JP2005013073A - Method for screening transport polypeptide - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for efficiently screening a polypeptide having an activity to transport a biologically active substance such as a polypeptide or a nucleic acid to a cell or a nucleus. <P>SOLUTION: A molecule used for screening the transport polypeptide is characterized by comprising a protein portion containing a candidate protein comprising 2 to 100 amino acid residues, and a nucleic acid portion containing a base sequence for encoding the candidate polypeptide and a target substance transported from the polypeptide to a target cell or a base sequence encoding the target substance, wherein the C-terminal of the protein portion is directly covalently bound to the 3'-terminal of the nucleic acid portion. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

【図面の簡単な説明】
【図１】図１は、本発明で使用可能なＩＶＶの構築方法を示す。
【図２】図２は、本発明の方法に従い作製したＩＶＶの構築結果を示す。
【図３】図３は、本発明の方法に従いＩＶＶ分子の細胞内移行を確認した結果を示す。
【図４】図４は、本発明の方法に従い細胞内移行したＩＶＶ分子をＰＣＲを用いてその回収を確認した結果を示す。
【図５】図５は、本発明の方法に従い細胞液中のＶｉｒｉｏｎをＰＣＲによって増幅する最適な条件を検討した結果を示す。
【図６】図６は、本発明の方法に従いＴＰ及びＴＴＰ Ｖｉｒｉｏｎ混合 ＰｏｏｌからＴＴＰ Ｖｉｒｉｏｎを選択した結果を示す。
【図７】図７は、本発明の方法に従い細胞に非特異的に付着したＩＶＶ分子を洗浄する方法を検討した結果を示す。
【図８】図８は、本発明の方法の概略を示す。[0001]
BACKGROUND OF THE INVENTION
The present invention relates to a method for screening a polypeptide involved in transport of a biologically active substance such as a polypeptide or nucleic acid into a cell or nucleus, and a molecule and a nucleic acid used in the method.
[0002]
[Prior art]
Proteins and nucleic acids used for the purpose of treatment and diagnosis cannot reach the target cells because they are macromolecules, and those that mainly act on the outside or on the surface are used. I came. Moreover, even low molecular weight compounds could not pass through the brain blood barrier, for example, and could not be delivered into brain cells. In general, as a method of introducing a biologically active substance into a cell, a method of introducing them into cells mainly in a test tube, such as microinjection or electroporation, or a biological or There has been proposed a method of binding to or encapsulating a synthetic vector and administering it to cells. However, when these methods are applied in a living body, there are problems in terms of cytotoxicity and transport efficiency.
[0003]
In contrast, it has become clear that there are polypeptides that transport proteins, nucleic acids, etc. into cells or nuclei in vivo, and transport of biologically active substances to cells using various polypeptides to cells. A method has been developed. Specifically, for example, a method using a specific partial polypeptide of HIV-1 tat protein (this may be referred to as “TAT polypeptide” or “Protein Transduction Domain (PTD) polypeptide”) (for example, Patent Document 1). Have been proposed).
[0004]
However, in the above method, since a naturally occurring polypeptide is used, its cell specificity and transport efficiency are limited. Polypeptides having higher transport activity and cell specificity in transport activity The development of polypeptides has been desired.
[0005]
On the other hand, as a screening method for intracellular or nuclear transport polypeptides, a method of directly introducing a fluorescently labeled polypeptide into a cell, a method of introducing a protein containing a polypeptide into a cell using a fluorescent protein as a support , A method of introducing a protein containing a polypeptide using a protein that catalyzes luminescence or color development as a support, a method of introducing a protein containing a polypeptide into a cell using a protein detected by an antibody as a support, etc. Has been developed. As a detection system, a flow cytometry method or a microscope observation method is used.
[0006]
However, with these methods, it is difficult to analyze many types of candidate polypeptides. In addition, since fluorescent substances, peptides, nucleic acids, polysaccharides, low molecular compounds and the like are introduced into cells, it is difficult to add these substances to transport peptides.
[0007]
As a conventional technique, a method for searching for a transport peptide using Page Display Library has been reported (for example, see Patent Document 2). However, since the page display uses the page for expression of the peptide, the sequence to be expressed may be biased, and the diversity size of the library is also limited. Furthermore, since the Page is very large, there is a question as to whether the cell or nuclear transport polypeptide functions efficiently, and there has been a problem as a method for searching the cell or nuclear transport polypeptide from the library.
[0008]
The in vitro virus method (see, for example, Patent Document 3) is a molecule in which a nucleic acid and a protein encoded by the nucleic acid are associated on a one-to-one basis (hereinafter referred to as “in vitro viral molecule”, “IVV molecule”, or “Virion”). Is used to detect the interaction between various molecules. Since this molecule is obtained by protein expression using a cell-free expression system, the sequence to be expressed can be expressed without considering cytotoxicity, etc., and there is no limit to the number of molecules that can be handled at a time, and at least 10¹²Can be handled at once. Therefore, even when used as a library, 10¹²It can be prepared as a peptide library having a large diversity size as described above.
[0009]
However, in order to use an IVV molecule for screening of a cell or nuclear transport polypeptide, the IVV molecule can be introduced into the cell with a target substance transported by the cell or the nuclear transport polypeptide, A method for screening a transport polypeptide into a cell or nucleus, such as whether a cell into which an IVV molecule has been introduced can be detected, and whether its nucleic acid moiety can be amplified using PCR from an IVV molecule introduced into the cell. Therefore, there was a problem such as having to make it suitable.
[0010]
[Patent Document 1]
Japanese Patent Laid-Open No. 10-33186
[Patent Document 2]
WO01 / 15511
[Patent Document 3]
WO98 / 16636 publication
[0011]
[Problems to be solved by the invention]
An object of the present invention is to provide a method for efficiently screening a polypeptide having an activity of transporting a biologically active substance such as a polypeptide or nucleic acid into a cell or nucleus. Specifically, a protein part containing a polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the same, a target substance transported to the target cell by the polypeptide, or a nucleic acid having the base sequence encoding the target substance And a method for conducting the screening using the same, wherein the C-terminus of the protein portion and the 3 ′ end of the nucleic acid portion are directly covalently bonded to each other. To do.
[0012]
[Means for Solving the Problems]
As a result of intensive studies to solve the above problems, the present inventors have found that a nucleic acid comprising a C-terminal of a fusion protein of a TAT polypeptide and a protein transported by the polypeptide and a base sequence encoding the fusion protein A molecule that is directly covalently bonded to the 3 ′ end of the portion and labeled with a fluorescent substance is prepared and co-cultured with a target cell. The labeled substance is detected in the cell. That is, it was found that the labeling substance was transferred into the cells. Furthermore, when this cell was isolated and the nucleic acid contained in the nucleic acid part of the molecule introduced into the cell was amplified by polymerase chain reaction (PCR), it was confirmed that the nucleotide sequence encoded the fusion protein. . The present invention has been accomplished based on these findings.
[0013]
That is, according to the present invention, a protein part containing a candidate polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the candidate polypeptide, and a target substance transported into a target cell by the polypeptide or A nucleic acid part containing a nucleotide sequence encoding the nucleic acid part, and the C-terminal of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded, Are provided.
[0014]
Preferably, a protein part containing a fusion protein of a candidate polypeptide consisting of 2 to 100 amino acid residues and a target protein transported into the target cell by the polypeptide, a base sequence encoding the candidate polypeptide, and the target And a nucleic acid part containing a base sequence encoding the protein, wherein the C-terminal of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded.
[0015]
Preferably, a non-protein target substance comprising a protein part containing a candidate polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the candidate polypeptide, and transported into the target cell by the polypeptide A molecule as described above is provided, wherein the C-terminal of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded.
[0016]
Preferably, the nucleic acid part is obtained by binding a nucleic acid derivative to the 3 'end of a nucleic acid having a base sequence encoding a candidate polypeptide and a base sequence encoding a target protein via a spacer.
Preferably, the nucleic acid part is a nucleic acid derivative bound to the 3 ′ end of a nucleic acid having a base sequence encoding a candidate polypeptide via a spacer, and further a non-protein target substance is bound to the spacer. Is.
[0017]
Preferably, the molecule further includes a labeling substance.
Preferably, the labeling substance is bound to a spacer.
Preferably, the labeling substance is bound to a nucleotide residue constituting a complementary strand of a nucleic acid having a nucleotide sequence contained in the nucleic acid part and / or a base sequence encoding the target protein.
[0018]
Preferably, the protein part includes a fusion protein of a candidate polypeptide consisting of 2 to 100 amino acid residues and a support protein that allows the candidate polypeptide to be expressed in a cell-free translation system.
Preferably, the molecule or group of molecules is provided, wherein the candidate polypeptide consists of a random amino acid sequence.
[0019]
Furthermore, according to the present invention, there are provided a base sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues, and a target substance transported into the target cell by the polypeptide or a nucleic acid having a base sequence encoding it. A nucleic acid characterized by having a nucleic acid derivative bound to a terminal via a spacer is provided.
[0020]
Preferably, a spacer is provided at the 3 ′ end of the nucleic acid containing a base sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues and a base sequence encoding a target protein transported into the target cell by the polypeptide. There is provided the above-mentioned nucleic acid, wherein a nucleic acid derivative is bound thereto.
Preferably, a nucleic acid derivative is bound to the 3 ′ end of a nucleic acid containing a base sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues via a spacer, and further to the spacer by the polypeptide. The nucleic acid is characterized in that it binds a target substance to be transported into a target cell.
[0021]
Preferably, the spacer includes a labeling substance.
Preferably, the candidate polypeptide consists of a random amino acid sequence.
[0022]
Furthermore, according to the present invention, there is provided a method for producing the molecule of the present invention or the group of molecules described above, which comprises transcribing / translating any of the nucleic acids or the group of nucleic acids in a protein synthesis system. The
[0023]
Furthermore, according to the present invention, there is provided a screening method for a transport polypeptide comprising:
(1) contacting the target cell with the group of molecules according to claim 10;
(2) amplifying the nucleic acid contained in the nucleic acid portion of the molecule introduced into the target cell or the nucleus of the target cell; and
(3) analyzing the base sequence of the amplified nucleic acid and identifying the polypeptide encoded by the base sequence as a transport polypeptide;
Is provided.
[0024]
Preferably, between the above steps (1) and (2), further includes (a) a step of removing the molecule that has not been introduced into the cell or nucleus from the surface of the target cell.
Preferably, the step (2) includes a process of selectively extracting the molecule from the target cell and selectively amplifying the nucleic acid contained in the nucleic acid part of the molecule.
Preferably, the treatment for selectively extracting the molecule from the target cell and selectively amplifying the nucleic acid contained in the nucleic acid part of the molecule is (2a) crushed target cells of 6000 to 10,000 × G (2b), and the nucleic acid portion of the molecule in the supernatant is converted into a single strand of DNA.
Preferably, after the step (2b), the nucleic acid contained in the supernatant is heat-denatured.
