JP2017104092A - Novel nucleic acid synthesis method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for synthesizing cDNA which maintains high accuracy and high reverse transcription activity, and to provide a method for improving the synthesis efficiency even when the target nucleic acid is DNA by using helicase in the NASBA method.SOLUTION: A method of synthesizing cDNA using RNA as a template in a solution containing specific (i) reverse transcriptase, (ii) reverse transcription DNA polymerase, and (iii) helicase. Also, a method of amplifying a nucleic acid using a target DNA as a template in a solution containing reverse transcriptase, RNase H, RNA polymerase, NTP, dNTP, and helicase.SELECTED DRAWING: None

Description

  The present invention relates to a novel nucleic acid synthesis method (particularly, a cDNA synthesis method and a DNA synthesis method by NASBA method). The contents of all documents mentioned herein (in particular WO2012 / 020759 and WO2010 / 050418) are hereby incorporated by reference.

  Current cDNA synthesis uses Moloney murine leukemia virus (MMLV) reverse transcriptase and retrovirus-derived reverse transcriptases such as avian myeloblastosis virus (AMV) reverse transcriptase. The accuracy does not reach DNA synthesis using DNA as a template. This is due to the secondary structure produced by the template RNA, the low heat resistance of reverse transcriptase, and the lack of proofreading activity. So far, reverse transcriptase (heat-resistant reverse transcriptase) having higher heat resistance than wild-type reverse transcriptase has been reported by introducing amino acid mutations (for example, Patent Document 1, Non-Patent Documents 1 and 2). However, their heat resistance is higher than that of wild-type reverse transcriptase, but is significantly lower than that of heat-resistant DNA polymerase.

  A heat-resistant DNA polymerase having reverse transcription activity has been reported by introducing an amino acid mutation into the heat-resistant DNA polymerase (for example, Patent Document 2). Since these have calibration activity, high accuracy is expected. However, its reverse transcription activity is weaker than reverse transcriptase (for example, Non-Patent Document 4) and has not been put into practical use.

  RNA / DNA helicases (also called simply RNA helicases or helicases) have been reported to eliminate nucleic acid misannealing. Therefore, it can be expected that nonspecific amplification, which is often a problem in cDNA synthesis, is resolved (for example, Non-Patent Document 5). However, RNA and DNA helicases may weaken the original annealing. Under the reaction conditions in which the action of reverse transcriptase is sufficiently retained, it is considered difficult to eliminate mis-annealing by the action of RNA / DNA helicase, and it has not been put into practical use.

  Nucleic acid sequence based amplification (NASBA) is a constant temperature RNA amplification method (for example, Non-Patent Document 6). Since it is not necessary to raise or lower the temperature as in RT-PCR, it is expected to be used more widely than RT-PCR. As an RNA amplification method other than NASBA that does not require temperature increase or decrease, a double-stranded cDNA is synthesized by reacting a target RNA with a reverse transcriptase typified by MMLV reverse transcriptase or AMV reverse transcriptase, and TtE- A method of amplifying DNA at a constant temperature by the action of a heat-resistant helicase typified by UvrD and a heat-resistant strand-displacing DNA polymerase typified by Bst polymerase (Patent Document 3), and a target RNA typified by PYROPHAGE 3173 , A double-stranded cDNA was synthesized by the action of a DNA polymerase having both reverse transcription activity and DNA-dependent DNA polymerase activity (hereinafter referred to as “reverse transcription DNA polymerase”). Tengcongensis and T.W. A heat-resistant helicase typified by actiasis-derived helicase and a method for amplifying DNA at a constant temperature by the action of the reverse transcription DNA polymerase (Patent Publication 4) have been reported. However, their amplification efficiencies are lower than those of NASBA and PCR, and are hardly put into practical use.

  By the way, the NASBA method is a method usually used when the target nucleic acid is RNA, but it can be amplified even when the target nucleic acid is DNA (for example, Non-Patent Document 7). However, when the target nucleic acid is DNA, the amplification efficiency of the NASBA method is low, and even if this is applied to the inspection of the presence of microorganisms, the detection sensitivity is low, so that it has been difficult to realize. As a result, the practical application of the NASBA method is limited to the target nucleic acid being RNA.

International Publication No. 2012/020759 International Publication No. 2010/050418 Special table 2008-526231 Special table 2013-516192 gazette

K. Yasukawa et al., “Increase in thermal stability of Moroney mureine leukaeemia virus reverse transolase ol. 299-306 B. Arezi et al., “A novel mutation in Moloney murine leukemia virus reverse transcriptase increases thermostability through strong binding to template-primers (Novelations in Moloney murine virus reverse transcription incres- ss.). template-primer) ", Nucleic Acids Research, 2009, vol. 473-481) S. Sano et al., "Mutations to create thermostable reverse transcribate with bacterial en er p in bio engineering and bio of the bio. . 315-321 K. Yasukawa et al., “Kinetic analysis of reverse transcription, activity of bacterial family, A DNA polymer,” Biochemical Biophysical Research Communication (Biochemical Biophysics, Bio27. 654-658 Y. Shimada et al., “Profession of cold inducible DEAD-box RNA helicase in hyperthermologic archaea”, Biochemical Biophysical Research 9 (Biochemical Biophysical 9). 622-626 T. T. Hayashi et al., “A competent nucleic acid sequence-based amplification assessment, the second of the quantification of human CMR (2). 115-126 C. Voisset et al., “RNA amplification Techniques, NASBA, also amplifiers homogeneous plasmid DNA in non-denaturing conditions”, 2000, BioTechniques 29, p. 236-240

  An object of the present invention is to find a cDNA synthesis method that maintains high accuracy and high reverse transcription activity. Another object of the present invention is to find a method for efficiently synthesizing a target DNA using the NASBA method.

  The present invention provides (α) a method for efficiently synthesizing cDNA by using a combination of three specific enzymes, and (β) a synthesis efficiency even when the target nucleic acid is DNA by using a helicase in the NASBA method. A method of improving.

  The inventors of the present invention efficiently used cDNA by combining three specific enzymes, ie, a specific (i) reverse transcriptase, a specific (ii) reverse transcription DNA polymerase, and a specific (iii) helicase. Has been found to be able to be synthesized, and further improvements have been made to complete the invention (α).

That is, the present invention includes, for example, the subject matters described in the following sections.
Item 1.
A method of synthesizing cDNA using RNA as a template in a solution containing the following (i) reverse transcriptase, (ii) reverse transcriptase DNA polymerase, and (iii) helicase.
(I) The reverse transcriptase according to the following (i-1) or (i-2);
(I-1): In the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313 A reverse transcriptase (i-2): (i-1) comprising an amino acid sequence in which at least one amino acid selected from the group consisting of leucine at position 435 and asparagine at position 454 is substituted with a positively charged amino acid; A reverse transcriptase (ii) consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added from the amino acid sequence of the reverse transcriptase, and having reverse transcription activity (ii) The reverse transcription DNA polymerase according to (ii-1) or (ii-2) below;
(Ii-1): In the amino acid sequence of SEQ ID NO: 2, at least one amino acid selected from the group consisting of the 326th, 329th, 384th, 388th, 408th, and 438th amino acids is substituted with alanine Reverse transcription DNA polymerase (ii-2) consisting of the amino acid sequence: (ii-1) In the amino acid sequence of reverse transcription DNA polymerase of (ii-1), one or more amino acids are deleted from the state in which the amino acid substitution is maintained, Helicase according to (iii-1) or (iii-2) below reverse transcription DNA polymerase (iii) consisting of a substituted or added amino acid sequence and having reverse transcription activity;
(Iii-1): Helicase consisting of the amino acid sequence of SEQ ID NO: 3 (iii-2): an amino acid in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the helicase of (iii-1) 1. a helicase term consisting of a sequence and having helicase activity
A method for confirming the presence of a template RNA, comprising a step of performing a nucleic acid amplification reaction on the cDNA obtainable by the method according to Item 1.
Item 3.
Item 3. The method according to Item 2, further comprising a step of detecting an amplified nucleic acid obtainable by the nucleic acid amplification reaction.
Item 4.
Item 4. The method according to Item 2 or 3, wherein the nucleic acid amplification reaction is RT-PCR or NASBA.
Item 5.
A cDNA synthesis kit comprising the following (i) reverse transcriptase, (ii) reverse transcriptase DNA polymerase, and (iii) helicase.
(I) The reverse transcriptase according to the following (i-1) or (i-2);
(I-1): In the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313 A reverse transcriptase (i-2): (i-1) comprising an amino acid sequence in which at least one amino acid selected from the group consisting of leucine at position 435 and asparagine at position 454 is substituted with a positively charged amino acid; A reverse transcriptase (ii) consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added from the amino acid sequence of the reverse transcriptase, and having reverse transcription activity (ii) The reverse transcription DNA polymerase according to (ii-1) or (ii-2) below;
(Ii-1): In the amino acid sequence of SEQ ID NO: 2, at least one amino acid selected from the group consisting of the 326th, 329th, 384th, 388th, 408th, and 438th amino acids is substituted with alanine Reverse transcription DNA polymerase (ii-2) consisting of the amino acid sequence: (ii-1) In the amino acid sequence of reverse transcription DNA polymerase of (ii-1), one or more amino acids are deleted from the state in which the amino acid substitution is maintained, Helicase according to (iii-1) or (iii-2) below reverse transcription DNA polymerase (iii) consisting of a substituted or added amino acid sequence and having reverse transcription activity;
(Iii-1): Helicase consisting of the amino acid sequence of SEQ ID NO: 3 (iii-2): an amino acid in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the helicase of (iii-1) A helicase comprising a sequence and having helicase activity

  Further, the present inventors have found that the synthesis efficiency can be improved even when the target nucleic acid is DNA by using helicase in the NASBA method, and further improvements have been made to complete the invention of (β). .

