JP2017137199A - Ceramic porous body for lactic acid bacterium pickle, and manufacturing method thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a pickle container suitable for inhabitation of lactic acid bacterium, in more detail, a ceramic porous body for lactic acid bacterium pickle of which characteristics as an absorbent of the lactic acid bacterium is improved, and manufacturing method thereof.SOLUTION: A method of manufacturing a ceramic porous body includes a first step where Miyazaki clay is dried, pulverized by a pulverizer, followed by sieving with a 500 mesh sieve to obtain a powder having a size of 0.5 mm or smaller, a second step where an organic material is cooled by dipping in liquid nitrogen, followed by pulverizing by a pulverizer, followed by sieving with a 0.5 mm mesh sieve to obtain a powder having a particle size of 0.5 mm or smaller, a third step where Miyazaki clay obtained in the first step and the organic material obtained in the second step are mixed such that a content of the organic material is 10 to 30 mass percent relative to a total mass to obtain a mixture, and a fourth step where the mixture is sintered in a furnace atmosphere of from 1,000°C to 1,100°C.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a ceramic porous body for pickled lactic acid bacteria having improved characteristics as an adsorbent for lactic acid bacteria, and a method for producing the same.

  Pickles are manufactured by changing various flavors of ingredients and various ingredients and pickles such as salt, vinegar, and sake lees in a container and immersing them to improve preservation and aging fermentation. In particular, pickles with fermentation are fermented by lactic acid bacteria contained in the pickle bed and sugars contained in the ingredients, and in order to improve the preservation and flavor, the taste of pickles depends on the fermentation of microorganisms (lactic acid bacteria), It has a close relationship with the growth of lactic acid bacteria.

  To pickle the pickles, a container such as a pickle barrel is used. The fermentation of lactic acid bacteria varies depending on the structure of the container (pore distribution) and the chemical composition (crystal structure) of the container. Therefore, when pursuing the taste of pickles, it is important to keep the lactic acid bacteria in an optimal state that facilitates fermentation. Conventionally, various inventions that have been devised to promote fermentation by focusing on pickles and lactic acid bacteria are disclosed. Has been.

  For example, in Patent Document 1, lactic acid fermentation is performed by a mixed culture in which okara lactic acid bacteria (Lactobacillus fermentum) are mixed with natural salt, kelp and chili and cultured, and the matured mixture is obtained at a required temperature. Sterilize by boiling for the required time, let the sterilized mixture cool naturally, and put the inner bag with the sterilized mixture into the required outer bag that contains the sachet containing powdered lactic acid bacteria in advance, and then ripen it with the lactic acid bacteria that seals A manufacturing method is disclosed. Further, for example, Patent Document 2 discloses that a fixed bed material mixed at a predetermined mixing ratio is fermented at a temperature of 25 to 35 ° C. for 10 to 20 days, and the obtained fixed bed is fixed at a temperature of 1 to 3 ° C. A method of storing the pickled sardines without altering them is disclosed. Furthermore, Patent Document 3 discloses a method of fermenting a pickled material in the presence of salt having a concentration not exceeding a predetermined weight in a bag or container in which a material that transmits oxygen at a predetermined permeability is used as a part or all of the material. It is disclosed.

JP 2003-47398 A JP-A-2005-237205 Japanese Patent Laid-Open No. 11-155478

  However, although the methods described in Patent Literature 1 to Patent Literature 3 disclose a method for promoting fermentation of lactic acid bacteria by adjusting fermentation conditions such as mixing ratio of materials and fermentation time, the structure of lactic acid bacteria and containers The relationship between (pore distribution) and the chemical components (crystal structure) of the container is not disclosed, and the container suitable for fermentation has not been known yet.

  In general, lactic acid bacteria have a habit called microhabitat that prefers pores of about several micrometers as a family. In order to attach a large amount of lactic acid bacteria using this behavior, a pickle container in which the pore distribution of the tissue of the container is adapted to the size of the lactic acid bacteria is desired.

