JP2017122065A - Cell adhesion molecule expression inhibitor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a cell adhesion molecule expression inhibitor characterized by containing Ganoderma lucidum.SOLUTION: Since Ganoderma lucidum exhibits cell adhesion molecule expression inhibitory action, it can be utilized as a pharmaceutical, quasi-drug or food having excellent cell adhesion molecule expression inhibitory action. Furthermore, since Ganoderma lucidum has monocyte adhesion inhibitory action to vascular endothelial cells and vascular endothelial cell dysfunction inhibitory action, it can also be utilized as a pharmaceutical, quasi-drug or food having a prevention action against arteriosclerosis or acute upper respiratory inflammation.SELECTED DRAWING: None

Description

The present invention relates to a cell adhesion molecule expression inhibitor comprising ganoderma.

Cell adhesion molecules are molecules responsible for adhesion between cells or between cells and viruses and extracellular matrix. Intercellular adhesion molecules (ICAM), vascular cell adhesion molecules (VCAM), and vascular cell adhesion molecules (VCAM), There are many types such as selectins, cadherins and integrins. Its functions range from maintenance of cell morphology and tissue structure, signal transduction, viral and bacterial receptors, arteriosclerosis, acute upper respiratory inflammation, rheumatism, collagen disease, type 1 diabetes, multiple sclerosis, viral hepatitis The relationship with other diseases has also been reported (Non-patent Document 1).

The vascular endothelium is a cell layer constituting the inner wall of a blood vessel including arteries and veins, and the cells constituting the vascular endothelium are called vascular endothelial cells. Vascular endothelial cells are important cells that maintain vascular function and vascular homeostasis by regulating vasodilation, angiogenesis, hemostatic response, inflammatory response, and the like. One of the main functions is to produce nitric oxide by the action of endothelial nitric oxide synthase (eNOS), thereby regulating blood vessel properties such as contraction, expansion, elasticity, and permeability. There is work to do. In addition, vascular endothelial cells regulate blood coagulation and blood pressure by producing prostacyclin, tissue plasminogen activator, thrombomodulin, and bradykinin. In addition, cell adhesion molecules such as ICAM, VCAM, and selectin expressed by vascular endothelial cells, monocyte chemotactic protein (MCP) and plasminogen activator inhibitor (PAI: Plasminogen Activator Inhibitor) are angiogenic. And plays an important role in wound healing. MCP acts on the migration of monocytes to vascular endothelial cells, and PAI is a molecule that promotes blood coagulation by loss of tissue plasminogen activator activity.

However, when inflammatory cytokines in the blood (interleukin, tumor necrosis factor, etc.), oxidized LDL (Low Density Lipoprotein), and oxidative stress increase, expression of cell adhesion molecules, MCP, PAI and expression of eNOS in vascular endothelial cells A decrease occurs. As a result, the state in which the vascular function cannot be maintained is vascular endothelial cell dysfunction, which causes arteriosclerosis (Non-Patent Documents 2 and 3).

Arteriosclerosis progresses from hypercholesterolemia and diabetes and causes myocardial infarction, stroke, cerebral thrombus, cerebral hemorrhage, subarachnoid hemorrhage and the like. Atherosclerosis, a type of arteriosclerosis, progresses when atheromatous plaques (bulges) develop inside the blood vessels of relatively large arteries and become enlarged. So far, increased blood cholesterol levels and deposition on vascular endothelium have been considered as the main cause of arteriosclerosis, but recent studies have revealed the importance of vascular endothelial cell dysfunction. When vascular endothelial cell dysfunction occurs, monocytes in the blood adhere to the surface of vascular endothelial cells due to increased expression of ICAM, VCAM, selectin, MCP, PAI, etc., and decreased expression of eNOS, and subsequently to the vascular endothelial cells Infiltration occurs. Infiltrated monocytes are transformed into macrophages, phagocytosing oxidized LDL and taken up into macrophages. When macrophages foamed by excessive uptake of oxidized LDL are deposited on the vascular intima, thickening of the vascular intima results in blood flow inhibition and vascular occlusion, leading to arteriosclerosis. Therefore, prevention of arteriosclerosis by suppressing vascular endothelial cell dysfunction has also been proposed (Patent Documents 1, 2, and 3).

