JP2017108749A - Proximity extension assay using exonuclease - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a detection assay using a proximity probe for an analyte in a sample in the improvement of reducing a non-specific "background" signal.SOLUTION: A method for detecting an analyte in a sample is provided that comprises: (a) contacting the sample with at least one set of at least a first and a second proximity probes which each comprise an analyte-binding domain and a nucleic acid domain and which can simultaneously bind to the analyte; (b) allowing the nucleic acid domains of the proximity probes to interact with each other upon binding of the proximity probes to the analyte, wherein the interaction comprises the formation of a duplex; (c) contacting the sample with a component comprising 3' exonuclease activity; (d) extending the 3' end of at least one nucleic acid domain of the duplex to generate an extension product, wherein the step may occur contemporaneously with or after step (c); and (e) amplifying and detecting the extension product.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a proximity probe based detection assay (“proximity assay”), particularly a proximity probe extension assay (PEA), for an analyte in a sample. In particular, the present invention relates to an improvement in the method that reduces non-specific “background” signals that occur in all types of samples and are particularly problematic in complex biological samples. Said improvement comprises using a component comprising 3 'exonuclease activity in such an assay.

  Proximity probe extension assays use a proximity probe that binds to the analyte, which has a nucleic acid domain (or tag) that interacts in a proximity-dependent manner upon binding to the analyte. The interaction can extend at least one of the nucleic acid domains from its 3 'end, generally through formation of one or more nucleic acid duplexes (by hybridization of the nucleic acid domains). This extension product forms a nucleic acid detection product or detection tag that is detectable and preferably amplifiable, which can be used to detect the analyte.

  In the present invention, a component containing 3 'exonuclease activity is added prior to or simultaneously with a component necessary for nucleic acid domain extension, such as a polymerase enzyme. Therefore, a component containing 3 'exonuclease activity is a free and unprotected nucleic acid domain with a 3' end, ie, a proximal probe that is not bound to the target analyte and therefore does not form a specific interaction or duplex The upper domain can be decomposed. In the present invention, the notable effect of including a component containing 3 ′ exonuclease activity is the generation of non-specific extension products from unhybridized or “non-duplex” nucleic acid domains. Hinder and increase both the specificity and sensitivity of the assay. The invention also provides kits comprising components comprising 3 'exonuclease activity for use in the methods of the invention.

  In general, proximity assays rely on the principle of “proximity probing”. In proximity probing, an analyte is bound by binding to multiple (ie, two or more, typically two or three) probes (and hence “proximity probes”) that generate signals when they are close together. Detected. In general, at least one proximal probe includes a nucleic acid domain (or site) linked to an analyte binding domain (or site) of the probe, and the generation of the signal may include between and / or the other nucleic acid site. It involves an interaction with another functional moiety held by the probe. Thus, the generation of the signal depends on the interaction between the probes (more specifically the nucleic acid sites / domains or other functional sites / domains held by them) and therefore both the required probes (or it) This only occurs when bound to the analyte, leading to improved specificity of the detection system. In recent years, the concept of proximity probing has evolved and many assays based on this principle are now known in the art. For example, a “proximity probe extension assay” or “proximity extension assay” (PEA) is a detectable signal that utilizes the extension of a nucleic acid domain, ie, the templated addition of nucleotides to the end of a nucleic acid molecule. Is a specific type of assay that produces

  Detection assays using proximity probes, particularly proximity extension assays, are fast and convenient by converting the presence of one or more analytes in a sample into a readily detectable or quantifiable nucleic acid based signal. With sensitivity it is possible to detect or quantify such analytes, which can be performed in a homogeneous or heterogeneous format.

  Proximity probes in the art are generally used in pairs, each consisting of an analyte binding domain that has specificity for a target analyte and a functional domain, eg, a nucleic acid domain linked to the analyte domain. The analyte binding domain can be, for example, a nucleic acid “aptamer” (Fredriksson et al (2002) Nat Biotech 20: 473-477) or can be of a proteinaceous nature, such as a monoclonal or polyclonal antibody (Gullberg et al. al (2004) Proc Natl Acad Sci USA 101: 8420-8424). Each analyte binding domain of each proximal probe pair may have specificity for a different binding site on the analyte, and the analyte may consist of a single molecule or a complex of interacting molecules, or, for example, When the target analyte is present as a multimer, it can have the same specificity. When adjacent probe pairs are in close proximity to each other (which occurs primarily when both bind to their respective sites on the same analyte molecule), functional domains (eg, nucleic acid domains) can interact. In the context of the present invention, for example, the nucleic acid domains may comprise regions that are complementary to each other. Therefore, the nucleic acid domains of adjacent probe pairs can hybridize to form a duplex. One or more domains can be extended by a polymerization reaction, usually using the nucleic acid domain of the other proximal probe as a template to form a new nucleic acid sequence. The new nucleic acid sequence generated thereby serves to report the presence or amount of the analyte in the sample, which can be detected qualitatively or quantitatively, for example by real-time quantitative PCR (q-PCR) Can do.

  There are many types of assays that use proximity probes. For example, WO 01/61037, US Pat. No. 6,511,809, and WO 2006/137932 describe a proximity extension assay, where the analyte is determined by a specific analyte-binding reagent for the assay using a proximity probe. Both first (immobilized to a solid substrate) and homogeneous (ie in solution) formats are described, for example, in WO 01/61037, WO 03/044231, WO 2005/123963, Fredriksson et al (2002) Nat Biotech 20: 473-477. And Gullberg et al (2004) Proc Natl Acad Sci USA 101: 8420-8424.

  Generally, proximity probes are used in pairs, but for example, WO01 / 61037, WO2005 / 123963, and WO2007 / 107743 describe modifications of the proximity probe detection assay, in which a single proximity probe is used with three proximity probes. Analyte molecules are detected. For example, a third proximity probe can be used to provide another nucleic acid domain capable of interacting with the nucleic acid domains of the first two proximity probes.

  In addition to changes in proximity probe detection assays, changes in the structure of the proximity probe itself are described, for example, in WO 03/044231, where multivalent proximity probes are used. Such multivalent proximity probes comprise at least two and at most 100 analyte binding domains conjugated to at least one, preferably two or more nucleic acids.

  Detection assays using proximity probes, particularly proximity extension assays, are used to detect proteins in many different applications specifically and with high sensitivity, for example, detection of low-expressing or low-abundance proteins. It has proven to be very useful. However, such assays are also problematic and there is room for improvement in terms of both assay specificity and sensitivity.

  For example, the sensitivity of a conventional proximity assay, such as the proximity extension assay described above, has two main factors: (i) the affinity of the analyte binding domain for the target analyte, and (ii) an unbound probe, particularly a probe. Limited by the non-specific background signal resulting from the random proximity of the pair. When using a probe having a binding domain with high affinity for the analyte, the sensitivity is limited to the detection of about 6000 molecules. Traditionally, very low concentrations of proximity probes had to be used to reduce the degree of background. This makes it impossible to compensate for probes containing analyte binding domains with low affinity by using higher concentrations of probes. Thus, it has been found that this can limit the sensitivity of the assay and the range over which quantitative results can be obtained.

  Other methods for reducing non-specific background signals, such as blocking reagents that bind to the free ends of nucleic acid domains on adjacent probes, for example, until replaced by displacer oligonucleotides, such as blocking oligonucleotides ( The use of blocking oligonucleotides has been proposed. Adding the displacer oligonucleotide after binding the proximity probe to the analyte means that the interaction of the proximity probe nucleic acid domains is likely only to occur for the proximity probe bound to the target analyte. Other methods for reducing the background signal are focused on improving the detection of nucleic acid extension products.

  However, there is still room to improve the extent of the background signal and 3 or before the extension reaction or simultaneously to overcome the above limitations of proximity assays, particularly proximity extension assays known in the art. 'It has now been found that the use of a component containing exonuclease activity significantly improves the specificity and sensitivity of the assay. Preferably, a component containing 3 'exonuclease activity is contacted with the sample simultaneously with a component used for nucleic acid domain extension, such as a polymerase enzyme. In a particularly preferred embodiment, the polymerase used for nucleic acid domain extension comprises 3 'exonuclease activity.

  Decomposing non-proximal nucleic acid domains (domains with free and unprotected 3 ′ ends), ie, forming (stable) sequence-specific duplexes with the nucleic acid domains of adjacent probes bound to the same target analyte By including in the assay components that are capable of degrading non-nucleic acid domains, non-specific background signals present in the assay can be reduced. In other words, the use of a component that includes 3 'exonuclease activity can be considered to reduce or inhibit the production of unwanted, undesired or non-specific extension products.

  The use of a component comprising 3 ′ exonuclease activity is known in the methods used to generate nucleic acid molecule extension products, but is not limited to methods for detecting an analyte in a sample, particularly the proximity extension assay of the present invention. The use of activity provides special unexpected advantages over assays using conventional proximity probes.

  In general, the components of the assay that use proximity probes are selected, among other things, to avoid degradation of other components in the assay. Generation of nucleic acid molecules that act as signals indicating the presence of a target analyte by degrading, destroying, or damaging some or all of the proximity probes, especially nucleic acid domains, for example by reducing the concentration of potential interaction partners Expected to be inhibited or prevented.

  Furthermore, the presence of such activity can be considered as an obstacle in further amplifying the nucleic acid product. That is, it is considered necessary to remove the activity in order to avoid degradation of the signal nucleic acid molecule or components necessary for the amplification reaction. The addition of additional steps to the analyte detection assay is generally undesirable because it reduces the simplicity of the method, making it more difficult to apply to automation and / or high throughput applications. Similarly, the addition of components to the assay is expected to reduce the sensitivity of the assay as sample complexity increases.

  However, the method of the present invention relies on the greatly reduced background (ie, increased signal-to-noise ratio) seen when a component containing 3 ′ exonuclease activity is contacted with a sample in PEA. . In particular, 3 'exonuclease activity is advantageously provided as part of the nucleic acid polymerase used to extend the nucleic acid domain of the proximal probe. Alternatively, or in addition, a component comprising 3 'exonuclease activity can be provided as a single component (ie, as a separate entity that is not part of or linked to the polymerase enzyme). Thus, it can be seen that the component comprising 3 'exonuclease activity can be contacted with the sample in any suitable form.

  While not wishing to be bound by theory, it is theoretically assumed that 3 ′ exonuclease activity can degrade nucleic acid domains having free and unprotected 3 ′ ends of unbound proximity probes. (Eg, when the nucleic acid domain is linked to the analyte binding domain by its 5 ′ end and the “free” 3 ′ end has not been denatured to resist 3 ′ exonuclease activity). In this regard, only duplexes formed between the nucleic acid domains of adjacent probes that are both bound to the target analyte can form a stable interaction (under the conditions of the assay, once the proximity probe binds to the target analyte. A stable, i.e. persistent or non-transient duplex will be formed, since it will not be easily separated from it). Duplex formation serves to protect the nucleic acid domain of the proximal probe from 3 'exonuclease activity. However, a proximity probe that is not bound to a target analyte cannot form a stable duplex, ie, a free / unbound probe (not bound to a target analyte) is a nucleic acid of another proximity probe. It only interacts temporarily with other components in the domain or sample (forms unstable and transient interactions or duplexes). As such, unbound probes in the assay are likely to be unhybridized at all times, and those unbound probes containing nucleic acid domains with free and unprotected 3 'ends are 3' exonucleases. It becomes a substrate for ingredients. Degradation of the nucleic acid domains of these unbound probes can be transient or non-specific when, for example, the unbound probe is sustainable, eg, with the nucleic acid domain of a proximal probe or other component in the sample. The extension product resulting from the duplex formed by the interaction of hinders the generation of non-specific extension products that can occur in the assay.

  The increased reduction of non-specific background signal in the proximity probe extension assay is brought about by the addition of this 3 'exonuclease component. As shown in more detail in the examples, the present invention represents a significant advance compared to proximity extension assays known in the art. Surprisingly, in the method of the invention using a component containing 3 ′ exonuclease activity, even if the sample already contains a high level of exonuclease activity, eg plasma, non-specific background activity. Reduction was observed. The addition of the 3 ′ exonuclease component resulted in an improved signal-to-noise ratio in assays performed with either sample containing the target analyte in buffer and plasma, which is completely unexpected. It was not something. Such a decrease in background signal increases both the specificity and sensitivity of the proximity probe detection assay.

  In addition, the methods disclosed herein also include simplified PEA, wherein the components used for amplification of the extension product are mixed with the components of the extension assay prior to inactivation of the component containing the 3 ′ exonuclease. can do. As explained below, components containing 3 ′ exonuclease activity are presumed to degrade certain components of the amplification reaction, such as PCR primers, so the addition of these components inactivates 3 ′ exonuclease activity. It can only be done after. However, the methods disclosed herein account for various component modifications that allow the reagents of both stages of the assay to be premixed. This advantageously results in a reduction in dispensing steps and a reduction in execution time, so that the assay can be easily automated and errors can be reduced.

  Thus, it can be seen that the present invention provides the use of a component comprising 3 'exonuclease activity in a proximity probe extension assay to detect an analyte in a sample. The extension product is then amplified and detected.

  More specifically, the extension product generation step in the proximity probe extension assay, more specifically the interaction of the nucleic acid domains of the proximity probes used in the proximity assay (such interactions are generally Hybridization, and subsequent extension of at least one domain, in general, a nucleic acid domain hybridizes such that one nucleic acid domain serves as a template for extension of the other domain) followed by During the step of performing an extension reaction to produce an extension product, a component containing 3 ′ exonuclease activity is used. Thus, a component having 3 ′ exonuclease activity generates an initial extension product in an extension assay using a proximity probe, ie, the extension product from the interaction of the nucleic acid domains of the proximity probe in the proximity probe extension assay. It is included in the process of generating.

  In another aspect, the present invention provides a method for detecting an analyte in a sample. The method includes a proximity probe extension assay, which includes the use of a component that includes 3 'exonuclease activity in the extension step of the assay, and then the extension product is amplified and detected.

  In yet another aspect, the present invention provides a method for reducing non-specific extension products (or improving the signal-to-noise ratio) in a proximity probe extension assay for detecting an analyte in a sample. The method includes the step of including a component comprising 3 'exonuclease activity in the extension step of the assay, and then a specific extension product is amplified and detected.

  As described above, the extension step of the proximity probe extension assay is the step of generating an initial extension product that is later detected as a means of detecting the analyte. That is, the extension step is based on the interaction of nucleic acid domains of adjacent probes, specifically, hybridization of the nucleic acid domains and extension of at least one subsequent domain using, for example, the other domain as a template. A step of producing an extension product.

  The method of the invention and the component comprising 3 'exonuclease activity are for use in assays that use proximity probes, which are proximity probes. The assay using the proximity probe can be any of the assays known in the art, for example, using a proximity probe to detect an analyte in the sample. Specifically, the assay is a proximity extension assay based on the interaction between nucleic acid domains of adjacent probes by hybridization and the detection of one or more extensions of those domains.

Therefore, in a preferred embodiment, the present invention is a method for detecting an analyte in a sample,
(A) contacting the sample with at least one set of at least first and second proximity probes each comprising an analyte binding domain and a nucleic acid domain and capable of simultaneously binding to the analyte;
(B) interacting the nucleic acid domain of the proximity probe when the proximity probe binds to the analyte, wherein the interaction includes the formation of a duplex;
(C) contacting the sample with a component comprising 3 ′ exonuclease activity;
(D) extending the 3 ′ end of at least one nucleic acid domain of the duplex to generate an extension product, which can occur simultaneously with or after the step (c);
(E) amplifying and detecting the extension product.

  As described in more detail below, the analyte binding domain may bind directly or indirectly to the analyte.

  Thus, it will be appreciated that components comprising 3 'exonuclease activity can be used to increase the specificity and / or sensitivity of proximity extension assays. Thus, the method of the present invention can be considered as a method of increasing the signal to noise ratio of a proximity stretch assay (for analytes). In other words, the methods of the invention can be used to reduce the amount of non-specific extension products in a proximity extension assay. Alternatively, the present invention can be viewed as providing a method of inhibiting or suppressing the formation of non-specific duplexes in proximity extension assays. Furthermore, the present invention can be viewed as providing a method for degrading nucleic acid domains of unbound proximity probes in proximity extension assays.

  As briefly described above, proximity extension assays extend at least one nucleic acid domain after a duplex is formed between the nucleic acid domains of the probes when two or more proximity probes bind to the target analyte. About doing. However, the same duplex (hybridization of two complementary nucleic acid domains) can be formed in a variety of ways depending on the orientation of the nucleic acid domains on adjacent probes.

  FIG. 1 schematically illustrates a typical example of a proximity stretch assay format. These embodiments are described in detail below. It should be noted that these various “versions” of PEA are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art from the following description that other variations are possible and these other variations are intended to be encompassed by the present invention. That is, the present invention is merely a nucleic acid comprising at least one proximate probe (not limited to the proteinaceous molecule or antibody shown in the figure, but this is a preferred embodiment of the present invention) containing an extendible free 3 'end. It has a domain and the extension requires that it can be templated by the nucleic acid domain of the second proximity probe. In this regard, as described in more detail below, the nucleic acid domain of the proximal probe can be single-stranded or partially double-stranded, but the single-stranded region of the domain is used for hybridization interaction. It is configured to be. The nucleic acid domains of each proximate probe can interact indirectly by hybridizing to a common “sprint” nucleic acid molecule, thereby indirectly forming a duplex. Therefore, in step (b) of the above method, the interaction of the nucleic acid domains to form a duplex is direct or indirect, and the nucleic acid domains linked to the analyte binding domain of the proximity probe hybridize to each other. Directly form a duplex, or they can each hybridize to another nucleic acid molecule to indirectly form a duplex. Such another nucleic acid molecule can be considered partly the second strand of a double stranded nucleic acid domain and hybridizes to at least a region of the nucleic acid molecule linked to the analyte binding domain of the proximity probe. (Forms a partially double-stranded nucleic acid domain linked through its one strand) and a terminal (eg, 3 ') single-stranded region complementary to a region of the nucleic acid domain of the other proximal probe Therefore, the interaction with the nucleic acid region of the other adjacent probe becomes possible. Alternatively, a “sprint” may be provided as the nucleic acid domain of another proximity probe.

  Version 1 of FIG. 1 shows a “conventional” proximity stretch assay. The nucleic acid domain (indicated by the arrow) of each proximity probe is bound to the analyte binding domain (indicated by the inverted “Y”) by its 5 ′ end, leaving two free 3 ′ ends. When their proximity probes bind to their respective analyte binding targets on the analyte (analyte not shown), the nucleic acid domains (complementary at their 3 ′ ends) of the probes can interact by hybridization. That is, a duplex can be formed. For example, the addition of a nucleic acid polymerase enzyme makes it possible to extend each nucleic acid domain by using the nucleic acid domain of the other proximal probe as a template for the extension. According to the method of the present invention, the target analyte can be detected by specifically amplifying and detecting the extension product.

  Version 2 of FIG. 1 shows another proximity extension assay. The nucleic acid domain of the first proximity probe is bound to the analyte binding domain by its 5 'end, and the nucleic acid domain of the second proximity probe is bound to the analyte binding domain by its 3' end. Therefore, the nucleic acid domain of the second proximity probe has a free 5 'end (indicated by a blunt arrow) that is extended using a common nucleic acid polymerase enzyme (extends only the 3' end). I can't. The 3 'end of the second proximity probe is effectively "blocked". That is, it is not “free” and cannot be stretched because it binds to the analyte binding domain and is therefore blocked by the analyte binding domain. In this embodiment, when the proximity probes bind to their respective analyte binding targets on the analyte, the nucleic acid domains of the probes sharing a complementary region at their 3 ′ ends can be interacted by hybridization. That is, a duplex can be formed. However, in contrast to version 1, only the nucleic acid domain of the first proximity probe (as a free 3 'end) can be extended using the nucleic acid domain of the second proximity probe as a template. As above, the target analyte can be detected by amplifying and detecting the extension product.