  The present invention has been made in view of the above problems, and is a pickle container suitable for the inhabiting of lactic acid bacteria, more specifically, a ceramic porous body for pickled lactic acid bacteria with improved characteristics as an adsorbent of lactic acid bacteria, and a method for producing the same The purpose is to provide.

  For this reason, the ceramic porous body for pickled lactic acid bacteria of the present invention has a first feature that it is obtained by firing clay and has pores on the surface or internal tissue, and the surface or internal tissue has a diameter of 1 to 100 μm. A second feature is that it has pores of meters.

  The third feature is that the crystal structure contains at least one of Microcline and Mullite, and the fourth feature is that the crystal structure contains Quarts and Hematite.

  Furthermore, a fifth feature is that clay and an organic material are added and baked, and a sixth feature is that the clay and the organic material are sorted into particles having a particle size of 0.5 mm or less.

  Furthermore, the seventh feature is that the content of the organic material is 10 to 30 mass%, and the eighth feature is that the clay is clay produced in Miyazaki Prefecture.

  The method for producing a ceramic porous body for pickled lactic acid bacteria according to the present invention is a method of drying a clay produced in Miyazaki Prefecture, pulverizing it with a pulverizer, and applying a sieve of 0.5 mm mesh to a particle size of 0.5 mm or less. The first step is taken, and the organic material is immersed in liquid nitrogen and cooled, then pulverized using a pulverizer, and passed through a sieve of 0.5 mm mesh so that the particle size is 0.5 mm or less. And the Miyazaki Prefecture clay obtained in the first step and the organic material obtained in the second step are mixed so that the content of the organic material is 10 to 30 mass% with respect to the total mass of the raw material. And a fourth step of firing the mixture at 1,000 ° C. to 1,100 ° C. in a furnace atmosphere.

  Since the porous ceramic body of the present invention has pores of 1 to 100 micrometers on the surface or inside thereof, lactic acid bacteria are easily adsorbed and are suitable for inhabiting lactic acid bacteria. Moreover, by pickling pickles using the ceramic porous body of the present invention, lactic acid bacteria increase and it becomes possible to make delicious pickles.

(A) of the ceramic porous body which concerns on embodiment of this invention is a graph which shows pore diameter distribution, (b) is a graph which shows a porosity. It is a figure which shows the X-ray-diffraction pattern of the ceramic porous body baked at 1,000 degreeC. It is a figure which shows the X-ray-diffraction pattern of the ceramic porous body baked at 1,100 degreeC. It is a graph which shows the number of viable bacteria which grew on the agar medium in a present Example. It is a microscope picture which shows GYP-74 stock | strain used in the present Example. It is a figure which shows the Blast search result using the 16S rRNA gene base sequence (500-600 bp) of GYP-74 strain | stump | stock used in the present Example. It is a figure which shows the Blast search result using the 16SrRNA gene base sequence (1449bp) of GYP-74 strain | stump | stock used in the present Example. It is the figure which showed 16SrRNA gene base sequence (1449bp) of GYP-74 strain | stump | stock used in the present Example. It is a graph which shows the adhesion bacteria count result of GYP-74 stock | strain to a test piece. It is a microscope picture which shows that GYP-74 stock | strain adhered to the ceramic porous body which concerns on a present Example.

  Hereinafter, with reference to drawings, the manufacturing method of the ceramic porous body concerning the embodiment of the present invention is explained.

  The ceramic porous body according to the embodiment of the present invention is manufactured by baking clay and is manufactured by mixing and baking clay and an organic material.