ICAM is one of the immunoglobulin superfamily cell adhesion molecules and is expressed in vascular endothelial cells and airway epithelial cells, and its expression is increased by the action of inflammatory cytokines. ICAM expressed in vascular endothelial cells contributes to the progression of arteriosclerosis. In addition, ICAM expressed in airway epithelial cells binds to rhinovirus that causes inflammation in the upper respiratory tract such as the nose and throat. Rhinovirus is a pathogenic virus of acute upper respiratory tract inflammation (cold, common cold), accounts for 50% of the causes of acute upper respiratory tract inflammation, and is also known to be involved in exacerbation of asthma in children (non-patent literature) 4). Therefore, rhinovirus infection prevention has an important role in preventing acute upper respiratory tract inflammation, and it is said that acute upper respiratory tract inflammation can be prevented by suppressing ICAM (Non-patent Document 5).

As a pharmacological action of ganoderma, cholesterol absorption inhibitor characterized by containing ganoderma extract (Patent Document 4), LDL receptor synthesis promoter characterized by containing ganoderma extract (patent document 4) Reference 5) has been reported. Patent Document 4 shows an action to suppress the absorption of diet-derived cholesterol in the intestinal tract using the action of suppressing the uptake of cholesterol into lipid micelles. However, Patent Document 4 does not describe a cell adhesion molecule expression inhibitory action and a vascular endothelial cell dysfunction inhibitory action in vascular endothelial cells and airway epithelial cells, and there is no expression suggesting these actions. Furthermore, since the organ on which patent document 4 acts is an intestinal tract and is an organ different from the blood vessel or upper airway of the present invention, the present invention cannot be conceived from patent document 4. Patent Document 5 shows an action of promoting LDL receptor synthesis in the liver. However, Patent Document 5 does not describe cell adhesion molecule expression inhibitory action and vascular endothelial cell dysfunction inhibitory action in vascular endothelial cells and airway epithelial cells, and there is no expression suggesting these actions. Furthermore, since the organ which patent document 5 acts on is a liver and is an organ different from the blood vessel or upper respiratory tract of the present invention, the present invention cannot be conceived from patent document 5.
Patent No. 5060136 JP 2011-219434 A Japanese Patent No. 5774839 JP2015-17043A JP 2010-208965 A Occupational Medical University magazine. 2001 23 (4): 421-429 Circulation. 2004 Jun 15; 109 (23 Suppl III): III27-32. Eur J Inter Med. 2002 May; 13 (3): 185-189 Am J Med. 2002 Apr 22; 112 Suppl 6A: 4S-12S. Cell. 1989 Mar 10; 56 (5): 839-47

The present invention relates to a cell adhesion molecule expression inhibitor containing ganoderma. More specifically, the present invention relates to a vascular endothelial cell dysfunction inhibitor, a preventive agent for arteriosclerosis or acute upper respiratory tract inflammation, characterized by containing ganoderma.

As a result of intensive studies, the present inventors have found that Ganoderma has a cell adhesion molecule expression inhibitory effect, a vascular endothelial cell dysfunction inhibitory effect, arteriosclerosis or acute upper respiratory tract preventive action.

Ganoderma used in the present invention is a mushroom belonging to the family Basidiomycete Ganodermataceae, Ganoderma, and according to Chinese old pharmacological books “Honcho Tuname” and “Shinnohonsakukei”, Ganoderma (Akashiba) , Black ganoderma (black turf), purple ganoderma (purple turf), blue ganoderma (blue turf), yellow ganoderma (yellow turf) and white ganoderma (white turf) are known. In the present invention, all mushrooms belonging to the family Amanitaceae can be used, preferably ganoderma, black ganoderma, purple ganoderma, blue ganoderma, yellow ganoderma, white ganoderma, and more preferably ganoderma. It is desirable to use (Akashiba, Ganoderma lucidum) or black reishi (Ganoderma sinensis, Ganoderma atom).

Ganoderma used in the present invention can be used regardless of fruiting bodies, spores, mycelium, natural products, cultivated products, cultures, etc., and those widely distributed in China, the Japanese market, etc. should be used. it can. Moreover, the state as it is, a crushed material, a dried material, etc. can be selected suitably as needed, and it can attach | subject to extraction operation. Examples of methods for obtaining broken wall spores include atomization treatment, roll press treatment, attrition treatment, ultra-high pressure micro steam treatment, and other mechanical methods commonly used in industry.