  Similar to version 2, in version 3 of FIG. 1, the nucleic acid domain of the first proximity probe is bound to the analyte binding domain by its 5 ′ end, and the nucleic acid domain of the second proximity probe is analyte by its 3 ′ end. It is bound to the binding domain. Therefore, the nucleic acid domain of the second proximity probe has a free 5 'end (indicated by a blunt arrow) that cannot be extended. However, in this embodiment, the nucleic acid domains each bound to the analyte binding domain of the proximity probe do not have a complementary region, so a duplex cannot be formed directly. Instead, a third nucleic acid molecule having a region homologous to the nucleic acid region of each proximal probe is provided, which acts as a “molecular bridge” or “sprint” between the nucleic acid domains. This “sprint” oligonucleotide fills in the gaps between the nucleic acid domains and allows the nucleic acid domains to interact indirectly. That is, each nucleic acid domain forms a duplex with the splint oligonucleotide. Thus, when a proximity probe binds to each analyte binding target on the analyte, the probe nucleic acid domains interact by hybridization, i.e., form a duplex with the splint oligonucleotide. Thus, it can be seen that the third nucleic acid molecule or splint can be regarded as the second strand of the partially double-stranded nucleic acid domain provided in one proximity probe. For example, one proximity probe comprises a partially double-stranded nucleic acid domain that binds to the analyte domain via the 3 ′ end of one strand and the other unbound strand has a free 3 ′ end. obtain. Such nucleic acid domains therefore have a terminal single stranded region with a free 3 'end. In this embodiment, the nucleic acid region of the first proximity probe (as a free 3 ′ end) is extended using a “sprint oligonucleotide” (or a single-stranded 3 ′ end region of the other nucleic acid region) as a template. Preferably, it is linked to the 5 ′ end of the nucleic acid domain of the second proximity probe (specifically, the 5 ′ end of the bound strand or the 5 ′ end of the double-stranded part of the nucleic acid domain). May be. Alternatively or in addition, the free 3 ′ end (ie, unbound strand, or 3 ′ single stranded region) of the splint oligonucleotide is extended using the nucleic acid region of the first proximity probe as a template. May be. As above, the target analyte can be detected by amplifying and detecting the extension product.

  As is apparent from the above description, in one embodiment, a splint oligonucleotide can be provided as a separate component of the assay. That is, it can be added separately to the reaction mixture (ie, added to the sample containing the analyte separately from the proximity probe). Nevertheless, splint oligonucleotides hybridize to nucleic acid molecules that are part of a proximity probe, and the hybridization occurs when contacted with such nucleic acid molecules, but is added separately but partially It can be considered as a strand of a double-stranded nucleic acid domain. Alternatively, the splint can be prehybridized with one of the nucleic acid domains of the proximity probe, i.e., hybridized prior to contacting the proximity probe to the sample. In this embodiment, the splint oligonucleotide can be considered directly as part of the proximity probe nucleic acid domain. That is, a nucleic acid domain is a partially double-stranded nucleic acid molecule, for example, a proximity probe links a double-stranded nucleic acid molecule to an analyte binding domain (preferably, the nucleic acid domain is single-stranded into the analyte binding domain. Ligated) to modify the nucleic acid molecule to produce a partially double stranded nucleic acid domain (with a single stranded overhang that can hybridize to the nucleic acid domain of the other proximal probe) Can be generated. Thus, extension of a nucleic acid domain of a proximity probe as defined herein also includes extension of a “sprint” oligonucleotide. When an extension product results from extension of a splint oligonucleotide, the resulting extended nucleic acid strand is linked to a proximal probe pair only by the interaction of the two strands of the nucleic acid molecule (hybridization of the two nucleic acid strands). Is preferred. Thus, in these embodiments, extension products can be separated from adjacent probe pairs using denaturing conditions such as increasing temperature, decreasing salt concentration, and the like. This is particularly useful in a heterogeneous format where the target analyte is bound to a solid substrate. This is because, for example, a proximity probe bound to an immobilized analyte can be in a solid phase, whereas an extension product can be in a liquid phase after denaturation, so that the extension product can be It is because it can isolate | separate easily from.

  Although the splint oligonucleotide shown in version 3 of FIG. 1 is illustrated as being complementary to the entire nucleic acid domain of the second proximity probe, this is merely an example and the splint is the nucleic acid of the proximity probe. It is sufficient that a duplex can be formed with the end of the domain (or near the end), i.e., as long as the gap is filled as defined further below.

  In other embodiments, a splint oligonucleotide may be provided as the nucleic acid domain of the third proximity probe, as described in WO2007 / 107743 (included herein by reference). The same document shows that this can further improve the sensitivity and specificity of the proximity probe assay.

  Version 4 of FIG. 1 is a modified version of version 1, wherein the nucleic acid domain of the first proximity probe is at its 3 ′ end a sequence that is not completely complementary to the nucleic acid domain of the second proximity probe. including. Thus, when those proximate probes bind to their respective analyte binding targets on the analyte, the nucleic acid domains of the probes can interact with each other by hybridization, i.e., form a duplex, but the first proximity The 3 'extreme 3' end of the probe's nucleic acid domain (the site of the nucleic acid molecule containing the free 3 'hydroxyl group) cannot hybridize, and therefore, a non-hybridized single-stranded "flap" flap) ". For example, when adding a nucleic acid polymerase enzyme, only the nucleic acid domain of the second proximity probe can be extended using the nucleic acid domain of the first proximity probe as a template. As above, the target analyte can be detected by specifically amplifying and detecting the extension product.

  In this embodiment, it may be useful to denature one or more nucleotides at the 3 'end of the nucleic acid domain of the first proximity probe, eg, to be resistant to 3' exonuclease activity. Suitable modifications are further described below. If the nucleic acid domain of the first proximity probe is resistant to 3 'exonuclease activity, only the nucleic acid domain of the second proximity probe can be extended. On the other hand, if the nucleic acid domain of the first proximity probe is susceptible to 3 ′ exonuclease activity, the “flap” is degraded and completely hybridized (annealed) to the nucleic acid domain of the second proximity probe. 3 'end is obtained. Therefore, the nucleic acid domain of the first proximity probe can also be extended using the nucleic acid domain of the second proximity probe as a template.

  The last embodiment shown in FIG. 1, ie version 5, can be regarded as a modified version of version 3. However, unlike version 3, the nucleic acid domains of both proximity probes are bound to their respective analyte binding domains by their 5 'ends. In this embodiment, the 3 'ends of the nucleic acid domains are not complementary to each other so that the nucleic acid domains of the proximal probes cannot interact or form a duplex directly. Instead, a third nucleic acid molecule is provided that has a region homologous to the nucleic acid domain of each proximal probe and acts as a “molecular bridge” or “sprint” between the nucleic acid domains. This “sprint” oligonucleotide fills the gap between the nucleic acid domains, allowing the nucleic acid domains to interact indirectly. That is, each nucleic acid domain forms a duplex with the sprint oligonucleotide. Thus, when a proximity probe binds to each analyte binding target on the analyte, each of the probe's nucleic acid domains interacts by hybridization, ie, forms a duplex with the splint oligonucleotide. Thus, consistent with version 3, the third nucleic acid molecule or splint can be considered as the second strand of the partially double stranded nucleic acid region provided in one proximity probe. In a preferred embodiment, one proximal probe binds to the analyte binding domain via the 5 ′ end of one strand and the second (unbound) strand has a free 3 ′ end, partially in two. A single-stranded nucleic acid domain may be provided. Such nucleic acid domains therefore have a terminal single stranded region with at least one free 3 'end. In this embodiment, the nucleic acid domain of the second proximity probe can be extended (as a free 3 'end) using a "sprint oligonucleotide" as a template. Alternatively, or in addition, using the nucleic acid domain of the second proximity probe as a template, the free 3 ′ end of the splint oligonucleotide (ie, the unbound strand, or the 3 ′ single strand of the first proximity probe) The chain region) can be extended. As above, the target analyte can be detected by amplifying and detecting the extension product.

  As described above in connection with version 3, the splint oligonucleotide can be provided as a separate component of the assay. On the other hand, splint oligonucleotides hybridize to nucleic acid molecules that are part of a proximity probe, and the hybridization occurs when in contact with such nucleic acid molecules, so the partial It can be regarded as a strand of a double-stranded nucleic acid domain. Alternatively, the splint can be prehybridized to one of the nucleic acid domains of the proximal probe, i.e., hybridized before contacting the proximal probe to the sample. In this embodiment, the splint oligonucleotide can be considered directly as part of the nucleic acid domain of the proximity probe. That is, a nucleic acid domain is a partially double-stranded nucleic acid molecule. For example, a proximity probe links a double-stranded nucleic acid molecule to an analyte binding domain (preferably, the nucleic acid domain is single-stranded by an analyte binding domain. By denature the nucleic acid molecule to produce a partially double stranded nucleic acid domain (with a single stranded overhang that can hybridize to the nucleic acid domain of the other proximal probe). Can be generated. Thus, extension of a nucleic acid domain of a proximity probe as defined herein also includes extension of a “sprint” oligonucleotide. When extension products result from extension of a splint oligonucleotide, the resulting extended nucleic acid strands are ligated to adjacent probe pairs only by interaction of the two strands of the nucleic acid molecule (hybridization of the two nucleic acid strands). It is suitable. Thus, in these embodiments, extension products can be separated from adjacent probe pairs using denaturing conditions such as increasing temperature, decreasing salt concentration, and the like. This is particularly useful in a heterogeneous format where the target analyte is bound to a solid substrate. This is because, for example, a proximity probe bound to an immobilized analyte can be in a solid phase, whereas an extension product can be in a liquid phase after denaturation, so that the extension product can be It is because it can isolate | separate easily from.

  The splint oligonucleotide shown in version 5 of FIG. 1 is illustrated as being complementary to the entire nucleic acid domain of the first proximity probe, but this is merely an example, and the splint is the nucleic acid of the proximity probe. It is sufficient that a duplex can be formed with the end of the domain (or near the end), i.e., just filling the gap as defined further below.

  In other embodiments, a splint oligonucleotide can be provided as the nucleic acid domain of a third proximity probe, as described in WO 2007/107743 (included herein by reference). The same document shows that this can further improve the sensitivity and specificity of the proximity probe assay.

  From the above, there are a number of different proximity extension assays, all of which are 3 ′ that allow the probes to interact and extend when two (or more) proximity probes bind to the analyte. It can be seen that it relies on the formation of a nucleic acid duplex containing the ends (in the case of template extension). Thus, the interaction between probes (more specifically, each of their nucleic acid domains, including splint oligonucleotides) is proximity dependent, and they (more Specifically, their nucleic acid domains are brought close to each other so as to interact with each other. Thus, the analyte can be detected by detecting the interaction (or the extension product that results). In the methods of the present invention, proximity probes can interact by hybridizing to each other (directly or indirectly) to allow extension of one or more nucleic acid molecules. This extension results in the nucleic acid domains of two proximal probes bound or integrated with each other, and a splint oligonucleotide (which can form part of the nucleic acid domain of the proximal probe) assists or mediates this interaction (binding). To do. Extension (binding if applicable) can be detected by detecting extension products and / or binding products (interaction products).

  While not wishing to be bound by theory, the method of the present invention is the addition of a component comprising a 3 ′ exonuclease activity that degrades the free and unprotected 3 ′ end of the nucleic acid domain of an unbound proximal probe. It is thought that it depends on. Otherwise, the nucleic acid domain of the unbound probe binds non-specifically and / or transiently (temporarily) to other unbound proximal probes or other components of the assay, It is believed that non-specific / background extension products are generated, preventing analyte detection.

  An echinonuclease is an enzyme that acts by hydrolyzing a phosphodiester bond at either the 3 'end or the 5' end to cleave nucleotides one by one from the end of the polynucleotide chain. As such, echinonuclease exists as either a 5 'or 3' echinonuclease, and its scientific term refers to the end where cleavage is initiated. That is, 3 'echinonuclease degrades nucleic acid molecules in the 3' to 5 'direction. Numerous types of echinonuclease enzymes are known to exist that can degrade DNA and / or RNA and act on double-stranded or single-stranded nucleic acids. For example, 5 'RNA echinonuclease for mRNA turnover, E. coli-derived echinonuclease I that degrades single-stranded DNA in 3' to 5 'direction, etc. present in both eukaryotes and prokaryotes , Echinonuclease is an independent entity (a separate enzyme with the sole function of degrading nucleic acids), but many echinonuclease activities are attributed to enzymes with multiple functions, eg, many DNA polymerases Also includes 3 ′ and / or 5 ′ echinonuclease activity (DNA polymerase I from E. coli).

  Therefore, a component containing 3 'echinonuclease activity used in the method of the present invention includes any element capable of degrading a nucleic acid from its 3' end. In a preferred embodiment of the invention, the component comprising 3 'echinonuclease activity acts specifically on single stranded nucleic acids. That is, it has a greater effect on single-stranded nucleic acid molecules than on double-stranded nucleic acids, for example at least 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold over single-stranded nucleic acid molecules. , 50 times, or 100 times.

  Components containing echinonuclease activity must be able to completely or partially degrade the nucleic acid domains of unbound proximity probes, i.e., probes that are not bound to the target analyte, and those nucleic acid domains must be free Has an unprotected 3 'end. As explained below, the nucleic acid domain of a proximity probe can consist of any nucleotide residue that can participate in Watson-Crick or similar base pair interactions. However, in embodiments where the nucleic acid domain comprises DNA, the component comprising 3 ′ echinonuclease activity acts on DNA and preferably has a greater effect on DNA than on RNA, eg, at least on DNA rather than RNA. 2x, 3x, 4x, 5x, 10x, 20x, 50x, or 100x. Similarly, in embodiments where the nucleic acid domain comprises RNA, it is preferred that the component containing 3 ′ echinonuclease activity acts on RNA and is more effective on RNA than on DNA, eg, on RNA rather than DNA. Acts at least 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, or 100 times.

  In one aspect of the invention, the component comprising 3 'echinonuclease activity is an enzyme. In a particularly preferred embodiment, the enzyme is a nucleic acid polymerase further comprising 3 'echinonuclease activity and capable of extending the 3' end of the nucleic acid molecule. Specifically, components comprising 3 ′ echinonuclease activity include T4 DNA polymerase, T7 DNA polymerase, Phi 29 (Φ29) DNA polymerase, DNA polymerase I, Klenow fragment of DNA polymerase I, Pyrocox frios (Pfu) DNA polymerase, and / Or may be selected from one or more of the group consisting of Purocox Vessey (Pwo) DNA polymerase. Thus, in some embodiments, the component comprising 3 'echinonuclease activity can be a hyperthermophilic enzyme, particularly a hyperthermophilic polymerase comprising 3' echinonuclease activity, such as Pfu DNA polymerase or Pwo DNA polymerase.

  Hyperthermophilic enzymes are generally hyperthermophilic organisms, ie, optimal at high temperatures above 90 ° C. (eg, near 100 ° C. (compared to most thermophilic organisms generally growing optimally around 70 ° C.)). It is an enzyme derived or obtained from a living organism. A hyperthermophilic polymerase (or more specifically a polymerase derived from a hyperthermophilic organism) is a temperature higher than the normal biological temperature, eg, more than 40 ° C, more than 50 ° C, more than 60 ° C, or more than 70 ° C, In general, it may have optimal enzyme action above 37 ° C, such as above 60 ° C or above 70 ° C. Significantly, such enzymes are preferably less active or less active at lower temperatures, such as room temperature, such as 25 ° C or 30 ° C. It is particularly preferred that the polymerase activity is small until the temperature reaches at least 45 ° C or 50 ° C. Such an enzyme has been identified in organisms that inhabit extreme temperature conditions, such as archaea (Purocox friosus, Purocox vessei, etc.). Of particular interest among enzymes derived from these organisms are polymerase enzymes that have been useful in the development of many molecular biology techniques, particularly PCR. Not only natural hyperthermophilic enzymes, but also denature thermostable enzymes with the highest temperature limit, giving them the property of low or low activity at room temperature, the same or similar to natural hyperthermophilic enzymes Characteristics, specifically, the same or similar temperature activity profile, ie, the highest temperature limit is high (eg,> 50 ° C,> 55 ° C, or> 60 ° C) and room temperature (or 30 ° C, 37 ° C) Or a lower temperature such as 40 ° C.) may form an enzyme that combines the characteristics of low or low activity. Such denatured polymerase enzymes include, for example, so-called “hot start” derivatives of Taq polymerase, which begin to be active at, for example, about 50 ° C. As used herein, the term “superthermophilic polymerase” includes not only the natural enzyme, but also all such modified derivatives, as well as derivatives of the natural hyperthermophilic polymerase enzyme. Particularly preferred hyperthermophilic enzymes for use in the methods of the present application include Pfu DNA polymerase, Pwo DNA polymerase, and derivatives thereof (eg, derivatives with sequence modifications) or variants. In certain embodiments, a hyperthermophilic polymerase is advantageous or preferred, but there is no need to use such an enzyme, and in other embodiments any hyperthermophilic or thermostable polymerase (which is stable at high temperatures) Any polymerase enzyme with a high maximum temperature limit), such as Taq polymerase, can be used.

In other embodiments, the polymerase activity for extension of the nucleic acid domain (and / or splint oligonucleotide) of the proximity probe is from an enzyme with minimal or no 3 ′ echinonuclease activity, eg, from E. coli. A component comprising 3 ′ echinonuclease activity provided by α subunit of DNA polymerase III, Klenow exo (−) fragment of DNA polymerase I, Taq polymerase, Pfu (exo ⁻ ) DNA polymerase, Pwo (exo ⁻ ) DNA polymerase, etc. Can be provided as a separate entity, for example as a separate enzyme comprising 3 ′ echinonuclease activity. As such, the polymerase enzyme with minimal or no 3 ′ echinonuclease activity can be a hyperthermophilic polymerase or a thermostable polymerase. In a further embodiment, the component comprising 3 ′ echinonuclease activity is in multiple forms, ie two or more components comprising 3 ′ echinonuclease activity, for example as part of a polymerase enzyme and its main function is 3 'Can be provided as an independent enzyme that is echinonuclease activity. In one aspect of the invention, the component comprising 3 ′ echinonuclease activity is echinonuclease I.

  The component containing 3 ′ echinonuclease activity is advantageously contacted with the sample prior to or simultaneously with the components necessary for extension of the nucleic acid domain after the nucleic acid domains of the proximity probe interact, ie, form a duplex. is there. In this regard, the nucleic acid domain of the proximity probe must be at least partially single-stranded upon contact with the sample so that it can interact upon binding to the target analyte. Therefore, when a component containing 3 ′ echinonuclease activity is present (present in an active state) prior to the formation of the duplex, nucleic acids having free and unprotected 3 ′ ends of all adjacent probes Domains can be susceptible to degradation. On the other hand, once a duplex is formed between adjacent probes bound to the target analyte, only the nucleic acid domain of the unbound proximal probe is subject to degradation. As noted above, probes that are not bound to the target analyte do not form a stable duplex, but they may interact with other unbound probes or other components of the sample, and these interactions It is likely to be temporary (temporary). This means that the nucleic acid domains of these probes become available substrates for components that contain 3 'echinonuclease activity.

  When a component containing 3 ′ echinonuclease activity is contacted with the sample at the same time as a component necessary for nucleic acid domain extension, for example, if the polymerase enzyme contains 3 ′ echinonuclease activity, extension and degradation will occur simultaneously. .