The clay is not particularly limited, but is preferably a clay produced in Miyazaki Prefecture, more preferably a fine and fine-quality clay that is excellent in formability and baked at low temperature. An example of such clay is “Himuka Ancient” (registered trademark, manufactured by Kuroki Construction Co., Ltd.). Himuka Ancient (registered trademark, manufactured by Kuroki Construction Co., Ltd.) is silicon dioxide (SiO ₂ ), aluminum oxide (Al ₂ O ₃ ), iron oxide (Fe ₂ O ₃ ), titanium dioxide (TiO ₂ ), calcium oxide (CaO ), Magnesium oxide (MgO), sodium oxide (Na ₂ O), potassium oxide (K ₂ O), and is a clay produced in Miyazaki Prefecture. The results of quantitative analysis of Himuka Ancient (registered trademark) are shown in Table 1. The loss on ignition (LOI) was 4.91%.
After the clay was dried, the clay was pulverized using a pulverizer, passed through a 0.5 mm mesh sieve, and a particle having a particle size of 0.5 mm or less was selected. This is used as a raw material for the ceramic porous body.

  Any organic material can be used as long as it is an organic material that has a strength capable of adjusting the particle size and is decomposed by firing. Examples of such an organic material include corn starch or synthetic resin in addition to POM resin. The POM resin has characteristics such as high crystallinity, excellent fatigue resistance, a mixture of crystal parts and amorphous parts, and excellent mechanical strength. The POM resin used in the present invention was cooled by immersing a commercially available POM resin in liquid nitrogen, pulverized using a pulverizer, sieved, and sorted by particle size. The selected particle size is 0.2 mm or less and a size of 0.2 to 0.5 mm. This was used as a raw material. When the particle diameter of the POM resin is larger than 0.5 mm, the pore diameter of the ceramic porous body is clearly increased, which causes cracks and the like.

  The mixing ratio of the clay and the POM resin was configured such that the content of the POM resin was 0 to 30 mass% with respect to the total mass of the raw materials (clay and POM resin). Each of the POM resins selected into two sizes of pulverized particle size of 0.2 mm or less and 0.2 to 0.5 mm is mixed at a mixing ratio of 0 mass%, 10 mass%, 20 mass%, and 30 mass%, The furnace atmosphere was fired at 1,000 ° C. and 1,100 ° C., and a total of 14 types of ceramic porous bodies (hereinafter referred to as test pieces) were molded.

The apparent porosity of the test piece was measured according to JIS R2205. Table 2 shows the apparent porosity of each test piece.

  Among the test pieces shown in Table 2, for test pieces made only from clay (two kinds of 1,000 ° C. and 1,100 ° C.), and test pieces having a mixing ratio of POM resin of 20% (four kinds in total), The pore distribution was measured with a porosimeter. FIG. 1A shows the pore distribution of each test piece. In terms of the firing temperature, a pore distribution of 1 micrometer or less is often observed at 1,000 ° C. (upper figure in FIG. 1), but compared to 1,000 ° C. at 1,100 ° C. (lower figure in FIG. 1). The pore distribution of 1 micrometer or less is small, and it is biased toward the pore distribution of 1 micrometer or more. At 1,100 ° C., it is baked by high-temperature firing, and small pores of 1 μm or less disappear and are biased toward a pore distribution of 1 μm or more. Further, as shown in FIG. 1B, the porosity is smaller at 1,100 ° C. than 1,000 ° C.

From the results shown in FIG. 1 and Table 2, the following became clear.
(1) A test piece made only from clay has many pores of 0.1 to 10 micrometers. On the other hand, test pieces (total 4 types) having a POM resin mixing ratio of 20% have many pores of 10 to 100 micrometers.
(2) As the particle size of the POM resin increases, the test piece has a higher porosity.
(3) As the mixing ratio of the POM resin increases, the test piece has a distribution with larger pores.

  From the results of FIG. 1, it was found that the pore distribution in the specimen structure can be controlled by changing the particle size of the POM resin, the mixing ratio of the POM resin with clay, and the firing temperature. That is, it is considered that a ceramic porous body having a pore distribution suitable for microorganisms can be produced.