For the ganoderma used in the present invention, water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1, 3) are used as extraction solvents. -Butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), ethers (ethyl) Ether, tetrahydrofuran, propyl ether, etc.) can be used. These solvents may be used alone or in combination of two or more.

The amount of ganoderma used in the present invention varies depending on the administration form, purpose of use, age, body weight, etc., but is converted to a dry product of 1 to 20000 mg / day, preferably 10 to 10000 mg / day, more preferably 50 to It can be orally administered once to several times a day within a range of 5000 mg / day. An amount smaller than the above dosage range may be sufficient, or it may be necessary to administer beyond the range. In addition, the method for adding medicinal ingredients in the formulation may be added in advance or during production, and may be appropriately selected in consideration of workability.

Cell adhesion molecules related to the present invention include ICAM, VCAM, selectin, cadherin, nectin, platelet endothelial cell adhesion molecule, nerve cell adhesion molecule, integrin, fibronectin, laminin, vitronectin, tenascin, fibrinogen, desmoglein, connexin, neuroligin, Neulexin, contactin, claudin, occludin, hemagglutinin, lectin and the like can be targeted. Among them, ICAM is the most important cell adhesion molecule in the onset and prevention of arteriosclerosis or acute upper respiratory tract inflammation.

The cell adhesion molecule expression inhibitor of the present invention can be used for any of foods, quasi drugs, and pharmaceuticals. The dosage forms include powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions and the like for oral use. Moreover, it can also be set as an injection, a suppository, etc. for parenteral use.

The cell adhesion molecule expression inhibitor of the present invention may use ganoderma as it is, as long as it does not impair the effect, if necessary, excipients used for ordinary pharmaceuticals, quasi drugs or foods, It can also contain components such as stabilizers, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives, fragrances and the like.

The inhibitor of cell adhesion molecule expression characterized by containing ganoderma of the present invention has an inhibitory effect on vascular endothelial cell dysfunction, arteriosclerosis or acute upper respiratory tract inflammation.

Production Example 1 Ganoderma lucidum extract Ganoderma lucidum was added to 400 g of purified water, extracted at 95-100 ° C. for 2 hours, filtered, and the filtrate was concentrated and lyophilized. 1.4 g of Ganoderma hot water extract was obtained.

Production Example 2 Ganoderma ethanol extract To 100 g of dried ganoderma lucidum, 900 mL of ethanol was added, extracted at room temperature for 7 days, filtered, the filtrate was concentrated to dryness, and Ganoderma ethanol extract 1.6g was obtained.

Production Example 3 Black Ganoderma Hot Water Extract
400 g of purified water is added to 20 g of dried ganoderma sinensis, extracted at 95-100 ° C. for 2 hours, filtered, the filtrate is concentrated, freeze-dried and extracted from black ganoderma hot water. 1.1 g was obtained.

Production Example 4 Black Ganoderma Ethanol Extract
900 g of ethanol was added to 100 g of dried ganoderma sinensis, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness to obtain 1.4 g of black ganoderma ethanol extract. .

Production Example 5 Ganoderma lucidum spore dried product 20 g is treated by atomization, 400 mL of purified water is added, extracted at 95-100 ° C. for 2 hours, filtered and filtered. Was concentrated and freeze-dried to obtain 1.2 g of a reishi spore hot water extract.

Production Example 6 Ganoderma spore ethanol extract 100 g of dried spore of Ganoderma lucidum was atomized, 900 mL of ethanol was added, extracted at room temperature for 7 days, filtered, and the filtrate was concentrated to dryness. Thus, 1.5 g of Ganoderma spore ethanol extract was obtained.

Examples will be given to describe the present invention in detail, but the present invention is not limited thereto. In the examples,% indicates% by weight.

Soft capsule <Prescription>
Component Content (%)
1. Reishi hot water extract (Production Example 1) 30.0
2. Rice germ oil 60.0
3. Beeswah 7.0
4). Vitamin E 3.0
<Manufacturing method>
Ingredients 1 to 4 are mixed, and 250 mg is filled into a film composed of gelatin, glycerin, and caramel pigment, and after drying, a soft capsule is obtained.
<Usage>
Ingest 4 tablets per day.