That is, the present invention includes the subject matters described in the following sections, for example.
Term A.
A mix for amplifying a nucleic acid using a target DNA as a template, comprising reverse transcriptase, RNase H, T7 RNA polymerase, NTP, dNTP, and helicase.
Term B.
A kit for amplifying a nucleic acid using a target DNA as a template, comprising at least one selected from the group consisting of reverse transcriptase, RNase H, T7 RNA polymerase, NTP, and dNTP, and a helicase.
Term C.
A method for amplifying a nucleic acid using a target DNA as a template in a solution containing reverse transcriptase, RNase H, T7 RNA polymerase, NTP, dNTP, and helicase (preferably, the concentration of helicase is 100 nM or less).
Term D.
A primer having a structure in which a DNA comprising a T7 promoter sequence is further bound to the 5 ′ end of a DNA comprising a base sequence that anneals with a part of the template DNA (preferably a complementary sequence of a part of the template DNA); The method according to Item C, further comprising the mix according to Item A or the kit according to Item B, or the primer in the solution.
Term E.
The mix according to Item A or the kit according to Item B, or the method according to Item C, wherein the helicase is a helicase having helicase activity at 35 to 45 ° C.
Term F.
The mix according to Item A, D or E or the kit according to Item B, D or E, or the method according to Item C, D or E, wherein the nucleic acid amplification is by the NASBA method.

  According to the cDNA synthesis method of the present invention (above (α)), cDNA can be synthesized very efficiently due to high reverse transcription activity. In addition, cDNA is synthesized with high accuracy. For this reason, cDNA can be synthesized accurately and in large quantities from a very small number of template RNA molecules. Therefore, RNA molecules can be detected with very high sensitivity and accuracy by the cDNA synthesis method according to the present invention.

  Further, according to the NASBA method using the helicase according to the present invention (above (β)), the target DNA can be efficiently synthesized using the NASBA method. Therefore, the target DNA molecule can be detected with very high sensitivity and accuracy by the NASBA method.

Of the experiments for measuring the unwinding activity of the purified protein (helicase), the results of using a both-end protruding type system are shown. Of the experiments for measuring the unwinding activity of the purified protein (helicase), the results of using the 5 'overhang type system are shown. Of the experiments for measuring the unwinding activity of the purified protein (helicase), the results of using the 3 'overhang type system are shown. Of the experiments for measuring the unwinding activity of purified protein (helicase), the results of using a blunt end type system are shown. 2 shows a graph summarizing the results of FIGS. The unwinding activity from the terminal of each type of double-stranded DNA calculated from the results of the unwinding activity measurement experiment is shown. The sequence of template RNA and primer used in the example (detection of cDNA synthesis product by PCR 1) is shown. CDNA synthesis and PCR were carried out by the method shown in Example (Detection of cDNA synthesis product by PCR 1), the PCR amplification product was subjected to 2% agarose electrophoresis, stained with ethidium bromide, and a DNA band was detected with a transilluminator. The analysis result is shown. The result of having performed PCR and NASBA-nucleic acid chromatography by the method shown in Example (detection of cDNA synthesis product by NASBA) is shown. The sequence of template RNA and primer used in Example (detection of cDNA synthesis product by PCR 2) is shown. CDNA synthesis and PCR were performed by the method shown in Example (Detection of cDNA synthesis product by PCR 2), the PCR amplification product was subjected to 1% agarose electrophoresis, stained with ethidium bromide, and a DNA band was detected with a transilluminator. The analysis result is shown. The arrow indicates the band of the amplification product of interest. CDNA synthesis and PCR were performed by the method shown in Example (PCR detection of cDNA synthesis product 3), the amplified product of PCR was subjected to 2% agarose electrophoresis, stained with ethidium bromide, and a DNA band was detected with a transilluminator. The analysis result is shown. The arrow indicates the band of the amplification product of interest. The outline figure when the plasmid DNA containing the cesD sequence is digested with a restriction enzyme (EcoRI or PstI) at either one of the forward primer side or the reverse primer side for cesD sequence amplification is shown.

  Hereinafter, the present invention will be described in more detail. First, the above (α) will be described.

  In the cDNA synthesis method encompassed by the present invention, specific three types of enzymes, ie, a specific (i) reverse transcriptase, a specific (ii) reverse transcription DNA polymerase, and a specific (iii) helicase are used in combination. These specific enzymes (i) to (iii) will be described in detail below.

The (i) reverse transcriptase used in the present invention is the following reverse transcriptase (i-1) or (i-2).
(I-1): In the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313 At least one amino acid selected from the group consisting of leucine at position 435 and asparagine at position 454,
A reverse transcriptase consisting of an amino acid sequence substituted with a positively charged amino acid.
(I-2): the amino acid sequence of the reverse transcriptase of (i-1), comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added from the state where the amino acid substitution is maintained, and A reverse transcriptase having reverse transcription activity.

  The positively charged amino acid is preferably an amino acid that is positively charged at pH 7.0, more preferably an amino acid that is positively charged at pH 8.0, and at a pH suitable for performing a reverse transcription reaction (pH 8.3). More preferred are amino acids that are positively charged. Of these, arginine and lysine are particularly preferable.

  “The amino acid sequence of the reverse transcriptase of (i-1)” means “in the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, An amino acid sequence in which at least one amino acid selected from the group consisting of glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313, leucine at position 435, and asparagine at position 454 is replaced with a positively charged amino acid. is there.

  Further, in the amino acid sequence of the reverse transcriptase of (i-1), it is preferable to exclude a sequence in which glutamic acid at position 302 is substituted with arginine.

  SEQ ID NO: 1 is identical to the amino acid sequence of wild-type Moloney murine leukemia virus (MMLV) reverse transcriptase.

  The (i) reverse transcriptase used in the present invention has high thermostability, and preferably exhibits reverse transcription activity under relatively high temperature (eg, 50 ° C. to 60 ° C.) conditions.

From the viewpoint of ensuring high thermal stability, the amino acid sequence of the reverse transcriptase of (i-1) is the amino acid sequence of SEQ ID NO: 1,
(I-1a) substitution of glutamic acid at position 69 with arginine or lysine,
(I-1b) substitution of aspartic acid at position 108 with arginine or lysine;
(I-1c) substitution of glutamic acid at position 117 to arginine or lysine;
(I-1d) substitution of aspartic acid at position 124 with arginine or lysine;
(I-1e) substitution of glutamic acid at position 286 to arginine or lysine;
(I-1f) substitution of glutamic acid at position 302 to lysine,
(I-1g) substitution of tryptophan at position 313 with arginine or lysine;
(I-1h) a sequence having at least one substitution selected from the group consisting of substitution of leucine at position 435 with arginine or lysine, and (i-1i) substitution of asparagine at position 454 with arginine or lysine. Preferably, it is a sequence having at least one substitution selected from the group consisting of (i-1d), (i-1e), (i-1f), and (i-1h). , (I-1e), (i-1f), and (i-1h), more preferably a sequence having at least one substitution selected from the group consisting of (i-1e), (i- It is more preferable that the sequence is a sequence in which 1f) and (i-1h) are substituted. Among them, in the amino acid sequence of SEQ ID NO: 1, substitution of glutamic acid at position 286 with arginine (E286R), substitution of glutamic acid at position 302 with lysine (E302K), and substitution of leucine at position 435 with arginine (L435R) It is particularly preferred that the sequence is made.

  In addition, the amino acid sequence of the reverse transcriptase (i-1) is preferably a sequence in which the aspartic acid at position 524 is further substituted with a nonpolar amino acid. Preferred examples of the nonpolar amino acid include glycine, alanine, valine, leucine, isoleucine, methionine, cysteine, tryptophan, phenylalanine, proline and the like, and alanine is particularly preferable.

One of the most preferred (i) reverse transcriptases used in the present invention is a substitution of glutamic acid at position 286 with arginine, substitution of glutamic acid at position 302 with lysine, and leucine at position 435 in the amino acid sequence of SEQ ID NO: 1. It is a reverse transcriptase consisting of a sequence (E286R / E302K / L435R / D524A) in which substitution with arginine and substitution of aspartic acid at position 524 with alanine have been performed.

In addition, “1 or 2 or more” in “i, 2 or more amino acid deletion, substitution or addition” in (i-2) is preferably 1 to 30 (that is, 1, 2, 3, 4, 5). 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 ), More preferably 1-20, still more preferably 1-10, even more preferably 1-5, particularly preferably 1, 2 or 3.

 The amino acid sequence of the reverse transcriptase (i-2) preferably has high identity with the amino acid sequence of the reverse transcriptase (i-1). More specifically, the identity is preferably 80% or more, more preferably 90% or more, further preferably 95% or more, still more preferably 98% or more, 99 % Or more is particularly preferable.