  Further, X-ray diffraction measurement was performed on the fired clay. The results are shown in FIGS. 2 and 3, and the crystal structure (structure) was considered. Fig. 2 shows the X-ray diffraction pattern of the porous ceramic body obtained by firing clay at 1,000 ° C, and Fig. 3 shows the X-ray diffraction pattern of the porous ceramic body fired at 1,100 ° C. The results of mineral identification are shown.

When material analysis was performed by ICDD database search (http://www.icdd.com/index.htm), both ceramic porous bodies were made of Quarts (SiO ₂ , mark ● in the figure) and Hematite (Fe ₂ O ₃ ) was found to be contained. Further, as shown in FIG. 2, the ceramic porous body fired at 1,000 ° C. has many Microclines (K _0.94 Na _0.06 Al _1.01 Si _2.99 O ₈ , ▼ in the figure), and as shown in FIG. When fired at 1,100 ° C., it was found that the structure had a lot of Mullite (Al _4.68 Si _1.32 O _9.66 , ▲ in the figure). This suggests that there exists a ceramic with a crystalline structure suitable for microbial habitat.

  In order to confirm the inhabitability of microorganisms by the ceramic porous body according to the present invention, an experiment was conducted by attaching bacteria to the above-described test piece. As the microorganism, lactic acid bacteria isolated from the bed of Kimura pickles Miyazaki Kogyo Co., Ltd. were used. Kimura pickles Miyazaki Kogyo Co., Ltd. bed was appropriately diluted with physiological saline and smeared on five types of agar plates (MRS medium, GYP medium, XYP medium, FYP medium and MYP medium) shown in FIG. The agar plate medium was cultured at 30 ° C. for 5 days, and the number of colonies formed was counted to calculate the number of viable bacteria per bed unit weight (colony forming unit, CFU). The isolate was observed under an optical microscope, and cell morphology and size were measured.

As a result of the colony counting, as shown in FIG. 4, it was found that 10 ⁶ CFU or more of lactic acid bacteria per g weight existed on the bed.

Forty strains isolated from the above-mentioned GYP medium were randomly selected and cultured in MRS liquid medium (Difco) to recover the cells. When one of the collected microbial cells was observed with a microscope, this strain was a catalase-negative gonococcus, and as shown in FIG. 5, the average cell diameter was 1 to 2 micrometers. In addition, this strain extends to 4 to 5 micrometers depending on cells. In the present invention, this strain is defined as GYP-74 strain.
Now, genomic DNA was extracted from the cultured cells using the phenol / chloroform extraction method. Using this extracted DNA as a template, 16sRDNA gene was amplified by PCR using two primers (27f [AGAGTTTGATCCTGGCTCAG], 1525r [AAAGGAGGTGATCCAGCC]). The PCR product was purified by PEG precipitation, and the base sequence was analyzed using Applied Biosystems 3730xl DNA analyzer (manufactured by Macrogen Japan Co., Ltd.). The primer 27f was used for the sequence analysis, and the primer 1525r was also used for the GYP-74 strain. Based on the obtained sequence information, a Blast search was performed and related species were estimated. FIG. 6 shows a BLAST search result using the 16S rRNA gene base sequence (500 to 600 bp) of the GYP-74 strain, FIG. 7 shows a BLAST search result using the 16S rRNA gene base sequence (1449 bp) of the GYP-74 strain, and FIG. This shows the 16S rRNA gene base sequence (1449 bp) of -74 strain.

  As shown in FIGS. 6 to 8, all the isolated lactic acid bacteria belong to the genus Lactobacillus, and the GYP-74 strain subjected to the Blast search with almost the full length of the 16s rRNA gene is presumed to be closely related to Lactobacillus namurensis or Lactobacillus acidifarinae. It was.