[0025]
According to the present invention, the nucleic acid or group of nucleic acids of the present invention is further produced using the polypeptide selected by the above-described transport polypeptide screening method as a candidate polypeptide, and the nucleic acid or group of nucleic acids is converted into a protein synthesis system. There is provided a screening method for a transport polypeptide, characterized in that the above screening method is carried out using a molecule or a group of molecules obtained by transcription / translation in the above, or by repeating these methods.
[0026]
DETAILED DESCRIPTION OF THE INVENTION
The present invention is described in further detail below.
(1) In vitro viral molecules containing candidate polypeptides
The present invention screens for a polypeptide having a function of transporting a target substance such as a polypeptide or nucleic acid into a cell or nucleus (sometimes referred to herein as a “transport polypeptide”). The present invention relates to a method, and a molecule for use in the screening method. A polypeptide used as a candidate for a transport polypeptide in the screening method of the present invention (which may be referred to as “candidate polypeptide” in the present specification) consists of 2 to 100 amino acid residues, and encodes this. Any DNA can be used as long as it can be produced by transcription and translation in a protein synthesis system. Specifically, the use of a random amino acid sequence of about 2 to 40 amino acids is preferable for performing an efficient screening method. When using a library containing a random amino acid sequence of about 2 to 40 amino acids, the amino acid sequence obtained as a transport polypeptide is likely to be used as a transport polypeptide as it is. It is useful as a library for
[0027]
In addition, as a DNA encoding a candidate polypeptide, a library containing a random amino acid sequence consisting of 41 or more amino acid residues, or a cDNA based on a sequence obtained from nature, although not strictly a random amino acid sequence Libraries can also be used. When such a library is used, the sequence that functions as a transport polypeptide is likely to be a partial sequence of the amino acid sequence obtained by the screening method of the present invention. Since it is desirable that the transport polypeptide has as few amino acid residues as possible, it is preferable to select a partial fragment having a function as a transport polypeptide from the obtained amino acid sequence. Examples of the selection method include a method in which a polypeptide comprising a partial sequence of the obtained amino acid sequence is prepared by a known method and screened using the effect of introduction into a cell as an indicator by the method described later. Furthermore, when many kinds of candidate polypeptides are obtained by the screening, the above-described screening method can be repeated to obtain an optimal transport peptide. Moreover, what introduce | transduced the variation | mutation into the known transport polypeptide can also be used.
[0028]
The IVV molecule containing the candidate polypeptide includes a protein part containing the polypeptide, a base sequence encoding the polypeptide, and, if necessary, a target substance transported into the target cell by the polypeptide or the same A molecule characterized by comprising a nucleic acid part having a base sequence to be linked, wherein the C-terminal of the protein part and the 3′-end of the nucleic acid part are directly covalently bonded.
[0029]
Specific examples of IVV molecules containing candidate polypeptides include:
(I) a protein part containing a fusion protein of a candidate polypeptide consisting of 2 to 100 amino acid residues and a target protein transported into the target cell by the polypeptide, a base sequence encoding the candidate polypeptide, and the target A molecule comprising a nucleic acid part comprising a base sequence encoding a protein, wherein the C-terminus of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded; and
(Ii) a non-proteinaceous target substance comprising a protein part containing a candidate polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the candidate polypeptide, and transported into the target cell by the polypeptide And a molecule in which the C-terminus of the protein portion and the 3 ′ end of the nucleic acid portion are directly covalently bonded. When the candidate polypeptide is a short chain, the nucleic acid part includes a base sequence encoding the candidate polypeptide and a base sequence encoding the support protein described below, and the protein part is a candidate polypeptide. And a support protein.
[0030]
In the case of (i) above, the nucleic acid part has a base sequence encoding the target protein. In this case, the candidate peptide and the target protein are contained as a fusion protein in the protein part.
[0031]
The target substance used in the present invention (that is, target protein or non-protein target substance) is not particularly limited as long as it can be used as a molecule for performing the screening method of the present invention. However, since the candidate polypeptide is a short chain, it is difficult to express it in a protein synthesis system, particularly a cell-free protein synthesis system, so that it is possible to express a relatively short polypeptide in a protein synthesis system. It is preferable to use body protein or the like as the target substance. Any of the above may be the N-terminal side or the C-terminal side of the fusion protein of the target protein, which is the target protein, and the candidate polypeptide.
[0032]
In general, the support protein preferably satisfies the following conditions. (1) globular protein that is easy to fold, (2) stable, (3) does not contain disulfide (SS) bond, etc. Examples of the protein satisfying these conditions include Oct-1 pou-specific domain (73 amino acid residues) (Dekker, N. et al. (1993) Nature 362, 852-854). Since this protein contains only one Cys residue, a mutant (SEQ ID NO: 3) in which this Cys residue is substituted with an Ala residue is particularly preferably used. Even if such a protein contains Cys in the peptide to be presented, it does not change the structure by S—S bonding with this support protein. In addition, since the Pou-specificdomain of this Oct-1 is separated from the N-terminal side and the C-terminal side, when a random peptide is presented on the N-terminal side, the spacer part on the C-terminal side (in the case of the in vitro virus method) ). This protein consists of four α-helices and is thought to be easy to fold. In addition, since short peptides are difficult to express in a cell-free translation system, it is necessary to make a fusion protein with such a support.
[0033]
The support protein used in the present invention is characterized by comprising a globular protein consisting of 30 to 200 amino acid residues. Preferably, it does not contain a cysteine residue, does not have a β-sheet structure, is composed of an α-helix structure, and the N-terminal and C-terminal are separated from each other in the three-dimensional structure, and does not interact with other biopolymers It is preferably a protein.
[0034]
Non-protein target substances are generally high-molecular substances such as biologically active nucleic acids and sugars, low-molecular substances such as pharmaceutically active ingredients, and nano beads such as quantum beads, photosensitizers and atoms. Molecule and the like. Examples of the position to which such a target substance is added include a spacer portion described later.
[0035]
The IVV molecule preferably also contains a labeling substance so that it can be easily detected when it is introduced into a cell or nucleus. Any labeling substance can be used as long as it can detect that IVV molecules have been introduced into cells or nuclei. Specifically, for example, fluorescent materials such as FITC, Cy3, and Cy5, and enzymes used for color assays such as horseradish peroxidase and β-galactosidase are preferably used. Although the labeling substance may be added to any position of the IVV molecule, it is preferably introduced by binding to a nucleotide residue constituting a complementary portion of a nucleic acid part contained in a spacer part or a nucleic acid part described later. Alternatively, a fluorescent protein (such as GFP) can be added to the protein portion of the IVV molecule as a fusion protein with a candidate polypeptide. The enzyme used in the color assay can also be added to the protein part of the IVV molecule as a fusion protein with a candidate polypeptide or the like.
[0036]
In addition, the IVV molecule may include a substance having a property of specifically binding to a certain substance for the purpose of purifying the IVV molecule. Specific examples include tag peptides such as FLAG, GST, and HIS × 6, and affinity substances such as biotin. The tag peptide and affinity substance may be located anywhere in the protein part of the IVV molecule, but the tag peptide is preferably added to the C-terminal or N-terminal of the protein part of the IVV molecule. It is preferable to add to the spacer part mentioned later.
[0037]
(2) Method for synthesizing in vitro viral molecules
(I) Template DNA
The IVV molecule is an RNA (hereinafter referred to as “template RNA”) characterized in that a nucleic acid derivative is bound to the 3 ′ end of RNA containing a base sequence encoding a candidate polypeptide via a spacer. Can be synthesized by translating in a protein synthesis system (FIG. 1). Here, the RNA can be prepared by transferring a template DNA (“template DNA” in FIG. 1) by a commonly used method known per se and then binding to a spacer or a nucleic acid derivative. The template DNA has a base sequence encoding the protein part of the IVV molecule containing the candidate polypeptide, and (1) a sequence necessary for the DNA to undergo transcription and translation on the 5 ′ end side, (2) A sequence or the like for binding the spacer can be included.
[0038]
When using a candidate polypeptide having a random amino acid sequence, a nucleic acid having a base sequence encoding the candidate polypeptide can be synthesized by a known method using, for example, a DNA synthesizer. Specifically, the first and second codons encoding amino acids were synthesized with a resin in which each dNTP was mixed at a ratio of 25%, and the third codon was mixed with dGTP and dCTP at a ratio of 50%. A method of synthesizing with a resin (NNS method: Reidhaar-Olson, JF, et al. (1991) Methods Enzymol. 208: 564-586), or mixing the third codon at a ratio of 50% of dGTP and dTTP. (NNK method: Scott, JK and Smith, GP (1990), Science, 249, 386-390) and the like.
[0039]
Examples of sequences necessary for transcription and translation of DNA include promoters, enhancers, base sequences recognized by ribosomes during translation, start codons, and the like. The type of the promoter is not particularly limited as long as it is appropriately selected from those suitable for the expression system to be applied. Examples thereof include an SP6 promoter sequence recognized by RNA polymerase of E. coli virus SP6, a promoter sequence recognized by RNA polymerase of E. coli viruses T7 and T3, and the like.
[0040]
DNA sequences recognized by ribosomes during translation include DNA sequences corresponding to RNA sequences (Kozak sequences) recognized by eukaryotic ribosomes during translation and Shine Dalgarno recognized by prokaryotic ribosomes. Examples thereof include a sequence (Shine-Dalgarno), a sequence recognized by the ribosome of tabacco mosaic virus such as an omega sequence, a ribosome recognition region of rabbitbit β-globulin, Xenopus β-globulin, or bromo mosaic virus.
[0041]
The sequence for binding a spacer is a sequence for binding a spacer, which will be described later, after the template DNA is transcribed, and specifically refers to a base sequence complementary to a part of the spacer.
[0042]
The template DNA having such a base sequence may be prepared from natural DNA, may be prepared by a gene recombination technique, or may be prepared by chemical synthesis. When it is necessary to bind a plurality of DNA fragments, it can be performed by a commonly used known method. Further, it is not necessary that all of the constituent nucleic acids are deoxyribonucleotides, only a part of them may be DNA type, and the other region may be ribonucleotide or PNA type. In addition, a peptide, sugar or the like may be bound.
[0043]
The template DNA is transcribed by a known method, and the obtained RNA (hereinafter sometimes referred to as “single-stranded RNA”) is purified using an appropriate method such as ethanol precipitation, and then described later. It is preferably used for binding to a spacer, a nucleic acid derivative and the like.
[0044]
(Ii) Template RNA
The nucleic acid derivative that binds to the single-stranded RNA obtained in (i) above has the ability to bind to the C-terminus of the synthesized protein when translated in a protein synthesis system using the nucleic acid construct of the present invention. If it is a compound which has, there will be no restriction | limiting in particular. When protein synthesis is performed using such a nucleic acid construct, an IVV molecule in which a nucleic acid containing the single-stranded RNA is bound to the C-terminus of the synthesized protein is synthesized. Specifically, a nucleic acid derivative having a chemical structure skeleton similar to aminoacyl-tRNA at the 3 'end can be selected. As a representative compound, puromycin having an amide bond (Puromycin), 3′-N-aminoacylpuromycin aminonucleoside (3′-N-Aminoacylpurinomycin amino acid, PANS-amino acid), for example, PANS-Gly having an amino acid part of glycine PANS-Val whose amino acid part is valine, PANS-Ala whose amino acid part is alanine, and other PANS-amino acid compounds whose amino acid part corresponds to all amino acids.