  In this specification, the identity of amino acid sequences refers to the identity when two amino acids are compared by the BLAST algorithm.

  In addition, it is preferable that the amino acid sequence of the reverse transcriptase of (i-2) does not become the amino acid sequence of sequence number 1. That is, it is preferable that the reverse transcriptase consisting of the amino acid sequence of SEQ ID NO: 1 is not included in the reverse transcriptase of (i-2). The reverse transcriptase of (i-1) and (i-2) can be produced, for example, by using a known genetic engineering technique. For example, it can be easily produced based on the method described in the WO2012 / 020759 pamphlet.

  As used herein, “reverse transcription activity” refers to an activity that catalyzes a reaction (reverse transcription reaction) in which RNA is used as a template to synthesize complementary DNA (complementary DNA; cDNA). In the present specification, the degree of reverse transcription activity in the case of having reverse transcription activity is not particularly limited. For example, when reverse transcription reaction is performed according to a conventional method, there are various known reverse transcriptases derived from retroviruses. It is preferable if it is a grade that produces cDNA equivalent to or higher than the above enzyme.

The reverse transcription activity can be measured by a known method or a method easily obtained from a known method. For example, the following steps 1) to 6):
1) Reaction solution [Composition: 25 mM Tris-HCl buffer (pH 8.3), 50 mM potassium chloride, 2 mM dithiothreitol, 5 mM magnesium chloride, 12.5 μM poly (rA) · p (dT) ₁₅ (p (dT) ₁₅ concentration in terms), and 0.2 mM [methyl ^- 3 H] dTTP] steps of incubation at 37 ° C. the reverse transcriptase in,
2) collecting 20 μL of the product obtained in step 1) and spotting it on a glass filter;
3) The glass filter after step 2) is washed with a cooled 5% by mass trichloroacetic acid aqueous solution for 10 minutes, and then with a cooled 95% by volume ethanol aqueous solution. rA) · p (dT) removing [ ³ H] dTTP that is not incorporated into ₁₅ ;
4) After drying the glass filter after step 3), placing the glass filter in 2.5 mL of a liquid scintillation reagent and counting the radioactivity;
5) A step of calculating the amount of [ ³ H] dTTP taken into poly (rA) · p (dT) ₁₅ (hereinafter referred to as “dTTP uptake amount”) based on the radioactivity obtained in step 4). 6) Based on the dTTP uptake calculated in step 5), the step of determining the amount of reverse transcriptase that incorporates 1 nmol of dTTP into poly (rA) · p (dT) ₁₅ in 10 minutes is performed. Can be measured.

The (ii) reverse transcription DNA polymerase used in the present invention is the following (ii-1) or (ii-2) reverse transcription DNA polymerase.
(Ii-1): In the amino acid sequence of SEQ ID NO: 2, at least one amino acid selected from the group consisting of the 326th, 329th, 384th, 388th, 408th, and 438th amino acids is substituted with alanine Reverse transcription DNA polymerase consisting of a specific amino acid sequence.
(Ii-2): the amino acid sequence of the reverse transcription DNA polymerase of (ii-1) consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added from the state where the amino acid substitution is maintained, And reverse transcription DNA polymerase having reverse transcription activity.

  SEQ ID NO: 2 is an anaerobic thermophilic bacterium Thermotoga sp. It is an amino acid sequence of a DNA polymerase isolated from K4 (hereinafter referred to as “K4 DNA polymerase”). K4 DNA polymerase does not have reverse transcription activity, but substitutes alanine for at least one amino acid selected from the group consisting of 326th, 329th, 384th, 388th, 408th and 438th amino acids To obtain reverse transcription activity (WO2010 / 050418 pamphlet).

Examples of the reverse transcription DNA polymerase of (ii-1) include the following reverse transcription DNA polymerase:
Reverse transcription DNA polymerase (T326A) in which the 326th threonine (T326) is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
In the amino acid sequence of SEQ ID NO: 2, reverse transcription DNA polymerase (L329A) in which the 329th leucine (L329) is substituted with alanine;
Reverse transcription DNA polymerase (Q384A) in which the 384th glutamine (Q384) is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
Reverse transcription DNA polymerase (F388A) in which the 388th phenylalanine (F388) is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
In the amino acid sequence of SEQ ID NO: 2, reverse transcription DNA polymerase (M408A) in which 408th methionine (M408) is substituted with alanine; and in the amino acid sequence of SEQ ID NO: 2, 438th tyrosine (Y438) is substituted with alanine. Reverse transcription DNA polymerase (Y438A).

  Among these (ii-1) reverse transcription DNA polymerases, for example, one selected from the group consisting of T326A, F388A, M408A, and Y438A is preferable, and selected from the group consisting of T326A, F388A, M408A, and Y438A. One is more preferable. In particular, one selected from the group consisting of T326A and M408A is preferred from the viewpoint of excellent 3'-5 'exonuclease activity.

  In addition, (ii-1) reverse transcription DNA polymerase may have the above amino acid substitutions alone or in combination, as long as it has reverse transcription activity. As will be described later, each reverse transcription DNA polymerase in which one selected from the group consisting of T326, L329, Q384, F388, M408, and Y438 in the amino acid sequence of SEQ ID NO: 2 is substituted with alanine is thermostable. Since reverse transcription activity can be acquired while maintaining it, reverse transcription DNA polymerase in which any multiple of these substitution sites are simultaneously substituted with alanine should also acquire reverse transcription activity while maintaining heat resistance. Can do.

    (Ii-1) The reverse transcription DNA polymerase in which a plurality of amino acid substitutions are made is selected from the group consisting of T329, F388, M408, and Y438, wherein L329 and / or Q384 are substituted with alanine Reverse transcription DNA polymerase in which at least one amino acid is replaced with alanine is preferred.

Specific examples of such (ii-1) reverse transcription DNA polymerase include the following reverse transcription DNA polymerase:
A reverse transcription DNA polymerase, wherein L329 is substituted with alanine and T326 is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
A reverse transcription DNA polymerase, wherein L329 is substituted with alanine and F388 is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
A reverse transcription DNA polymerase, wherein L329 is replaced with alanine and M408 is replaced with alanine in the amino acid sequence of SEQ ID NO: 2;
A reverse transcription DNA polymerase, wherein L329 is substituted with alanine and Y438 is substituted with alanine in the amino acid sequence of SEQ ID NO: 2;
A reverse transcription DNA polymerase in which the amino acid sequence of SEQ ID NO: 2 has Q384 replaced with alanine and T326 replaced with alanine;
A reverse transcription DNA polymerase in which Q384 is substituted with alanine in the amino acid sequence of SEQ ID NO: 2 and F388 is substituted with alanine; and in the amino acid sequence of SEQ ID NO: 2, Q384 is substituted with alanine; and Reverse transcription DNA polymerase in which M408 is replaced with alanine;
A reverse transcription DNA polymerase, wherein Q384 is substituted with alanine and Y438 is substituted with alanine in the amino acid sequence of SEQ ID NO: 2.

  (Ii-1) The reverse transcription DNA polymerase having a combination of a plurality of amino acid substitutions, L329 and / or Q384 is substituted with alanine, and at least selected from the group consisting of L329, F388, M408, Y438 and the like More preferably, the reverse transcription DNA polymerase in which one amino acid is substituted with alanine, L329 and / or Q384 is substituted with alanine, and at least one amino acid selected from the group consisting of F388, M408, and Y438 is More preferred is reverse transcription DNA polymerase substituted with alanine.

  (Ii-1) Among the reverse transcription DNA polymerases, a particularly preferred reverse transcription DNA polymerase is selected from the group consisting of the 326th, 329th, 384th, 388th, 408th and 438th amino acids of SEQ ID NO: 2. A reverse transcription DNA polymerase in which one amino acid is substituted with alanine, and particularly preferably a reverse transcription DNA polymerase in which the 329th amino acid (leucine) is substituted with alanine.

  In addition, “1 or 2 or more” in “ii. Deletion or substitution or addition of one or more amino acids” in (ii-2) is preferably 1 to 30 (ie 1, 2, 3, 4, 5 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 ), More preferably 1-20, still more preferably 1-10, even more preferably 1-5, particularly preferably 1, 2 or 3.

 The amino acid sequence of the reverse transcription DNA polymerase (ii-2) preferably has high identity with the amino acid sequence of the reverse transcription DNA polymerase (ii-1). More specifically, the identity is preferably 80% or more, more preferably 90% or more, further preferably 95% or more, still more preferably 98% or more, 99 % Or more is particularly preferable.

  In addition, it is preferable that the amino acid sequence of the reverse transcription DNA polymerase of (ii-2) does not become the amino acid sequence of sequence number 2. That is, the reverse transcription DNA polymerase consisting of the amino acid sequence of SEQ ID NO: 2 is preferably not included in the reverse transcription DNA polymerase of (ii-2). The reverse transcription DNA polymerases (ii-1) and (ii-2) can be produced, for example, by using a known genetic engineering technique. For example, it can be easily produced based on the method described in the WO2010 / 050418 pamphlet.

The (iii) helicase used in the present invention is the following (iii-1) or (iii-2) helicase.
(Iii-1): Helicase consisting of the amino acid sequence of SEQ ID NO: 3 (iii-2): an amino acid in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the helicase of (iii-1) A helicase comprising a sequence and having helicase activity

  SEQ ID NO: 3 is the amino acid sequence of TK0566, a helicase derived from a hyperthermophilic archaea belonging to the genus Thermococcus, Thermococcus kodacarensis.