  When a component containing 3 ′ echinonuclease activity is contacted with the sample prior to the component required for nucleic acid domain extension, for example, it contains 3 ′ echinonuclease activity (but has substantial or detectable polymerase activity). When an independent enzyme (not included) is contacted with the sample, the nucleic acid domain with the free and unprotected 3 'end of the unbound probe is degraded prior to the extension reaction, resulting in 3' echinonuclease activity. Including components can be inactivated (eg, removed, inhibited, or modified). However, 3 'echinonuclease activity can be maintained during the extension process.

  In one embodiment, components containing 3 'echinonuclease activity are inactivated prior to the step of amplifying the extension product to prevent degradation of the components required for the amplification step. The term “inactivation” means to suppress, denature or physically remove the same component from, for example, heat. In this regard, only the 3 'echinonuclease activity need be inactivated.

  For example, if the extension product is amplified by PCR, a standard unmodified primer (having a free and unprotected 3 'end) can be a substrate for a 3' echinonuclease. Failure to inactivate this activity will result in degradation of these PCR reagents and amplification may not occur or be limited.

  In preferred embodiments, some or all of the reagents for the amplification reaction are added to the sample prior to contacting the component with 3 'echinonuclease activity. In a particularly preferred embodiment, the reagent is added during steps (b) and (c) as defined above. Alternatively, some or all of the reagents for the amplification reaction are added to the sample at the same time, i.e., simultaneously with the component containing 3 'echinonuclease activity.

  In one embodiment, the primer is provided in a modified form that is resistant to 3 'echinonuclease activity. Modification of nucleic acid molecules or nucleotides contained within nucleic acid molecules to prevent degradation by echinonucleases is known in the art, and modification of one or more residues at the protected end, eg, the 3 ′ end, is common Used. Any modification suitable for protection from 3 'echinonuclease activity may be used in the methods of the invention. In this regard, the primer used in the present invention preferably contains at least one modified nucleotide at its 3 'end. For example, the modification is one or more of the list consisting of thiophosphate modified nucleotides, locked nucleic acid nucleotides (inaccessible RNA nucleotides, 2′-OMe-CE phosphoramidite modified nucleotides, or peptide nucleic acid nucleotides) Can be selected.

  In the step of amplifying the extension product of the method of the invention, the “hot” (described in Kaboev et al., 2000, Nuc. Acids Res., 28 (21), pp. E94, incorporated herein by reference) It is advantageous to use a “start” primer. The hot start primer is an oligonucleotide primer containing a stem loop structure with complementary regions at its 5 'end and 3' end. In this regard, the primer is designed to be complementary to the target sequence (a specific region in the extension product) and at least 5-6 nucleotides are added to the 5 ′ end of the primer, which are A complementary sequence is formed at the 3 ′ end. At low temperatures, for example, the temperature at which the components of the reaction are mixed and / or the temperature at which the extension reaction is performed, the primer forms a stem-loop structure and therefore acts as an efficient primer for extension product extension. I can't. However, after heating to the annealing temperature of PCR, primer extension (amplification) can be initiated to obtain a linear structure of the primer. It is believed that the use of hot primers prevents the PCR primer from interfering with the interaction between adjacent probes of the method of the invention and further protects the primer from 3 'echinonuclease activity.

As used herein, the terms “amplify” or “amplified” generally refer to any number that increases the number of replicas of an extension product or portion thereof in an assay as a means of signaling the presence of a target analyte in a sample. It is used as including means. For example, any amplification means known in the art such as PCR, LCR, RCA, MDA, etc. can be utilized in the methods of the present invention. Depending on whether the amount of target analyte in the sample is large, the extension product or its product is so that the concentration of the extension product is doubled, i.e. twice the number of replicas present before amplification. It may be necessary to amplify a portion. Alternatively, it may be preferable to increase the number of replicas by several orders of magnitude. In some embodiments, amplification results in an amount of extension product or portion thereof in the sample that is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold of the original amount. Double, 10 times, 15 times, 20 times, 50 times, or 75 times. In a further preferred embodiment, the amount of extension product or part thereof in the sample is at least 10 ² times, 10 ³ times, 10 ⁴ times, 10 ⁵ times, 10 ⁶ times, 10 ⁷ times, 10 ⁷ times 10 ⁸ times the original amount. It may be preferable to amplify the extension product to be 10 times, 10 ⁹ times, 10 ¹⁰ times, etc.

  It can be seen that it is not necessary to extend all of the extensible organisms to see if the sample contains the target analyte. Only a portion of the extension product that was not present in the sample before the extension reaction occurred needs to be amplified. For example, the extension product is produced by a template extension reaction with two sites in effect, a first “old” site (existing site) containing the nucleotide sequence that comprised the nucleic acid domain of the proximal probe (or splint). And a second “new” site (extension site) containing the rendered nucleotide sequence. Detection of the second “new” or “extension” site allows detection of the target analyte. That is, if no analyte is present, elongation will not occur, so there is no “new” or “elongation” site. Thus, in a preferred embodiment of the invention, the step of amplifying the extension product comprises amplifying a portion of the extension site of the extension product.

  A portion of the extension site must be large enough to be distinguishable from other sequences present in the sample. In effect, the portion of the extension site of the extension product acts as a unique identifier or signal corresponding to the presence of the target analyte. Thus, if the portion contains a nucleotide sequence that would otherwise not be present in the sample, it is sufficient to amplify that sequence to inform the presence and number of target analytes in the sample.

  Thus, said portion may comprise at least 8, preferably at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides. The portion of the extension site of the extension product can generally be in the range of about 8 to about 1000 nucleotides in length. In certain embodiments, they range from about 8 to about 500 nucleotides in length, including from about 8 to about 250 nucleotides in length, such as from about 12 to about 150 nucleotides in length, from about 14 to about 130 nucleotides in length, from about 16 to about About 8 to about 160, such as 110 nucleotides long, about 8 to about 90 nucleotides long, about 12 to about 80 nucleotides long, about 14 to about 75 nucleotides long, about 16 to about 70 nucleotides long, about 16 to about 60 nucleotides long, etc. Can be in the range of nucleotide lengths. In certain exemplary embodiments, the extension site of the extension product ranges from about 10 to about 80 nucleotides in length, from about 12 to about 75 nucleotides in length, from about 14 to about 70 nucleotides in length, from about 34 to about 60 nucleotides in length. , And any length between those ranges.

  Although it is foreseen that the entire extension product, i.e., both the existing site and the extension site, can be amplified, it is sufficient that the amplification product includes at least a portion of the extension site of the extension product. In one aspect of the invention, the primer is placed on either side of the extension site portion of the extension product, and that portion is designed to be amplified, for example by PCR, (with said portion of the extension product (Including) amplification products can be detected as follows. In another aspect of the invention, the portion of the extension site of the extension product is a template for ligation of a padlock probe that forms, for example, a circular oligonucleotide (as described elsewhere herein). And amplification of that sequence, for example by rolling circle amplification (RCA), can result in an amplification product comprising multiple copies of the sequence corresponding to said portion of the extension site of the extension product. The extension product, more specifically a portion thereof, can be amplified in this way. Alternatively, or in addition, said portion of the extension site of the extension product can act as a primer for rolling circle amplification of a circular oligonucleotide comprising a sequence complementary to the extension site of the extension product. As described above, the resulting product may correspond to the portion of the extension site of the extension product and contain multiple copies of the sequence that can be detected as described below. Therefore, in this embodiment, the extension product, more specifically, a part thereof is also amplified.

  In embodiments in which the “sprint” oligonucleotide is extended, the extended oligonucleotide can be circularized to provide a template for amplification, preferably for rolling circle amplification. In these embodiments, the 3 ′ end (extension end) of the extension oligonucleotide is linked to the 5 ′ end (non-extension end) of the extension oligonucleotide, and the ligation is any of those described elsewhere herein. It can be realized by any suitable means. In a particularly preferred embodiment, the ligation reaction is template ligation and the 3 ′ and 5 ′ ends of the extension oligonucleotide are “sprinted” between the 3 ′ and 5 ′ ends of the nucleic acid molecule, eg, the extension oligonucleotide. Alternatively, they are brought close together by hybridizing to oligonucleotides (as defined elsewhere) that are added to the reaction to act as “molecular bridges”. When the ends of the extension oligonucleotide hybridize to the “sprint” nucleic acid molecule, the ends can be joined, for example, by the activity of a ligase enzyme, to form a circular oligonucleotide that includes the extension site of the extension product. Thus, for example, amplification of the circular oligonucleotide by rolling circle amplification results in amplification of the extension product. In this case, the amplification product includes a sequence that is the complement of the extension site of the extension product. Thus, amplification of the circularized oligonucleotide results in indirect amplification of the extension product.

  From the above, it can be seen that the extension site of the extension product only needs to contain a relatively small number of nucleotides. Furthermore, the maximum size of the extension product depends on the size of the nucleic acid domain of the proximal probe and / or the size of the splint oligonucleotide (defined below) that acts as a template for the extension product. The extension product can be provided by full or partial extension of a splint oligonucleotide that acts as a template for the nucleic acid domain and / or extension product. That is, the extension reaction can result in an extension product that has been extended to the end of the template nucleic acid, or the extension reaction can result in only a partially complementary strand of the template nucleic acid. Can be used.

  As used herein, the term “detect” or “detected” includes any means for determining the presence of an analyte (ie, whether it is present) or any form of measuring an analyte. Widely used as a thing. In the methods of the invention, by amplifying the extension product (including amplifying the product based on or derived from or using the extension product) and detecting the amplification product , The specimen is indirectly detected. Therefore, detecting the sample is synonymous with detecting the amplification product defined above, and these terms are used interchangeably in this specification.

  As such, “detecting” can include anything to identify, measure, evaluate, or analyze the presence, quantity, or location of an analyte. Includes quantitative and qualitative testing, measurement, or evaluation, including semi-quantitative. Such a test, measurement, or evaluation may be relative, or absolute, for example, when two or more different analytes are detected in the sample. As such, when the term “quantification” is used in the context of quantifying a target analyte in a sample, it can mean absolute or relative quantification. Absolute quantification can be achieved by including one or more control analytes of known concentration and / or referencing the detection level of the target analyte using the known control analyte (eg, by generating a standard curve). . On the other hand, relative quantification can be achieved by comparing the detection levels or amounts of two or more different target analytes to obtain a relative quantification relative to each of the two or more different analytes, i.e. to each other.

  An “analyte” can be any substance (eg, molecule) or entity that is desired to be detected by the methods of the present invention. The analyte is the “target” of the assay method of the present invention. Thus, an analyte can be any biomolecule or chemical compound that it may be desired to detect, such as a peptide or protein, or a small molecule including nucleic acid molecules or organic and inorganic molecules. The specimen can be a cell or a microorganism containing a virus, or a fragment or product thereof. Thus, it will be appreciated that an analyte can be any substance or entity that is capable of producing a specific binding partner (eg, an affinity binding partner) thereto. The analyte is only required to be able to bind at least two binding partners (more specifically, the analyte binding domains of at least two proximity probes) at the same time. Assays that use proximity probes, such as the assays of the present invention, have been found to be particularly useful for the detection of proteins or polypeptides. Therefore, what is of particular interest as a specimen includes protein-like molecules such as peptides, polypeptides, proteins, prions, or any molecule containing a protein component or polypeptide component, or fragments thereof. In particularly preferred embodiments of the invention, the analyte is completely or partially a proteinaceous molecule. The analyte is a single molecule, or a complex comprising two or more molecular subunits, which may or may not be covalently linked to each other, and may be the same or different. It can be. Thus, in addition to cells or microorganisms, such complex analytes can also be protein complexes. As such, such complexes can be homomultimers or heteromultimers. A molecule, eg, a collection of proteins, eg, the same protein or a collection of different proteins, can also be a target analyte. The analyte can also be a complex of a nucleic acid molecule such as DNA or RNA and a protein or peptide. Of particular interest is, for example, the interaction between a regulatory factor such as a transcription factor and a protein and nucleic acid such as the interaction of DNA or RNA.

  All biological and clinical samples are included, for example, any cell or tissue sample of a living organism, or any body fluid or preparation derived therefrom, and samples such as cell incubations, cell preparations, cell lysates. Also included are environmental samples such as soil and water samples, or food samples. The sample may be freshly prepared, or may be pre-treated by any convenient method such as storage.

  As such, a representative sample can include any material that can include biomolecules, or any other desired or target analyte including, for example, food and related products, clinical samples, and environmental samples. The sample can be a biological sample that can contain any viral or cellular material, including all prokaryotic or eukaryotic cells, viruses, bacteriophages, mycoplasma, protoplasts, and organelles. Thus, such biological materials can include all types of mammalian and non-mammalian cells, plant cells, algae including cyanobacteria, fungi, bacteria, protozoa and the like. Therefore, typical samples are whole blood and blood-derived products such as plasma, serum and buffy coat, blood cells, urine, stool, spinal fluid, or other body fluids (eg, airway secretions, saliva, breast milk, etc. ), Biological tissue, biopsy, cell incubate, cell suspension, culture supernatant, other samples of cell incubate components, and the like. The sample may be processed in advance by any convenient or desired method, such as cell degradation or purification, sample separation, and the like, and then used for the method of the present invention.

  Proximity probes for use in the methods of the present invention comprise an analyte binding domain and a nucleic acid domain, which are in effect detection probes that bind to the analyte (via the analyte binding domain) and probe upon said binding Such binding can be detected (in order to detect the analyte) by means of detecting the interaction that takes place between the two nucleic acid domains. Thus, a probe can be viewed as a nucleic acid tagged affinity ligand or nucleic acid tagged binding partner for an analyte, where the analyte binding domain is an affinity binding partner and the nucleic acid domain is a nucleic acid tag. The nucleic acid domain is linked to the analyte binding domain, and this “linkage” or connection may be by any desired or convenient means known in the art, either directly or, for example, a linking group. It may be an indirect one via. For example, the domains are linked to each other by covalent bonds (eg, chemical cross-linking) or by non-covalent association, eg, streptavidin-biotin linkage (biotin in one domain and streptavidin in the other) May be.

  The analyte binding domain may be any binding partner for the target analyte, and may be a direct or indirect binding partner. Thus, the analyte binding domain may bind directly to the target analyte or indirectly through a binding partner or intermediate molecule that binds to the target analyte, in which case the analyte binding domain is bound to the intermediate molecule (binding Partner). In particular, the analyte binding domain or intermediate binding partner is a binding partner specific for the analyte. A binding partner is any molecule or entity that can bind to its target, eg, a target analyte, and a specific binding partner is one that can specifically bind to that target (eg, a target analyte), ie, the same binding. The partner binds with higher affinity and / or specificity to the target (eg, analyte) than to other components in the sample. As such, binding to a target analyte can be distinguished from binding to a non-target analyte. A specific binding partner does not bind to a non-target analyte, or if it binds, it is insignificant, cannot be detected, or can be distinguished if such non-specific binding occurs It can be. The binding between the target analyte and its binding partner is generally non-covalent.

The analyte binding domain can be selected to have a high binding affinity for the target analyte. High binding affinity means that the binding affinity is at least about 10 ⁻⁴ M, usually at least 10 ⁻⁶ M or more, such as 10 ⁻⁹ M or more. The analyte binding domain can be any of a variety of different types of molecules, provided that the binding affinity to the target protein meets the above requirements when it is present as part of a proximity probe. . In other embodiments, the analyte binding domain can be a ligand with moderate or lower affinity for its target analyte, eg, less than about 10 ⁻⁴ .

  The analyte binding domain can be a small molecule ligand or a large molecule ligand. By small molecule ligand is meant a ligand whose size ranges from about 50 to about 10,000 daltons, generally from about 50 to about 5,000 daltons, more typically from about 100 to about 1,000 daltons. . By large molecule is meant a ligand whose size ranges from about 10,000 daltons or more in molecular weight.

  Small molecules can be any molecule that can bind to a target analyte with the required affinity, and binding moieties or fragments thereof. In general, small molecules are small organic molecules that can bind to a target analyte of interest. Small molecules include one or more functional groups necessary for structural interaction with the target analyte, such as groups required for hydrophobic interactions, hydrophilic interactions, electrostatic interactions, or covalent interactions. When the target analyte is a protein, the small molecule ligand contains functional groups necessary for structural interaction with the protein such as hydrogen bonding, hydrophobic-hydrophilic interaction, electrostatic interaction, etc., and at least an amine group, an amide group , Sulfhydryl groups, carbonyl groups, hydroxyl groups, or carboxyl groups, preferably generally containing at least two of said functional chemical groups. Small molecules can also include regions that can participate in and / or be modified in covalent linkage with the nucleic acid domain of the proximal probe without substantially adversely affecting the ability of the small molecule to bind to the target analyte.

  In general, small molecule affinity ligands include cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Structures within biomolecules, including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof are also small molecules of interest. Such compounds are screened to identify those of interest, and a variety of different screening protocols are known in the art.

  Small molecules can be derived from natural or synthetic compounds that can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. Numerous means are available for random and directed synthesis of a wide range of organic compounds and biomolecules, including the preparation of randomized oligonucleotides and randomized oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are available or readily produced. Furthermore, natural or synthetically generated libraries and compounds can be readily modified by conventional chemical, physical, and biochemical means, and they can be used to generate combinatorial libraries. Known small molecules may be directly or randomly chemically modified, such as acylation, alkylation, esterification, amidation, etc., to produce structural analogs.

  As such, the small molecule may be obtained from a library of natural or synthetic molecules, including a library of compounds generated from combinatorial means, ie, a compound diversity combinatorial library. . When obtained from such libraries, the small molecules utilized exhibit some desirable affinity for the target protein in a simple binding affinity assay. Combinatorial libraries and methods for their production and screening are known in the art and are described in US Pat. No. 5,741,713, US Pat. No. 5,734,018, US Pat. No. 5,731,423, U.S. Patent No. 5,721,099, U.S. Patent No. 5,708,153, U.S. Patent No. 5,698,673, U.S. Patent No. 5,688,997, U.S. Patent No. 5,688,696, U.S. Patent No. 5,684,711, U.S. Patent No. 5,641,862, U.S. Patent No. 5,639,603, U.S. Patent No. 5,593,853, U.S. Patent No. 5,574,656, US Patent 5,571,698, US Patent 5,565,324, US Patent 5,549,974, US Patent 5,545,568, US Patent 5,5 No. 1,061, US Pat. No. 5,525,735, US Pat. No. 5,463,564, US Pat. No. 5,440,016, US Pat. No. 5,438,119, US Pat. No. 223,409, the disclosures of which are hereby incorporated by reference.

The analyte binding domain can also be a large molecule. Of particular interest as large molecule analyte binding domains are antibodies and binding fragments, derivatives, or mimetics thereof. If the antibodies are analyte binding domains, they may be derived from a polyclonal composition in which heterogeneous populations of antibodies with different specificities are each “tagged” with the same tagged nucleic acid. Each homogenous population of the same antibody having the same specificity for the target analyte may be derived from a monoclonal composition tagged with the same tag nucleic acid. As such, the analyte binding domain can be either a monoclonal antibody or a polyclonal antibody. In yet another embodiment, the affinity ligand is an antibody-binding fragment, derivative or mimetic thereof, and these fragments, derivatives, and mimetics have the required binding affinity for the target analyte. For example, antibody fragments such as Fv, F (ab) ₂ , and Fab can be prepared by cleavage of an intact protein, such as protease cleavage or chemical cleavage. Antibody fragments or derivatives produced by recombination or synthesis such as single chain antibodies or scFvs, or chimeric antibodies or CDR grafted antibodies are also targeted, and antibody fragments produced by such recombination or synthesis are subject to the binding properties of the above-mentioned antibodies. Is maintained. Such antibody fragments or derivatives usually comprise at least the V _H and V _L domains of the subject antibody in order to maintain the binding properties of the subject antibody. Such antibody fragments, derivatives, or mimetics of the invention are disclosed in US Pat. Nos. 5,851,829 and 5,965,371, the disclosures of which are hereby incorporated by reference. It can be readily prepared using any convenient methodology, such as a methodology.