[0045]
Also, 3'-N-aminoacyl adenosine aminonucleoside (3'-Aminoacylenosine aminonucleotide, AANS-amino acid) linked by an amide bond formed by dehydration condensation of the amino group of 3'-aminoadenosine and the carboxyl group of amino acid, for example AANS-Gly whose amino acid portion is glycine, AANS-Val whose amino acid portion is valine, AANS-Ala whose amino acid portion is alanine, and other AANS-amino acid compounds whose amino acid portions correspond to each amino acid of all amino acids can be used.
[0046]
Further, nucleosides or those obtained by ester bonding of nucleosides and amino acids can also be used. Furthermore, nucleic acid or a compound having a chemical structure skeleton and base similar to nucleic acid and a compound chemically bonded to a substance having a chemical structure skeleton similar to amino acid are all included in the nucleic acid derivatives used in this method. .
[0047]
The nucleic acid derivative is more preferably a compound in which puromycin, PANS-amino acid or AANS-amino acid is bound to a nucleoside via a phosphate group. Of these compounds, puromycin derivatives such as puromycin, ribocytidylpuromycin, deoxycytidylpuromycin, and deoxyuridylpuromycin are particularly preferred.
[0048]
As the spacer to be bound to the single-stranded RNA of the present invention, those described in WO 98/16636 can be used. Specifically, polymer substances such as polyethylene or polyethylene glycol or derivatives thereof, oligonucleotides, Biopolymer substances such as peptides or derivatives thereof are used. Of these, polyethylene glycol is preferably used. The length of the spacer is not particularly limited, but preferably the molecular weight is 150 to 6000, or the number of atoms in the main chain is 10 to 400 atoms, more preferably the molecular weight is 600 to 3000, The number of atoms in the chain is 40 to 200 atoms. The spacer is cleaved by the fluorescent substance such as FITC and the derivative thereof described in (1) above, the affinity substance such as biotin and the derivative thereof, the nucleic acid such as deoxyribonucleotide and the derivative thereof, or biochemistry or chemical reaction. A substance having a bond, for example, a photodegradable substance such as a 5-substituted-2-nitroacetophenone derivative can be included.
[0049]
The method described in WO 98/16636 can be used as a method for binding single-stranded RNA to the spacer and nucleic acid derivative. However, according to the following method, the binding efficiency can be further increased.
[0050]
As a preferable method for producing a template RNA, (1) a single-stranded RNA having a sequence complementary to each other (the sequence for binding a spacer in (i) above) and a single-stranded DNA or a derivative thereof are used. And (2) treating the annealing product with RNA ligase and linking the 3 ′ end of single-stranded RNA and the 5 ′ end of single-stranded DNA or a derivative thereof.
[0051]
Here, the single-stranded DNA or a derivative thereof means a single-stranded DNA in which a nucleic acid derivative is bound to the 3 'end via a spacer. The same nucleic acid derivative as described above can be used for the single-stranded DNA. As a derivative of single-stranded DNA, a single-stranded DNA sequence complementary to the sequence on the 3 ′ end side of single-stranded RNA is included, and at the 3 ′ end of the DNA sequence, for reverse transcription of the single-stranded RNA And a primer having a nucleic acid derivative at the end and having a branched spacer bonded to any one of the single-stranded DNA sequences can be used. Since such a nucleic acid construct has a T-shaped structure, it is also referred to as T-Spacer in this specification.
[0052]
As used herein, “primer sequence for reverse transcription of single-stranded RNA” is a translation of the template RNA of the present invention obtained by ligation of a nucleic acid construct (T-Spacer) and single-stranded RNA. Later, when a synthetic product is introduced into a reverse transcription reaction system, it means a base sequence that acts as a primer sequence for initiating the reverse transcription reaction, and is generally a sequence complementary to the sequence of single-stranded RNA It is preferable that it is comprised.
[0053]
Furthermore, as the single-stranded DNA to which the affinity substance (1) is bound, the single-stranded DNA sequence that can be annealed with the 3′-end sequence of the single-stranded RNA is placed on the 3′-end side. A spacer having a primer sequence for reverse transcription of the single-stranded RNA at the 3 ′ end of the single-stranded DNA sequence, and a spacer having a nucleic acid derivative at the end is branched into any of the single-stranded DNAs And those having an affinity substance bound to the 5 ′ end of the single-stranded DNA sequence. Affinity substances are used to purify IVV molecules and to bind to solid phases.
[0054]
When single-stranded DNA to which an affinity substance is added is used, a restriction enzyme recognition site is preferably present on the 5 'end side of the position to which the affinity substance is added. The restriction enzyme recognition site is usually composed of a double strand of DNA. By introducing such a restriction enzyme recognition site, the IVV molecule can be separated from the affinity substance. For example, when an IVV molecule is bound to a solid phase via an affinity substance, the IVV molecule can be separated from the solid phase (support). That is, IVV molecules strongly bound to the support by binding of affinity substances (for example, biotin-streptavidin, etc.) can be cleaved and purified by a restriction enzyme under a mild condition of 37 ° C. The sequence of the restriction enzyme recognition site is not particularly limited, and any restriction enzyme recognition sequence such as PvuII can be used.
[0055]
On the other hand, when using affinity substances that show strong affinity under optimal conditions, such as poly dA sequence and poly dT sequence, but do not show affinity under such conditions, When affinity substances whose affinity is competitively inhibited by substances having stronger affinity are used, it is preferable because they can be purified without breaking all covalent bonds.
[0056]
Such single-stranded DNA or a derivative thereof can be produced by a chemical bonding method known per se. Specifically, when the synthesis unit is bound by a phosphodiester bond, the synthesis unit can be synthesized by solid phase synthesis by a phosphoramidide method or the like generally used in DNA synthesizers. When a peptide bond is introduced, a synthesis unit is bound by an active ester method or the like, but when a complex with DNA is synthesized, a protecting group capable of supporting both synthesis methods is required.
[0057]
In this method, it is necessary that the single-stranded RNA and the single-stranded DNA (or a derivative thereof) to be bound have sequences complementary to each other. It is possible to efficiently ligate both by associating them by annealing single-stranded RNA and single-stranded DNA having sequences complementary to each other under suitable conditions, and then treating with RNA ligase. it can.
[0058]
As a method for binding such single-stranded RNA and single-stranded DNA, 5 ′ of DNA having a sequence complementary to the 3 ′ end of the single-stranded RNA and the sequence in the RNA by the Y-ligation method. Examples thereof include a method of covalently bonding the ends with RNA ligase. The single-stranded RNA used in the method of the present invention preferably has an annealing sequence and a branch sequence in the 5 'to 3' direction on the 3 'end side.
[0059]
The branch sequence referred to in the present specification is a sequence that is present in a single-stranded state without annealing each other when annealing sequences in single-stranded RNA and single-stranded DNA or derivatives thereof are annealed. The length of the branch sequence in single-stranded RNA and single-stranded DNA or a derivative thereof is not particularly limited as long as both can be linked by RNA ligase treatment. Generally, the shorter the length of the branch arrangement, the higher the coupling efficiency, but the upper limit is not particularly limited. The length of the branch sequence is preferably about 1 to 100 bases, more preferably about 1 to 10 bases. The lengths of the branch sequences in both nucleic acids may be the same or different.
[0060]
The annealing sequence referred to in this specification is a sequence that can be annealed to the DNA to be bound, and a sequence complementary to the annealing sequence in single-stranded RNA is present in the single-stranded DNA to be bound. It will be. The length of the annealing sequence is not particularly limited as long as it is long enough to allow both strands to hybridize, but is generally about 10 to 50 bases, more preferably about 10 to 30 bases.
[0061]
Since the single-stranded RNA and the single-stranded DNA or derivative thereof bound by this method have complementary sequences to each other, both can be annealed under certain conditions. More specifically, the annealing sequence in the single-stranded RNA and the sequence complementary to the annealing sequence in the single-stranded DNA or derivative thereof are hybridized to form a double strand. At that time, since the branch sequence in the single-stranded RNA and the branch sequence in the single-stranded DNA or derivative thereof exist as single strands, these portions form a Y-shape as a whole. . The name Y-ligation method derives from the form of this structure. This method is characterized in that the coupling efficiency can be improved by changing the reaction for linking two kinds of nucleic acids from an intermolecular reaction to an intramolecular reaction. Therefore, it can be applied to a low concentration substrate.
[0062]
In the method of the present invention, first, single-stranded RNA having the above-mentioned complementary sequences and single-stranded DNA or a derivative thereof (hereinafter, these may be collectively referred to as “single-stranded nucleic acid”) are annealed. Let
[0063]
Annealing is performed by dissolving the above-mentioned two types of single-stranded nucleic acids in a suitable buffer (for convenience of the following procedure, a buffer for RNA ligase is preferable) and gradually lowering the temperature from high to low. be able to. Such temperature change can also be performed using a PCR device or the like. An example of the annealing condition is a condition of cooling from 94 ° C. to 25 ° C. over 10 minutes, but this is only an example, and the temperature and time can be appropriately changed. The annealing conditions (buffer composition, annealing temperature, annealing time, etc.) can be appropriately set according to the length of the annealing sequence, the base composition, and the like.
[0064]
The molar ratio of single-stranded RNA and single-stranded DNA or derivative thereof in the annealing reaction is not particularly limited as long as the annealing reaction proceeds, but from the viewpoint of reaction efficiency, it is about 1: 1 to 1: 2.5. It is preferable.
After annealing single-stranded RNA and single-stranded DNA or a derivative thereof, the annealing product is treated with RNA ligase to link the 3 ′ end of single-stranded RNA with the 5 ′ end of single-stranded DNA or derivative thereof. Is done.
[0065]
The RNA ligase used in the present invention may be any RNA ligase that can link two single-stranded nucleic acids. Preferably, T4 RNA ligase can be used.
In addition, when an appropriate solution for the RNA ligase is used as the solution for annealing, the solution containing the annealing product can be used as it is for the ligase reaction, otherwise, the annealing product is used. Is recovered by an ordinary nucleic acid purification method and then dissolved in an RNA ligase buffer to prepare a solution for ligase reaction.
[0066]
The conditions for the ligation reaction (ligase reaction) may be any conditions as long as the activity of the RNA ligase used is exhibited. For example, a suitable buffer (for example, T4 RNA ligase buffer (50 mM Tris-HCl, pH 7.5, 10 mM) MgCl₂, 10 mM DTT, 1 mM ATP), etc.) or a reaction at a constant temperature of 25 ° C., or a cycle of 25 ° C. for 30 minutes and 45 ° C. for 2 minutes followed by a reaction at 25 ° C. for 30 minutes. Can do. The temperature and reaction time shown here are merely examples, and can be appropriately changed so as to increase the reaction efficiency.