  In addition, “1 or 2 or more” in “one or more amino acids are deleted, substituted or added” in (iii-2) is preferably 1 to 30 (that is, 1, 2, 3, 4, 5). 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 ), More preferably 1-20, still more preferably 1-10, even more preferably 1-5, particularly preferably 1, 2 or 3.

 The amino acid sequence of the (iii-2) helicase preferably has higher identity than the amino acid sequence of the (iii-1) helicase. More specifically, the identity is preferably 80% or more, more preferably 90% or more, further preferably 95% or more, still more preferably 98% or more, 99 % Or more is particularly preferable. In the present specification, having helicase activity means that the ATP hydrolysis energy is used to destabilize the helix of the double-stranded nucleic acid and to rewind the double-stranded nucleic acid into the single-stranded nucleic acid. Say.

  The activity of unwinding a double-stranded nucleic acid into a single-stranded nucleic acid (double-stranded nucleic acid unwinding activity) is measured as follows.

  The unwinding activity measurement uses double-stranded DNA as a substrate. Only one DNA strand of the double strand is fluorescently labeled. In addition to the substrate, single-stranded DNA (trap DNA) for trapping the single strand released by unwinding the double-stranded DNA with a helicase is added to the measurement system. Specifically, measurement is performed with a combination of the following four types of substrate and trap DNA (in each type, double-stranded DNA formed by two DNAs other than trap DNA is used as a substrate). Thereby, it can be examined whether the helicase to be measured rewinds the double-stranded DNA from the 3 'end side and / or the 5' end side.

Both ends protruding type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / TCACTCCCGCATCTGCCGATTCTGGCTGTGGCGGTTTCTGGGTGGTCTCTAGGTC-3 '
(70-mer)
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAGGAAGCCGATTGCGAGGCCGTCCTACCATCCTGCAGG-3 '
(34-mer (trap DNA))
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAG-3 '
5 'protruding type (34-mer fluorescently labeled with IRD700)
5'-d / IRD700 / GACCTAGGAACCCACAGAAACACGCCACAGCCAG-3 '
(54-mer)
5'-dTCACTCCCGCATCTCCGCATTCTGGCTGTGGCGTGTTCTGGTGGTTCCTAGGGTC-3 '
(34-mer (trap DNA))
5'-dCTGGCTGTGGCGGTTTCTGGGTGGTCTCTAGGTC-3 '
3 'protruding type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / CTGGCTGTGGCGGTGTTCTGGTGGTCTCTAGGTCTTAGCCGTTCTACGCCTCACT-3 '
(34-mer)
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAG-3 '
trap DNA is similar to 5 'overhang
Blunt end type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / GACCTAGGAACCACCAGAAACACGCCCACAGCCAGAATCGGCAGATGCGGAGTGA-3 '
(54-mer (trap DNA))
5'-dTCACTCCCGCATCTCCGCATTCTGGCTGTGGCGTGTTCTGGTGGTTCCTAGGGTC-3 '
The excitation wavelength of IRD700 is 685 nm and the fluorescence wavelength is 712 nm.

  The specific procedure is as follows. First, Table 1 shows the composition of the reaction solution for preparing the substrate. After treatment at 95 ° C. for 3 minutes with the reaction composition shown in Table 1, the mixture is allowed to stand until it reaches room temperature, and then treated at 25 ° C. for 1 hour. The prepared substrate is diluted 10-fold to prepare 2 μM double-stranded DNA. And it makes it react with a to-be-measured helicase at 50 degreeC by the composition of Table 2 for 40 minutes. The reaction is stopped by quenching on ice. Dilute the sample 3 times, mix 2 μL of the sample, 1 μL of 10 × loading buffer and 7 μL of water, apply to 13% acrylamide gel, and perform Native Page for 15 minutes at 15 mA while shielding light. Then, fluorescence is detected using an Odyssey (Odyssey infrared imaging system (LI-COR, Nebraska, USA)). If the measurement target helicase has the unwinding activity, the amount of substrate double-stranded DNA is decreased by helicase (more specifically, as the amount of helicase added is increased).

  In addition, as to whether or not the helix of the double-stranded nucleic acid is destabilized using the energy of ATP hydrolysis, the ATPase activity in the presence of the double-stranded nucleic acid is measured. It can be judged that the helix of the double-stranded nucleic acid is destabilized using the energy of hydrolysis. ATPase activity is measured as follows.

ATPase activity is measured by measuring the amount of free phosphate released when ATP is converted to ADP. First, in order to examine nucleic acid dependency, 63merRNA (ssRNA63 (SEQ ID NO: 4)) which is ssRNA is used as a substrate. The total volume of the reaction solution is 10 μL, and contains 5 nM nucleic acid substrate, 0.2 μM purified protein, 1 mM ATP, ₂ mM MgCl ₂ , ₂ mM DTT, 4 units of Ribonuclease inhibitor (Human placenta) (Takara Bio), 50 mM HEPES (pH 7.6). This is reacted at 90 ° C. for 30 minutes and immediately transferred to ice to stop the reaction. The amount of free phosphoric acid in the reaction solution is measured using BIOMOGREEN ^™ (BIOMOL), and Ab ₅₃₀ is measured using Multiskan Spectrum (ThermoLabsystems).

  The present invention also includes a method of synthesizing cDNA using RNA as a template in a solution containing (i) reverse transcriptase, (ii) reverse transcriptase DNA polymerase, and (iii) helicase.

    In the cDNA synthesis method according to the present invention, (i) reverse transcriptase and (ii) reverse transcriptase DNA polymerase synthesize DNA using RNA molecules as templates. Moreover, (iii) helicase eliminates the secondary structure (for example, hairpin structure) of the RNA molecule and increases the reaction efficiency.

These enzymes (i), (ii) and (iii) are contained and used in the same solution. The solution contains dNTP (various deoxyribonucleoside triphosphates; a mixture of dATP, dTTP, dGTP and dCTP), ATP, primers and the like in addition to these three types of enzymes and template RNA. Otherwise, to the reaction of the enzyme efficiently, various salts (e.g. KCl, MgCl _2, etc.), buffers (e.g. _{Tris-HCl, Bicine-KOH,} Mn (CH 3 COO) 2, CH 3 COOK , etc.), Trehalose, E.I. E. coli RNA, glycerol and the like may be included. The type and amount of the other components used are not particularly limited, but can be appropriately set in consideration of the method of using the cDNA synthesis method according to the present invention (for example, RT-PCR, NASBA, etc.).

  For example, the dNTP concentration is preferably about 0.01 to 0.5 mM, more preferably about 0.05 to 0.3 mM, and further preferably about 0.1 to 0.2 mM.

  The buffer is preferably contained so that the pH is set to about 7.5 to 9, more preferably about pH 8 to 8.5, still more preferably about pH 8.1 to 8.4, and pH 8.2. About 8.3 is still more preferable.

For example, the KCl concentration is preferably about 10 to 100 mM, more preferably about 25 to 75 mM, and further preferably about 40 to 60 mM. For example, the MgCl ₂ concentration is preferably about 1 to 10 mM, more preferably about 2.5 to 7.5 mM, and further preferably about 4 to 6 mM.

  When trehalose is contained in the solution, the concentration is preferably about 0.01 to 0.5M, more preferably about 0.05 to 2.5M, still more preferably about 0.08 to 1.5M, About 1M is even more preferable.

  The ATP concentration is preferably about 0.1 to 5 mM, more preferably about 0.5 to 2.5 mM, still more preferably about 0.8 to 1.5 mM, and still more preferably about 1 mM.

  E. When E. coli RNA is contained in the solution, the concentration is preferably about 0.01 to 0.5M, more preferably about 0.05 to 0.25M, further preferably about 0.08 to 0.15M, About 0.1M is even more preferable.

  The primer concentration is preferably 0.1 to 5 μM, more preferably 0.5 to 2.5 μM, still more preferably 0.8 to 1.5 μM, and still more preferably about 1 μM.

  Further, the reaction temperature and reaction time can also be examined and determined based on the reaction efficiency of each enzyme. For example, the reaction temperature is preferably 45 to 65 ° C, more preferably 50 to 60 ° C. The reaction time is, for example, preferably 10 to 60 minutes, more preferably 20 to 40 minutes, and further preferably about 30 minutes.

  One of the best reaction conditions is as follows. This condition is obtained by repeating the factor analysis for various factors, and the concentration of each component in the reaction solution is optimized.

(I) Reverse transcriptase 10 nM
(Ii) Reverse transcription DNA polymerase 50 nM
(Iii) Helicase 20nM
dNTP (each) 0.2 mM
KCl 50 mM
Tris-HCl (pH 8.3): 25 mM
Bicine-KOH (pH 8.2): 50 mM
MgCl ₂ : 5 mM
Mn (CH ₃ COO) ₂ 1 mM
CH ₃ COOK 30 mM
Trehalose 0.1M
ATP 1 mM
E. coli RNA 10 μg / ml
Temperature 50 ℃
Reaction time 30 minutes RNA 1 to 1 million molecules Primer 1 μM
Reaction volume 10 μl

  In addition, various applications are possible by using the cDNA synthesis method according to the present invention. In particular, a nucleic acid amplification reaction can be performed on the resulting cDNA. For example, RT-PCR (reverse transcriptase-PCR) can be performed to synthesize a large amount of cDNA. That is, cDNA can be synthesized by the cDNA synthesis method according to the present invention, and PCR can be performed on the cDNA. In addition, for example, single-stranded RNA (antisense RNA) having a base sequence complementary to the template RNA can be amplified by NASBA (nucleic acid sequence based amplification).

