3) Peptide modification with unnatural amino acid (1) Translation The mRNA-linker conjugate prepared in Example 1 was translated as follows using a cell-free translation system containing no termination factor. Reaction solutions having the compositions shown in Table 5 below were prepared and reacted at 37 ° C. for 25 minutes. To this reaction solution, 10 μL of 3M KCl and 3 μL of 1M MgCl ₂ were added. Thereafter, this solution was further reacted at 37 ° C. for 45 minutes to obtain a cDNA display molecule.

(2) Immobilization Streptavidin (SA) magnetic particles (Dynabeads MyOne Streptavidin C1: manufactured by Invitrogen) were washed according to the instructions, and an amount necessary for immobilizing the cDNA display molecule was placed in an Eppendorf tube, and the magnetic stand Let stand on top for 1 minute. The supernatant was then removed and resuspended in solution A (100 mM NaOH, 50 mM NaCl). After tapping for 1-2 minutes, the sample was left on a magnetic stand for 1 minute. Thereafter, the same operation was performed once again with the solution A, and the same operation was performed once with the solution B (100 mM NaCl).

  7.6 μL of 0.5 M EDTA was added to the cDNA display and incubated at room temperature for 5 minutes. Then add 30 μL of the above streptavidin magnetic particles, 15.2 μL of 4x binding buffer (containing 20 mM Tris-HCl (pH 7.5), 2M NaCl, 2 mM EDTA, 0.2% Tween-20) and 1x binding buffer. The mixture was stirred at room temperature for 45 minutes to obtain a solid-bound magnetic substance-bound cDNA display molecule.

(3) Reverse transcription reaction The above magnetic substance-bound cDNA display molecule is mixed with the reaction solution for reverse transcription shown in Table 6 below, and incubated at 42 ° C for 30 minutes with stirring using a rotator. Was prepared.

(4) Fluorescence modification by Husgen cycloaddition reaction without using a copper catalyst To the magnetic substance-bound cDNA display molecule obtained in (3) above, the reaction solution 1 for fluorescence modification shown in Table 7 is added, and the reaction is performed at room temperature. Reacted overnight.

  To the tube containing the modified functional group-magnetic substance-bound cDNA display molecule obtained as described above, add the Rnase solution shown in Table 8 below, and incubate at 37 ° C. for 15 minutes. And a functional group-bound cDNA display molecule was obtained, and mRNA on the functional group-bound cDNA display molecule was degraded. The obtained functional group-bound cDNA display molecule was subjected to a sample for electrophoresis.

(5) Biotin modification by Husgen cycloaddition reaction when copper catalyst is not used The biotin modification reaction solution shown in Table 9 is added to the magnetic substance-bound cDNA display obtained in (3) above, and the reaction is carried out overnight at room temperature. I let you.

Add the Rnase solution shown in Table 8 above to the tube containing the modified functional group-magnetic substance-bound cDNA display molecule obtained as described above, and incubate at 37 ° C. for 15 minutes. And a functional group-bound cDNA display molecule was obtained, and mRNA on the functional group-bound cDNA display molecule was degraded.
Then, add 1μL of 4M NaCl and 1.5μL of 0.2mg / mL streptavidin solution (37mM piperazine (pH6.1), 37mM EDTA and 6M urea) to bind biotin and streptavidin, resulting in functional group binding The cDNA display molecule was subjected to electrophoresis samples.

(6) Fluorescence modification by Husgen cycloaddition reaction when using a copper catalyst To the magnetic substance-bound cDNA display molecule obtained in (3) above, the reaction solution 2 for fluorescence modification shown in Table 10 is added, and the reaction is performed at room temperature. Reacted overnight.

  Add the Rnase solution shown in Table 8 above to the tube containing the modified functional group-magnetic substance-bound cDNA display molecule obtained as described above, and incubate at 37 ° C. for 15 minutes. And a functional group-bound cDNA display molecule was obtained, and mRNA on the functional group-bound cDNA display molecule was degraded. The obtained functional group-bound cDNA display molecule was subjected to a sample for electrophoresis.

(7) Success or failure of chemical modification with or without copper catalyst The functional group-bound cDNA display molecule prepared in (4) above was subjected to fluorescein and SYBR by SDS-PAGE of 4% stacking gel-6% separation gel according to a conventional method. Confirmed by staining with Gold. Fluorescein staining was performed to confirm the Husgen cycloaddition reaction product, and SYBR Gold staining was performed to confirm the mRNA-linker conjugate and the cDNA display molecule. Here, for example, if the fluorescein-stained electrophoresis band and the SYBR Gold-stained electrophoresis cDNA display band are in the same position, the Husgen cycloaddition reaction occurs on the side chain of the unnatural amino acid on the cDNA display. It means that the modification by is done.

  As a result of electrophoresis, in the reaction system not using a copper catalyst, a band of a cDNA display molecule that appeared due to the Huesgen cycloaddition reaction was confirmed when fluorescein staining and SYBR Gold staining were performed (see FIG. 7). On the other hand, when no amino acid containing an azide group was present, the band of the cDNA display molecule could not be confirmed when stained with fluorescein.

  From this, the N-Boc-4-azido-L-phenylalanine, an unnatural amino acid having an azide group, is expressed on the peptide sequence of the cDNA display, so that Heusgen cyclization is performed on the unnatural amino acid on the cDNA. It was confirmed that chemical modification by addition reaction was performed.

Similarly, whether or not chemical modification was performed on the functional group-bound cDNA display molecule prepared in (6) above was confirmed by staining with fluorescein and SYBR Gold by SDS-PAGE.
As a result, in the reaction system using the copper catalyst, both bands of the cDNA display and the ligation product showing the cDNA display before the modification reaction could not be confirmed in both fluorescein staining and SYBR Gold staining (see FIG. 8). ). This was presumed that the band disappeared because the cDNA on the cDNA display was degraded by the presence of copper (I).