[0067]
After the reaction, template RNA can be obtained by purifying the reaction product by conventional methods such as phenol extraction and ethanol precipitation. Here, when polyethylene glycol or the like is included in the spacer, phenol extraction cannot be used. Therefore, a purification method in which ethanol precipitation is performed after purification using a silica-gel column such as RNeasy kit (manufactured by QIAGEN) is used. It is preferable to use it. The template RNA itself thus obtained is also within the scope of the present invention.
[0068]
(Iii) Translation of template RNA
An IVV molecule can be prepared by introducing the template RNA described in (ii) above into a protein translation system and translating the single-stranded RNA into a protein.
Transcriptional translation systems for artificially generating the protein that it encodes from nucleic acids are known to those skilled in the art. Specifically, a cell-free protein synthesis system in which a component having protein synthesis ability is extracted from an appropriate cell, and the target protein is synthesized using the extract. Such a cell-free protein synthesis system includes elements necessary for a transcription / translation system such as a ribosome, an initiation factor, an elongation factor and tRNA.
[0069]
Such cell-free protein synthesis systems (systems derived from cell lysates) include cell-free translation systems composed of prokaryotic or eukaryotic extracts, such as Escherichia coli, rabbit reticulocyte extract, wheat germ. An extract or the like can be used, but any may be used as long as it produces the target protein from DNA or RNA. Cell-free translation systems that are commercially available as kits can be used, such as rabbit reticulocyte extract (Rabbit Reticulocyte Lysate Systems, Nuclease Treated, Promega) or wheat germ extract (PRETEIOS, TOYOBO). Manufactured by Wheat Germ Extract, manufactured by Promega).
[0070]
As the protein translation system, live cells may be used. Specifically, prokaryotic or eukaryotic organisms such as E. coli cells may be used.
The cell-free translation system or living cells are not limited as long as protein synthesis is performed by adding or introducing a nucleic acid encoding a protein therein.
In the present invention, a template RNA is introduced into a translation system as described above, a single-stranded RNA is translated into a protein, and then a ribosome is removed to produce an IVV molecule comprising RNA and the protein encoded by the RNA. can do.
[0071]
(3) Transport peptide screening method using in vitro viral molecules
(I) Reverse transcription reaction
The IVV molecule obtained in the above (2) can maintain the stability of the nucleic acid part by reverse-transcription of this RNA part to make a hybrid with DNA. Moreover, since it is obtained as an IVV molecule in which the nucleic acid part and the protein part are all covalently bonded, it is preferably used as a molecule for searching for a transport peptide. Reagents and reaction conditions necessary for the reverse transcription reaction are well known to those skilled in the art, and can be appropriately selected as necessary. The primer used for reverse transcription is preferably performed using the “primer sequence for reverse transcription of single-stranded RNA” described in (2) (ii) above.
In this reverse transcription reaction, by using dNTP to which a labeling substance such as a fluorescent substance is added as a substrate, the labeling substance is introduced into the obtained complementary strand, and the IVV molecule can be labeled.
[0072]
(Ii) Step of contacting the target cell with the IVV molecule group
As a screening method for the transport polypeptide of the present invention, the IVV molecule or group of IVV molecules prepared in the above (2) is brought into contact with the target cell, the IVV molecule is introduced into the cell or nucleus, and introduced into the cell. A method for analyzing IVV molecules can be mentioned.
[0073]
Here, the target cell may be any cell as long as it is for introducing the target substance. Specific examples include prokaryotic cells, yeast cells, eukaryotic cells, plant cells, human or mammalian cells. Furthermore, embryonic cells, established cultured cells, human lung, trachea, skin, muscle, brain, liver, heart, spleen, bone marrow, thymus, bladder, lymph, blood, pancreas, stomach, kidney, ovary, testis, rectum, peripheral Alternatively, cells obtained from organs such as the central nervous system, eye, cartilage, or endothelium, cultured cells thereof, and cancer cells can be used. Examples of such cells include Chinese hamster fibroblasts (CHO cells: Proc. Natl. Acad. Sci. USA, 77, 4216 (1980), African green monkey kidney-derived cells (COS7: ATCC: CRL1651), human uterus. Cervical cancer-derived cells (HeLa cells: Cancer, Res., 12, 264-265 (1952)), human leukemia T lymphoma cells (Jurkat cells: ATCC: TIB-152)) and the like. Of these, human cervical cancer-derived cells and human leukemia T lymphoma cells are preferably used. Moreover, what made said cell into a special state etc. can be used. Special states include, for example, a state in which a foreign gene has been introduced, a state in which a foreign gene has been expressed, a state in which cells have been stimulated with drugs, or cells that have been cultured and differentiated under appropriate conditions. State.
[0074]
A method for bringing the target cell into contact with the IVV molecule prepared in the above (2) is not particularly limited, but a method of culturing the target cell by an appropriate method in the presence of the IVV molecule is preferably used. The culture method, the amount of IVV molecule added, the culture temperature, the culture time, and the like can be appropriately selected depending on the target cells, IVV molecules, and the like. Specifically, when CHO cells are used as target cells, 10⁵The cells are cultured in a HamF12 + 10% fetal bovine serum medium or the like so that they become individual, the cells are washed with PBS or the like, and then PBS or the like containing 1 to 100 nM of IVV molecules is added, and preferably placed at ice-cooled to 37 ° C. And a method of culturing for 1 to several hours.
[0075]
(Iii) Step of amplifying nucleic acid part of cell or nuclear IVV molecule into which IVV molecule has been introduced, and step of identifying transport polypeptide
After contacting the IVV molecule with the target cell, the nucleic acid portion of the IVV molecule in the cell or nucleus into which the IVV molecule has been introduced is amplified. Cells into which IVV molecules have been introduced may be detected and separated, or may be used in the nucleic acid portion amplification step described below even if cells that have not been introduced are mixed. In any case, it is desirable to confirm that there are cells into which IVV has been introduced in the culture system. In addition, since a state where a large number of IVV molecules are attached to the cell surface is also conceivable, it is preferable to confirm the state of the cells and the IVV molecules.
[0076]
The detection method of the IVV molecule may be any method as long as it is clear that the IVV molecule is present outside the cell, cell or nucleus. Specifically, the method for detecting the labeling substance (1) above is preferably used. When a fluorescent substance or a fluorescent protein is used as the labeling substance, flow cytometry or a fluorescence microscope can be used as the detection means. In addition, when an enzyme for performing a color assay is used, it can be detected by a color assay to which a necessary substrate or the like is added. Furthermore, as will be described later, PCR can be performed using DNA extracted from cells as a template to detect that the nucleic acid portion of the IVV molecule can be amplified as an indicator.
[0077]
In any method, it is preferable to perform the detection after washing IVV molecules that are not introduced into cells or nuclei but are attached to the cell surface. The washing method can be appropriately selected from known methods for washing cells. Specifically, for example, treatment with a nuclease such as acid or DNaseI is preferably used. In addition, when performing detection by flow cytometry, it is preferable that the adherent cells after culture be treated with trypsin.
[0078]
As a method for confirming that an IVV molecule is introduced into a cell or nucleus, an IVV molecule attached to the cell surface is distinguished from an IVV molecule introduced into the cell or nucleus, and the IVV molecule is introduced into the cell or nucleus. Any method can be used as long as the cell into which the molecule is introduced can be confirmed. For example, when flow cytometry is used as a detection means, a similar contact process is performed with an IVV molecule containing a candidate polypeptide and an IVV molecule not containing the candidate polypeptide, and contacted with an IVV molecule containing the candidate polypeptide. When the fluorescence intensity of the obtained cell is stronger than the fluorescence intensity of the cell brought into contact with the IVV molecule not contained, a method of determining that the IVV molecule is introduced into the cell is used. Moreover, in the case of the detection method using a fluorescence microscope, the method etc. which observe the fluorescence emitted from the fluorescent substance which is a labeling substance in a cell or a nucleus are mentioned.
[0079]
Furthermore, as a method for separating cells in which IVV molecules have been introduced into cells or nuclei, a method in which cells with fluorescence detected by flow cytometry are separated with a cell sorter, or cells with fluorescence detected by a fluorescence microscope are laser-treated. For example, a method of separating using capture.
[0080]
With respect to a cell into which the IVV molecule thus obtained has been introduced, the nucleic acid part of the IVV molecule present in the cell or nucleus is amplified by polymerase chain reaction (PCR), and the nucleotide sequence thereof is analyzed, whereby the cell or nucleus It is possible to identify a polypeptide having a function of transporting a target substance. As a method for amplifying the nucleic acid part of an IVV molecule present in a cell or nucleus by polymerase chain reaction (PCR), all the nucleic acid components in the cell are extracted by a known method, and they are used as templates as the above ( Examples include a method in which PCR is performed using a primer comprising two base sequences capable of amplifying a base sequence encoding a candidate polypeptide in the single-stranded RNA described in 2). Here, extraction of the nucleic acid component in a cell can be performed using commercially available kits, such as Lyse-N-Go PCR Regent (made by PIERCE), for example. In addition, the extracted nucleic acid component is centrifuged at 5,000 to 15,000 rpm for 10 to 30 minutes, and then RNA is degraded using an RNA-degrading enzyme such as RNase H. Furthermore, the supernatant is ethanol precipitated. It is preferable to carry out PCR after purification, for example, because specific amplification of PCR occurs.
[0081]
Furthermore, it is also preferable to perform PCR after heat-treating the template obtained above at 90 to 100 ° C. for about 10 minutes, and if necessary, ice-cooling.
[0082]
When the above transport polypeptide is identified, it is not clear whether IVV having the amplified nucleic acid part was introduced into the cell or nucleus, or attached to the cell surface. Therefore, the DNA fragment amplified by PCR is separated and purified by a method known per se, and IVV is prepared again using the DNA fragment as a template DNA by the method described in (2) above. By carrying out the above, the transport polypeptide can be concentrated. Specifically, the candidate polypeptide encoded by the DNA fragment whose DNA amount increased in the second cycle by comparing the DNA fragment amplified by the PCR in the first cycle and the DNA fragment amplified in the second cycle PCR Is identified as having the function of transporting the target substance. In addition, by observing fluorescence in the cell or nucleus by the flow cytometry or microscope described above, comparing the first cycle with the second cycle, and confirming the enhancement of the fluorescence of IVV transported into the cell or nucleus, The selected transport polypeptide may be identified as having a function of transporting the target substance.
[0083]
A DNA fragment amplified by PCR containing a transport polypeptide is cloned according to a known method, and a base sequence encoding the transport polypeptide contained therein is identified by sequence analysis.
[0084]
(4) Analysis and utilization of selected transport polypeptides
The transport polypeptide thus selected and identified can be transported to the target cell by preparing a complex in which the transport polypeptide is bound to one or more target substances and bringing the complex into contact with the target cell.
The following examples further illustrate the present invention, but the present invention is not limited to the examples.