  Furthermore, the presence of the template RNA can be detected by detecting the amplified nucleic acid thus obtained. That is, when nucleic acid is amplified, it can be detected, and detection means that the template RNA was present. Conversely, when the nucleic acid is not amplified, it cannot be detected, and the fact that it cannot be detected means that the template RNA is not present or only a very small amount is present.

  By using this, for example, it is possible to detect RNAs specific to viruses and bacteria, and RNAs specific to diseases. As a result, virus and bacteria infection tests, and specific disease tests (especially diagnostic tests) Can be used. In particular, by using the cDNA synthesis method according to the present invention, the test can be performed with extremely high sensitivity and accuracy. Depending on the type of target RNA and reaction conditions, detection is possible even if there are only about 10 to 1000 molecules (or 10 to 500 molecules, 10 to 300 molecules, 10 to 100 molecules) of target RNA molecules. It can be.

  In addition, the detection method in particular of the amplified nucleic acid is not restrict | limited, A well-known method can be selected suitably and can be used. For example, methods such as agarose gel electrophoresis and staining with a nucleic acid staining reagent (for example, ethidium bromide), or using nucleic acid chromatography are exemplified. Another example is a method in which a probe that is complementary to the amplified nucleic acid and bound with a fluorescent substance or radioactive substance is hybridized with the amplified nucleic acid.

  The cDNA synthesis method according to the present invention can be used for various reactions other than these, and the form of use is not particularly limited.

  The present invention also includes a kit used for the cDNA synthesis method. The kit includes the enzymes (i) to (iii) above. In addition, for example, the above-described components such as various salts used for cDNA synthesis, buffer materials, and ATP may be provided. Further, for example, RNA used as a template for reverse transcription reaction, oligonucleotide primer complementary to the RNA, four kinds of deoxyribonucleoside triphosphates, reverse transcription reaction buffer, organic solvent, and the like may be provided. The form in which the enzyme of (i)-(iii) is contained in a kit is not restrict | limited in particular, For example, it may be contained in the same solution, is contained in a separate solution, and mixes all when using. It may be combined. Further, components other than the enzyme may be contained in the same solution as the enzyme or may be contained in another solution. Further, it may be contained in a solid or powder state.

  The kit can be preferably used for detecting a marker in a sample containing RNA obtained from a living body, for example. That is, it can be preferably used as a detection kit. Since the cDNA synthesis method according to the present invention can synthesize cDNA while maintaining high accuracy and high reverse transcription activity by using the enzymes (i) to (iii), the detection kit can be used in various ways. It can be used for samples and is highly versatile. Examples of RNA detection target samples include, but are not particularly limited to, food (including beverages), seawater, water, drainage, soil, parts of plants and animals (such as tissues), air, and the like.

  Examples of the marker include base sequences peculiar to viruses or bacteria contained in living bodies, RNA having base sequences peculiar to diseases, and the like. In the present specification, the “base sequence peculiar to a virus or a bacterium” refers to a base sequence that exists in a virus or a bacterium but does not exist in a living body or a living body infected with a virus or a bacterium. A base sequence that is significantly different in the expression level in a living body. In addition, a “base sequence peculiar to a disease” refers to a base sequence that exists in a living body affected with a disease but does not exist in a normal living body that does not suffer from the disease, or a living body affected with the disease. A nucleotide sequence that is significantly different in the expression level in a normal living body.

  Although it does not specifically limit as said virus, For example, HPV, HIV, influenza virus, HCV, Norovirus, West Nile virus etc. are mentioned. Examples of the bacterium include Bacillus cereus, Salmonella, enterohemorrhagic Escherichia coli, Vibrio, Campylobacter, and methicillin-resistant Staphylococcus aureus that cause food poisoning. Examples of the disease include cancer, diabetes, heart disease, hypertension, infectious disease, genetic disease, congenital disease and the like.

  Examples of the reagent for detecting the marker include a probe that is complementary to the RNA serving as the marker and bound with a fluorescent substance or a radioactive substance, or a fluorescent substance that specifically intercalates with a double-stranded nucleic acid (for example, Ethidium bromide).

  As described above, by using the detection kit, a reverse transcription reaction can be efficiently performed even under a temperature condition in which the formation of secondary structure is suppressed. Therefore, the RNA used as a test sample is highly versatile. Regardless of the type, it is possible to detect with high accuracy a base sequence peculiar to a virus or a bacterium or a base sequence peculiar to a disease.

  Next, (β) will be described.

  In the NASBA method using helicase included in the present invention, the target nucleic acid molecule to be amplified is DNA. Therefore, the present invention includes a kit for amplifying a nucleic acid using a target DNA as a template, or a method for amplifying, which contains components and helicases used in the NASBA method. Furthermore, the present invention also includes a kit for amplifying a nucleic acid using a target DNA as a template, which comprises at least one component used in the NASBA method and a helicase.

  In the NASBA method, the reaction proceeds in a solution obtained by adding a target nucleic acid and a primer set as a substrate to reverse transcriptase, DNA-dependent DNA polymerase, RNase H, RNA polymerase, NTP, and dNTP. Therefore, also in the present invention, components used in the NASBA method include reverse transcriptase, DNA-dependent DNA polymerase, RNase H, RNA polymerase (preferably T7 RNA polymerase), NTP, and dNTP. A reverse transcriptase having both RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity (that is, DNA and RNA-dependent DNA polymerase) is also known, and such reverse transcriptase is also preferably used in the present invention. it can. When the reverse transcriptase is used, a DNA-dependent DNA polymerase may not be used.

  The reverse transcriptase is not particularly limited, and a known reverse transcriptase can be used. A reverse transcriptase having reverse transcription activity at about 40 to 45 ° C is preferred, and a reverse transcriptase having an optimum temperature of about 40 to 45 ° C is more preferred. Commercially available products can be purchased and used as reverse transcriptase. An example of a particularly preferred reverse transcriptase is AMV reverse transcriptase (AMV-RT). AMV-RT is a DNA and RNA dependent DNA polymerase. AMV is an abbreviation for Avian Myeloblastosis Virus.

  RNaseH is not particularly limited, and known RNaseH can be used. RNase H having RNase activity at about 40 to 45 ° C. is preferable, and RNase H having an optimum temperature of about 40 to 45 ° C. is more preferable. For example, E. coli-derived RNase H can be mentioned. As RNase H, a commercially available product can be purchased and used.

  The RNA polymerase is not particularly limited as long as it has a DNA-dependent RNA polymerase activity, and a known RNA polymerase can be used. An RNA polymerase having RNA polymerase activity at about 40 to 45 ° C is preferred, and an RNA polymerase having an optimum temperature of about 40 to 45 ° C is more preferred. For example, T7 RNA polymerase can be preferably mentioned. As RNA polymerase, a commercial item can also be purchased and used.

  NTP is preferably a mix of ATP, GTP, CTP and UTP. Moreover, it is preferable that dNTP is a mix of dATP, dGTP, dCTP, and dTTP.

  In addition, as a purchase place of the commercial item of the above enzyme, Takara Bio Inc., NEB, Promega Corporation etc. are mentioned, for example.

  Particularly preferred combinations of components used in the NASBA method include DNA and RNA-dependent DNA polymerase, RNase H, T7 RNA polymerase, NTP, and dNTP.

  The target DNA may be single-stranded or double-stranded, but in the case of double-stranded, it is preferable to perform an operation of breaking it into single-stranded at the start of reaction. Examples of the operation include heating (for example, at 90 to 98 ° C. for about 1 to 10 minutes).

  As the structure of the primer set used for amplification of the target DNA, the forward primer is DNA comprising a sequence that anneals to the target DNA, the reverse primer is provided at the 5 ′ end of the DNA comprising the sequence that anneals to the target DNA, and further the RNA polymerase promoter It has a structure in which DNA composed of sequences is bound and contained.

  In amplifying the target DNA, a reverse primer complementary to the single-stranded DNA (sense strand) is annealed. The forward primer has a sequence complementary to DNA (antisense strand) generated by extension of the reverse primer. The forward primer anneals to the DNA (antisense strand) and extends the DNA (sense strand).

  The RNA polymerase promoter sequence possessed by the reverse primer is preferably one that can be recognized by the RNA polymerase used. For example, when the RNA polymerase used is T7 RNA polymerase, the RNA polymerase promoter sequence that the reverse primer has is preferably a T7 RNA polymerase promoter sequence.

  The sequence that anneals to the target DNA is a complementary sequence, or one to a plurality of (for example, 2, 3, 4, or 5) bases are deleted, substituted, and / or added in the complementary sequence. A sequence is preferred. In both the forward primer and the reverse primer, the base at the 3 'end is preferably a complementary base to the base of the single-stranded DNA that each anneals.