Hard capsule <Prescription>
Component Content (%)
1. Black Ganoderma Hot Water Extract (Production Example 3) 20.0
2. Cornstarch 72.0
3. Sucrose fatty acid ester 8.0
<Manufacturing method>
Ingredients 1 to 3 are mixed and 250 mg is filled into a No. 2 hard capsule to obtain a capsule.
<Usage>
Ingest 4 tablets per day.

Beverage <Prescription>
Component Content (%)
1. Reishi hot water extract (Production Example 1) 0.5
2. Citric acid 6.0
3. Sucrose 10.0
4). Fragrance 1.0
5. Water 82.5
<Manufacturing method>
Components 1 to 4 are stirred and dissolved in a part of the component 5 water. Next, the remaining water of component 5 is added and mixed, and the sterilized product is used as a beverage.
<Usage>
Take 50 mL per day.

Granule <Prescription>
Component Content (%)
1. Ganoderma ethanol extract (Production Example 2) 8.0
2. Lactose 80.0
3. Cellulose 12.0
<Manufacturing method>
Components 1 to 3 are granulated by a dry method to obtain granules.
<Usage>
Take 1g per day.

Tablet <Prescription>
Component Content (%)
1. Reishi Spore Hot Water Extract (Production Example 5) 11.0
2. Lactose 60.0
3. Reduced maltose starch syrup 25.0
4). Sucrose fatty acid ester 4.0
<Manufacturing method>
Ingredients 1 to 4 are mixed and tableted to obtain 0.5 g of a tablet.
<Usage>
Take 2 capsules per day.

Jelly <Prescription>
Component Content (%)
1. Black Ganoderma Ethanol Extract (Production Example 4) 0.1
2. Carrageenan 2.0
3. Gelatin 1.0
4). 28.5 sugar
5. Purified water 68.4
<Manufacturing method>
Ingredients 1-5 are mixed, boiled with heating, poured into a jelly mold and cooled.
<Usage>
Take 1 (100g) per day.
Comparative Example 1

Conventional Soft Capsule The same soft capsule as in Example 1 except that the ganoderma hot water extract was replaced with rice germ oil was used as the conventional soft capsule.

Test Example 1 Cell adhesion molecule expression suppression test The cells were cultured using vascular endothelial cells HUVEC (Kurabo) and the medium was Humedia-EG2 (Kurabo). As a substance that induces vascular endothelial cell dysfunction to confluent HUVEC, 7-ketocholesterol contained in oxidized LDL is 7.5 μg / mL, and Ganoderma hot water extract (Production Example 1) is 1 mg / mL. Were added and cultured. The collected cells were then sonicated and separated by SDS polyacrylamide gel electrophoresis. After separation, it was transferred to an Immunobilon-P membrane (Millipore), blocked, and reacted with an anti-ICAM-1 antibody (rabbit polyclonal antibody, Proteintech) and an anti-rabbit IgG antibody (goat polyclonal antibody, Rockland). Subsequently, the fluorescence signal emitted by ECL Prime Western Blotting Detection Reagent (GE Healthcare) was detected with Light Capture AE6792 (ATTO) and quantified with CS Analyzer (ATTO). Further, β-actin was quantified by the same method using anti-β-actin antibody (mouse monoclonal antibody, Abcam) and anti-mouse IgG antibody (horse polyclonal antibody, Vector Laboratories), and ICAM-1 and β-actin were quantified. From the ratio, the expression level of ICAM-1 protein was calculated. And the protein expression level ratio at the time of adding 7-ketocholesterol and Ganoderma hydrothermal extract was calculated by setting the protein expression level without 7-ketocholesterol as 1.

The results of Test Example 1 are shown in Table 1. Ganoderma hot water extract suppressed the expression level of ICAM-1 protein. Therefore, it was shown that Ganoderma hot water extract has a cell adhesion molecule expression inhibitory effect.