[0085]
【Example】
Example 1  Spacer production
The following modified DNA was synthesized using a DNA synthesizer as a spacer material.
DNA1: (thiol) (Spc) (Spc) (Spc) (Spc) CC (ZFP)
DNA2: (Pso) TACGCCAGCTGCACCCCCCGCCCCCCCCCCG (At) CCGC
DNA3: CCCGG (Ft) GCAGCTGGCGGTATAAAAAAAAAAAAAAAAAAAAAAA
[0086]
(Thiol), (Spc), (Bt), (Ft), (At), and (Pso) in the above sequences are abbreviations of units, and all were introduced into the sequences using a synthesis reagent manufactured by Glen Research. . The abbreviations of these units, the names of the synthesis (introduction) reagents and their chemical names are as follows.
[0087]
(Thiol)
5'-Thiol-modifier C6
(S-Trityl-6-mercaptohexyl)-(2-cyanoeyl)-(N, N-diisopropyl)]-phosphoramidite
[0088]
(Spc)
Spacer Phosphoramidite18
18-O-Dimethyltrihexylethylenecol, 1-[(2-cyanethyl)-(N, N-diisopropyl)]-phosphoramidite
[0089]
(Ft)
Fluorescein-dT
5′-Dimethyloxylty-5- [N-((3 ′, 6′-dipivaloylfluoresceinyl) -aminohexyl) -3-acrylimido] -2′-deoxyUridine, 3 ′-[(2-cyanoethyyl-di, ro, p, )]-Phosphoramitite
[0090]
(At)
Amino-modifier C6 dT
5'-Dimethyltrityl-5-[[N- (trifluoroacelaminohexyl) -3-acrylimido] -2'-deoxyUridine, 3 '-[(2-cyanethylyl)-(N, N-diisopropytyl)]-phenyl
[0091]
(Pso)
Psoralen C6 Phosphoramidite
2- [4 '-(hydroxymethyl) -4,5', 8-trimethylpsoralen] -hexyl-1-O- (2-cyanethyl)-(N, N-disopropyl) -phosphoramidite
[0092]
Further, (ZFP) represents a Nα- (Nα-benzyloxyphenylphenyl) -puromycin residue, which was introduced into the sequence using a reagent synthesized as follows.
250 mg of puromycin dihydrochloride (manufactured by Wako Pure Chemical Industries, Ltd.) was dissolved in 3 ml of water, and 2 ml of dimethoxyethane (DME) and 0.5 ml of 10% aqueous sodium carbonate solution were added. While stirring, a solution prepared by dissolving 200 mg (1.1 equivalent) of Z-Phe-OSu (manufactured by BACHEM) in 2 ml of DME was added, and 0.5 ml of 10% aqueous sodium carbonate solution was further added. After stirring for 1 hour at room temperature, the precipitated solid was collected on a glass filter, washed twice with 2 ml of 50% DME aqueous solution, twice with 2 ml of water and twice with 2 ml of cooled DME, and then dried with a vacuum pump. Nα- (Nα-benzyloxycarbonylphenylalanyl) -puromycin was obtained.
[0093]
(1) Preparation of spacer (T-splint3FA)
DNA2 (12 nmol) and DNA3 (12 nmol) were dissolved in 0.48 ml of TBS buffer (25 mM Tris-HCl, pH 7.0, 100 mM NaCl), heated at 85 ° C. for 40 seconds, and then allowed to cool at room temperature. After standing on an ice bath for 5 minutes, it was irradiated with a handy UV lamp (365 nm) for 8 minutes, and the reaction product was purified by reverse phase HPLC. This DNA (4 nmol) was dissolved in 15 μl of a 0.1 M disodium hydrogen phosphate aqueous solution, and 4 μl of 5 mM DMF solution of N- (6-maleimidocaproyloxy) succinimide (EMCS) (crosslinking agent; manufactured by Dojindo) was added for 20 minutes at room temperature. Stir with. A solution prepared by dissolving DNA1 (20 nmol) in 40 μl of 0.1 M phosphate buffer (pH 7.1) was added to this solution, and the mixture was further stirred at room temperature for 16 hours. The reaction product of DNA1, DNA2, and DNA3, which has been bound via a crosslinking agent, is isolated by reverse-phase high-performance liquid chromatography (reverse-phase HPLC), dissolved in 50 mM phosphate buffer (pH 8.0), and chymotrypsin solution The enzyme was added at a weight ratio of about 10% with respect to the substrate and allowed to stand at 36 ° C. for 1 hour. Purification by reverse phase HPLC gave T-splint3FA.
[0094]
Example 2  Production of IVV molecules
Production of IVV molecules was performed as follows according to the method described in Japanese Patent Application No. 2002-221405. The manufacturing method is shown in FIG.
(1) Template DNA construction and production of single-stranded RNA
An HIV TAT polypeptide was used as a known transport peptide, and a DNA encoding a part of Oct-1 (POU) was constructed downstream as a support (TTP: SEQ ID NO: 1). As a negative control, a DNA encoding only POU was constructed (TP: SEQ ID NO: 2). The above DNA sequence includes a DNA sequence (T7 promoter sequence) recognized by RNA polymerase of E. coli virus T7 having high transcription efficiency, a DNA sequence (Kozak sequence) recognized by eukaryotic ribosomes during translation, and a prokaryotic cell sequence. It has a (Shine-Dalgarno sequence) recognized by a ribosome upstream, and a FLAG sequence and a sequence (Y-tag) for linking to a spacer are encoded downstream thereof.
[0095]
A specific method for constructing TTP was carried out in accordance with the method described in JP-A No. 2003-70483. Specifically, it is as follows. A single-stranded DNA containing a TAT polypeptide was synthesized (SEQ ID NO: 3), and an equimolar number of double-stranded DNA (SEQ ID NO: 4) containing a POU sequence used as a support was extended under the following conditions without using a primer. A reaction cycle was performed. Using EX-Taq DNA Polymerase (manufactured by TAKARA), the reaction conditions were a cycle of 95 ° C. for 30 seconds, 64 ° C. for 20 seconds, and 72 ° C. for 20 seconds 25 times. The ligation product was ethanol precipitated, and the ligation product and a synthesized T7 promoter sequence and a single-stranded DNA containing the Kozak sequence (SEQ ID NO: 5) were ligated in the same manner as described above to obtain TTP DNA (SEQ ID NO: 1 ) 5 μg of the DNA prepared as described above was added per 100 μl of the reaction solution, and transferred to mRNA using an RNA synthesis kit Ribomax Large Scale RNA Production System (manufactured by Promega). In order to increase translation efficiency and to prevent degradation of mRNA, a cap analog (RNA Capping Analog; manufactured by Invitrogen) was added to a final concentration of 7.2 mM, and the 5 'side of mRNA was modified. In order to remove the cap analog and excess NTP (nucleotide triphosphate), ethanol precipitation was performed using a primer remover (Primer Remover; manufactured by Edge Biosystems).
[0096]
(2) Preparation of template RNA (linkage between mRNA and spacer)
Ligation of the spacer (T-splint3FA) prepared in Example 1 (1) and the mRNA prepared above was performed according to the method described in JP-A No. 2002-291491. Specifically, it is as follows.
[0097]
TP and TTP mRNA prepared in Example 2 (1) and a spacer were mixed at a ratio (molar ratio) of 1: 1.2 to 1.5, and T4 RNA ligase buffer (50 mM Tris-HCl, pH 7.5, 10 mM). MgCl₂In order to increase specificity, DMSO (dimethylsulfoxide) was added as a denaturing agent to a final concentration of 5% in order to dissolve in 10 mM DTT, 1 mM ATP). The obtained mixture was annealed by cooling to 94 ° C. to 25 ° C. over 10 minutes using a PCR apparatus.
[0098]
Subsequently, T4 Polynucleotide Kinase (manufactured by BioLabs) and T4 RNA ligase (manufactured by Takara) were added to the above-mentioned annealed solution and reacted at 25 ° C. for 30 minutes to 2 hours.
After the reaction, the ligation product was purified using RNeasy Mini Kit (manufactured by QIAGEN). In order to confirm the efficiency of ligation, the sample was run under conditions of 4% acrylamide 8M urea denaturing gel electrophoresis, 65 ° C., 250 V, stained with Vistra Green (Amersham Pharmacia), and Molecular Imager (BioRad). ). Moreover, the fluorescence (Fluoroscein) introduced into the spacer was also confirmed. From this result, it was confirmed that the binding rate between mRNA and spacer (the formation rate of RNA-DNA conjugates) was 80 to 90%.
[0099]
(3) IVV molecule formation
To bind TP and TTP template RNA: 480 pmol using wheat germ cell-free translation system PROTEIOS (manufactured by TOYOBO) at 26 ° C. for 30 minutes, and to bind the translated peptide to puromycin (virionation) Final concentration is 40 mM MgCl₂Salt was added so that it might become 1M KCl, and it was made to react at 26 ° C for 1 hour.
[0100]
(4) Purification of template RNA and IVV molecule from translation system
TP and TTP template RNA: 480 pmol was converted into an IVV molecule by the above-described method, and desalting was performed using Micro BioSpin Column-P6 (manufactured by Bio-Rad) to perform buffer exchange, followed by 1M NaCl, 100 mM Tris-HCl ( MAGNOTEX-SA (manufactured by Takara) 360 μl adjusted to pH 8.0), 10 mM EDTA, 0.25% Triton-X100, and bound with 9.6 nmol Biotinylated Oligo (dT) Probe (manufactured by Promega) Binding was performed at 4 ° C. for about 1 hour. Thereafter, the supernatant is taken and washed three times with washing buffer A (1M NaCl, 100 mM Tris-HCl (pH 8.0), 0.25% Triton-X100), and buffer B (500 mM NaCl, 100 mM Tris-HCl (pH 8. 0), washed once with 0.25% Triton-X100), washed once with buffer C (250 mM NaCl, 100 mM Tris-HCl (pH 8.0), 0.25% Triton-X100), then 120 μl of MilliQ water To obtain template RNA and Virion.
[0101]
Samples were run on a 5M urea-denatured 5% SDS-PAGE gel. Imaging was performed with Molecular Imager (manufactured by BioRad) using fluorescence (Fluoroscein) introduced into the spacer. The results are shown in FIG. FIG. 2A shows the result of TP, and FIG. 2B shows the result of TTP. Lane 1 is 6 μl of salt desalted after virionization, lane 2 is 10 μl of supernatant during purification from the translation system, lane 3 is 10 μl of washing solution during purification from the translation system, and lane 4 is from the translation system. 6 μl of the eluate at the time of purification, lane 5 is 1/18 of the beads after purification from the translation solution.
[0102]
(5) Reverse transcription reaction after purification of IVV molecule using spacer
For TP and TTP, the fraction eluted during IVV molecular purification using a spacer was reverse-transcribed using TrueScript II Reverse Transcriptase (Sawady). In addition, Cy5-dCTP (manufactured by Amersham Pharmacia) was incorporated together to increase the amount of fluorescence signal. Elution fraction in 360 μl 5 × RT Buffer: 144 μl, 10 mM ATP: 36 μl, 10 mM GTP: 36 μl, 10 mM TTP: 36 μl, 10 mM CTP: 7.2 μl, Cy5-dCTP: 36 μl, RNase Inhibitor (40 U / μl) 18 μl, RTase (100 U / μl) 36 μl and distilled water 10.8 μl were added and reacted at 50 ° C. for 1 hour.