  The above antibodies, fragments, derivatives, and mimetics thereof may be obtained from commercial sources and / or prepared using any convenient technique, including polyclonal antibodies, monoclonal antibodies, recombinant thereof Methods of producing fragments, derivatives and mimetics thereof including derivatives are known to those skilled in the art.

  Polynucleic acid aptamers are also suitable for use as binding domains. Polynucleic acid aptamers can be RNA oligonucleotides that can have the effect of selectively binding proteins in much the same way as receptors or antibodies (Conrad et al., Methods Enzymol. (1996), 267 (Combinatorial Chemistry), 336 -337). In certain embodiments where the analyte binding domain is a nucleic acid, such as an aptamer, the target analyte is not a nucleic acid.

  It is important that the analyte binding domain includes a site that can be covalently bound to the nucleic acid domain without substantially losing the binding affinity of the analyte binding domain to the target analyte.

  In addition to the antibody-based peptide / polypeptide or protein-based binding domain, the analyte binding domain is a lectin, soluble cell surface receptor, or derivative thereof, affibody, or any protein from combinatorial, or phage display or ribosome display It can also be a derived peptide, or any kind of combinatorial peptide or protein library. Any combination of analyte binding domains may be used.

  Each analyte binding domain of the proximity probes in the set may have the same or different binding sites on the analyte. Thus, for example, in the case of a homomeric protein complex or assembly comprising two or more identical subunits or protein components, the analyte binding domains of two or more probes can be the same. If the analyte comprises a single molecule or different subunits or components (eg, heteromeric complexes or aggregates of different proteins), the analyte binding domains can be different.

  Since the length of the nucleic acid domain of the proximal probe can be configured to span various molecular distances, the binding sites on the analyte of the analyte binding domain need not be on the same molecule. They can be on separate but close molecules. For example, multiple binding domains of microorganisms such as bacteria or cells, or viruses can be targeted by the methods of the invention.

  As described above, the analyte binding domain may bind directly or indirectly to the analyte. In the case of indirect binding, the target analyte is first bound by a specific binding partner (or affinity ligand), and the analyte binding domain of the proximal probe can bind to that specific binding partner. This allows the proximity probe to be designed as a universal reagent. For example, the analyte-specific partner is an antibody, and a set of universal proximity probes can be used to detect different analytes by binding to the Fc region of a variety of different antibodies specific for the analyte.

  The nucleic acid domains of the first and second proximity probes can be considered as nucleic acid “tags” that react with each other to form a detectable product that can be detected to signal detection of the analyte. As such, nucleic acid domains can be considered reactive nucleic acid functionalities that react with each other to provide a signal (more specifically, a signal-giving product) that is used to detect an analyte. it can. In other words, the nucleic acid domains can be considered as “detection tags” that react with each other to form or allow the formation of “detectable” tags or products. When two or more analytes are present in the same sample, they are detected simultaneously using two or more sets of proximity probes, each set of proximity probes extending one or more unique nucleic acid sequence upon interaction. Designed to form a product or “detectable tag”. These unique “detectable tags” include liquid chromatography, electrophoresis, mass spectrometry, DNA sequencing, both bead-based and planar DNA array technology, and multicolor real-time, simultaneously with or after amplification. It is separately detected and quantified using methods known in the literature, including PCR.

In a preferred embodiment, the detectable tag (ie extension product) is amplified and detected by quantitative PCR (qPCR), also known as real-time PCR. In particularly preferred embodiments, dyes that intercalate with nucleic acid molecules to provide a detectable signal, preferably a fluorescent signal, are used in qPCR. Fluorescent intercalating dyes that may be particularly useful in the present invention are SYBRGreen® and EvaGreen ^™ , but the qPCR embodiments of the present invention are not limited to these dyes.

  In the method of the invention, one or both of the nucleic acid domains of the first and second proximity probes are extended, thereby resulting in the formation of a new nucleic acid molecule or “extension product” that can be amplified or detected.

  In some embodiments, after one nucleic acid domain is extended, the nucleic acid domains can be ligated together to produce an extension product or a detectable tag. That is, the gap between the nucleic acid domains is “filled” by the polymerase enzyme using the “sprint” oligonucleotide as a template. In embodiments where the nucleic acid domain is ligated, this ligation is mediated by a splint that can be considered part of the nucleic acid domain of one proximity probe, as described above, ie, the nucleic acid domain is partially duplicated. This is the main chain. The splint may be provided separately as a free nucleic acid molecule or may be provided as a nucleic acid domain of a third proximity probe.

  The ligation results in the formation of new nucleic acid molecules or nucleic acid sequences that can be amplified and detected.

  A nucleic acid domain is a single-stranded nucleic acid molecule (ie, an oligonucleotide), a partially double-stranded, partially single-stranded molecule, or a double-stranded region and two nucleic acid strands are not complementary. It can be a double-stranded molecule comprising a region that is single-stranded. As such, in certain embodiments, the nucleic acid domain consists of a single stranded nucleic acid. In other embodiments, the nucleic acid domain consists of two partially complementary nucleic acid strands, the two strands comprising a hybridizing region and a non-hybridizing region.

  The nucleic acid domains of the first and second proximity probes must be capable of hybridization interaction, ie, formation of one or more duplexes. This interaction is direct, eg, the nucleic acid domains contain regions complementary to each other, preferably at their 3 ′ ends (complementary regions can be within one nucleic acid domain, eg, FIG. Version 2 and 4) or indirectly (eg, each of the nucleic acid domains of the first and second proximity probes can hybridize to a region of a so-called “sprint” oligonucleotide).

  In general, the nucleic acid domain is of sufficient length so that it can interact with the nucleic acid domain of the other proximal probe upon binding to the target analyte (or upon a sprint-mediated interaction). In general, nucleic acid domains range from about 8 to about 1000 nucleotides in length, and in certain embodiments, nucleic acid domains range from about 8 to about 500 nucleotides in length, including from about 8 to about 250 nucleotides in length, such as about 12 To about 150 nucleotides long, about 14 to about 130 nucleotides long, about 16 to about 110 nucleotides long, about 8 to about 90 nucleotides long, about 12 to about 80 nucleotides long, about 14 to about 75 nucleotides long, about 16 to about It may be about 8 to about 160 nucleotides long, such as 70 nucleotides long, about 16 to about 60 nucleotides long. In certain exemplary embodiments, the nucleic acid domains range from about 10 to about 80 nucleotides in length, from about 12 to about 75 nucleotides in length, from about 14 to about 70 nucleotides in length, from about 34 to about 60 nucleotides in length, and these It can be any length between the ranges. In some embodiments, the nucleic acid domain is generally about 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 44, 46, 50, 55, 60, 65, or 70 nucleotides in length or less.

  A nucleic acid domain consists of ribonucleotides and / or deoxyribonucleotides and synthetic nucleotide residues that can participate in Watson-Crick or similar base pair interactions, ie, the formation of “hybridization” or “duplex”. obtain. Thus, the nucleic acid domain can be DNA or RNA or any modification thereof, such as PNA or other derivatives that include a non-nucleotide backbone.

  The sequence of the nucleic acid domains of the first and second proximity probes (ie, the “detection” nucleic acid domain) is any sequence capable of forming a duplex, selected with respect to each other or with respect to the splint, if any Or it can be selected. Thus, the sequence is not critical as long as the first and second domains can hybridize to each other or to the third nucleic acid domain (sprint). However, the sequence should be selected so that hybridization other than hybridization between the nucleic acid domains of the first and second proximity probes or hybridization with the nucleic acid domain of the splint oligonucleotide is prevented. Once the sequence is selected or specified, the nucleic acid domain can be synthesized using any convenient method.

  The two components of the proximity probe are joined directly by a bond or indirectly through a linking group. When a linking group is utilized, such a group is such that the nucleic acid domain and the analyte binding domain are covalently bonded via the linking group so that the analyte binding domain maintains the desired binding affinity for its target analyte. Can be selected. The linking group of interest can vary greatly depending on the analyte binding domain. In many embodiments, if a linking group is present, it is biologically inactive. A variety of linking groups are known to those skilled in the art and can be used in the proximity probes. In an exemplary embodiment, the linking group is generally at least about 50 daltons, generally at least about 100 daltons, up to 1000 daltons or more, for example up to 1 million daltons if the linking group includes a spacer. However, it is typically less than about 500 daltons and generally less than about 300 daltons. In general, such linkers comprise a spacer group terminated at either end by a reactive functionality that can be covalently linked to a nucleic acid site or analyte binding site. Target spacer groups include aliphatic and unsaturated hydrocarbon chains, spacers containing heteroatoms such as oxygen or nitrogen (ethers such as polyethylene glycol in the case of oxygen, polyamines in the case of nitrogen), peptides, hydrocarbons, It can include cyclic or acyclic systems that can include heteroatoms. The spacer group can also consist of a ligand that binds to the metal such that two or more ligands coordinate to form a complex in the presence of the metal ion. Specific spacer elements include 1,4-diaminohexane, xylylenediamine, terephthalic acid, 3,6-dioxaoctanedioic acid, ethylenediamine-N, N-diacetic acid, 1,1′-ethylenebis (5 -Oxo-3-pyrrolidinecarboxylic acid) and 4,4'-ethylenedipiperidine. Potential reactive functional groups include nucleophilic functional groups (amines, alcohols, thiols, hydrazides), electrophilic functional groups (aldehydes, esters, vinyl ketones, epoxides, isocyanates, maleimides), cycloaddition reactions, disulfide bonds Or a functional group capable of binding to a metal. Specific examples include primary and secondary amines, hydroxamic acid, N-hydroxysuccinimidyl ester, N-hydroxysuccinimidyl carbonate, oxycarbonylimidazole, nitrophenyl ester, trifluoroethyl ester, glycidyl ether , Vinyl sulfone, and maleimide. Specific linker groups that may be useful in the proximity probes of the present invention include azidobenzoyl hydrazide, N- [4- (p-azidosalicylamino) butyl] -3 ′-[2′-pyridyldithio] propionamide), Bis-sulfosuccinimidyl suberate, dimethyl adipimidate, disuccinimidyl tartrate, N-maleimidobutyryloxysuccinimide ester, N-hydroxysulfosuccinimidyl-4-azidobenzoate, N-succinimidyl [4 -Azidophenyl] -1,3'-dithiopropionate, N-succinimidyl [4-iodoacetyl] aminobenzoate, glutaraldehyde, succinimidyl-4- [N-maleimidomethyl] cyclohexane-1-carboxylate, etc. Heterofunctional compound 3- (2-pyridyldithio) propionic acid N- hydroxysuccinimidyl ester (SPDP), 4-(N- maleimidomethyl) - cyclohexane-1-carboxylic acid N- hydroxysuccinimide ester (SMCC), and the like.

  Proximity probes utilized in the methods of the present invention can be prepared using any convenient method. In an exemplary embodiment, the nucleic acid domain is bound to the analyte binding domain directly or indirectly through a linking group. These components may be covalently linked to each other via functional groups as is known in the art, such functional groups being present on the component, for example oxidation reactions, reductions You may introduce | transduce into a component using one or more processes, such as reaction and a cutting reaction. Functional groups that can be used to covalently bond components to each other to produce proximity probes include hydroxy groups, sulfhydryl groups, amino groups, and the like. The particular portion of the different component modified to provide covalent binding can be selected so as not to substantially interfere with the desired binding affinity of the component for the target analyte. A blocking group may be used to protect a particular site on the component, as is known in the art, as needed and / or desired. See, for example, Green & Wuts, Protective Groups in Organic Synthesis (John Wiley & Sons) (1991). Methods for producing nucleic acid / antibody conjugates are known to those skilled in the art. See, for example, US Pat. No. 5,733,523, the disclosure of which is hereby incorporated by reference.

  In other embodiments, nucleic acid-protein conjugates, i.e., nucleic acid covalently linked to a protein, such as a molecule having a coding sequence, can be used to produce proximity probes. That is, the analyte binding domain is produced in vitro from a vector encoding a proximity probe. Examples of in vitro protocols of interest include protocols using RepA (see eg Fitzgerald, Drug Discov. Today (2000) 5: 253-258 and WO 98/37186), protocols using ribosome display (eg Hanes et al. al., Proc. Natl Acad. Sci. USA (1997) 94: 4937-42, Roberts, Curr Opin Chem Biol (1999) Jun; 3: 268-73, Schaffitzel et al., J Immunol Methods (1999) Dec 10 231: 119-35, and WO 98/54312).

  In embodiments utilizing a splint oligonucleotide (which may be the nucleic acid domain of a third proximity probe), the splint oligonucleotide is between the nucleic acid domains of the first and second proximity probes (ie, the “detection” domain). It has a function to mediate interaction. As noted above, splint oligonucleotides can also act as nucleic acid domains to be extended, resulting in extension products that are amplified and detected according to the methods of the invention. Therefore, the Sprint is a “connector” oligo that acts to connect or “hold together” so that the detection domains of the first and second proximity probes react with each other or are ligated together. It can be considered a nucleotide. Alternatively, or in addition, a splint can be used as an extendable domain of a nucleic acid domain, or a tag, or another nucleic acid domain that acts as a “primer” for extension to generate an extension product to be amplified and detected. Can be considered.

  In these embodiments, the splint hybridizes with the nucleic acid domains of the first and second proximity probes. More specifically, the splint hybridizes (anneals) at least simultaneously with the nucleic acid domains of the first and second proximity probes. However, if a “sprint” oligonucleotide is prehybridized to the nucleic acid domain of at least one said proximal probe, it will hybridize to the nucleic acid domain of the other neighboring probe before hybridizing to one. However, it is preferred that the “sprint” be hybridized simultaneously with the nucleic acid domains of both proximity probes to form an extensible and stable complex.

  When the splint oligonucleotide is provided as the nucleic acid domain of the third proximity probe, the nucleic acid domains of all sets of proximity probes are hybridized to each other so that when the probe-target complex binds to the target analyte. Increases binding activity. This binding activity effect contributes to the sensitivity of the assay by supporting the formation of a complex between the proximate probe providing the signal and the target analyte.

  As used herein, the term “hybridization” or “hybridize” means the formation of a duplex between nucleotide sequences that are sufficiently complementary to form a duplex by Watson-Crick base pairing. Two nucleotide sequences are “complementary” to each other if their molecules share a base pair organizational homology. “Complementary” nucleotide sequences, combined with specificity, form stable duplexes under appropriate hybridization conditions. For example, two sequences are complementary if a portion of the first sequence can bind to a portion of the second sequence in an anti-parallel sense, and the 3 ′ end of each sequence is Bound to the 5 ′ end of the other sequence, each sequence A, T (U), G, and C is aligned with the other sequence T (U), A, C, and G, respectively. The RNA sequence can also include complementary A = U or U = A base pairs. Thus, in the present invention, homology need not be complete for two sequences to be “complementary”. Typically, the two sequences are molecules that are judged to be complementary or at least about 85% (preferably at least about 90%, most preferably at least about 95%) of nucleotides base paired for a given length of the domain. If they share a configuration, they are fully complementary. Therefore, the nucleic acid domains of the first and second proximity probes include a region that is complementary to the nucleic acid domain of the other proximity probe. Alternatively, if a splint oligonucleotide is used, the first and second proximity probes include a region that is complementary to the splint oligonucleotide (which may be present on the third proximity probe), whereas the splint oligonucleotide is , Comprising regions complementary to each of the nucleic acid domains of the first and second proximity probes.

  The complementary region (ie, the hybridization region) can have a length in the range of 4-30 bp, such as 6-20, 6-18, 7-15, or 8-12 bp.

  Generally, the splint nucleic acid domain is of sufficient length to result in simultaneous binding of the nucleic acid domains of the first and second probes described above. In an exemplary embodiment, the splint oligonucleotide ranges from about 6 to about 500 nucleotides in length, including from about 20 to about 40 nucleotides in length, for example from about 25 to about 30 nucleotides in length.

  As described above, the interaction between the nucleic acid domains of the first and second proximity probes is mainly duplex formation, with one or both nucleic acid domains extending, in particular, using the nucleic acid domain of the other proximity probe as a template. It can be subjected to a template-directed extension. As a result, for example, when both domains are fully extended, a complete double-stranded nucleic acid, or, for example, only one strand is extended or both strands are partially extended. Can form a partially double-stranded molecule. Thus, extension of one or both nucleic acid domains can be thought of as joining the respective domains, eg, generating one double stranded nucleic acid from two single stranded molecules.

  In other embodiments, this “junction” can be a ligation. In particular, for example, the nucleic acid domain of the first proximity probe can be template-directed ligation of the two domains with its 3 ′ end in close proximity to the 5 ′ end of the second proximity probe. It is stretched. In such a case, it can be seen that the ligation template is provided by a splint that forms part of one of the nucleic acid domains or can be separately provided in solution or as a nucleic acid domain of a third proximity probe. . Such ligation can be performed, for example, using a ligase enzyme that can be added to the reaction after extension of the nucleic acid domain of the first proximity probe mediated by a polymerase.

  Thus, in a preferred embodiment of the method of the invention, the nucleic acid domains of the first and second probes can be ligated using a reaction templated by the hybridized splint, and the nucleic acid domains are ligated. After extension of one nucleic acid domain, a “ligation” product that is also an extension product is amplified and detected. Thus, in such embodiments, a splint can be considered as a “sprint template” or “ligation template” or “template oligonucleotide”. In such embodiments, the splint can also be extended to produce additional “extension products” that are amplified and detected.

  As mentioned above, the nucleic acid domains of the first and second proximity probes need to be linked to the analyte binding domain in a specific orientation in order for various interactions to occur between the nucleic acid domains. . For example, when extending both domains, the domains comprise single stranded nucleic acids, each nucleic acid domain linked to an analyte binding domain at its 5 ′ end and “annealed” when in proximity or “ The free 3 'hydroxyl end to be "hybridized" must be left. However, when extending a conjugate of one domain and / or two domains, the nucleic acid domain of the first proximity probe is linked by its 5 ′ end (leaving a free 3 ′ hydroxyl end that can be extended) It is common (not required, see version 4 in FIG. 1) to link the other domain by its 3 ′ end (leaving a free 5 ′ phosphate end that cannot be extended using conventional polymerases). .

  In embodiments in which the nucleic acid domains can be linked, each of the first and second nucleic acid domains hybridizes to the splint, or the nucleic acid domain of one proximate probe has a partially double stranded overhang. In the case of a double-stranded domain, the nucleic acid domain of the other proximity probe hybridizes with the overhanging domain. A domain having a 3 'end can then be extended by template-directed extension to the 5' phosphate end of the other domain and the two strands can be joined using a ligase enzyme. Therefore, each of the 3 ′ end and the 5 ′ end does not immediately hybridize to each other even if they are close to each other on the sprint (template), and thus hybridizes to the sprint, so there is a space (or stretch of nucleotides) between them. Remains.