(8) Examination of efficiency of chemical modification The efficiency of modification by the Husgen cycloaddition reaction when a copper catalyst was not used was examined.
The streptavidin-biotin-binding cDNA display, HEPES-Buffer and DMSO obtained in (5) above were prepared so as to have the respective compounding amounts shown in the table of FIG. 1 μL of this preparation was mixed with 1 μL of loading buffer (50 mM sodium acetate, 8M urea), and a gel shift assay using 6M urea-denaturing gel (50 mM sodium acetate) was performed. Staining was performed with ethidium bromide (SYBR Gold), and the modification efficiency was calculated by comparing the intensity of the bands.

  As a result of the gel shift assay, the modification efficiency increased from 11% to 40% as the amount of DMSO increased from 0 μL to 9 μL. Compared with HEPES Buffer, it was confirmed that the chemical modification efficiency increases as the blending amount of DMSO increases (see Fig. 9).

The present invention is useful in the pharmaceutical field, particularly in the field of diagnostic agents.

SEQ ID NO: 1: tRNA preparation primer SEQ ID NO: 2: tRNA preparation primer SEQ ID NO: 3: tRNA preparation primer SEQ ID NO: 4: tRNA preparation primer SEQ ID NO: 5: nucleotide sequence encoding B domain of A protein SEQ ID NO: 6 Base sequence complementary to mRNA having stop codon SEQ ID NO: 7: Base sequence complementary to mRNA having stop codon SEQ ID NO: 8: Base sequence complementary to mRNA having stop codon SEQ ID NO: 9: photocrosslinkable linker Base sequence of the main chain SEQ ID NO: 10: Base sequence of the side chain of the photocrosslinking linker SEQ ID NO: 11: Primer for preparing flexizyme SEQ ID NO: 12: Primer for preparing flexizyme SEQ ID NO: 13: Primer sequence for preparing flexizyme SEQ ID NO: 14: Primer for preparing flexizyme SEQ ID NO: 15: Primer for preparing flexizyme SEQ ID NO: 16: Flexizyme Production primer SEQ ID NO: 17: tRNA preparation primer SEQ ID NO: 18: tRNA preparation primer SEQ ID NO: 19: tRNA preparation primer SEQ ID NO: 20: tRNA preparation primer SEQ ID NO: 21: tRNA preparation primer SEQ ID NO: 22: tRNA preparation Primer SEQ ID NO: 23: tRNA preparation primer SEQ ID NO: 24: tRNA preparation primer SEQ ID NO: 25: tRNA preparation primer SEQ ID NO: 26: PCR forward primer SEQ ID NO: 27: PCR reverse primer SEQ ID NO: 28: Biotin-segment Puro Base sequence of mycin linker SEQ ID NO: 29: Spacer sequence SEQ ID NO: 30: SBP linker sequence

Claims (8)

(1) a linker binding step of binding mRNA having a predetermined sequence to a linker to obtain an mRNA-linker conjugate;
(2) a termination factor removing step of removing the termination factor from the cell-free translation system;
(3) an aminoacylation step of preparing an aminoacylated tRNA by binding an unnatural amino acid and tRNA;
(4) The mRNA-linker conjugate is translated in a cell-free translation system containing the aminoacylated tRNA and the termination factor is removed, and the peptide containing the unnatural amino acid is displayed on the mRNA-linker conjugate. A cDNA display molecule production step;
(5) an immobilization step of binding the cDNA display molecule to a solid phase;
(6) a purification step for purifying the cDNA display molecule immobilized in the solid phase step;
(7) A peptide containing the unnatural amino acid by introducing a bulky functional group into the peptide bound to the cDNA display molecule obtained in the purification step using a Husgen cycloaddition reaction without using a metal complex. A modification step of modifying
(8) a cleavage step of cleaving the modified cDNA display molecule from the solid phase;
A method for post-translational modification of a peptide, comprising:   The method for post-translational modification of a peptide according to claim 1, wherein the tRNA has an anticodon that recognizes a termination codon or an anticodon for an extended codon of 4 to 6 bases.   The method for post-translational modification of a peptide according to claim 1 or 2, wherein the aminoacylation step uses an unnatural amino acid aminoacylating enzyme.   The non-natural amino acid aminoacylating enzyme is tyrosyl tRNA synthetase, pyrrolyl tRNA synthetase, tryptophanyl tRNA synthetase, phenylalanyl tRNA synthetase, leucyl tRNA synthetase, lysyl tRNA synthetase, glutamyl tRNA synthetase and variants thereof. And the post-translational modification method for peptides according to any one of claims 1 to 3, wherein the peptide is any one selected from the group consisting of flexizyme.   The method for post-translational modification of a peptide according to any one of claims 1 to 4, wherein the metal complex is Cu (I). The method for post-translational modification of a peptide according to any one of claims 1 to 5, wherein the bulky functional group is contained in the compound represented by the general formula I.

Where
-X is a cyclic containing a carbon chain or a side chain composed of a carbon chain containing at least an oxygen atom, and biotin, a fluorescent dye, a fluorescent protein, a low-molecular compound serving as a drug candidate, and a complex metal bonded to the terminal. The bulky functional group comprising any molecule selected from the group consisting of compounds.   The method for post-translational modification of a peptide according to any one of claims 1 to 6, wherein the unnatural amino acid has an azide in the side chain. The method for post-translational modification of a peptide according to any one of claims 1 to 7, wherein the unnatural amino acid is any one selected from the group consisting of compounds represented by chemical formulas II to V.

Images