[0103]
(6) Confirmation of Cy5-dCTP Introduction Reverse Transcription Reaction of Template RNA Using Spacer Cy5-dCTP introduction efficiency into template RNA was confirmed. TTP and TP template RNA were reverse transcribed with Cy5-dCTP (Amersham Pharmacia) and TrueScript II Reverse Transscriptase (Sawady). 10 pmol of template RNA, 5 × RT Buffer: 4 μl, 10 mM ATP: 1 μl, 10 mM GTP: 1 μl, 10 mM TTP: 1 μl, 10 mM CTP: 0.2 μl, Cy5-dCTP: 1 μl, RNase Inhibitor (40 U / μl) 0 0.5 μl and 1 μl of RTase (100 U / μl) were added and reacted at 50 ° C. for 1 hour. In addition, RNaseH (manufactured by TOYOBO) was added to those reacted under the same conditions, reacted at 37 ° C. for 30 minutes, and digested with RNA that had been annealed with DNA to confirm cDNA complementary to the remaining template RNA. . Each reaction product was run on an 8M urea-denatured 4% polyacrylamide gel, stained with VistraGreen (Amersham Pharmacia), and imaged with MolecularImager (BioRad). Fluorescence (Fluoroscein and Cy5) was also imaged.
[0104]
The results are shown in lane 6 of FIGS. 2A (TP) and B (TTP). As is clear from the figure, the reverse transcription product and the product treated with RNase H after the reverse transcription reaction were detected in the expected size, and the introduction of Cy5 into the cDNA strand was also confirmed. Furthermore, it was found that 1.5 to 2.5 Cy5-dCTP can be introduced per molecule under conditions that do not affect reverse transcription efficiency.
[0105]
(7) Purification of IVV molecule using anti-FLAG antibody
About TP and TTP, 720 μl of the reverse-transcribed reaction in Example 2 (5) was converted to final 50 mM Tris-HCl, 150 mM NaCl, 0.25% Triton-X100, 50 μg / ml BSA, 0.5 μg / ml tRNA. Prepared. This was bound to 20 μl of Protein G Sepharose beads (Amersham Pharmacia) bound with 52.5 μg of anti-FLAG M2 antibody (Sigma) at 4 ° C. for about 1 hour to overnight, and 3 times with 60 μl PBS. Washed and eluted 3 times with 20 μl of 100 μM 3 × FLAG peptide (manufactured by Sigma) to obtain IVV molecules. In order to confirm the purification efficiency, samples were run on a 5M urea-denatured 5% SDS-PAGE gel. Using fluorescence (Fluoroscein and Cy5) introduced in the spacer, imaging was performed with a Molecular Imager (BioRad). The results are shown in FIG. FIG. 2A shows the result of TP, and FIG. 2B shows the result of TTP. Each of the upper images was visualized with a Molecular Imager (BioRad) using fluorescence (Fluoroscein) introduced into the spacer, and the lower images are fluorescence (Cy5) introduced into the cDNA strand by reverse transcription reaction. ) Using a Molecular Imager (Bio-Rad). Lane 6 is 6 μl of the solution after reverse transcription reaction, lane 7 is 10 μl of supernatant after binding to anti-FLAG antibody, lane 8 is 10 μl of washing solution with PBS, lane 9 is 6 μl of eluate with FLAG peptide, and lane 10 is 1/8 of the beads after elution is shown. The samples in lanes 6 to 10 were added with RNase H (manufactured by TOYOBO), reacted at 37 ° C. for 30 minutes, and migrated with in vitro virus as cDNA. A highly purified virion solution could be obtained in the fraction eluted with FLAG peptide. This elution fraction was used for the intracellular transfer experiment.
[0106]
Example 3  Intracellular movement of IVV molecules
(Confirmation of intracellular migration using flow cytometry)
Add CHO cells to a 96-well plate.⁴Cells / well, using HamF12 + 10% fetal bovine serum medium, 37 ° C., 5% CO 2₂The cells were cultured for 2 to 3 days under the above conditions. This was washed twice with PBS, TP labeled with the fluorescent dye obtained in Example 2 and 2.43 pmol / 54 μl (45.0 nM) of TTP Virion were added, and incubated on ice for 1 hour. After washing twice with PBS, Trypsin-EDTA was added and incubated at 37 ° C. for 5 minutes. 200 μl of the medium was added thereto to stop the Trypsin reaction, and then collected by pipetting. The prepared cells were analyzed by flow cytometry. In the flow cytometry method, fluorescence was detected using FL1 for FITC and FL4 for Cy5. The results detected with Cy5 are shown in FIG.
[0107]
FIG. 3A plots the fluorescence intensity of Cy5 on the horizontal axis and the number of cells on the vertical axis. Compared with the fluorescence intensity detected in the cells to which PBS (containing no fluorescent substance) and TP Vision was added, the fluorescence intensity of the cells to which TTP Vision was added was significantly increased. This was comparable to the results of analysis with a fusion protein containing the same concentration of TAT polypeptide using known experimental methods. In addition, although it appears that the fluorescence intensity is slightly increased in TP Virion as compared with PBS, in the confirmation experiment of intracellular migration using a confocal microscope later, in the cells to which TP Virion was added, Fluorescence was not detected in the nucleus, but fluorescence was observed only on the cell surface in a part of the cell mass. From this, it is considered that the increase in fluorescence intensity observed in the cells to which TP Virion was added was due to TP Virion non-specifically attached to the cell surface, and TTP Virion was specifically transferred into the cell. It can be said.
[0108]
FIG. 3B shows the results of A plotted with the fluorescence intensity of Cy5 on the horizontal axis and the cell size on the vertical axis. It was confirmed that the fluorescence intensity of the cells was enhanced overall in the cells to which TTP Vision was added as in A. Similar results were obtained with Fluoroscein.
FIG. 3C quantifies the ratio of cells included in an area (range indicated by M in FIG. 3B) in which the fluorescence intensity is increased with respect to all cells.
[0109]
(Confirmation of intracellular migration using confocal microscope)
Intracellular movement treatment was performed in the same manner as in Example 3 (1) above, and then observed with a confocal microscope. In the cells to which TTP Virion was added, fluorescence was observed in the cells of all the cells, and in particular, strong fluorescence was observed in the nuclei, and there were some cells that accumulated in the nuclei. From this, it became clear that TTP Virion was taken up into cells and nuclei. On the other hand, in the cells to which TP Vision was added, almost no fluorescence was detected, but in the cells that partially formed cell clusters, fluorescence was observed only on the cell surface. From this, it is considered that the increase in fluorescence intensity observed in cells to which TP Virion was added in flow cytometry was due to TP Virion non-specifically attached to the cell surface, and TTP Virion was specifically intracellular. It can be said that it moved to.
[0110]
(Confirmation of recovery of intracellularly transferred IVV molecules using PCR)
As in Example 3 (1), intracellular transfer treatment was performed using 1.32 pmol of TTP and TP virion. The collected cells were washed with PBS and stored frozen at -80 ° C. 10 μl of Lyse-N-Go Buffer (Lyse-N-Go PCR Reagent: PIERCE) was added to the cells, and the cells were suspended. Subsequently, in order to destroy the cell membrane and the nuclear membrane, the suspension was heat-treated under the following conditions in accordance with the Lyse-N-Go PCR Reagent protocol.
65 ° C .: 30 seconds → 8 ° C .: 30 seconds → 65 ° C .: 90 seconds → 97 ° C .: 180 seconds → 8 ° C .: 60 seconds → 65 ° C .: 180 seconds → 97 ° C .: 60 seconds → 65 ° C .: 60 seconds → 80 ° C. : 60 seconds, make up to 50 μl with distilled water, add 1 μl of 10 U / μl RNase H (TOYOBO), incubate at 37 ° C. for 30 minutes, precipitate with ethanol, dissolve in 20 μl of distilled water The Vion collection liquid was used. This recovered solution was diluted 10 times, 10²Double dilution, 10³Double dilution, 10⁴Double dilution, 10⁵The sample was diluted twice and 2.5 μl was used as a sample for PCR.
[0111]
As a standard for quantification, CHO cells 10⁶Suspend cells by adding 100 μl of Lyse-N-Go Buffer to each tube / tube, heat-treat the suspension in the same manner as the sample above, precipitate with ethanol, dissolve in 250 μl of distilled water, and add 2.5 μl of cell solution. (CHO cell 10⁴Single-stranded TP, TTP template RNA cDNA of known concentration, 10-10⁹1 μl of molecule / μl was added.
[0112]
PCR was performed with EX Taq DNA Polymerase (TaKaRa) using a sense primer (SEQ ID NO: 6) and an antisense primer (SEQ ID NO: 7) common to TTP and TP using these as templates. PCR conditions were 95 ° C / 30 sec, 68 ° C / 20 sec, and 72 ° C / 20 sec.
[0113]
Each 2.5 μl (1/10 volume) of the above PCR product was run on a 2% -agarose gel, stained with ethidium bromide, and then imaged with Molecular Imager (BioRad) to detect the amplification product band. The sample was quantified in comparison with the standard for quantification.
[0114]
The results are shown in FIG. In FIG. 4, the upper part shows TTP and the lower part shows TP. Lane M shows a molecular weight marker, and lanes (1) to (9) are quantification standards ((1): template RNA-cDNA 10 molecules, (2): template RNA-cDNA 10).²Molecule, (3): Template RNA-cDNA 10³Molecule, (4): Template RNA-cDNA 10⁴Molecule, (5): Template RNA-cDNA 10⁵Molecule, {circle around (6)}: Template RNA-cDNA 10⁶Molecule, (7): Template RNA-cDNA 10⁷Molecule, (8): Template RNA-cDNA 10⁸Molecule, {9}: Template RNA-cDNA 10⁹Lane (10) (circle numbers in the figure, hereinafter the same) to (14) are samples after addition of TP or TTP Virion to the cells ((10): 2 × 10), respectively.^-5μl addition, (11): 2 × 10^-4μl addition, (12): 2 × 10^-3μl addition, (13): 2 × 10^-2μl addition, (14): 0.2 μl addition). Further, as a result of quantification from the intensity of each band, amplification by PCR was not observed in cells to which PBS was added instead of Virion. In the case of TTP Virion, it is 4.52 × 10 4 in 20 μl of the total recovered solution after adding Virion.⁸The number of added TTP virions (7.95 × 10¹¹1-1.76 × 10 of the molecule)³Has been recovered. On the other hand, in the case of TPVision, 3.91 × 10 6 is contained in 20 μl of the total recovery solution after the addition of Vilion.⁷The number of added TP virions (7.95 × 10¹¹1 to 2.03 × 10 of the molecule)⁴Has been recovered. As a result, TTP Viron was recovered about 12 times more than TP Virion, which indicates that TTP Virion is concentrated about 12 times higher than TP Virion in the analysis using PCR. ing.