  The gap, space, or stretch of nucleotides between the two ends ranges from about 8 to about 1000 nucleotides in length, and in certain embodiments they are about 8 to 500, including about 8 to about 250 nucleotides in length. Nucleotide length ranges such as about 12 to about 150 nucleotides long, about 14 to about 130 nucleotides long, about 16 to about 110 nucleotides long, about 8 to about 90 nucleotides long, about 12 to about 80 nucleotides long, about 14 to It may be about 8 to about 160 nucleotides long, such as about 75 nucleotides long, about 16 to about 70 nucleotides long, about 16 to about 60 nucleotides long. In certain exemplary embodiments, the nucleic acid domains range from about 10 to about 80 nucleotides in length, from about 12 to about 75 nucleotides in length, from about 14 to about 70 nucleotides in length, from about 34 to about 60 nucleotides in length, and these It can be any length between the ranges. In some embodiments, the nucleic acid domain is generally about 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 44, 46, 50, Less than 55, 60, 65, or 70 nucleotides in length.

  As such, the splint can include a first 3 'region that is complementary to the nucleic acid domain of the 5' free proximity probe and a second 5 'region that is complementary to the nucleic acid domain of the 3' free proximity probe. The first and second regions of the splint are 3-20, 6-17, 6-15, or 6-12, or 8-12 nucleotides long, eg, about 13-17, 12-16, 11-15, or It can be 12-14 nucleotides long, or about 6-12, 7-11, or 8-10 nucleotides long.

  As described in detail below, amplification of the ligation / extension product is performed before or simultaneously with the detection step. Thus, in some embodiments, the splint may be designed to minimize the possibility of false amplification that can occur in such a process, for example, the splint may act as a template for the polymerase used in the amplification. It is considered desirable. Thus, splints can be provided, for example, as RNA oligonucleotides or DNA / RNA hybrids (since Taq polymerase commonly used in amplification reactions cannot use RNA templates). Alternatively, a similar effect can be achieved with a DNA splint having two short hybridization regions (since hybridization is weak, such splints do not template DNA polymerization at the high temperatures used in PCR).

  Alternatively, in other preferred embodiments, the splint is advantageously extended to produce an extension product as defined above, which itself is amplified and detected according to the method of the present invention.

  In certain embodiments, a sample can be assayed to examine two or more different target analytes. In such an embodiment, the sample is contacted with a set of proximity probes for each target analyte such that the number of sets in contact with the sample is 2 or more, such as 3 or more, 4 or more, and the like. Such a method is particularly useful in multiplex and high throughput applications.

  Concentrations of proximity probes in the reaction mixture so that the proximity probes do not bind to the target analyte and are not in close proximity to each other in a random manner (at least to prevent this from occurring on a large scale or substantially) The amount of proximity probe added to the sample can be selected so that is sufficiently low. Therefore, it means that the proximity probes are close to each other only when the proximity probe is bound to the analyte through the binding interaction between the analyte binding domain of the proximity probe and the binding site of the analyte.

  Surprisingly, however, the addition of a component containing 3 ′ exonuclease activity degrades the nucleic acid domain with a free and unprotected 3 ′ end, and interaction between adjacent probes that are not bound to the target analyte. It has been found that the number of can be reduced. In this regard, such interaction is transient because it is less stable than the interaction between probes bound to the target analyte. As a result, such unbound probes are degraded by components that contain 3 'exonuclease activity. As such, the methods of the present invention may be able to use proximity probes at concentrations that could not be used previously in proximity-based detection assays. This is particularly advantageous when higher concentrations are required due to the moderate or low affinity of the analyte binding domain of the proximity probe to the target analyte.

  In an exemplary embodiment, the concentration of the proximity probe in the reaction mixture after mixing with the sample is in the range of about 1 fM to 1 μM, such as about 1 pM to about 1 nM, including about 1 pM to about 100 nM.

  After mixing the sample and the set of proximity probes, the reaction mixture is incubated for a period of time sufficient for the proximity probes to bind to the target analyte (if any) in the sample. In an exemplary embodiment, the product mixture is incubated at a temperature in the range of about 4 to about 50 ° C., including about 20 to about 37 ° C., for a period of about 5 minutes to about 48 hours, including about 30 minutes to about 12 hours. Can be done. The conditions under which the reaction mixture is maintained should be optimized so that the proximity probes are specifically bound to the analyte while non-specific interactions are suppressed. Conditions should also allow for efficient and specific hybridization between the nucleic acid domains described above.

  In some embodiments, the proximity probe is lyophilized. In one embodiment of the invention, the lyophilized proximity probe is rehydrated prior to contacting the sample containing the analyte. In a preferred embodiment of the invention, the lyophilized proximity probe is rehydrated when added to a sample containing the target analyte.

In certain embodiments, when a target analyte is present in the sample, the effective volume of the incubation mixture is reduced during at least part of the incubation step in which the proximity probe binds to the target analyte. In these embodiments, the effective volume of the incubation mixture can be reduced for a number of different reasons. In certain embodiments, the effective volume of the incubation mixture is reduced to allow use of an analyte binding domain with medium or low affinity and / or to increase the sensitivity of the assay. For example, in certain embodiments in which the effective volume of the incubation mixture is reduced, the analyte binding domain is a binder with medium or low affinity, where medium or low affinity means analyte binding to the target analyte. It means that the binding affinity of the domain is less than about 10 ⁻⁴ M, such as 1 nMkd. In certain embodiments, the assay can detect no more than about 100 target analytes in a 1 μL sample, including no more than about 75 target analytes in a 1 μL sample, and no more than about 50 target analytes in a 1 μL sample. The sensitivity of the assay can be increased.

  In certain embodiments, during the incubation step, for example, to reduce the effective volume of the incubation mixture while proximity probes bind to their target analytes, A “volume excluder” is included in the mixture. “Crowding agents” are usually water-soluble macromolecular substances. Suitable macromolecular substances broadly include biocompatible natural or synthetic polymers having an average molecular weight of about 1500 to several million and do not specifically interact with other reagents or products in the mixture. Such polymers are described in the art as “volume” because their main function is to occupy volume in an in vitro reaction medium, providing a high concentration environment for biochemical reactions, eg, approaching in vivo conditions. Known as “Excluder”. Of course, the volume exclusion polymer must be sufficiently soluble to provide the required concentration. Suitable exemplary polymers include, but are not limited to, commercially available, for example, polyethylene glycol (PEG) polymers having an average molecular weight greater than about 2000, FICOLL polymers such as FICOLL polymers having an average molecular weight of about 70,000, bovine plasma Examples include albumin, glycogen, polyvinylpyrrolidone, and dextran such as Sephadex (registered trademark) which is a cross-linked dextran. High molecular weight PEG polymers, particularly PEG 1450, PEG 3350, PEG 6000 (also sold as PEG 8000), and PEG 20000 having average molecular weights of about 1450, 3000-3700, 6000-7500, and 15,000-20,000, respectively Are utilized in representative embodiments. PEG 6000 and PEG 8000 are used in representative embodiments. The concentration of the volume exclusion polymer in the incubation reaction in an exemplary embodiment is in the range of about 5% w / v to about 45% w / v, depending on the type of polymer and its molecular weight. In general, to obtain the same effect on enzyme activity, a given type of polymer with a higher molecular weight needs to be present at a lower concentration than the same type of polymer with a lower molecular weight.

  In a preferred embodiment, the crowding agent or volume excluder is Sephadex. In a particularly preferred embodiment, the Sephadex is of the G-100 type.

  In embodiments where a volume extruder is utilized, prior to the next step of the method of the present invention, the presence of the volume extruder, for example, depending on the amount of volume extruder present, the characteristics of the diluent fluid, etc. The incubation mixture can be diluted to at least about 2-fold or more, such as at least 5-fold or more, including at least about 10-fold or more. In an exemplary embodiment, the dilution fluid is water or other suitable aqueous fluid that includes water and one or more solutes such as salts, buffers, and the like.

  As an alternative or in addition to using a volume excluder, the volume of the incubation mixture may be reduced during the incubation by removing a portion of the water from the incubation mixture, for example by evaporation. In these embodiments, the volume of fluid may be reduced as desired, including at least about 2 times or more, including at least about 10 times or more, including at least about 10 times or more. In these embodiments, it is important not to remove all the water from the incubation mixture. Any convenient protocol may be used to reduce the volume of the incubation mixture by removing a portion of the water from the incubation mixture. Means for controlling the evaporation rate may be used by observing and adjusting the humidity and temperature, and in certain embodiments, for example, the volume of the incubation mixture is reduced by continuously measuring the volume of the incubation mixture. When observed and properly evaporated, the polymerase and PCR mixture can be added as described above. A heating block can be used if desired to enhance evaporation. Alternatively, the volume of the incubation mixture may be reduced by filtering and removing water. In an exemplary embodiment, a size exclusion filter is used to selectively include molecules of a size larger than the exclusion limit and to pass smaller molecules and water through the filter. The force applied to the solution to pass the solution through the filter can be either stretch separation or vacuum suction.

  When the binding domain of the proximity probe binds to the analyte, the nucleic acid domains of the proximity probe approach each other. As a result, the nucleic acid domains of the first and second probes can hybridize to each other directly or indirectly, for example via a splint.

  If a sprint is present, the sprint can be added to the sample prior to, simultaneously with, or after the proximity probe. In one embodiment, the splint is prehybridized to the proximity probe. In other embodiments, the splint oligonucleotide forms part of the nucleic acid domain of the proximal probe. In yet other embodiments, the splint oligonucleotide is linked to the analyte binding domain in the form of a third proximity probe, preferably added simultaneously with the first and second proximity probes.

  After mixing the sample with the proximity probe, the sample may preferably be diluted with non-enzymatic components for extension reactions, such as buffers, salts, nucleotides, etc., rather than components that include 3 'exonuclease activity. In preferred embodiments, the dilution also includes reagents for the amplification reaction, such as buffers, salts, nucleotides, primers, and polymerases. The dilution process serves to reduce the possibility of interaction between unbound proximity probes and / or their interaction with other components in the sample.

  Dilution may also prevent interaction between the bound probe nucleic acid domains. However, since the bound probes are close to each other, they are stable (ie, annealed or hybridized again) under appropriate conditions, even if there are hindered interactions. Thus, in one embodiment, the sample can be further incubated for a period of time sufficient to stabilize the interaction between the bound proximity probes. In an exemplary embodiment, the product mixture has a temperature in the range of about 4 to about 50 ° C., including about 20 to about 37 ° C., for a period in the range of about 5 minutes to about 48 hours, including about 30 minutes to about 12 hours. Can be incubated. The conditions under which the reaction mixture is incubated should be optimized so that specific binding of the proximity probe to the analyte is retained while non-specific interactions are suppressed. Conditions should also allow efficient and specific hybridization between nucleic acid domains as described above.

  When an amplification reagent is added to the sample after the step of incubating the probe and sample, the primer is preferably protected from 3 'exonuclease activity by modifying the 3' end of the primer as described above. Alternatively, or in addition, in a further preferred embodiment, the primer may be a hot start PCR primer, such as a stem loop primer. In a preferred embodiment, the polymerase is a thermostable polymerase as further defined below. In still other preferred embodiments, buffers and / or salts allow for the activity of all enzymes added to the sample.

  Following an optional dilution step, a component containing 3 'echinonuclease activity is contacted with the sample. This step may include further dilution of the sample, eg, adding an appropriate buffer and / or other salt / component ingredients. As noted above, the component comprising 3 'echinonuclease activity can be added prior to or simultaneously with the polymerase enzyme required for the extension reaction. In a preferred embodiment, the polymerase enzyme also includes 3 'echinonuclease activity. The sample can be further incubated under appropriate conditions to effect its 3 'echinonuclease activity on the nucleic acid domain of the unbound proximal probe. The same conditions should also contribute to the elongation of the nucleic acid domain if a polymerase is present in the sample. In some embodiments, a polymerase can be added after the component comprising 3 'echinonuclease activity. In this case, the sample can be further incubated to produce an extension product. Incubation conditions vary depending on the components used in the reaction, and some typical conditions are those described above. However, in embodiments where the polymerase used for nucleic acid domain extension is a thermostable polymerase such as a hyperthermophilic polymerase as defined above, eg, modified Taq polymerase, Pfu DNA polymerase, Pwo DNA polymerase, or Taq polymerase, the present invention. Other reaction conditions, particularly other temperature conditions, may be preferred in the echinonuclease step and / or extension step of the method. For example, the temperature for the extension reaction, and if the polymerase also includes 3 ′ echinonuclease activity, the temperature for the echinonuclease reaction is about 20 to about 75 ° C., about 30 to about 60 ° C., or about 45 to about It can range from about 4 to about 80 ° C. including 55 ° C. Thus, in some embodiments, the temperature for the extension reaction, and if the polymerase also includes 3 ′ echinonuclease activity, the temperature for the echinonuclease reaction is at least 20, 25, 30, 35, 40, 45. , 50, 55, 60, 65, 60, or 75 ° C.

  Following production of the extension product, the component containing 3 'echinonuclease activity can be inactivated. In a preferred embodiment, for example, heat denaturation at 65-80 ° C. for 10 minutes inactivates the 3 ′ echinonuclease activity, but the necessary conditions change depending on the nature of the component, eg, the 3 ′ echinonuclease activity. It can be seen that the included hyperthermophilic polymerase cannot be inactivated under the above conditions. In some embodiments, heat inactivation can be the first step of the amplification reaction.

  If no amplification reactant was added to the sample after the step of contacting the proximity probe to the sample, the reactant should be contacted with the sample at this stage. In a preferred embodiment, an aliquot of the sample can be transferred to a new container containing the amplification component and amplified and detected. In this regard, after inactivation of a component containing 3 'echinonuclease activity, the primer need not be resistant to 3' echinonuclease activity.

  In some embodiments, if the polymerase capable of extending the nucleic acid domain of the proximity probe is a hyperthermophilic polymerase or thermostable polymerase as described above, such as Pfu DNA polymerase, Pwo DNA polymerase, etc., the polymerase is also useful in the extension reaction. Can be.

  When an amplification reagent is added to the sample after the step of bringing the proximity probe into contact with the sample, the amplification reaction can proceed directly. In a preferred embodiment, an aliquot of the sample is transferred to a new container and amplified and detected.

  In general, any convenient protocol that can detect the presence of proximity-dependent interactions can be used. The detection protocol may or may not require a separate step.

  In an exemplary embodiment (other exemplary embodiments of the method of the present invention are described above), the extension products generated from the interaction of the first and second proximity probes are the first and second Realized by nucleic acid extension of the free 3 ′ hydroxyl end of the nucleic acid domain of the second proximity probe, this interaction is later detected by amplifying and detecting the extension product. In this exemplary embodiment, extension of the nucleic acid domains of the first and second proximity probes contact the reaction mixture with, for example, nucleic acid extension activity provided by a suitable nucleic acid polymerase, and nucleic acid domain extension occurs. This is accomplished by maintaining the mixture under conditions sufficient for

  As is known in the art, polymerases catalyze the formation of phosphodiester bonds between juxtaposed nucleotides, and nucleotides containing a 3 ′ hydroxyl site (3 ′ end) can be used to generate an existing polymer of nucleotides. I.e. it may form part of a nucleic acid. In general, the nucleic acid is annealed or hybridized to a complementary nucleic acid molecule (ie, a template nucleic acid) that acts as a template for extension of a nucleic acid having a free 3 'end. A free nucleotide having a free 5 'phosphate site, complementary to the next nucleotide on the template nucleic acid, then joins and extends the nucleic acid having a free 3' end. This process is repeated, for example, until the end of the mold is reached. Any convenient polymerase may be used, and representative polymerases of interest include, but are not limited to, polymerases including components containing 3 ′ echinonuclease activity, such as T4 DNA polymerase, T7 DNA polymerase, Phi 29 ( Φ29) DNA polymerase, DNA polymerase I, Klenow fragment of DNA polymerase I, Pfu DNA polymerase, and / or Pwo DNA polymerase. Polymerases with 3 'echinonuclease activity can be obtained from any suitable organism, including but not limited to prokaryotes, eukaryotes, or archael organisms. Certain RNA polymerases may be used in the methods of the invention.

An extension step is performed by a polymerase having no 3 ′ echinonuclease activity, such as Klenow exo (−), Taq polymerase, Pfu (exo ⁻ ) DNA polymerase, Pwo (exo ⁻ ) DNA polymerase, etc. (an extension product is generated) If so, a component comprising a 3 ′ echinonuclease, such as an echinonuclease enzyme, is added to the sample prior to or simultaneously with the polymerase. Any convenient 3 ′ exonuclease, such as echinonuclease I, may be used. Certain RNA exonucleases may be used in the methods of the invention.

In this extension step, a suitable polymerase, optionally another 3 ′ exonuclease, and any necessary and / or desired reagents are mixed with the reaction mixture to cause extension of the hybridized nucleic acid domain. To maintain under sufficient conditions. The conditions should also be sufficient for degradation of the nucleic acid domain of the unbound proximity probe to occur. Conditions for polymerase and echinonuclease reactions are known to those skilled in the art. During the extension and / or decomposition, the reaction mixture may in certain embodiments range from about 4 ° C. to about 80 ° C., such as about 20 to about 75 ° C., about 30 to about 60 ° C., such as about 45 to It can be maintained at about 55 ° C. or about 20 ° C. to about 37 ° C. (depending on the optimal conditions for the polymerase used in the assay) for a period ranging from about 5 seconds to about 16 hours, such as about 1 minute to about 1 hour. In still other embodiments, the reaction mixture is at a temperature in the range of about 35 ° C. to about 45 ° C., such as about 37 ° C. to about 42 ° C., such as at or near 38 ° C., 39 ° C., 40 ° C., or 41 ° C. Or in the range of about 35 ° C to about 75 ° C, such as above about 40 ° C to about 60 ° C, about 45 ° C to 55 ° C, such as 46 ° C, 47 ° C, 48 ° C, 49 ° C, 50 ° C, 51 ° C, It may be maintained at or near 52 ° C, 53 ° C or 54 ° C for a period ranging from about 5 seconds to about 16 hours, such as from about 1 minute to about 1 hour, including from about 2 minutes to about 8 hours. In an exemplary embodiment, the amplification component is not included prior to adding the component containing 3 ′ echinonuclease activity, and the extension and degradation reaction mixture is 70 mM Tris pH 7.5, 17 mM ammonium sulfate, 1 mM DTT, 40 μm. Each dNTP, 3 mM MgCl ₂ , 62.5 units / ml DNA polymerase, eg, T4 DNA polymerase. In an exemplary embodiment, an amplification component is included prior to adding a component comprising 3 ′ echinonuclease activity, and the extension and degradation reaction mixture is 50 mM KCI, 20 mM Tris-HCI pH 8.4, 0.2 mM. each dNTPs, 3 mM of MgCl _2, SYBR Green I, including fluorescein 20 nM, 3'thioate protection hairpin primers, 25 units / ml of iTaqDNA polymerase, and 62.5 units / ml of DNA polymerases, for example, a T4DNA polymerase.

  After extension, extension products (eg, extended nucleic acid domains of the first and second probes) are amplified as an indication of the presence of the analyte in the sample or as a measure of the amount and optionally location of the analyte in the sample. And detected. As described above, the extension product can include single-stranded or double-stranded nucleic acid molecules. Single-stranded nucleic acid molecules are either dissociated from the nucleic acids of the first and second proximity probes or are in close proximity to the two of the first and second probes that are terminated at each end in the analyte binding domain. It can be provided by extension of a splint oligonucleotide that can be a conjugated product of a nucleic acid domain.

  The next step of the method of the invention following the extension step is the step of identifying the presence of extension products in the reaction mixture to detect the target analyte in the sample. That is, to detect the presence of the target analyte in the sample being assayed, the reaction product is screened (ie, assayed, evaluated, numerically determined, analytical test, etc.) and the resulting extension product Confirm the existence of. According to the present invention, the detection step includes an amplification step that produces an amplification product that is normally detected by amplification of all or part of the extension product.