From the Blast search shown in FIG. 6, the GYP-74 strain was selected as a group of lactic acid bacteria composed of the genus Lactobacillus presumed to be dominant in the bed, and this was used as a subsequent test strain. The 14 types of test pieces described above were used for the lactic acid bacteria adhesion test. 5 ml of 1/100 concentration MRA medium was prepared in a screw-cap test tube, each test piece (≈5 mm * 5 mm) was accommodated, and sterilized by an autoclave. To this, GYP-74 strain cultured in MRS liquid medium and washed with physiological saline was added to the solution so as to be 10 ⁵ / ml. The test tube was incubated at 27 ° C. for 45 hours, and the number of adherent bacteria on the test piece was measured. For the measurement, first, the test piece was finely crushed with a sterilized mortar, serially diluted with physiological saline, and the number of viable bacteria was calculated according to a conventional method using MRS agar plate medium. The results are shown in FIG. However, among the test pieces shown in Table 2, the test was performed except for the test piece having a firing temperature of 1,000 ° C., a pulverized particle size of 0.2 mm, and a POM resin content of 30%. As shown in FIG. 9, it was confirmed that lactic acid bacteria adhered to the test piece. Moreover, although the viable count was calculated in the same procedure for the silicon piece as a control group with the test piece, no adhesion of lactic acid bacteria was observed on the silicon piece. Furthermore, it was confirmed that the number of adherent bacteria increased significantly with respect to the test piece produced at a firing temperature of 1,100 ° C. rather than 1,000 ° C.

  As described above, from the results of Examples, it was found that the furnace atmosphere during firing was favorable at 1,100 ° C. as a method for producing a ceramic porous body for pickled lactic acid bacteria. As shown in FIG. 9, the ceramic porous body fired at 1,100 ° C. rather than 1,000 ° C. has a high adhesion number of lactic acid bacteria. The reason is that the ceramic porous body fired at 1,100 ° C. As shown in FIG. 2, it is considered that the pore distribution is 1 μm or more, and that the pore distribution is optimal from the relationship with the size of lactic acid bacteria. Further, as shown in FIG. 3, the X-ray diffraction pattern of the ceramic porous body at 1,100 ° C. suggested that it had a crystal structure suitable for the growth of microorganisms.

  In order to confirm that the lactic acid bacteria are attached to the ceramic porous body for pickled lactic acid bacteria according to the present invention, among the above test pieces, the firing temperature is 1,100 ° C., the pulverized particle size is 0.2 mm, and the POM resin is contained Those having a rate of 30% were visually confirmed using a scanning electron microscope (SEM) after drying with a freeze-drying apparatus. FIG. 10 is a photograph at that time, and it can be confirmed that lactic acid bacteria are present in the indentations and gaps of the test piece. In particular, in FIG. 10, many lactic acid bacteria can be confirmed in the pores of about 10 micrometers on the left side from the center, the pores from the upper right to the lower side, and the pores on the lower left, and the other surface portions are not much attached. There wasn't. In addition, in FIG. 10, the lower right groove was artificially formed at the time of taking a picture, so no lactic acid bacteria were taken.

[General]
As can be said from FIG. 1 to FIG. 9, the size of lactic acid bacteria is an average of 1 to 2 micrometers, and some strains extend to 4 to 5 micrometers. As described above, the porosity is smaller at 1,100 ° C. than 1,000 ° C., but the distribution at 1,100 ° C. is less than 1 μm less than 1,000 ° C., and the porosity is smaller than 1 μm. There are many pore distributions. That is, it is difficult for lactic acid bacteria to adhere to pores of 1 micrometer or less, which is smaller than the size of lactic acid bacteria, but there are many pores of 1 micrometer or more that are the same as or larger than the size of lactic acid bacteria, and prefers 1,100 ° C. It is attached.