[0115]
(4) PCR product cloning and nucleotide sequence analysis
Each PCR product was cloned using the cells to which TTP Virion and TP Virion obtained in Example 3 (3) above were added as samples (Promega Corporation: pGEM-T Easy Vector Systems was used), and nucleotide sequence analysis was performed. I went (consigned to Sawasdee Technology). As a result of the base sequence analysis, only TTP Virion gene was confirmed from the cells to which TTP Virion was added, and only TP Virion gene was confirmed from the cells to which TP Virion was added.
[0116]
Example 4  Examination of amplification conditions of Virion in cell fluid by PCR
When performing PCR using template RNA or Virion contained in cell fluid as a template, the cell suspension contains a large amount of disrupted cell-derived substances (proteins, nucleic acids, etc.), which can interfere with PCR. Sex is conceivable. Therefore, a method for preparing a sample capable of efficiently amplifying a template contained in a cell solution was examined.
[0117]
(1) Examination of PCR template recovery conditions from cell fluid
10^-10To 10^-1To 1 μl of pmol / μl template RNA, 5 μl of Lyse-N-Go PCR Reagent as a cell lysate (PIERCE) and 1 μl of 2 u / μl RNase H (TOYOBO) were added and incubated at 37 ° C. for 30 minutes. . Next, half the amount was subjected to PCR as it was, half the amount was subjected to ethanol precipitation and then dissolved in 3.5 μl of distilled water and then subjected to PCR. PCR was performed with EX Taq DNA Polymerase (TaKaRa) using a sense primer (SEQ ID NO: 8) specific for TTP and a common primer (SEQ ID NO: 9) as an antisense primer. As PCR conditions, a cycle of 94 ° C./30 sec, 60 ° C./20 sec, 72 ° C./60 sec was repeated 25 to 35 times.
The result is shown in FIG. 5A. (−) Shows no ethanol precipitation operation, and (+) shows an ethanol precipitation operation. As a result, PCR amplification efficiency was better with ethanol precipitation.
[0118]
(2) Examination of PCR conditions using Virion containing cell fluid
10 to 10⁵Molecular TTP Virion: 5 × 10 in 1 μl⁴After adding 2.5 μl of each cell suspension and allowing to stand at 4 ° C. for 1 hour, 6.5 μl of Lyse-N-Go PCR Reagent was added and heat-treated. 140 μl of PBS was added to this and then centrifuged at 8,000 rpm for 10 minutes to remove cell clumps, which were treated with RNase H and ethanol precipitated, respectively, and dissolved in 5 μl of distilled water. Subsequently, PCR was performed with TAT-specific primers (SEQ ID NOs: 8 and 9) in the same manner as in Example 4 (1).
[0119]
The result is shown in FIG. 5B. (-) Indicates no centrifugal operation, and (+) indicates a centrifugal operation. From this result, it was found that the PCR amplification efficiency was better when the cell solution was centrifuged to remove the cell mass after cell lysis.
[0120]
At this time, in order to remove amplification products other than TTP that seem to be derived from the cell genome, in addition to the above, when the cell fluid was further treated at 98 ° C. for 10 minutes, no amplification product derived from the cell genome was detected. . The result is shown in FIG. 5C. (-) Indicates that no heat treatment was performed, and (+) indicates that heat treatment was performed.
[0121]
The results of Example 4 are all obtained by running 2.5 μl (1/10 volume) of each PCR product on a 2% -agarose gel, staining with ethidium bromide, and imaging with MolecularImager (manufactured by BioRad). Detected.
[0122]
Example 5  Selection of TTP Virion from TP and TTP Virion Mixed Pool
Two sets of 50 μl of TP and TTP Virion prepared in Example 2 were prepared at the following mixing ratio.
(1) TP: 5.65 × 10¹¹Molecule / TTP: 10⁶molecule
(2) TP: 5.65 × 10¹¹Molecule / TTP: 10⁴molecule
(3) TP: 5.65 × 10¹¹Molecule / TTP: 10³molecule
(4) TP: 5.65 × 10¹¹Molecule / TTP: 10²molecule
(5) TP: 5.65 × 10¹¹Molecule / TTP: 10 molecules
Of the two sets, one set was added to the cells, and the other set was used as a sample before selection.
[0123]
Virion for cell addition was added to the cells in the same manner as in Example 3 (1) and reacted at 4 ° C. for 1 hour. After the intracellular transfer reaction, the recovered cells were washed with PBS and stored frozen at −80 ° C. 20 μl of PBS and 20 μl of Lyse-N-Go Buffer (manufactured by Lyse-N-Go PCR Reagent: PIERCE) were added to the cells, and the cells were suspended. Next, in the same manner as in Example 3 (1), the suspension was heat-treated according to the Lyse-N-Go PCR Reagent protocol in order to destroy the cell membrane and the nuclear membrane. This was diluted to 200 μl with distilled water, 1 μl of 10 U / μl RNase H (manufactured by TOYOBO) was added, and the mixture was incubated at 37 ° C. for 30 minutes. Thereafter, the mixture was centrifuged at 8,000 rpm for 10 minutes with a small high-speed centrifuge, and the supernatant was collected. This supernatant was precipitated with ethanol and then dissolved in 20 μl of distilled water to obtain a Vion recovery solution. This recovered solution was diluted 10 times, 10²Double dilution, 10³Double dilution, 10⁴Double dilution, 10⁵A 2.5-fold dilution was used as a sample for PCR. In addition, the sample was heat-treated at 98 ° C. for 10 minutes before PCR. Samples for selection were prepared in the same manner.
[0124]
First, a sample derived from this Virion-added cell was compared and analyzed using TTP and a common sense primer (SEQ ID NO: 10) and a common antisense primer (SEQ ID NO: 9). In the same manner as in Example 3, 2.5 μl of the above Vion recovery solution was serially diluted by 10 times 10²10³10⁴Twenty-five cycles of amplification were performed using 2.5 μl of each diluted solution as a template. Each 2.5 μl (1/10 volume) of this PCR product was run on a 2% -agarose gel, stained with ethidium bromide, and then imaged with Molecular Imager (manufactured by BioRad) to detect the amplification product band, Samples were quantified in comparison to quantitation standards.
[0125]
The result is shown in FIG. 6A. As shown in FIG. 6A, when the common primer (SEQ ID NOs: 9 and 10) was used, only TP was detected regardless of before and after addition of Virion cells. Prior to the addition, the amount of TP was quantified from the band intensity.¹¹Calculated to include molecules. When the amount of TP after addition of the cells was quantified from the band intensity, it was 7.2 × 10 6 in 20 μl of the total recovered solution.⁷Calculated to include molecules. From this, the added TP Virion is about 1/10 by washing.⁴It can be seen that the number decreased. Moreover, although TTP amplification was not confirmed in this result, even if TTP was amplified from the principle of PCR, in order to confirm amplification with this common primer (SEQ ID NOs: 9 and 10), It seems to be below detection sensitivity.
[0126]
From this, PCR amplification of this PCR product was performed using a sense primer specific to TTP (SEQ ID NO: 8) to confirm TTP amplification. A common primer (SEQ ID NO: 9) was used as an antisense primer. 10³2.5 μl of the Virion collection solution before addition of the diluted cells was amplified with a common primer (SEQ ID NOs: 9 and 10).³After doubling dilution, 2.5 μl was amplified for 35 cycles with TAT-specific primers (SEQ ID NOs: 8 and 9). Further, the recovered Villion solution after addition of the cells was amplified with a common primer (SEQ ID NOs: 9 and 10), and this PCR product was amplified by 10³Dilute by a factor of 35 and amplify for 35 cycles with TAT-specific primers (SEQ ID NOs: 8 and 9). The result is shown in FIG. 6B. The detection sensitivity of TTP using TAT-specific primers (SEQ ID NOs: 8 and 9) is 10 before cell addition.⁴Whereas it was a molecule, a TTP band could be detected from 10 molecules after addition of cells. This is because the TTP Virion was specifically transferred into the cell, and the TTP Virion was about 10 in the TP and TTP Virion mixed Pool.³It shows that it was double concentrated.
[0127]
Furthermore, by repeating the process of re-IVV molecularizing the PCR amplification product of TTP Virion-enriched TP and TTP Virion mixed Pool and adding it to the cell, a small amount of TTP Virion (the sequence that moves into the cell and nucleus) Molecule) is selected from a large amount of TP Virion (a molecule including a sequence that does not migrate into the cell), and finally, a Pool of a large amount of TTP Virion (a molecule that includes a sequence that migrates into the cell and nucleus) is obtained. It is considered possible.
[0128]
Example 6  Examination of washing method of IVV molecules non-specifically attached to cells
TTP (or a molecule containing a sequence that moves into the cell and nucleus) In order to increase the selection efficiency of Virion, in order to remove adhesion of nonspecific template RNA and Virion to the cell membrane surface, At the time of cell collection, degradation of template RNA and Virion by DNase I was attempted.
[0129]
CHO cells are 10 in 96 well plates.⁴Cells / well, using HamF12 + 10% fetal bovine serum medium, 37 ° C., 5% CO 2₂The cells were cultured for 2 to 3 days under the above conditions. After washing this with PBS, TP Virion labeled with the fluorescent dye prepared in Example 2: 1.0 × 10¹¹Molecule / 60 μl or TTP Virion: 3.0 × 10¹⁰Molecule / 60 μl was added and incubated on ice for 1 hour.
[0130]
(Normal condition)
After removing the supernatant, the plate was washed with PBS, added with 0.25% Trypsin-EDTA: 50 μl, incubated at 37 ° C. for 5 minutes, added with 50 μl of medium to stop the Trypsin reaction, and then pipetting. After collection and washing with PBS, the precipitate was stored frozen at -80 ° C.
[0131]
(DNase treatment)
After removing the supernatant, it was washed 3 times with PBS, 2Units DNase I (Amersham Pharmacia) and 10 mM MgCl₂After adding 100 μl of PBS containing 37 μm and incubating at 37 ° C. for 30 minutes, 50 μl of medium was added to stop the Trypsin reaction, and then pipetting was performed to collect, and the precipitate was washed with PBS. Cryopreserved at ℃.
[0132]
(DNase + EDTA treatment)
After removing the supernatant, it was washed 3 times with PBS, 2Units DNase I (Amersham Pharmacia) and 10 mM MgCl₂After adding 100 μl of PBS and incubating at 37 ° C. for 30 minutes, DNase I was inactivated by adding 1/10 amount of 25 mM EDTA, and 50 μl of medium was added thereto to stop the Trypsin reaction. After collecting by pipetting and washing with PBS, the precipitate was stored frozen at -80 ° C.