In addition, in the cell adhesion molecule expression suppression test of Test Example 1, the same effect was obtained in any case where the Ganoderma hot water extract was replaced with the Ganoderma extract of Production Examples 2-6. The same effect was obtained when HUVEC was replaced with airway epithelial cells HSAEpC (Promo Cell). From the above results, a preventive action against arteriosclerosis or acute upper respiratory tract inflammation due to ganoderma can be expected.

Test Example 2 Vascular endothelial cell dysfunction inhibition test cells were cultured using vascular endothelial cells HUVEC (Kurabo), and the medium was Humedia-EG2 (Kurabo). Confluent HUVEC, 7-ketocholesterol 10 μg / mL, Ganoderma hot water extract (Production Example 1), Black ganoderma hot water extract (Production Example 3), or Ganoderma spore hot water extract (Production Example 5) was added to 1 mg / mL and cultured for 24 hours. RNA was extracted using RNAiso Plus (Takara Bio Inc.), and a cDNA solution was prepared using High Capacity RNA-to-cDNA Kit (Life Technologies Japan Inc.). Using the prepared cDNA, gene expression analysis was performed by a real-time PCR method using Step One Plus (Applied Biosystems). Gene expression analysis was performed with ICAM-1, VCAM-1, selectin, PAI-1, MCP-1, and eNOS, which are genes associated with vascular endothelial cell dysfunction. At that time, the expression level was calculated from the ratio of the target gene and GAPDH using GAPDH (Glyceraldehyde-3 Phosphate Dehydrogenase) as an internal standard. Then, assuming that the gene expression level fluctuated by 7-ketocholesterol was 1, the ratio of gene expression level when adding the reishi hot water extract, black ganoderma hot water extract, and reishi spore hot water extract was calculated. . The primers used for gene expression analysis are as follows.

Primer set CCGGTATGAGATTGTCATCATCA for ICAM-1 (SEQ ID NO: 1)
GGCCTGCAGTGCCCATTAGA (SEQ ID NO: 2)
Primer set CAAATCCTTGATACTGCTCATC for VCAM-1 (SEQ ID NO: 3)
TTGACTTCTTGCTCCACAGC (SEQ ID NO: 4)
Primer set CTGCCTGTTACAATACATCC for selectin (SEQ ID NO: 5)
CAGTTTCACAATTTGCTCACAC (SEQ ID NO: 6)
Primer set CGTGGTTTTCTCACCCTATGG for PAI-1 (SEQ ID NO: 7)
CTGGGTTTCTCCTCCTGTTGTC (SEQ ID NO: 8)
Primer set TCAGCCGATAGGCATCAATGC for MCP-1 (SEQ ID NO: 9)
GGACACTTGCTGCTGGTGATTC (SEQ ID NO: 10)
Primer set CCTGTGTATGGATGAGTATGAC for eNOS (SEQ ID NO: 11)
CGGATCTTATAACTCTTGTGCT (SEQ ID NO: 12)
GAPDH primer set TGCACCACCAACTGCCTTAGC (SEQ ID NO: 13)
TCTTCTGGGGTGCAGTGATG (SEQ ID NO: 14)

The results of Test Example 2 are shown in Table 2. Ganoderma hot water extract, Black ganoderma hot water extract, and Ganoderma spore hot water extract reduced the gene expression levels of ICAM-1, VCAM-1, selectin, PAI-1, and MCP-1, and eNOS The gene expression level increased. In addition, Table 3 shows the results when the Ganoderma hot water extract and the Black Ganoderma hot water extract were added simultaneously. The gene expression levels of ICAM-1, VCAM-1, and selectin were more markedly decreased when the Ganoderma hot water extract and the black ganoderma hot water extract were added simultaneously rather than individually. Therefore, it was shown that the Ganoderma hot water extract, the black ganoderma hot water extract, and the Ganoderma spore hot water extract have a vascular endothelial cell dysfunction inhibitory action. Moreover, it was shown that the combined use of Ganoderma hot water extract and Black Ganoderma hot water extract has a higher inhibitory effect on vascular endothelial cell dysfunction.

In the vascular endothelial cell dysfunction inhibition test of Test Example 2, Ganoderma hot water extract, Black Ganoderma hot water extract, and Ganoderma spore hot water extract were used. The same effect was obtained in any case where the product was replaced. From the above results, it can be expected that Ganoderma will prevent arteriosclerosis.