  The extension product, more specifically the amplification product, produced by the above method can be detected using any convenient protocol in the broadest sense. The particular detection protocol can vary depending on the sensitivity desired and the application in which the method of the invention is practiced. As described herein, in the methods of the invention, the detection protocol includes an amplification component, increasing the number of copies of the extension product nucleic acid (or a portion thereof), eg, increasing the sensitivity of a particular assay. Can be. However, in other methods, extension products can be detected directly without amplification.

  Although not a preferred embodiment of the method of the invention, the nucleic acid extension product can be detected in many different ways if detection without amplification is feasible. For example, one or more of the extension products can be directly fluorescently labeled, such as directly fluorescently labeled, or otherwise labeled with spectrophotometry or a radioisotope, or any signal, such that the extension product is directly labeled. It can be labeled with a donor label. In these embodiments, in order to detect extended nucleic acids, the directly labeled extension product is sized from the remainder of the reaction mixture comprising non-extended oligonucleotides (ie, nucleic acid domain oligonucleotides or splint oligonucleotides). Can be separated. Alternatively, conformationally selective probes, such as molecular beacons (discussed in more detail below) may be used to detect the presence of extension products, in which case these probes may be extended nucleic acids. It is directed to sequences that exist only in the product.

  As described above, in a preferred embodiment of the method of the present invention, the detection step comprises an amplification step, for example, the number of replicates of the extended nucleic acid or part thereof is increased to increase the sensitivity of the assay. The amplification may be linear or exponential as desired, and typical amplification protocols of interest include, but are not limited to, polymerase chain reaction (PCR), isothermal amplification, rolling circle amplification Etc. In a particularly preferred embodiment of the invention, the amplification protocol is quantitative PCR (qPCR) or real-time PCR.

  For example, rolling circle amplification using the padlock probe described in US Pat. No. 6,558,928 or any circular nucleic acid molecule as a template is also generated from an existing “signal” nucleic acid molecule or part thereof, such as a proximity extension assay. It is useful for the amplification of extended products. Thus, in a preferred embodiment of the invention, the extension product (or part thereof) can be amplified by rolling circle amplification. In one embodiment, rolling circle amplification is performed using a padlock probe. In other embodiments, rolling circle amplification is performed using a circular template (circular oligonucleotide).

  When the detection step includes an amplification step (more specifically, an in vitro amplification step of the extension product or a part thereof), the sample can be detected by detecting the amplified product (or the amplification product). .

  Polymerase chain reaction (PCR) is known in the art and is described in US Pat. Nos. 4,683,202, 4,683,195, 4,800,159, 4,965,188, and No. 5,512,462, the disclosures of which are incorporated herein by reference. In a typical PCR amplification reaction, the extension nucleic acid or extension product (which can also be regarded as a template nucleic acid in the amplification reaction) is one or more primers used in the primer extension reaction, eg, a PCR primer (geometric Forward primer and reverse primer used in (or exponential) amplification, or a single primer used in linear amplification). The oligonucleotide primer to which the template nucleic acid (referred to below as template DNA for convenience) is contacted is of sufficient length to provide hybridization to complementary template DNA under annealing conditions (described in more detail below). Have. Primer length is usually at least 10 bp, generally at least 15 bp, more usually at least 16 bp, longer is 30 bp or more, and primer length is usually 18-50 bp, generally about 20 Can be ~ 35 bp. The template DNA is contacted with a single primer or a set of two primers (forward primer and reverse primer) depending on whether primer extension, linear amplification or exponential amplification of the template DNA is desired. obtain.

  As described above, the primer can be added to the sample prior to adding a component comprising 3 'echinonuclease activity. In that case, the primer is modified to have resistance to 3 'echinonuclease activity, for example, by modification of the 3' end. Further, the primer may be a hot start primer as described above.

  In addition to the above components, the reaction mixture produced by the method of the present invention typically comprises a polymerase and deoxyribonucleoside triphosphates (dNTPs). Desirable polymerase activity can be provided by one or more separate polymerase enzymes. In many embodiments, the reaction mixture includes at least a family A polymerase, including, but not limited to, naturally occurring polymerase (Taq) and Klentaq (Barns et al, Proc. Natl. Acad. Sci USA (1994) 94: 2216-2220) or thermophilic bacterial polymerases including derivatives and analogs thereof such as iTaq (BioRad); natural polymerase (Tth) and derivatives and analogs thereof, etc. And an extremely thermophilic bacterium polymerase. In certain embodiments where the amplification reaction performed is a high fidelity reaction, the reaction mixture may further comprise a polymerase enzyme having 3′-5 ′ echinonuclease activity that may be provided, for example, by Family B polymerase. . Family B polymerases of interest include, but are not limited to: Hyperthermophilic archaeon DNA polymerase (Vent) as described in Perler et al, Proc. Natl. Acad. Sci. USA (1992) 89: 5577-5581; Examples include Purocox species GB-D (Deep Vent); Purocox friosus DNA polymerase (Pfu) described in Lundberg et al., Gene (1991) 108: 1-6, Purocox vessei (Pwo), and the like. When the reaction mixture includes both Family A and Family B polymerases, the amount of Family A polymerase present in the reaction mixture is greater than that of Family B polymerase, and the difference in activity is generally at least 10 times, more commonly Is at least 100 times. Typically, the reaction mixture contains four different dNTPs corresponding to the four natural bases present, namely dATP, dTTP, dCTP, and dGTP. In the method of the present invention, the amount of each dNTP present is usually about 10 to 5000 μM, and generally about 20 to 1000 μM.

The reaction mixture prepared in the detection step of the method of the present invention may further comprise an aqueous buffer medium comprising a source of monovalent ions, a source of divalent cations, and a buffer. Any convenient source of monovalent ions such as KCI, potassium acetate, ammonium acetate, potassium glutamate, NH ₄ Cl, ammonium sulfate, etc. can be used. The divalent cation may be magnesium, manganese, zinc or the like, and generally the cation is magnesium. Any convenient source of magnesium cation can be used, including MgCl ₂ , magnesium acetate, and the like. The amount of Mg ²⁺ present in the buffer can range from 0.5 to 10 mM, but is preferably in the range of about 3 to 6 mM, ideally about 5 mM. Exemplary buffers or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS, etc., and the amount of buffer is usually in the range of about 5-150 mM, generally about 10-10. 100 mM, more typically about 20-50 mM, and in certain preferred embodiments, the buffer is at 72 ° C. and has a pH in the range of about 6.0-9.5, most preferably a pH of 7 A sufficient amount to be .3. Other agents that may be present in the buffer medium include chelating agents such as EDTA and EGTA.

  In preparing the reaction mixture for this step of the process of the invention, the various components can be mixed in any convenient order. For example, the buffer may be mixed sequentially with the primer, polymerase, and template DNA, or all of the various components may be mixed simultaneously to form a reaction mixture. In a particularly preferred embodiment, the amplification reaction is mixed with the components of the extension reaction and the decomposition reaction. In this regard, the components of the reaction include all of the enzyme components of the reaction, ie, components that include 3 ′ echinonuclease activity, a “first” polymerase for the generation of extension products, and optionally a “first” polymerase. Is preferably suitable for the activity of a “second” polymerase for the amplification step. In some embodiments, the “first” polymerase and the “second” polymerase are the same, ie, the polymerase extends the nucleic acid domain of the proximal probe and amplifies at least a portion of the extended domain. Is possible. In further embodiments, the polymerase comprises 3 'echinonuclease activity. For example, in embodiments where the product of the extension reaction is detected by RCA, Phi 29 (Φ29) DNA polymerase may be useful. That is, Phi 29 (Φ29) DNA polymerase can be used as a 3 'echinonuclease component, an extension component, and an amplification component. A further non-limiting example is Pfu DNA polymerase that may be useful in embodiments in which the product of the extension reaction is detected by PCR. That is, Pfu DNA polymerase can be used as a 3 'echinonuclease component, an extension component, and an amplification component.

The amplification product of the amplification reaction may be detected using any convenient protocol, and depending on the particular protocol used, the amplification product may be non-specific or specific, as described in more detail below. Can be detected. Representative non-specific detection protocols of interest include protocols that use signal generation systems that selectively detect double-stranded DNA products, for example, by intercalation. Representative examples of detectable molecules useful in such embodiments include fluorescent nucleic acid stains such as phenanthridinium dyes (including their monomers, homodimers or heterodimers) that form high fluorescence when complexed with nucleic acids. Examples include reagents (fluorescent nucleic acid stain). Examples of phenanthridinium dyes include ethidium homodimer, ethidium bromide, propidium iodide, and other alkyl substituted phenanthridinium dyes. In other embodiments of the invention, the nucleic acid staining reagent is an acridine dye such as acridine orange, acridine homodimer, ethidium-acridine heterodimer, or 9-amino-6-chloro-2-methoxyacridine, or a homodimer or heterodimer thereof. Is or includes them. In yet another embodiment of the invention, the nucleic acid staining reagent is Hoechst 33258, Hoechst 33342, Hoechst 34580 (BIOPROBES 34, Molecular Probes, Eugene Oregon (May 2000)), DAPI (4 ′, 6-diamidino-2-pheny Lindole) or DIPI (4 ′, 6- (diimidazolin-2-yl) -2-phenylindole) and other indole dyes or imidazole dyes. Other usable nucleic acid staining reagents include, but are not limited to, 7-aminoactinomycin D, hydroxystilbamidine, LDS751, specific psoralen (furocoumarin), styryl dyes, ruthenium complex and other metal complexes, and transitions. Metal complexes such as those containing Tb ⁺³ and Eu ⁺³ . In certain embodiments of the invention, the nucleic acid staining reagent is a cyanine dye or a cyanine dye homodimer or heterodimer that provides high fluorescence when associated with a nucleic acid. US Pat. No. 4,883,867 to Lee (1989), US Pat. No. 5,582,977 to Yue et al. (1996), US Pat. No. 5,321,130 to Yue et al. (1994), And Yue et al., US Pat. No. 5,410,030 (1995) (all four patents are incorporated by reference) may use any of the dyes, including TOTO, BOBO, Nucleic acid staining reagents marketed by Molecular Probes of Eugene Oregon under the trademarks POPO, YOYO, TO-PRO, BO-PRO, PO-PRO, and YO-PRO are included. Haugland et al., US Pat. No. 5,436,134 (1995), Yue et al., US Pat. No. 5,658,751 (1997), and Haugland et al., US Pat. No. 5,863,753 (1999). ) (All three patents are incorporated by reference) may be used, including SYBRGreen, SYTO, SYTOX, PICOGREEN, OLIGREEN, and RIBOGREEN trademarks of Eugene, Oregon. Nucleic acid staining reagents marketed by the company are included. In yet another embodiment of the invention, the nucleic acid staining reagent comprises an azaheterocycle or polyazabenzazolium heterocycle such as azabenzoxazole, azabenzdiimidazole, or azabenzothiazole, and is highly fluorescent when associated with a nucleic acid. Monomeric cyanine dyes, homodimeric cyanine dyes, or heterodimeric cyanine dyes, which are produced by Molecular Probes of Eugene Oregon under the trademarks SYTO, SYTOX, JOJO, JO-PRO, LOLO, LO-PRO. Commercially available nucleic acid staining reagents are included. An intercalating dye that may be useful in the method of the present invention is EVAGgreen ^™ from Biotium.

In a particularly preferred embodiment of the invention, the extension product is amplified by PCR, said PCR is quantitative PCR, and the amplified nucleic acid molecules are quantified using an intercalating dye. In a preferred embodiment, the intercalating dye is selected from SYBRGreen® and EVAGRen ^™ .

  In yet other embodiments, amplification can be detected using a signal generation system specific to the amplification product, as opposed to common double-stranded molecules. In these embodiments, the signal generation system may include a probe nucleic acid that specifically binds to a sequence within the amplification product. In that case, the probe nucleic acid may be labeled with a detectable label directly or indirectly. Directly detectable labels can be detected directly without using additional reagents, whereas indirectly detectable labels can be detected by using one or more additional reagents For example, the label is part of a signal generation system consisting of two or more components. In many embodiments, the label is a directly detectable label, and the directly detectable label of interest includes, but is not limited to, a fluorescent label, a radioisotope label, a chemiluminescent label, and the like. In many embodiments, the label is a fluorescent label and the labeling reagent used in such embodiments is a fluorescently tagged nucleotide, such as fluorescently tagged CTP (Cy3-CTP, Cy5- CTP, etc.). Fluorescent moieties that can be used to tag nucleotides to generate labeled probe nucleic acids include, but are not limited to, fluorescein and cyanine dyes such as Cy3, Cy5, Alexa555, Bodipy630 / 650. Other labels such as those described above may be used as is known in the art.

  In certain embodiments, a specifically labeled probe nucleic acid is labeled with an “energy transfer” label. As used herein, “energy transfer” refers to a process in which the fluorescence emission of a fluorescent group is altered by a fluorescence-modifying group. When the fluorescent modifying group is a quenching group, the fluorescence emission from the fluorescent group is attenuated (quenched). Energy transfer can occur via fluorescence resonance energy transfer or via direct energy transfer. The exact energy transfer mechanism in these two cases is different. In addition, it turns out that the reference to the energy transfer in this application includes all the phenomena from which these mechanisms differ. As used herein, “energy transfer pair” means any two molecules that participate in energy transfer. In general, one of the molecules acts as a fluorescent group and the other acts as a fluorescent modifying group. “Energy transfer pair” is used to mean a group of molecules that form a single complex in which energy transfer occurs. Such a complex can include, for example, two fluorescent groups and one quenching group, which can be different from each other, two quenching groups and one fluorescent group, or multiple fluorescent groups and multiple quenching groups. When multiple fluorescent groups and / or multiple quenching groups are present, the individual groups can be different from one another. As used herein, “fluorescence resonance energy transfer” or “FRET” refers to an energy transfer phenomenon in which light emitted by an excited fluorescent group is at least partially absorbed by the fluorescent modifying group. If the fluorescent modifying group is a quenching group, the group can emit the absorbed light as light of a different wavelength or it can emit it as heat. FRET relies on the overlap between the emission spectrum of the fluorescent group and the extinction spectrum of the quenching group. FRET also relies on the distance between the quenching group and the fluorescent group. Beyond a certain critical distance, the quenching group is unable to absorb the light emitted by the fluorescent group, or if not enough. As used herein, “direct energy transfer” means an energy transfer mechanism in which no photon exchange occurs between a fluorescent group and a fluorescent modifying group. Without being bound by a single mechanism, it is believed that in direct energy transfer, the fluorescent group and the fluorescent modifying group interfere with each other's electrical structure. If the fluorescent modifying group is a quenching group, the quenching group will prevent even the fluorescent group from emitting light.

  An energy transfer labeled probe nucleic acid, eg, an oligonucleotide, may have a variety of different configurations as long as it includes a donor, acceptor, and target nucleic acid binding domain. Thus, the energy transfer labeled oligonucleotides used in these embodiments of the methods of the invention comprise a fluorescent energy donor, i.e., a fluorophore domain in which the donor is located, and a fluorescence energy acceptor, i.e., an acceptor in which the acceptor is located A nucleic acid detector comprising a domain. As described above, the donor domain includes a donor fluorophore. The donor fluorophore may be located anywhere on the nucleic acid detector, but is generally present at the 5 'end of the detector. The acceptor domain includes a fluorescent energy acceptor. The acceptor may be located anywhere in the acceptor domain, but is generally present at the 3 'end of the nucleic acid detector or probe.

  In addition to the fluorophore domain and the acceptor domain, the energy transfer labeled probe oligonucleotide can, for example, target nucleic acids in the amplification product of interest (as described above) under stringent hybridization conditions (as defined above). Also included is a target nucleic acid binding domain that binds to the sequence. This target binding domain usually ranges from about 10 to about 60 nucleotides in length, and is generally from about 15 to about 30 nucleotides in length. Depending on the nature of the oligonucleotide and the assay itself, the target binding domain may hybridize to a region of the template nucleic acid or a region of the primer extension product. For example, if the assay is a 5 ′ nuclease assay using, for example, a TaqMan® type oligonucleotide probe, the target binding domain is a template that is, under stringent conditions, downstream of the primer binding site or 3 ′ of the primer binding site. Hybridizes to the target binding site of the nucleic acid. In alternative embodiments, such as molecular beacon type assays, the target binding domain hybridizes to one domain of the primer extension product. The total length of energy transfer labeled oligonucleotides used in these embodiments, including all three of the above domains, typically ranges from about 10 to about 60 oligonucleotides in length, generally from about 15 to about 30. Nucleotide length.

  In certain embodiments, the energy transfer labeled oligonucleotide is between the fluorophore and acceptor of the energy transfer labeled oligonucleotide probe upon excitation of the fluorophore when the energy transfer labeled oligonucleotide is not hybridized to the target nucleic acid. It is configured to cause energy transfer.

  In certain embodiments, the oligonucleotide is a single-stranded molecule that does not form an intramolecular structure, and energy transfer occurs because the donor-acceptor spacing results in a single-stranded linear form of energy transfer. In these embodiments, energy transfer also occurs between the fluorophore of the labeled oligonucleotide probe and the acceptor upon fluorophore excitation when the labeled oligonucleotide probe is hybridized to the target nucleic acid. Specific examples of such labeled oligonucleotide probes include US Pat. No. 6,248,526 (and Held et al., Genome Res. (1996) 6: 986, the disclosure of which is incorporated herein by reference). -994; Holland et al., Proc. Natl Acad. Sci. USA (1991) 88: 7276-7280; and Lee et al., Nuc. Acids Res. (1993) 21: 3761-3766). (Registered trademark) type probe. In many of these embodiments, the target nucleic acid binding domain hybridizes, ie is complementary, to the sequence of the template nucleic acid. That is, the target nucleic acid of the target nucleic acid binding domain is a sequence (ie, a pseudotarget nucleic acid or a surrogate nucleic acid) present in the template nucleic acid.

  In other embodiments, the probe oligonucleotide is capable of energy transfer between the fluorophore and acceptor of the energy transfer labeled oligonucleotide probe upon fluorophore excitation when the energy transfer labeled oligonucleotide probe is hybridized to the target nucleic acid. Has a structure that does not occur. Examples of these types of probe structures include those described in Scorpion probes (Whitcombe et al., Nature Biotechnology (1999) 17: 804-807; US Pat. No. 6,326,145, the disclosures of which are incorporated by reference). Included in this specification), sunrise probes (as described in Nazarenko et al., Nuc. Acids Res. (1997) 25: 2516-2521; US Pat. No. 6,117,635, the disclosures of which are hereby incorporated by reference) ), Molecular beacons (Tyagi et al., Nature Biotechnology (1996) 14: 303-308; US Pat. No. 5,989,823, the disclosures of which are hereby incorporated by reference). And conformally assisted probes (as described in US Provisional Application No. 60 / 138,376, the disclosure of which is hereby incorporated by reference). In many of these embodiments, the target binding sequence or domain comprises a hybridization domain that is complementary to the sequence of the primer extension product of the amplification reaction but not complementary to the sequence in the pseudo-target nucleic acid.

  The next step in the method of the invention is to detect a signal from the labeled amplification product of interest, and the detection of the signal may vary depending on the particular signal generation system used. In certain embodiments, simply the presence or absence of a detectable signal, such as fluorescence, is measured and used in the assay to determine or identify the presence or absence of a target nucleic acid, for example, by detection of a pseudo target nucleic acid and / or its amplification product. To do. Depending on the particular label used, detection of the signal can indicate the presence or absence of the target nucleic acid.