[0133]
Each of the above samples was analyzed by PCR using common primers (SEQ ID NOs: 9 and 10) in the same manner as in Example 5. Under each condition, 3 samples (each 1 to 3) were analyzed independently, and PCR was performed twice. Each 2.5 μl (1/10 volume) of this PCR product was run on a 2% -agarose gel, stained with ethidium bromide, and then imaged with Molecular Imager (manufactured by BioRad) to detect the amplification product band, The sample was quantified in comparison with the standard for quantification as in Example 3.
[0134]
FIG. 7A shows the result of TP and B shows the result of TTP. In FIG. 7A, lane M represents a molecular weight marker, and lanes (1) to (8) in the left and right diagrams are for quantification ((1): template RNA-cDNA 10).²Molecule (2): Template RNA-cDNA 10³Molecule, (3): Template RNA-cDNA10⁴Molecule, (4): Template RNA-cDNA 10⁵Molecule, (5): Template RNA-cDNA 10⁶Molecule, {circle around (6)}: Template RNA-cDNA 10⁷Molecule, (7): Template RNA-cDNA 10⁸Molecule, (8): Template RNA-cDNA 10⁹Molecule). Lanes (9) and (10) in the left and right diagrams show the results of PCR using the TP Virion recovery solution before addition to the cells as a template (recovered solution of 10).³Double dilution: (9), recovering solution 10⁴Double dilution: (10)). The left lanes (11) to (13) are normal conditions: 1 to 3, the left lanes (14) to (16) are DNase treatments: 1 to 3, and the right lanes (11) to (13). Indicates DNase + EDTA treatment: 1-3.
[0135]
As a result of quantifying the virion included from each band intensity, the TP virion is 1.4 × 10 6 under normal conditions.⁶1/10 of the amount of TP Virion recovered and added⁴Met. When the DNase process is performed, the TP Vision is 4.9 × 10.⁴It was found that the molecules were recovered and about 30 times as much TP Vion could be removed by the Dnase treatment as compared with the above normal conditions. Furthermore, when DNase + EDTA treatment is performed, TP Vision is 1.3 × 10⁵It was found that the molecules were recovered and about 10 times as much TP Vion was removed by the Dnase + EDTA treatment as compared with the normal condition.
[0136]
From these facts, DNase treatment was most effective in removing TP Vision, and DNase treatment had an effect of removing TP Vision about 30 times that in normal conditions. This is considered that DNase decomposed | disassembled TP Virion adhering to the cell surface. In addition, the addition of EDTA treatment decreased the effect of removing TP Vision by about 3 times compared to DNase treatment alone. In the case of only DNase treatment, DNase remaining during the subsequent washing operation worked to decompose Virion. However, DNase was deactivated by the addition of EDTA treatment, and it was considered that decomposition during the washing operation was not performed. From the above, when TP Virion is used, it can be understood that TP Virion non-specifically attached to the cell surface is decomposed by DNase treatment, and the amount of collected Virion is reduced by 10 times or more compared to normal conditions. It was. This indicates that the concentration efficiency is 10 times better than before.
[0137]
In FIG. 7B, lane M represents a molecular weight marker, and lanes (1) to (8) in the left and right diagrams are for quantification ((1): template RNA-cDNA 10).²Molecule (2): Template RNA-cDNA 10³Molecule, (3): Template RNA-cDNA 10⁴Molecule, (4): Template RNA-cDNA10⁵Molecule, (5): Template RNA-cDNA 10⁶Molecule, {circle around (6)}: Template RNA-cDNA 10⁷Molecule, (7): Template RNA-cDNA 10⁸Molecule, (8): Template RNA-cDNA 10⁹Molecule). Lanes (9) and (10) in the left and right diagrams show the results of PCR using the TP Virion recovery solution before addition to the cells as a template (recovered solution of 10).³Double dilution: (9), recovering solution 10⁴Double dilution: (10)). The left and right lanes (11) show normal condition 1, lane (12) shows DNase process 1, and lane (13) shows DNase process + EDTA process 1.
[0138]
As a result of quantifying the virions contained from the respective band intensities, the TTP virion was 6.7 × 10 6 under normal conditions.⁶1 to 5.5 × 10 times the amount of TTP virion before molecular recovery and addition to cells³It was twice. In addition, when the DNase treatment is performed, the TTP version is 1.4 × 10⁷1 to 2.6 × 10 of TTP virion amount before molecular recovery and addition to cells³It was twice. Furthermore, when DNase + EDTA processing is performed, TTP version is 2.1 × 10⁷1 to 1.8 × 10 of the amount of TTP virion before the molecule is recovered and added to the cell³It was twice.
[0139]
From the above, it was found that when TTP Virion was used, TTP Virion incorporated into cells was not decomposed even when DNase treatment was performed. DNase treatment does not degrade TTP virions (or molecules containing intracellular and nuclear translocation sequences) that have migrated into cells, while TP virions (or cells and nuclei attached to cell membranes do not migrate into cells). It was found that only TTP virions (or molecules containing intracellular and nuclear transfer sequences) can be efficiently recovered and amplified by PCR. From the above results, it is considered useful for selection of molecules containing intracellular and nuclear translocation sequences from IVV molecular libraries.
[0140]
【The invention's effect】
According to the present invention, a method for efficiently screening a polypeptide having an activity of transporting a biologically active substance such as a polypeptide or a nucleic acid into a cell or nucleus is provided. According to this method, since polypeptides having various amino acid sequences can be comprehensively screened, polypeptides having higher transport efficiency than existing transport polypeptides and polypeptides having cell-specific transport activity are obtained. It is highly possible.
[0141]
[Sequence Listing]

[Brief description of the drawings]
FIG. 1 shows a method for constructing IVV that can be used in the present invention.
FIG. 2 shows the construction results of IVV produced according to the method of the present invention.
FIG. 3 shows the results of confirming intracellular translocation of IVV molecules according to the method of the present invention.
FIG. 4 shows the results of confirming the recovery of IVV molecules migrated into cells according to the method of the present invention using PCR.
FIG. 5 shows the results of examining optimum conditions for amplifying Virion in cell fluid by PCR according to the method of the present invention.
FIG. 6 shows the results of selecting a TTP Vision from a TP and TTP Virion mixed Pool according to the method of the present invention.
FIG. 7 shows the results of examining a method for washing IVV molecules non-specifically attached to cells according to the method of the present invention.
FIG. 8 shows an overview of the method of the present invention.

Claims (22)

A protein part containing a candidate polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the candidate polypeptide, a target substance transported into the target cell by the polypeptide, or a base sequence encoding the same A molecule for use in screening for a transport polypeptide, comprising a nucleic acid part, wherein the C-terminus of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded. A protein part comprising a fusion protein of a candidate polypeptide consisting of 2 to 100 amino acid residues and a target protein transported into the target cell by the polypeptide; a base sequence encoding the candidate polypeptide; and the target protein 2. The molecule according to claim 1, wherein the molecule comprises a nucleic acid part containing a base sequence to be processed, and the C-terminal of the protein part and the 3 ′ end of the nucleic acid part are directly covalently bonded. A nucleic acid comprising a protein part containing a candidate polypeptide consisting of 2 to 100 amino acid residues, a base sequence encoding the candidate polypeptide, and a nonprotein target substance that is transported into the target cell by the polypeptide The molecule according to claim 1, wherein the C-terminal of the protein part and the 3 'end of the nucleic acid part are directly covalently bonded. The nucleic acid part is a nucleic acid derivative bound to a 3 'end of a nucleic acid having a base sequence encoding a candidate polypeptide and a base sequence encoding a target protein via a spacer. Molecule described in 1. The nucleic acid part is a nucleic acid derivative bound to the 3 ′ end of a nucleic acid having a base sequence encoding a candidate polypeptide through a spacer, and further a non-protein target substance is bound to the spacer. The molecule according to claim 3, wherein The molecule according to any one of claims 1 to 5, wherein the molecule further contains a labeling substance. The molecule according to claim 6, wherein the labeling substance is bound to a spacer. The said labeling substance is couple | bonded with the nucleotide residue which comprises the complementary strand of the nucleic acid which has the nucleotide residue contained in a nucleic acid part, and / or the base sequence which codes the target protein, It is characterized by the above-mentioned. Molecule. The protein part includes a fusion protein of a candidate polypeptide consisting of 2 to 100 amino acid residues and a support protein that allows the candidate polypeptide to be expressed in a cell-free translation system. The molecule according to claim 2. The molecule or group of molecules according to any one of claims 1 to 9, characterized in that the candidate polypeptide consists of a random amino acid sequence. A nucleotide sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues, and a target substance transported into the target cell by the polypeptide or a nucleic acid having a nucleotide sequence encoding the target substance via a spacer And a nucleic acid derivative bound thereto. Nucleic acid via a spacer at the 3 ′ end of a nucleic acid comprising a base sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues and a base sequence encoding a target protein transported into the target cell by the polypeptide The nucleic acid according to claim 11, wherein the derivative is bound thereto. A nucleic acid derivative is bound to the 3 ′ end of a nucleic acid containing a base sequence encoding a candidate polypeptide consisting of 2 to 100 amino acid residues via a spacer, and the polypeptide is further bound to the target cell by the polypeptide. The nucleic acid according to claim 11, wherein a target substance to be transported to a nucleic acid is bound. The nucleic acid according to any one of claims 11 to 13, wherein the spacer contains a labeling substance. 15. The nucleic acid or group of nucleic acids according to any one of claims 11 to 14, characterized in that the candidate polypeptide consists of a random amino acid sequence. A molecule or group of molecules according to any one of claims 1 to 10, characterized in that the nucleic acid or group of nucleic acids according to any of claims 11 to 15 is transcribed / translated in a protein synthesis system. Production method. A method for screening a transport polypeptide, comprising:
(1) contacting the target cell with the group of molecules according to claim 10;
(2) a step of amplifying a nucleic acid contained in the nucleic acid part of the molecule introduced into the target cell or the nucleus of the target cell; and (3) analyzing the base sequence of the amplified nucleic acid, Identifying a polypeptide to be transported as a polypeptide;
A method comprising the steps of: The method according to claim 17, further comprising the step of (a) removing the molecule that has not been introduced into the cell or nucleus from the surface of the target cell between the steps (1) and (2). Method. The step (2) includes a process of selectively extracting the molecule from the target cell and selectively amplifying the nucleic acid contained in the nucleic acid part of the molecule. 18. The method according to 18. The process of selectively extracting the molecule from the target cell and selectively amplifying the nucleic acid contained in the nucleic acid part of the molecule is as follows: (2a) 20. The method according to claim 19, wherein centrifugation is performed for 30 minutes, and (2b) the nucleic acid part of the molecule in the supernatant is converted to a single strand of DNA. The method according to claim 20, wherein the nucleic acid contained in the supernatant is heat-denatured after the step (2b). A nucleic acid or group of nucleic acids according to any one of claims 11 to 14 is produced using the polypeptide selected in claim 17 as a candidate polypeptide, and the nucleic acid or group of nucleic acids is transcribed / translated in a protein synthesis system, A method for screening a transport polypeptide, comprising performing the method according to any one of claims 17 to 21 using the obtained molecule or group of molecules, or repeating these methods.

Images