  A known helicase can be used as the helicase. Although not particularly limited, a helicase having helicase activity at about 40 to 45 ° C is preferable, and a helicase having an optimum temperature of about 40 to 45 ° C is more preferable. Moreover, as an example of a preferable helicase, for example, a hyperthermic archaea-derived DEAD-box type RNA helicase and a modified form thereof can be used. More specifically, for example, the hyperthermic archaic DEAD-box type RNA helicase described in International Publication No. 2016/013620 and a variant thereof can be used. Moreover, the helicase of said (iii) can also be used. Still further, examples of preferred helicases for use in the present invention (β) include TK0460 and its variants. By using TK0460 and its variants, the target DNA molecule can be detected particularly sensitively and accurately by the NASBA method.

  TK0460 is a helicase derived from Thermococcus kodacarensis, a hyperthermophilic archaea belonging to the genus Thermococcus. The amino acid sequence of TK0460 is shown in SEQ ID NO: 22. In addition, the term “modified product” as used herein refers to a product that is not identical in amino acid sequence but has high identity and has helicase activity. The variant of TK0460 is a helicase having an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of TK0460 and having helicase activity. Here, “1 or 2 or more” in “1 or 2 or more amino acids are deleted, substituted or added” is preferably 1 to 30 (that is, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30), more preferably 1 to 20, more preferably 1 to 10, still more preferably 1 to 5, particularly preferably 1, 2 or 3. The amino acid sequence of the variant of TK0460 is preferably 80% or more in identity with the amino acid sequence of TK0460, more preferably 90% or more, still more preferably 95% or more, and 98% or more. It is still more preferable that it is 99% or more. The method for measuring helicase activity is as described in the description of (α) above.

  The content (concentration) of helicase in the helicase-containing NASBA mix can be appropriately set, and is usually 100 nM or less, for example, preferably 100 aM to 100 nM, more preferably 1 fM to 75 nM, further preferably 1 pM to 50 nM, and 1 nM to 30 nM is even more preferable. Alternatively, since the NASBA amplification efficiency can be good even if the helicase concentration is relatively low, it may be, for example, about 200 aM to 20 nM, 20 aM to 2 nM, 2 aM to 200 pM, or 200 fM to 20 pM.

  In this specification, “including” includes “consisting essentially of” and “consisting of” (The term “comprising” includes “consisting essentially of” and “consisting of.”).

Hereinafter, the present invention will be specifically described, but the present invention is not limited to the following examples. First, (α): a method for efficiently synthesizing cDNA by using a combination of three specific enzymes will be described in detail. Next, (β): a target nucleic acid is obtained by using a helicase in the NASBA method. A method for improving the synthesis efficiency also in the case of DNA will be specifically described.
<About (α)>
(I) Production of reverse transcriptase According to the description in the “Example” column of WO 2012/020759 pamphlet (especially the description in Example 4), the mutated reverse transcriptase of MMLV reverse transcriptase (consisting of the amino acid sequence of SEQ ID NO: 1) (E286R / E302K / L435R / D524A) was obtained. The multiple mutant reverse transcriptase is sometimes referred to as reverse transcriptase MM4. The enzyme was used in the following studies as (i) reverse transcriptase.

(Ii) Production of reverse transcription DNA polymerase According to the description in the “Example” column of WO2010 / 050418 pamphlet (especially the description in Example 1 and Example 3), Thermotoga sp. A mutant reverse transcribed DNA polymerase in which the leucine at position 329 of the DNA polymerase derived from the K4 strain (consisting of the amino acid sequence of SEQ ID NO: 2) is substituted with alanine is obtained, and it is further determined that the reverse transcribed DNA polymerase has reverse transcription activity. -Confirmed by PCR. The mutant reverse transcription DNA polymerase was used in the following examination as (ii) reverse transcription DNA polymerase.

(Iii) Production of helicase The total DNA of kodakarensis was used as a template, and the TK0566 gene was amplified using primers (TK0566EX-F (SEQ ID NO: 5), TK0566EX-R (SEQ ID NO: 6)). The obtained DNA fragment containing the TK0566 gene was cleaved with NdeI and EcoRI and inserted into pET28a. Using the constructed pET-TK0566 plasmid, E. coli was used. E. coli BL21-Codon-Plus (DE3) -RIL was transformed. Pre-culture in 5 mL of LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl; adjusted to pH 7.3 with NaOH) at 37 ° C. for 6 hours, and in 20 mL of LB medium (1 % Inoculation, 37 ° C., 10 hours). Furthermore, 1 L culture was performed at 37 ° C. using a jar fermenter, and β-D-1-thiogalactopyranoside (IPTG) (final concentration 1 mM) was added and induced when OD ₆₆₀ was around 0.4. Bacteria were collected 4 hours after induction, and the expression of TK0566 was confirmed by SDS-PAGE. The LB medium contains 20 μg / mL kanamycin and 30 μg / mL chloramphenicol. The cultured cells were collected, suspended in 10 mL of buffer D: 20 mM Tris-HCl, 500 mM NaCl, 0.1% Triton X-100, pH 7.9, and sonicated. The crushed liquid was centrifuged at 8000 g for 10 minutes, and the supernatant was heat-treated at 80 ° C. for 15 minutes. Then, the supernatant was collected again by centrifugation at 8000 g for 10 minutes. Since His6tag was added to the N-terminal side of the expressed TK0566, it was purified using a Ni column. The column was equilibrated with buffer D, and the supernatant was applied thereto. Then, after washing with buffer E: 20 mM Tris-HCl, 500 mM NaCl, 20 mM imidazole, 0.1% Triton X-100, pH 7.9, buffer F: 20 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole, 0.1% Elute with Triton X-100, pH 7.9. The eluted fraction was dialyzed against buffer D.

ATPase activity measurement ATPase activity was measured by measuring the amount of free phosphate released when ATP was converted to ADP. First, 63mer RNA (ssRNA63) which is ssRNA was used as a substrate in order to examine nucleic acid dependency. The total volume of the reaction solution was 10 μL, 5 nM nucleic acid substrate, 0.2 μM purified protein, 1 mM ATP, 2 mM MgCl ₂ , 2 mM DTT, 4 units of Ribonuclease inhibitor (Human placenta) (Takara Bio), 50 mM HEPES (pH 7.6) including. This was reacted at 50 ° C. to 110 ° C. for 30 minutes and immediately transferred onto ice to stop the reaction. The amount of free phosphoric acid in the reaction solution was measured using BIOMOL GREEN ^™ (BIOMOL), and Ab ₅₃₀ was measured using Multiskan Spectrum (ThermoLab Systems). Thereby, it was confirmed that the obtained purified protein (helicase) had ATPase activity.

Rewinding activity measurement In the unwinding activity measurement, double-stranded DNA was used as a substrate. One of the double-stranded DNA strands was fluorescently labeled. In addition to the substrate, single-stranded DNA (trap DNA) for trapping the single strand released by unwinding the double-stranded DNA with a helicase was added to the measurement system. Specifically, the measurement was performed with a combination of the following three types of substrates and trap DNA (in each type, double-stranded DNA formed by two DNAs other than trap DNA was used as a substrate).

Both ends protruding type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / TCACTCCCGCATCTGCCGATTCTGGCTGTGGCGGTTTCTGGGTGGTCTCTAGGTC-3 '
(70-mer)
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAGGAAGCCGATTGCGAGGCCGTCCTACCATCCTGCAGG-3 '
(34-mer (trap DNA))
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAG-3 '
5 'protruding type (34-mer fluorescently labeled with IRD700)
5'-d / IRD700 / GACCTAGGAACCCACAGAAACACGCCACAGCCAG-3 '
(54-mer)
5'-dTCACTCCCGCATCTCCGCATTCTGGCTGTGGCGTGTTCTGGTGGTTCCTAGGGTC-3 '
(34-mer (trap DNA))
5'-dCTGGCTGTGGCGGTTTCTGGGTGGTCTCTAGGTC-3 '
3 'protruding type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / CTGGCTGTGGCGGTGTTCTGGTGGTCTCTAGGTCTTAGCCGTTCTACGCCTCACT-3 '
(34-mer)
5'-dGACCTAGGAACCACCAGAAACACCCCCACAGCCAG-3 '
trap DNA is similar to 5 'overhang
Blunt end type (54-mer fluorescently labeled with IRD700)
5'-d / IRD700 / GACCTAGGAACCACCAGAAACACGCCCACAGCCAGAATCGGCAGATGCGGAGTGA-3 '
(54-mer (trap DNA))
5'-dTCACTCCCGCATCTCCGCATTCTGGCTGTGGCGTGTTCTGGTGGTTCCTAGGGTC-3 '

  The excitation wavelength of IRD700 is 685 nm and the fluorescence wavelength is 712 nm.

  Specifically, it was performed as follows. Table 7 shows the composition of the reaction solution for preparing the substrate. After treatment at 95 ° C. for 3 minutes with the reaction composition shown in Table 7, the mixture was allowed to stand at room temperature, and then treated at 25 ° C. for 1 hour. The prepared substrate was diluted 10-fold to prepare a 2 μM double-stranded DNA solution. And it was made to react with the to-be-measured helicase at 50 degreeC by the composition of Table 8 for 40 minutes. The reaction was stopped by quenching on ice. The sample was diluted 3 times, 2 μL of the sample was mixed with 1 μL of 10 × loading buffer and 7 μL of water, applied to a 13% acrylamide gel, and subjected to Native Page for 15 minutes at 15 mA while shielding light. And fluorescence was detected using Odyssey (Odyssey infrared imaging system (LI-COR, Nebraska, USA)). As the amount of helicase added was increased, the amount of double-stranded DNA in the substrate decreased (FIGS. 1a to 1f), so that it was confirmed that the purified protein (helicase) to be measured had rewinding activity. It was also found that the purified protein (helicase) unwinds double-stranded DNA from the 3 'end side.