Test Example 3 Inhibition of monocyte adhesion to vascular endothelial cells Cell culture was performed using vascular endothelial cells HUVEC (Kurabo) as the medium and Humedia-EG2 (Kurabo) as the medium. 7-ketocholesterol (7.5 μg / mL) and Ganoderma hot water extract (Production Example 1) were added to confluent HUVEC at 1 mg / mL and cultured for 24 hours. Subsequently, monocyte THP-1 (RIKEN BioResource Center) labeled with BCECF (2 ′, 7′-Bis (carboxyethyl) -4 or 5-carboxyfluorescein, Dojindo Laboratories Inc.) was added and cultured for 4 hours. . After culture, unadhered THP-1 was removed, and the number of adhered monocytes was compared by measuring the fluorescence intensity with SPECTRA MAX GEMIN EM (Molecular Device Japan).

As a result of Test Example 3, the fluorescence intensity was reduced by the Ganoderma hot water extract, indicating that the Ganoderma hot water extract has an action of suppressing monocyte adhesion to vascular endothelial cells.

In addition, in the monocyte adhesion suppression test for vascular endothelial cells in Test Example 3, the same effect was obtained in any case where Ganoderma hot water extract was replaced with Ganoderma extract of Production Examples 2-6. . From the above results, it can be expected that Ganoderma will prevent arteriosclerosis.

Test Example 4 Examination of the preventive action of acute upper respiratory tract 20 healthy men and women (27-62 years old) were divided into 10 control groups and test groups, and the control group was divided into conventional soft capsules (Comparative Example 1), The test group uses a soft capsule containing ganoderma (Example 1) and ingests 4 capsules once a day for 3 months from December to February. A questionnaire was conducted regarding the number of cases of inflammation and subjective symptoms at the time of the onset. In the questionnaire, regarding the degree of subjective symptoms at the time of illness, there are three levels of answers: “A little”, “A”, “Terrible”, “A little”, 1 “A”, 2 “Awful” As a point, the average score of the degree of subjective symptoms per disease during the period was calculated.

Table 4 shows the results of the questionnaire regarding the number of cases of acute upper respiratory tract inflammation in Test Example 4. As a result, comparing the number of affected cases of acute upper respiratory tract in the group that took the soft capsule containing ganoderma and the group that took the conventional soft capsule, the group that took the soft capsule containing ganoderma The number of cases of acute upper respiratory tract inflammation decreased. Table 5 shows the results of the questionnaire regarding the subjective symptoms of Test Example 4. As a result, when comparing the degree of subjective symptoms per disease between the group that took a soft capsule containing ganoderma and the group that took a conventional soft capsule, it took a soft capsule containing ganoderma The average score of the degree of subjective symptoms per affected person decreased in the group. In other words, it was shown that Ganoderma has a preventive action against acute upper respiratory tract inflammation. During the study period, none of the subjects complained of deterioration in physical condition other than acute upper respiratory tract inflammation such as sore throat and cough.

From the above results, it was shown that Ganoderma has a cell adhesion molecule expression inhibitory action, a vascular endothelial cell dysfunction inhibitory action, an arteriosclerosis or an acute upper respiratory tract preventive action.

The cell adhesion molecule expression inhibitor of the present invention showed an excellent cell adhesion molecule expression inhibitory action. Therefore, it is useful for use as a pharmaceutical, quasi-drug or food having a safe and excellent cell adhesion molecule expression-suppressing action.

Claims (8)

A cell adhesion molecule expression inhibitor comprising ganoderma. The cell adhesion molecule expression inhibitor according to claim 1, wherein the cell adhesion molecule is an intercellular adhesion molecule (ICAM). A monocyte chemotactic protein (MCP) expression inhibitor characterized by containing reishi. A plasminogen activator inhibitor (PAI) expression inhibitor comprising ganoderma. An endothelial nitric oxide synthase (eNOS) expression promoter characterized by containing ganoderma. An inhibitor of monocyte adhesion to vascular endothelial cells, comprising ganoderma. The vascular endothelial cell dysfunction inhibitor according to claim 1, comprising ganoderma. The preventive agent for arteriosclerosis or acute upper respiratory tract inflammation according to claim 1, comprising ganoderma.