  In embodiments where the signal generation system is a fluorescence signal generation system, the detection of the signal generally includes detecting a change in the fluorescence signal from the reaction mixture to obtain an assay result. In other words, any modulation of the fluorescence signal produced by the reaction mixture is evaluated. Depending on the nature of the label used, the change may be an increase or decrease in fluorescence, but in certain embodiments is an increase in fluorescence. Samples are screened for any increase in fluorescence using any convenient means, for example, a suitable fluorometer such as a thermostable cuvette fluorometer or plate reader fluorometer. It is preferable to observe the fluorescence using a known fluorometer. Signals from these devices are sent to a data processing board, for example in the form of a photomultiplier voltage, and converted to a spectrum associated with each sample tube. Multiple tubes, for example 96 tubes, can be evaluated simultaneously.

If the detection protocol is a real-time protocol, such as used in a real-time PCR reaction protocol, data can be collected throughout the reaction at such frequent intervals, for example once every 3 minutes. By observing the fluorescence of the reaction molecules from the sample during each period, the progress of the amplification reaction can be observed in various ways. For example, the data provided by the melting peak can be analyzed, for example, by calculating the area under the melting peak and plotting these data against the number of periods. In a preferred embodiment of the invention, the fluorescent signal is obtained using a dye that intercalates into a double stranded nucleic acid molecule, said intercalating dye being preferably selected from SYBRGreen® and EvaGreen ^™. .

  The spectrum generated in this way can be decomposed to form peaks representing each signal site (ie, fluorophore) using “fits” of preselected fluorescent sites such as dyes, for example. . The area under the peak representing the intensity value of each signal is determined and represented as a quotient of each other as needed. Signal intensity differences and / or ratios allow changes in labeled probes to be recorded throughout the reaction or at different reaction conditions such as temperature. Said change is associated with the binding phenomenon between the oligonucleotide probe and the target sequence or the degradation of the oligonucleotide bound to the target sequence. The integration of the area under the differential peak allows calculation of the intensity value of the labeling effect.

  By screening the mixture for changes in fluorescence, the sample was screened once at the end of the primer extension reaction, or screened multiple times, eg after each cycle of the amplification reaction (eg, with real-time PCR monitoring) The result of one or more assays.

  The data generated as described above can be interpreted in various ways. In the simplest manner, an increase or decrease in fluorescence from the sample during or at the end of the amplification reaction is present in the sample, for example because it is related to the amount of amplification product detected in the reaction mixture. Increase in the amount of target analyte to be performed and the amplification reaction proceeds, thus suggesting that the target analyte was actually present in the original sample. Quantification is also possible by monitoring the amplification reaction over the amplification process. Quantification can also include assaying one or more nucleic acid controls in the reaction mixture as described above.

  In this way, the reaction mixture can be easily screened (or evaluated or assayed, etc.) to determine the presence of the target analyte. The method of the invention is suitable for detection of a single target analyte and for multiplex analysis in which two or more different target analytes are assayed in a sample. In the case of these latter multiplex analyses, the number of different sets of probes that can be used is usually in the range of about 2 to about 20 or more, for example up to 100 or more, 1000 or more, and the like.

  Analyzing many analytes simultaneously in a single reaction using multiple different sets of proximity probes (multiplexing) is made possible by the increased specificity and sensitivity achieved by the 3 'echinonuclease method. Each probe set can be designed to produce a unique extension product that can be used to identify the presence, amount, and / or location of the analyte being examined by the probe set. The extension products are known and well established directly from literature, preferably after amplification, including liquid chromatography, electrophoresis, mass spectrometry, microscopy, real-time PCR (quantitative PCR), fluorescent probes, etc. It can be detected using a method for analyzing nucleic acid molecules. In a preferred embodiment of the method of the invention, quantitative or real-time PCR is used. Of particular interest is the combination of the present invention with a DNA array readout format. Several unique extension products derived from the multiplex proximity extension assay described herein are hybridized to a standardized DNA array carrying a number of oligonucleotide sequences (tags) that are complementary to the sequence of the extension products. obtain. Each extension product hybridized to the array is identified by its position on the DNA array, and the intensity detected at a given hybridization spot depends on the amount of that particular extension product and the origin of the extension product. This indicates the amount of the sample. The detection of extension products can be realized by spectroscopic measurements, fluorescence, radioisotopes and the like. By using fluorescently labeled primers or fluorescently labeled nucleotides in the amplification reaction (PCR), a fluorescent site can be easily introduced into the extension product. The DNA array can be a simple dot blot array on a membrane containing a small number of spots, or it can be a high density array holding hundreds or thousands of spots.

  Modifications can be made to the methods of the invention to further reduce the background associated with non-specific nucleic acid hybridization. Such modifications include adjusting the methods of the invention to reduce any non-specific nucleic acid hybridization. In some embodiments, proteins can be added to the mixture containing the sample and proximity probe to reduce weak and non-specific DNA hybridization. For example, E. coli single stranded DNA binding proteins have been used to increase the yield and specificity of primer extension and PCR reactions (US Pat. Nos. 5,449,603 and 5,534,407). The gene T32 protein (single-stranded DNA binding protein) of phage T4 clearly improves the ability to amplify larger DNA fragments (Schwartz, et al., Nucl. Acids Res. 18: 1079 (1990)) Increase the fidelity of the polymerase (Huang, DNA Cell. Biol. 15: 589-594 (1996)). When using such proteins, the concentration in the reaction mixture is about 0.01 ng / μL to about 1 μg / μL, such as about 0.1 ng / μL to about 100 ng / μL, including about 1 ng / μL to about 10 ng / μL. It is used to be in the range.

  In some embodiments, background can be reduced by adding poly-A RNA and / or bulk RNA to the assay. Bulk RNA is also known as total RNA. That is, bulk RNA is simply total RNA extracted from a sample, including, for example, two or more forms, preferably all of the various types of RNA present in the sample, such as mRNA, rRNA, microRNA, etc. .

  In other embodiments, partially double stranded nucleic acids can be used as the nucleic acid domains of the first and second proximity probes to reduce weak and non-specific DNA hybridization.

  As described above, the method of the present invention is designed such that an interaction occurs between the nucleic acid domains of the probe only when the first and second probes bind to the analyte. This is because the nucleic acid domain of an unbound probe having a 3 'end that is free and unprotected is completely or partially degraded by components that contain 3' echinonuclease activity. However, as with any assay of this type, this cannot always be guaranteed, and if the probes are in close proximity in solution, some background interaction of the nucleic acid domain can occur (probing by splint). In embodiments where such nucleic acid domains require that their nucleic acid domains hybridize to each other, this possibility is reduced, as all three domains are compared when compared to a two-probe assay. Is still possible in some circumstances). In order to reduce or minimize the possibility of background due to unbound (ie unreacted) probes, in addition to other blocking agents described above and known in the art, blocking oligonucleotides Can be used. In a preferred embodiment, the sample can be incubated with one or more blocking agents, such as BSA, before adding the proximity probe.

  The blocking oligonucleotide binds (ie, hybridizes or anneals) to the free ends of the nucleic acid domains of the first and second proximity probes. Thus, the blocking oligonucleotide can bind to the free 3 'OH end of the 5' proximity probe nucleic acid domain and the free 5 'phosphate end of the 3' proximity probe nucleic acid domain. For example, if the splint oligonucleotide is present at a high local concentration, the binding of the blocking oligonucleotide may compete and this may occur in some embodiments of the invention. Thus, the blocking oligonucleotide can prevent the first and second domains from hybridizing to the splint in the absence of analyte binding. In other embodiments, one or more specific “competing” oligonucleotides are added to the assay, eg, after the proximity probe is bound to the target analyte, separating the blocking oligonucleotide from the end of the nucleic acid domain of the probe, Allow the probe domains to interact. As such, the free ends of the 5 'and / or 3' probes are prevented from interacting until after they are bound to the analyte. In embodiments where a splint oligonucleotide is used to form the nucleic acid domain of the third proximity probe, when all three probes bind to the analyte, the local concentration of the splint is sufficient to compete against the blocking oligonucleotide. Thus, the first and second domains hybridize to the sprint and replace the blocking oligonucleotide.

  Thus, blocking oligonucleotides allow the use of competition-based methods in reducing background and increasing assay sensitivity.

  The length of the blocking oligonucleotide can range from about 4-100 nucleotides, such as 6-75 or 10-50 nucleotides. They can hybridize to a region at or near the free end of the nucleic acid domain of the first or second probe ("near" refers to 1-20 at the free 3 'or 5' end, Or within 1 to 10 nucleotides, such as 1 to 6 nucleotides). The region of hybridization can be 3-15 nucleotides long, eg, 3-12, 3-10, 3-8, 4-8, 3-6, 4-6 nucleotides long.

  Generally, the blocking oligonucleotide is used in a larger amount than the respective probe, for example, 2 to 1000 times, such as 20 to 500, 50 to 300, 100 to 500, or 100 to 300 times, such as 20, 200, or 300 times.

  In general, competing oligonucleotides are used more often than blocking oligonucleotides, for example 2-1000 times, such as 20-500, 50-300, 100-500, or 100-300 times, such as 20, 200 or 300 times.

  When detecting an analyte using a proximity probe with low affinity and a slow binding rate, the step of preincubating the proximity probe at a sufficiently high concentration promotes the binding of the proximity probe to the analyte. This preincubation step is quickly diluted in a large amount of cold buffer (eg, a buffer that does not contain analyte or proximity probe), and then a portion of this dilution is added to the extension reaction mixture. Low temperatures, including about 4 ° C. to about 10 ° C., for example in the range of about 0 ° C. to about 20 ° C., minimize the separation of existing proximity probe-analyte complexes, while at the same time binding by significant dilution. Since the concentration of non-proximal probes is reduced, their reactivity is reduced and the background signal is minimized.

  In such embodiments, using a small incubation volume of about 1 μl to about 20 μl, for example, using about 1 μl, or about 2 μl, or about 3 μl, or about 4 μl, or about 5 μl, or about 6 μl of sample and proximity probe The assay is performed. Since the effective concentration of the proximity probe in the final incubation volume is diluted, the signal is maintained while the background is reduced. This is because there is no time for the bond between the probe and analyte to separate before the first and second nucleic acid domains are extended. As long as the extension product can concentrate the extension product from a large amount, such as greater than 100 μl or more, this approach allows very high sensitivity and proximity-dependent interaction detection. In such an embodiment, the interaction between the probe and the probe can be reduced by using a single-stranded binding protein.

  The problems with composite samples can be eliminated by diluting the composite sample prior to analysis. This greatly reduces the amount of protein to which the probe can bind non-specifically, thus reducing the required probe concentration. Although analytes are also diluted, high sensitivity proximity probing provides good detection and quantification.

  The method of the present invention may be used homogeneously (ie, in solution) as described above, or may be used heterogeneously using a solid phase. In the latter case, for example, since the bound analyte is immobilized on the solid phase, the washing step can be used. The use of a solid phase assay offers the advantage that the wash step can help remove inhibitory components and concentrate analytes from an undesirably large amount of sample, especially in detecting difficult samples. Since unbound analytes and probes can be removed by washing, higher concentrations and larger numbers of proximity probes can be used. The ability to remove unbound or unconjugated probes by washing also means that solid phase assays allow for proximity probes that are less pure than homogeneous assays.

  The immobilization of the specimen on the solid phase can be realized by various methods. Thus, several embodiments of the solid phase assay of the present invention are contemplated. In one such embodiment, one (or more) of the first and second proximity probes (and third proximity probe, if used) is immobilized on a solid phase (or solid support). (Or immobilization is possible). First, the analyte is captured by one (or more) immobilized (or immobilizable) probe and then bound by the subsequently added probe. In such a scheme, the aforementioned binding activity effect may not exist during the binding process, but it relates to the washing process. A non-immobilized / non-immobilizable probe was added to the reaction mixture at the same time as it was bound to the solid phase (ie, immobilized) so that the binding activity effect also contributed to the detection (binding) step. It is preferable that the specimen is brought into contact with a probe that can be immobilized.

  The immobilized proximity probe can be immobilized, i.e. bound to a carrier, by any convenient method. Thus, the immobilization method or means and the solid support may be selected from a number of immobilization means and solid supports known in the art and described in the literature, depending on preference. Thus, the probe may be bound directly to the carrier, for example via an analyte binding domain (eg by chemical cross-linking) or indirectly by a linker group or an intermediate binding group (eg by biotin-streptavidin interaction). May be. Therefore, the proximity probe is provided with an immobilization means (for example, an affinity binding partner that can bind to its binding partner, ie, a cognate binding partner such as streptavidin or an antibody, such as biotin or a hapten) provided on the carrier. Also good. The probe may be immobilized before or after binding to the analyte. Such “immobilizable” probes may also be contacted with the sample along with the carrier.

  The solid support may be any known support or matrix that is currently widely used or proposed for immobilization, separation, etc. These can be in the form of particles (eg, beads that can be magnetic or non-magnetic), sheets, gels, filters, thin films, fibers, capillaries, or macrotiter strips, tubes, plates, or wells.

  The carrier can consist of glass, silica, latex, or a polymeric material. A material with a high surface area for binding to the analyte is preferred. Such carriers have an irregular surface and can be, for example, porous or particulate, such as particles, fibers, webs, sinters or sieves. Particulate materials such as beads, especially polymer beads, are useful because of their high binding capacity.

  Conveniently, the particulate solid support used according to the present invention comprises spherical beads. The size of the beads is not critical, but can be, for example, a diameter of at least 1 μm, preferably at least 2 μm and a maximum diameter of preferably 10 μm or less, for example 6 μm or less.

  Monodisperse particles, i.e. those having a substantially uniform size (e.g., a size with a diameter standard deviation of less than 5%) have the advantage of providing a very uniform reaction reproducibility. Representative monodisperse polymer particles can be made by the method described in US Pat. No. 4,336,173.

  However, magnetic beads are advantageous to aid in operation and separation. As used herein, the term “magnetic” means that when a carrier is placed in a magnetic field, it can have a magnetic moment imparted to it, eg, the carrier can be paramagnetic so that Below it can be substituted. That is, the carrier containing magnetic particles can be easily removed by magnetic assembly, providing a quick, simple and efficient method for separating the particles after the analyte binding step.

  In other embodiments, an immobilized (or immobilizable) analyte-specific probe that includes only a binding domain (ie, an analyte capture probe) can be used in addition to a non-immobilized proximity probe in a homogeneous assay. . Therefore, in such an embodiment, the sample is first captured by an immobilized or immobilizable capture probe that only serves to immobilize the sample on the solid phase, and then the immobilized sample is incubated with the proximity probe. The In such embodiments, the capture probe can be any binding partner that can bind directly or indirectly to the analyte (eg, as described above in connection with the analyte binding domain of the proximal probe). More specifically, such a capture probe specifically binds to the analyte. This embodiment of the invention requires that at least three probes (binding domains) bind to the analyte or complex analyte simultaneously, so potentially at least three different epitopes can be examined, and the assay is highly specific Gives sex.

  In further embodiments, the analyte itself can be immobilized (can be immobilizable) to the solid phase, eg, by non-specific absorption. In certain such embodiments, the analyte is present in a state that is optionally immobilized and / or permeable within the cell, and is bound to (be capable of binding to) a solid support.

  The method described above detects splint mediated proximity-dependent interactions present in the reaction mixture, thereby allowing the amount of target analyte in the sample being assayed to be measured. Measurements can be qualitative or quantitative.

  Accordingly, the above-described method for detecting one or more target analytes in a composite sample is useful in a variety of different applications.

  The methods of the invention can be used to screen a sample to determine the presence or absence of one or more target analytes in the sample. As noted above, the present invention provides methods for detecting the presence or quantifying the presence of one or more target analytes in a sample.

  The methods of the present invention can be used to detect the presence of one or more target analytes in a variety of different types of samples, including complex samples with large amounts of non-targets, and the methods of the present invention The specimen is detected with high sensitivity. Therefore, the method of the present invention is a method for detecting one or more target analytes in a sample or a composite sample with high sensitivity. Samples assayed with the methods of the invention are, in many embodiments, derived from physiological sources as detailed above.

  In addition to detecting a wide range of analytes, the method of the present invention can be used to screen for compounds that modulate the interaction between the analyte binding domain of the proximity probe and the analyte binding region, ie, the binding of the analyte binding domain to the analyte. obtain. The term modulating includes reducing (eg, suppressing) and increasing the interaction between two molecules. Screening methods can be in vitro or in vivo, both formats being readily developable by those skilled in the art.

  A variety of different candidate agents can be screened by the methods described above. Candidate agents include a number of chemical classes, but generally they are organic molecules, preferably small organic compounds having a molecular weight greater than 50 daltons and less than about 2500 daltons. Candidate agents contain functional groups necessary for structural interactions with proteins, especially hydrogen bonds, and generally contain at least amine, carbonyl, hydroxyl or carboxyl groups, preferably these functional chemical groups. Of at least two. Candidate agents often include cyclic carbon structures or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found in biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.

  Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and direct synthesis of a wide range of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds that are also in the form of extracts from bacteria, fungi, plants and animals are available or readily produced. In addition, natural or synthetically generated libraries and compounds may be readily modified by conventional chemical, physical and biochemical means to generate combinatorial libraries. Known drugs may be directly or randomly chemically modified, such as acylation, alkylation, esterification, amidation, etc., to produce structural analogs.

  The agents identified in the above screening assays are useful in a variety of ways, including methods of adjusting the conditions for the action of the target analyte and its presence and / or activity.

Kits useful for performing the above-described methods of the invention are also provided. For example, in some embodiments, a kit for performing a method of the invention includes at least one set of proximity probes, each of which includes an analyte binding domain and a nucleic acid domain as described above. . The particular protocol described above uses two or more different sets of such probes to simultaneously detect two or more target analytes in a sample, eg, in a multiplex and / or high throughput format. As such, in certain embodiments, the kit includes a set of two or more different proximity probes. In addition, there may be additional reagents required or desired in the protocol carried out using the components of the kit, including but not limited to 3 'echinonuclease activity. A component comprising: one or more polymerase enzymes, a splint oligonucleotide (optionally in the form of a third proximity probe), blocking oligonucleotide, competing oligonucleotide, probe, binding domain, or solid for immobilizing an analyte Means for immobilizing carriers, probes, binding domains or analytes, amplification means and detection means, eg fluorescently labeled nucleotides or oligonucleotides or intercalating dyes (eg SYBRGreen® and / or EvaGreen ^™ ) An auxiliary nucleic acid pair, Stranded binding protein, and PCR amplification reagents (e.g., nucleotides, buffer, cations, etc.) and the like. In certain embodiments, the kit may include an element used to reduce the effective volume of the incubation mixture described above, such as a volume excluder. The components of the kit may be present in separate containers, or one or more of the components may be present in the same container, the container being a storage container and / or a kit designed therefor. Can be a container used during an assay.

  In addition to the above components, the kit of the present invention may further comprise instructions for performing the method of the present invention. In the kit of the present invention, these instructions may exist in various forms, one or more of which may be present in the kit. One form that these instructions can take is information printed on a suitable medium or substrate, such as a kit package, package insert, etc., for example, paper on which the information is printed. Still other means may be a computer readable medium, such as a disc having recorded information, a CD, a flash drive, and the like. Yet another means that may exist is the address of a website, which is used over the Internet to access information on the destination site. Any convenient means may be present in the kit.

Thus, in a further aspect, the present invention provides a kit for use in a method for detecting an analyte in a sample,
(A) at least one set of at least first and second proximity probes, each comprising an analyte binding domain and a nucleic acid domain, capable of simultaneously binding to the analyte;
(B) a component comprising 3 ′ exonuclease activity;
(C) optionally, means for extending at least one of the nucleic acid domains of the first and second proximity probes to produce an extension product;
(D) optionally providing a kit comprising means for amplifying and detecting the extension product.