The purified protein was used in the following studies as (iii) helicase.

Examination of cDNA synthesis reaction conditions It is difficult to find conditions that can function well in a system containing all three enzymes, namely (i) reverse transcriptase, (ii) reverse transcription DNA polymerase, and (iii) helicase. . This is because the optimum conditions under which each enzyme works are different.

  In particular, helicases are used in cDNA synthesis reactions with the expectation of reducing nucleic acid misannealing and suppressing non-specific amplification. Under the reaction conditions that sufficiently retain the action of reverse transcriptase, helicases It is extremely difficult to eliminate mis-annealing by the action. This is because the optimum conditions for reverse transcriptase and helicase differ greatly.

Therefore, in the three-enzyme-containing cDNA synthesis system, each factor that may affect the reaction was optimized as much as possible using the following method.
1) Thirteen factors that could affect the response were listed, and three levels (level 1, level 2, and level 3 respectively) were set for each factor. An example is given in Table 13. In Table 13, factors A to N are condition study factors, and the concentration of each factor is examined by dividing it into three levels.
2) One level was chosen from each factor and 27 different reaction conditions were determined. An example is given in Table 14. As is apparent from Table 14, one level for each factor is used for nine reaction conditions.
3) cDNA synthesis was performed under different reaction conditions (100 to 1,000,000) for each of the 27 reaction conditions, and a higher score was obtained for each reaction condition with higher detection sensitivity. It was. In addition, for each level of each factor, the score of the reaction condition in which that level was used was totaled. An example is given in Table 15. It can be said that the highest score is preferable for each factor.
4) Further, the contribution ratio of each factor to the score when the whole was 100% was determined. An example is given in Table 15.
5) Factors with large contribution ratios were examined in more detailed conditions in the following factor analysis, taking levels within a narrow range.

  Table 16 lists the new factors and levels based on the results in Table 15. For example, for MM4, the contribution ratio is the second highest and the score is highest at level 3 (1 nM). Therefore, MM4 was considered to have a higher contribution ratio and higher concentration, so the score was better. In the study (Table 16), conditions are set so that it is possible to study what happens when the concentration is made higher than 1 nM. Conversely, the contribution rate of D4R4 concentration (primer concentration) is extremely low, so it is judged that it is not an important factor. In the next study (Table 16), the ATP concentration is newly examined by removing it from the condition study factors. It is added as a factor.

  In the description of each factor in Table 13, Table 15, and Table 16, MM4 indicates reverse transcriptase MM4, L392A indicates reverse transcriptase DNA polymerase, TK0556 indicates helicase, and D4R4 indicates primer DR4-4. .

  The examination was repeated in the above cycle to search for the optimum conditions in the three enzyme-containing cDNA synthesis system.

Detection of cDNA synthesis product by PCR 1
A cDNA synthesis reaction was performed under the following reaction conditions. The following conditions are the optimum conditions obtained as a result of searching for the optimum conditions in the three enzyme-containing cDNA synthesis system as described above.

Reverse transcriptase MM4 10 nM
Reverse transcription DNA polymerase (L329A) 50 nM
Helicase (TK0566) 20 nM
dNTP (each) 0.2 mM
KCl 50 mM
Tris-HCl (pH 8.3): 25 mM
Bicine-KOH (pH 8.2): 50 mM
MgCl ₂ : 5 mM
Mn (CH ₃ COO) ₂ 1 mM
CH ₃ COOK 30 mM
Trehalose 0.1M
ATP 1 mM
E. coli RNA 10 μg / ml
Temperature 50 ℃
Reaction time 30 minutes RNA (sequence is shown in FIG. 2) 100, 1000, 10,000, 100,000, 1 million molecules Primer DR4-4 (sequence is shown in FIG. 2) 1 μM
Reaction volume 10 μl

  Next, cDNA synthesis reaction was performed under the following reaction conditions.

Primer DR4-4 (sequence shown in FIG. 2) 1 μM
Primer DF2-2 (sequence shown in FIG. 2) 1 μM
1.5 μl of the above reaction solution
dNTP (each) 0.2 mM
MgSO ₄ 1 mM
10 × Buffer 2.5 μl attached to KOD-Plus-Neo (Toyobo)
10 units / ml KOD-Plus-Neo (Toyobo) 0.5 μl
Temperature conditions 95 ° C 30 seconds, 59 ° C 30 seconds, 72 ° C 30 seconds, 30 cycles

  The results of subjecting the reaction product to 2% agarose electrophoresis are shown in FIG. In FIG. 3, lane 1 is the above condition containing 1 million molecules of RNA, lane 2 is the above condition containing 100,000 molecules of RNA, lane 3 is the above condition containing 10,000 molecules of RNA, and lane 4 is 1000 molecules of RNA. Lane 5 contains 100 molecules of RNA, lane 6 contains 1 million molecules of RNA, and does not contain any of reverse transcriptase MM4, reverse transcriptase DNA polymerase (L329A) and helicase. The results when cDNA synthesis was carried out are shown.

  Since a thin band was seen in lane 5, after performing cDNA synthesis with 3 enzymes in 10 μl of a sample containing 100 molecules of target RNA, PCR performed on 1.5 μl of sample (equivalent to 15 molecules of target RNA) It was shown that amplified DNA was detected.

Detection of cDNA synthesis product by NASBA cDNA synthesis was carried out under the conditions described above in “ Detection of cDNA synthesis product by PCR” (RNA is 1 million molecules, volume 20 μl).

  Next, the reaction product was diluted with water to 10 9 times, 10 10 times, or 10 11 times, and 2.5 μl of each was added to the NASB-Nucleic Acid Chromatography Detection Reagent Kit for Cereus (Inc. Kainos: Swift Gene (registered trademark) Cereulide-producing Cereus "Kainos"). The results are shown in FIG. In FIG. 4, IC is an internal control line for confirming that amplification inhibition has not occurred, reference is a line for confirming normal development in nucleic acid chromatography, and ces is the target cereus RNA. The line when it is detected is shown. A is 10 molecules of cesD RNA, B is water, C is a reaction product of cDNA synthesis diluted to the ninth power of 10, D is a reaction product of cDNA synthesis diluted to the 10th power of 10, and E is The results of subjecting the cDNA synthesis reaction product diluted to the 11th power of 10 to NASBA-nucleic acid chromatography are shown.

  Since a band was detected at the position of ces in lanes C and D, cDNA synthesis was performed with 3 enzymes using 20 μl of a sample containing 1 million molecules of target RNA, and then the reaction solution was diluted to 10 μl of 10 × 2.5 μl. It was shown that amplified RNA was detected by NASBA performed on the cells.

Detection of cDNA synthesis product by PCR 2
Using 16S rRNA, which is known to have a secondary structure, and 16S miss Rv2 25-5-5 ′, which is a primer having a mismatch of 5 bases, a cDNA synthesis reaction was performed under the following reaction conditions.

Reverse transcriptase MM4 10 nM
Reverse transcription DNA polymerase (L329A) 50 nM
Helicase (TK0566) 0, 2, 40, or 130 nM
dNTP (each) 0.2 mM
KCl 50 mM
Tris-HCl (pH 8.3): 25 mM
Bicine-KOH (pH 8.2): 50 mM
MgCl ₂ : 5 mM
Mn (CH ₃ COO) ₂ 1 mM
CH ₃ COOK 30 mM
Trehalose 0.1M
ATP 1 mM
E. coli RNA 10 μg / ml

T.A. Kodakarensis 16S rRNA (sequence shown in FIG. 5) 100 ng / ml;
Primer 16SRv (sequence shown in FIG. 5) 1.2 μM;
Primer 16S miss Rv2 25-5-5 ′ (sequence shown in FIG. 5) 1.2 μM;
Reaction volume 20 μl
Temperature 45 ° C
Reaction time 30 minutes

Next, PCR was performed under the following reaction conditions.
Primer 16S Fw (sequence shown in FIG. 5) 1.2 μM
Primer 16S Rv (sequence shown in FIG. 5) 1.2 μM
2.0 μl of the above reaction solution
dNTP (each) 0.2 mM
MgSO4 1 mM
10 × Buffer 2.5 μl attached to KOD-Plus-Neo (Toyobo)
10 units / ml KOD-Plus-Neo (Toyobo) 0.5 μl
Temperature conditions 94 ° C 3 minutes 94 ° C 15 seconds, 60 ° C 30 seconds, 68 ° C 120 seconds, 30 cycles 68 ° C 5 minutes

  The results of subjecting the above reaction product to 1% agarose electrophoresis are shown in FIG. When the cDNA synthesis reaction was performed in the presence of reverse transcriptase MM4 and reverse transcriptase DNA polymerase (L329A) and in the absence of helicase (TK0566), a 1500 base pair band was not observed (lane 1). On the other hand, in the presence of MM4 and L329A, and in the presence of TK0566 2 nM (lane 2) or 40 nM (lane 3), a band of 1500 base pairs was seen, indicating that TK0566 increases the efficiency of the cDNA synthesis reaction. . However, a 1500 base pair band was not observed in the presence of MM4 and L329A and in the presence of TK0566 130 nM (lane 4). This suggested that the presence of TK0566 at an excessive concentration may reduce the efficiency of the cDNA synthesis reaction.