  Further, when viewed at a firing temperature of 1,000 ° C., FIG. 9 (A: clay only, H: pulverized particle size 0.2 to 0.5 mm, POM resin content 10%, I: pulverized particle size 0.2 to From 0.5 mm, the POM resin content is 20%, J: the pulverized particle size is 0.2 to 0.5 mm, and the POM resin content is 30%. As the mixing ratio of organic materials increases, that is, the porosity increases. It turns out that there are many lactic acid bacteria adhesion numbers. From FIG. 1, when the firing temperature is 1,000 ° C. and clay alone, the pore distribution is less than 1 micrometer, but when the firing temperature is 1,000 ° C., the organic material is 20%, and the pulverized particle size is 0.2 to 0.5 mm. Since there are many pore distributions of 1 micrometer or more, lactic acid bacteria are easy to adhere to the pore distribution of 1 micrometer or more. By adjusting the particle size, mixing rate, and firing temperature of the organic material mixed with clay, it is possible to control the pore distribution in the structure of the ceramic porous body, and the ceramic pore has an optimal pore distribution for adhesion of lactic acid bacteria. The body can be made.

  In FIG. 9, lactic acid bacteria are more adhered at 1,100 ° C. than at 1,000 ° C., but at 1,100 ° C., the crystal structure contains more mullite. By adjusting the firing temperature to 1,100 ° C., a ceramic porous body having a crystal structure optimum for the growth of lactic acid bacteria containing mullite can be produced.

Finally, the manufacturing process of the ceramic porous body in the present invention is summarized as the following process.
(1) A process of drying Miyazaki prefecture-made clay, followed by pulverization using a pulverizer and passing through a 0.5 mm mesh sieve to make the particle size 0.5 mm or less.
(2) A step in which an organic material such as POM resin is immersed in liquid nitrogen and cooled, and then pulverized using a pulverizer and passed through a 0.5 mm mesh sieve to make the particle size 0.5 mm or less.
(3) A step of mixing the clay obtained in (1) and the organic material obtained in (2) so that the content of the organic material is 10 to 30 mass% with respect to the total mass of the raw material.
(4) A step of firing the mixture obtained in the above (3) in a furnace atmosphere at 1,000 ° C. to 1,100 ° C.
The ceramic porous body obtained through these steps is not limited to a container shape as shown in the above-described embodiments. For example, in the step (4), a small piece of a size that can be put into a container is molded and fired, and then put into a pickled container for use. Moreover, it adds that the ceramic porous body in this invention is not limited to a container shape.

Claims (9)

  A ceramic porous body for pickled lactic acid bacteria characterized by firing clay and having pores on the surface or in the internal structure.   2. The ceramic porous body for pickled lactic acid bacteria according to claim 1, wherein the surface or internal tissue has pores having a diameter of 1 to 100 micrometers.   The ceramic porous body for pickled lactic acid bacteria according to claim 1 or 2, wherein the crystal structure contains at least one of Microcline and Mullite.   The ceramic porous body for pickled lactic acid bacteria according to claim 3, wherein the crystal structure contains Quarts and Hematite.   The ceramic porous body for pickled lactic acid bacteria according to any one of claims 1 to 4, which is fired by adding clay and an organic material.   6. The ceramic porous body for pickled lactic acid bacteria according to claim 5, wherein the clay and the organic material are sorted into particles having a particle size of 0.5 mm or less.   The ceramic porous body for pickled lactic acid bacteria according to claim 5 or 6, wherein the content of the organic material is 10 to 30 mass%.   The ceramic porous body for pickled lactic acid bacteria according to any one of claims 1 to 7, wherein the clay is clay produced in Miyazaki Prefecture.   After drying the clay produced in Miyazaki Prefecture, it is pulverized using a pulverizer, passed through a 0.5 mm mesh sieve to make the particle size 0.5 mm or less, and the organic material is immersed in liquid nitrogen. After cooling, and then crushing using a pulverizer, passing through a sieve of 0.5 mm mesh, the particle size is 0.5 mm or less, and the Miyazaki Prefecture clay obtained in the first step And a third step of mixing the organic material obtained in the second step so that the content of the organic material is 10 to 30 mass% with respect to the total mass of the raw material, and the mixture in the furnace atmosphere A method for producing a ceramic porous body for pickled lactic acid bacteria, comprising a fourth step of firing at 1,000 to 1,100 ° C.