As indicated above, the means for extending the nucleic acid domain may be a polymerase enzyme, and such means may optionally further comprise reagents (eg, nucleotides) necessary for the polymerase reaction. The means for amplification and detection of the extension product can be any of the means described above in the context of the assay method, eg, the amplification means and means for detecting the amplification product, eg, reagents for PCR reactions (eg, , Amplification primers and optionally polymerases and / or nucleotides, etc.) and reagents for detecting PCR amplification etc. (eg Taqman® probes, SYBRGreen® and / or EvaGreen ^™ intercalates Pigment).

  The kit optionally further comprises splint oligonucleotides and / or blocking oligonucleotides for the first and second probes.

  The kit may optionally further comprise an immobilized capture probe for a specimen or a capture probe provided with an immobilization means. Alternatively, the kit may include a solid phase that captures or binds to the analyte, or one or more of the first or second proximity probes are immobilized or may comprise immobilization means. .

  The invention will be further described with reference to the following non-limiting examples with reference to the following drawings.

FIG. 1 is a schematic diagram of five different versions of proximity extension assays. FIG. 2 is a bar graph showing the activity of various polymerases with 3 ′ exonuclease activity or combined 3 ′ exonuclease activity in the detection of interleukin-8 (50 pM) using the method of the present invention. . FIG. 3 plots the signal generated when the analyte (ICAM antibody) in the sample was detected using the method of the present invention in the presence and absence of the “crowding agent” Sephadex G-100. It is a graph. FIG. 4 is a graph plotting the signal generated from the detection of a specimen (phycoerythrin, PE) in a sample using the method of the present invention, the specimen being added to either buffer or plasma. . FIG. 5 is a graph plotting a signal generated from detection of a specimen (glial cell-derived neurotrophic factor, GDNF) in a sample using the method of the present invention. Is this specimen added to the buffer? Or it was naturally present in plasma. FIG. 6 is a graph plotting the signal generated from detection of an analyte (interleukin-8, IL8) in a sample using the “one-step” method of the present invention. FIG. 7 is a graph plotting signals generated from detection of an analyte (vascular endothelial growth factor, VEGF) in a sample using the “one-step” method of the present invention. FIG. 8 shows two hyperthermophilic polymerases with 3 ′ exonuclease activity in the detection of interleukin-8 (100 pM) using the method of the present invention, namely Pfu DNA polymerase and Pwo DNA polymerase (commercially available from DNA GDANSK). It is a bar graph showing the activity of a polymerase expressed as Hypernova ^™ .

Experimental procedure: Adjustment of detection proximity probe of interleukin-8 (IL8) Using Innovas Lightning-Link conjugation technology, one batch of polyclonal antibody (RnD System, AF-208-NA) was prepared. Ligate to two different ssDNA strands, one at the 5 'end:
5′-GGCCCAAGTGTTTAATTGCTTCACGATGAGACTGGATGAA-3 ′ (SEQ ID NO: 1)
The second is at the 3 'end:
5′-TCACGGTAGGCATAAGGTGCAGTATGGAGAACTTCGCTACAG-3 ′ (SEQ ID NO: 2)
Connected.
A third oligonucleotide, called “extension oligo”, was added to 3′-attached conjugates at a ratio of 2: 1 (oligo: conjugate).

PEA protocol 1 (two-stage type)
1 μL of a sample (PBS + 0.1% BSA buffer, IL-8 antibody standard 208-IL-010, EDTA plasma manufactured by RnD Systems), 0.21 mg / ml goat IgG (Sigma Aldrich I9410), 107 μg / Ml single-stranded salmon sperm DNA (Sigma Aldrich D7656), 0.085% BSA, 4.3 mM EDTA, 0.21% Triton-X100, 0.02% sodium azide, and 2.5 μM And 1 μL of blocking buffer containing the blocking conjugate (Olink AB, WO2012 / 007511). Samples were blocked at 25 ° C. for 20 minutes.

  To 2 μL of the blocked sample, 2 μL of the probe mixture (Tris-HCI: 25 mM, EDTA: 4 mM, biotin: 1 mM, single-stranded salmon sperm DNA (Sigma Aldrich D7656): 0.016 mg / ml, sodium azide: 0. 02%, and each PEA conjugate: 100 pM) followed by 1 hour incubation at 37 ° C.

  After incubation of the probe, the sample was transferred to a thermal cycler and allowed to stand at 37 ° C. 76 μL of a diluted mixture containing 70.5 mM Tris-HCl, 17.7 mM ammonium sulfate, 1.05 mM dithiothreitol, and 40 μM (each) dNTPs was added to the incubated samples. After 5 minutes at 37 ° C., 20 μL of extension mixture (Tris-HCl: 66.8 mM, ammonium sulfate: 16.8 mM, dithiothreitol: 1 mM, magnesium chloride: 33 mM, and T4 DNA polymerase (Fermentas) as a second addition. EP0062): 62.5 U / mL), or other DNA polymerases were added. The extension reaction was carried out at 37 ° C. for an additional 20 minutes and then heat inactivated at 80 ° C. for 10 minutes.

  In order to detect extension products by qPCR, 4 μL of extension product was transferred to a qPCR plate and 6 μL of qPCR mixture (Tris-HCl: 25 mM, magnesium chloride: 7.5 mM, potassium chloride: 50 mM, ammonium sulfate: 8.3 mM). , Trehalose (Across Organics, 182550250): 8.3%, dNTP (each): 333 μM, dithiothreitol: 1.67 mM, each primer: 833 nM (forward: 5′-TCGTGAGCCCCAAGGTTAATTTGCTTCACGA-3 ′ (SEQ ID NO: 3), reverse direction: 5'-TGCAGCTCTGTAGCGAAGTTCTCATACTGCA-3 '(SEQ ID NO: 4), Biomers, molecular beacon: 417 nM (FAM-CCCGCTCGCTTATCTCACCGTGACCTGCCGAA CCCGAGCGGG-DABSYL (SEQ ID NO: 5) Biomers), recombinant Taq polymerase (Fermentas, EP00402): 41.7U / mL, and ROX standard (ROX-TTTTTTT, Biomers): 1.33μM) and mixed. Two-step qPCR was performed with initial denaturation at 95 ° C. for 5 minutes, followed by denaturation at 95 ° C. for 45 seconds for 15 seconds, and a combination of annealing and extension at 60 ° C. for 1 minute.

Comparison of different DNA polymerases Samples of DNA polymerases having 3 '->5' exonuclease activity (T4 DNA polymerase, DNA polymerase, Phi 29 DNA polymerase, DNA polymerase I, Klenow fragment) are those having no such activity (Klenow fragment exo). When compared to (-)), it was found that the signal relative to the background was clearly different (see FIG. 2). The Klenow fragment without 3 'exonuclease activity has a much higher background than the Klenow fragment (3' exo +), and when exonuclease I is added to the Klenow fragment exo (-), the Klenow fragment (3 'exo +) Similar results to those obtained using Therefore, echinonuclease I which is not a DNA polymerase can rescue the reaction polymerized by Klenow (exo-).

  For some DNA polymerases containing 3 'exonuclease activity, such as T7 and Phi29 DNA polymerase, the signal for both background and antibody samples was small (Figure 2). This result is due to the strong 3 'exonuclease activity present in these enzymes, and these enzymes are useful in the methods described herein by further optimizing the specific reaction conditions of these enzymes. It is assumed that

  Since the positive effect of using an enzyme containing 3 'exonuclease activity in a proximity extension assay is believed to result from the degradation of free and non-proximal DNA ends, they can be used during the extension reaction itself. Unable to accumulate extension product.

The potential for improved PEA performance through the use of molecular crowding agents, such as crowding polymers, is suggested in US Patent Application No. 2009/0162840 for incubating proximity ligation assays of probes using Sephadex G-100 beads. To investigate, the use of Sephadex beads was tested using the method described above. Dry Sephadex beads can swell by absorbing water when rehydrated in solution, and large molecules such as proteins (ie, analytes) and proximity probes that may be present in the solution remain outside the beads. This effectively increases the concentration of the protein and proximity probe and promotes binding of the probe to the target. FIG. 3 shows the results of an assay in which the probe mixture and sample were added to 0.5 μg Sephadex G-100 that had been lyophilized at the bottom of the PEA incubation tube. Significant improvements in sensitivity and signal-to-noise ratio are seen, indicating increased binding to the target.

Plasma Recovery and Matrix Effect on PEA To test the ability of PEA to use 3 'exonuclease-effective DNA polymerase and accurately detect proteins in a complex matrix, the above was used with human EDTA-prepared plasma The assay was performed. The non-human protein phycoerythrin (PE) is added at various concentrations to either non-complex matrix PBS (phosphate buffered saline) or very complex matrix EDTA plasma with 0.1% BSA, and PEA Was quantified. Non-human proteins were selected so that recovery could be evaluated even at low concentrations. Since there was virtually no signal difference between the complex and non-complex matrices, good recovery of this analyte in plasma was observed even at 10 pM (FIG. 4).

  In another example, the human protein GDNF (glial cell-derived neurotrophic factor) was added to human plasma (FIG. 5). The amount of this protein in plasma is very small and difficult to detect with standard techniques. Even in the case of this specimen, excellent recovery was observed again, indicating that endogenous GDNF can be quantified even at 0.1 pM or less.

Simplified PEA protocol (2)
If it is possible to simplify the experimental procedure, it is always desirable to do so. It was found that the extension mixture can be combined with the qPCR mixture. This allows the extension product to be transferred directly from the thermal cycler to the qPCR instrument without requiring any further dispensing and in a short hands-on time. This protocol proved to maintain high sensitivity and signal with good accuracy (FIGS. 6 and 7). In order to be able to use a 3 ′ exonuclease DNA polymerase in a proximity extension reaction in the presence of a qPCR primer, the primer needs to be resistant to exonuclease. This could be achieved by generating a primer that forms a hairpin structure at the low temperature of the PEA reaction and modifying the last two residues at its 3 ′ end with phosphate thioate. A one-stage PEA protocol is described below. The results of detection of IL8 and VEGF are shown in FIGS. 6 and 7, respectively. These results were obtained using a one-step protocol.

PEA protocol 2 (one-stage type)
1 μL of a sample (PBS + 0.1% BSA buffer, 208-IL-010, EDTA plasma, which is an IL-8 antibody standard manufactured by RnD Systems), 0.19 mg / ml goat IgG (Sigma Aldrich I9410), 94 μg / Ml single-stranded salmon sperm DNA (Sigma Aldrich D7656), 0.075% BSA, 3.8 mM EDTA, 0.19% Triton-X100, 0.015% sodium azide, and 2.5 μM And 1 μL of blocking buffer containing the blocking conjugate (Olink AB, WO2012 / 007511). Samples were blocked at 25 ° C. for 20 minutes.

  To 2 μL of the blocked sample, 2 μL of the probe mixture (Tris-HCI: 25 mM, EDTA: 4 mM, biotin: 1 mM, single-stranded salmon sperm DNA (Sigma Aldrich D7656): 0.016 mg / ml, sodium azide: 0. 02%, and each PEA conjugate: 100 pM) followed by 1 hour incubation at 37 ° C.

After the probe incubation step, the sample was transferred to a thermal cycler and allowed to stand at 37 ° C. 1x of iTaq SYBR Green Supermix (BioRad, 172-5851 ) and 3'-thioate protection hairpin primers ^{(forward: 5'-TCGTGAGCCCAAGTGTTAATTTGCTTCAC * G * A} -3 '(SEQ ID NO: 6), reverse: TGCAGTCTGTAGCGAAGTTCTCATACTG ^* C 36 μL of the diluted mixture containing ^* A-3 ′ (SEQ ID NO: 7) ^* indicates thioate modification) was added to the sample. After 3 minutes at 37 ° C., 10 μL of extension mixture (1 × iTaq SYBR Green Supermix (BioRad, 172-5851) and T4 DNA polymerase (Fermentas, EP0062): 62.5 U / mL) was added. The extension reaction was carried out at 37 ° C. for another 20 minutes, and then T4 DNA polymerase was heat-inactivated at 65 ° C. for 10 minutes.

  The reaction mixture (50 μL) contained all of the extension products and reagents required for qPCR. 10 μL of the reaction mixture was transferred to an optical qPCR plate for quantification. Two-step qPCR was performed with initial denaturation at 95 ° C. for 5 minutes, followed by denaturation at 95 ° C. for 45 seconds for 15 seconds, and a combination of annealing and extension at 64 ° C. for 1 minute.

Claims (51)

A method for detecting an analyte in a sample, comprising:
(A) contacting the sample with at least one set of at least first and second proximity probes each comprising an analyte binding domain and a nucleic acid domain and capable of simultaneously binding to the analyte;
(B) interacting the nucleic acid domain of the proximity probe when the proximity probe binds to the analyte, wherein the interaction includes the formation of a duplex;
(C) contacting the sample with a component comprising 3 ′ exonuclease activity;
(D) extending the 3 ′ end of at least one nucleic acid domain of the duplex to generate an extension product, which can occur simultaneously with or after the step (c);
(E) amplifying and detecting the extension product.   The method of claim 1, wherein the detection is quantitative.   The method of claim 1, wherein the detection is qualitative.   The method according to any one of claims 1 to 3, wherein the specimen is completely or partially a proteinaceous molecule.   The method according to any one of claims 1 to 4, wherein at least one analyte binding domain of the at least first and second proximity probes is an antibody, a binding fragment thereof, or a derivative thereof.   6. The method according to any one of claims 1 to 5, wherein step (d) is performed by a nucleic acid polymerase further comprising 3 'exonuclease activity.   The component containing 3 ′ exonuclease activity is T4 DNA polymerase, T7 DNA polymerase, Phi 29 (Φ29) DNA polymerase, DNA polymerase I, Klenow fragment of DNA polymerase I, Pyrocox frios (Pfu) DNA polymerase, and / or Pyrocox 7. A method according to any one of the preceding claims, wherein the method is selected from one or more of the group consisting of Pwo DNA polymerases.   The method according to any one of claims 1 to 4, wherein step (d) is performed by a nucleic acid polymerase with minimal or no 3 'exonuclease activity.   9. The method of claim 8, wherein the polymerase is added after the component comprising the 3 'exonuclease activity, and the sample is further incubated to produce the extension product. The nucleic acid polymerase is selected from the α subunit of DNA polymerase III, the Klenow exo (−) fragment of DNA polymerase I, Taq polymerase, Pfu (exo ⁻ ) DNA polymerase, and / or Pwo (exo ⁻ ) DNA polymerase. 10. A method according to claim 8 or 9.   11. The method according to any one of claims 1 to 10, wherein the component containing 3 'exonuclease activity is exonuclease I.   12. A method according to any one of the preceding claims, wherein the component comprising 3 'exonuclease activity is inactivated prior to the step of amplifying the extension product.   13. The method of claim 12, wherein the 3 'exonuclease activity is inactivated by heat denaturation.   The method according to claim 13, wherein the thermal inactivation is a first step of the amplification reaction in the step (e).   Before contacting the sample with the component containing the 3 ′ exonuclease activity, add part or all of the reagent for the amplification reaction of step (e) to the sample, or part or all of the reagent The method according to claim 1, wherein the sample is contacted with the sample simultaneously with the component containing the 3 ′ exonuclease activity.   The method of claim 15, wherein the reagent is added during steps (b) and (c).   17. A method according to any one of claims 1 to 16, wherein step (e) comprises amplifying a portion of the extension site of the extension product.   18. Amplification of a portion of the extension site of the extension product is achieved by amplifying the portion using primers located on either side of the extension site portion of the extension product. The method described.   18. The method of claim 17, wherein the portion of the extension site of the extension product templates a oligonucleotide ligation to generate a circular oligonucleotide, the circular oligonucleotide acting as a template for amplification.   The method of claim 19, wherein the amplification is rolling circle amplification.   20. A method according to claim 17 or 19, wherein the portion of the extension site of the extension product acts as a primer for rolling circle amplification of a circular oligonucleotide.   The method according to claim 1, wherein the step (e) includes a polymerase chain reaction.   23. The method of claim 22, wherein the polymerase chain reaction is a quantitative polymerase chain reaction.   24. The method of claim 23, wherein the quantitative polymerase chain reaction uses a dye that provides a detectable signal, preferably a fluorescent signal, by intercalating with a nucleic acid molecule. 25. The method of claim 24, wherein the dye that intercalates with the nucleic acid molecule to provide a detectable signal is SYBRGreen (R) or EvaGreen ( ^TM ).   The method according to any one of claims 22 to 25, wherein the primer used in the polymerase chain reaction is provided in a modified form so as to be resistant to 3 'exonuclease activity.   27. The method of claim 26, wherein the primer comprises at least one modified nucleotide at its 3 'end.   28. The modified nucleotide is selected from one or more of the list consisting of a thiophosphate modified nucleotide, a locked nucleic acid nucleotide, a 2'-OMe-CE phosphoramidite modified nucleotide, and / or a peptide nucleic acid nucleotide. the method of.   The method according to any one of claims 22 to 28, wherein the primer is a hot start primer.   30. A method according to any one of claims 22 to 29, wherein the polymerase is a thermostable polymerase.   31. The method of any one of claims 1-30, wherein one or both of the first and second proximity probe nucleic acid domains are extended in step (d).   32. The method of any one of claims 1-31, wherein at least one of the nucleic acid domains is partially double stranded.   35. The method of claim 32, wherein the partially double stranded nucleic acid domain comprises a single stranded nucleic acid domain hybridized to a splint oligonucleotide.   34. The method of claim 33, wherein prior to step (a), the splint oligonucleotide is prehybridized to one nucleic acid domain of the proximity probe.   35. The method of claim 33 or 34, wherein the splint oligonucleotide is extended in step (d) to form an extension product.   36. The method of claim 35, wherein the extension product is circularized to provide a template for amplification.   38. The method of claim 36, wherein the 3 'end of the extension product is ligated to the 5' end of the extension product oligonucleotide by template ligation.   37. A method according to claim 35 or 36, wherein the amplification is rotational circle amplification.   39. The method of any one of claims 33 to 38, wherein the splint oligonucleotide is provided separately as a free nucleic acid molecule.   40. The method of claim 39, wherein the splint oligonucleotide is added to the sample prior to, simultaneously with, or after the proximity probe.   41. The method of claim 40, wherein the splint oligonucleotide is provided as a nucleic acid domain of a third proximity probe.   42. The method of claim 41, wherein the third proximity probe is added to the sample simultaneously with the first and second proximity probes.   32. The method of any one of claims 1-31, wherein the extended nucleic acid domains are ligated together.   44. The method of claim 43, wherein the ligation reaction is via a splint oligonucleotide as defined in any one of claims 33-42.   45. The method of any one of claims 1-44, comprising a combined analysis using multiple sets of at least first and second proximity probes, each set producing a unique extension product.   The method according to any one of claims 1 to 45, wherein a crowding agent is included in the steps (a) and / or (b).   47. The method of claim 46, wherein the crowding agent is Sephadex, preferably the Sephadex is of type G-100. A kit for use in a method for detecting an analyte in a sample,
(A) at least one set of at least first and second proximity probes, each comprising an analyte binding domain and a nucleic acid domain, capable of simultaneously binding to the analyte;
(B) a component comprising 3 ′ exonuclease activity;
(C) optionally, means for extending at least one of the nucleic acid domains of the first and second proximity probes to produce an extension product;
(D) optionally a means for amplifying and detecting the extension product.   49. The kit of claim 48, further comprising a splint oligonucleotide and / or a blocking oligonucleotide for the first and second probes.   50. A kit according to claim 48 or 49, further comprising an immobilized capture probe for the analyte or a capture probe comprising an immobilization means.   51. The kit according to any one of claims 48 to 50, wherein the component containing 3 'exonuclease activity is as defined in claim 7 or 11.