Detection of cDNA synthesis product by PCR 3
A cDNA synthesis reaction was performed under the following reaction conditions.

Reverse transcriptase MM40 0 or 10 nM
Reverse transcription DNA polymerase (L329A) 0 or 1000 nM
Helicase (TK0566) 0 or 20 nM
dNTP (each) 0.2 mM
KCl 50 mM
Tris-HCl (pH 8.3): 25 mM
Bicine-KOH (pH 8.2): 50 mM
MgCl ₂ : 5 mM
Mn (CH ₃ COO) ₂ 1 mM
CH ₃ COOK 30 mM
Trehalose 0.1M
ATP 1 mM
E. coli RNA 10 μg / ml
Temperature 50 ℃
Reaction time 30 minutes RNA (same as that used in detection 1 of cDNA synthesis product by PCR) 1 million molecules Primer DR4-4 0.5 μM
Reaction volume 10 μl

  Next, cDNA synthesis reaction was performed under the following reaction conditions.

Primer DR4-4 0.4 μM
Primer DF2-2 0.4 μM
4.0 μl of the above reaction solution
dNTP (each) 0.12 mM
Bicine (pH 8.2) 50 mM
Mn (CH3COO) 2 1 mM
CH3COOK 110 mM
Glycerol 8%
Temperature conditions 95 ° C 30 seconds, 59 ° C 30 seconds, 72 ° C 30 seconds, 30 cycles

  The result of subjecting the reaction product to 2% agarose electrophoresis is shown in FIG. Lane 1 is in the absence of reverse transcriptase MM4, reverse transcriptase DNA polymerase (L329A) and helicase (TK0566), lane 2 is in the presence of MM4 and L329A and TK0566 are not present, lane 3 is in the presence of L329A and MM4 and TK0566 In the absence, lane 4 is in the presence of TK0566 and in the absence of MM4 and L329A, lane 5 is in the presence of MM4 and L329A and in the absence of TK0566, lane 6 is in the presence of MM4 and TK0566 and in the absence of L329A, lane 7 is L329A Lane 8 shows the results when cDNA synthesis was performed in the presence of MM4, L329A, and TK0566, respectively, in the presence of TK0566 and in the absence of MM4.

  The target bands were detected in lanes 5 and 8, and the band of 8 was detected darker than lane 5. From this, it was found that if MM4 and L329A are present, an amplification reaction occurs without adding a new enzyme in the PCR step, and that TK0567 can be further added to synthesize cDNA more efficiently.

<About (β)>
Preparation of helicase TK0460 Thermococcus kodakarensis KOD1 strain (Atomi et al. Archaea. 2004, 1 (4): 263-7.) In 20 ml of ASW-YT-S ⁰ medium (Atomi et al. Archa. : 263-7.) And liquid culture was performed at 85 ° C. for 12 hours. The grown cells were centrifuged at 10,000 × g and 4 ° C. for 20 minutes. Genomic DNA was extracted from the obtained cells by phenol-chloroform-isoamyl alcohol (Nippon Gene, Code No. 311-90151) treatment and ethanol precipitation treatment. PCR was performed using the obtained genomic DNA, primer set tk-0460-Fw (SEQ ID NO: 20), tk0460-Rv (SEQ ID NO: 21) and KOD-plus polymerase (Toyobo, Code No. KOD-201X10), and TK0460 The gene was amplified. The amplified TK0460 gene was purified by Wizard SV Gel and PCR Clean-Up System (Promega, Code No. A9241) and then subjected to restriction enzyme treatment with NdeI and NotI (Takara Bio). The obtained restriction enzyme-treated fragment was introduced into the NdeI / NotI site of pET-28a (Merck Millipore, Code No. 69864-3CN). The TK0460 expression vector obtained by gene transfer was designated as pET28a-TK0460.

pET28a-TK0460 was introduced into Escherichia coli BL21 CodonPlus (DE3) (Agilent Technology, Code No. 230280). A colony of the transformant on the LB agar medium was inoculated into 15 ml of an LB liquid medium containing 20 μg / ml kanamycin and 25 μg / ml chloramphenicol, and cultured with shaking at 37 ° C. for 12 hours to prepare a preculture solution. 15 ml of the preculture was inoculated into 1.5 liters of LB liquid medium containing 20 μg / ml kanamycin and 25 μg / ml chloramphenicol, and cultured with shaking at 37 ° C. When the OD _{660 of the} culture solution reached 0.5, isopropyl-β-thiogalactopyranoside was added to the culture solution to a final concentration of 0.1 mM, and cultured with shaking at 37 ° C. for 4 hours. TK0460 was expressed. Next, it was centrifuged at 10,000 × g and 4 ° C. for 20 minutes to collect the grown cells. 15 ml of disruption buffer (10 mM Tris-HCl (pH 8.0), 400 mM potassium chloride, 1 mM dithiothreitol, 50% glycerol, 0.1 mM sodium ethylenediaminetetraacetate) is added to the collected cells, and the output is 30 W for 15 minutes. Ultrasonic crushing. The obtained cell-free extract was centrifuged at 10,000 × g and 4 ° C. for 10 minutes. The supernatant was collected and heat-treated at 60 ° C. for 30 minutes. The heat-treated solution was centrifuged at 21000 × g and 4 ° C. for 1 hour, and the supernatant was collected. Next, the supernatant was added to a 2 ml Ni ²⁺ -NTA-agarose column (Qiagen, Code No. 30210) equilibrated with the disruption buffer, and an elution buffer containing 10 mM, 50 mM, 100 mM, 200 mM, and 500 mM of imidazole (10 mM Tris, respectively). Step elution was performed with -HCl (pH 8.0), 400 mM potassium chloride, 1 mM dithiothreitol, 50% glycerol, 0.1 mM sodium ethylenediaminetetraacetate. The fraction in which TK0460 is present was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The fraction in which TK0460 was present was subjected to PD-10 (GE Healthcare, Code No. 17085101) in which the elution buffer was substituted, and imidazole in the enzyme solution was removed. The obtained purified enzyme solution was used as helicase TK0460. A -20 ° C freezer was used for storage. The amino acid sequence of helicase TK0460 is shown in SEQ ID NO: 22.

Examination of DNA amplification by helicase-added NASBA method For examination of DNA amplification by helicase-added NASBA method , use NASBA-nucleic acid chromatographic detection reagent kit for cereus (Kinos Co., Ltd .: Swift Gene (registered trademark) cereus-produced cereus "Kinos") It was. The kit is for amplifying the cesD sequence of the ces operon of the cereulide synthase gene of Bacillus cereus by the NASBA method and confirming the presence or absence of cereus. A reagent solution containing a primer set for amplifying dNTPs, NTPs, and cesD was prepared according to the instructions in “Method for Preparing Reagents” described in the instruction manual of the kit. The base sequence of the forward primer is shown in SEQ ID NO: 23, and the base sequence of the reverse primer is shown in SEQ ID NO: 24. The reverse primer has a structure in which DNA consisting of an RNA polymerase promoter sequence is further bound to the 5 ′ end of DNA consisting of a sequence that anneals to cesD sequence DNA.

  To this reagent solution, plasmid DNA containing the cesD sequence (pCED-1, approximately 3500 bp) was heat-denatured (treated at 95 ° C. for 5 minutes and then ice-cooled), and then added to an enzyme solution (AMV-RT, RNase H, T7 RNA). 5 minutes later, helicase TK0460 was added (or not added) at a final concentration of 20 nM, and the cesD sequence DNA was amplified by the NASBA method for 25 minutes (reaction time 30 minutes). After the reaction, a developing solution was added according to the instructions of the above-mentioned kit, and then the reaction solution was subjected to nucleic acid chromatography contained in the kit to examine whether cesD sequence DNA was detected. As for the amount of plasmid DNA containing the added cesD sequence, the amount of plasmid that can be amplified in 30 minutes without helicase is 1 and the amount of 1/10, 1/100, or 1/1000 is examined. (Table 18).

  Further, it was examined whether cesD sequence DNA was detected in the same manner as described above except that the reaction time by NASBA method was 120 minutes (the addition of helicase did not change in 5 minutes from the start). Further, the plasmid DNA containing the cesD sequence was added after digestion with restriction enzyme (EcoRI or PstI) on either the forward primer side or the reverse primer side (see FIG. 8) and heat denaturation treatment. Except for the above, it was examined whether cesD sequence DNA was detected in the same manner as described above.

  The results are shown in Table 18 below. In the table, “◯” indicates that it was detected, “−” indicates that it was not detected, and “NT” indicates that it was not considered.

  As a result of examining whether the cesD sequence DNA was amplified (detected) by the NASBA method in the same manner as described above except that the helicase used was changed to TK0566 or PF0053, no helicase was used regardless of which helicase was used. The detection sensitivity was improved as compared with the case of not using it.

Claims (9)

A method of synthesizing cDNA using RNA as a template in a solution containing the following (i) reverse transcriptase, (ii) reverse transcriptase DNA polymerase, and (iii) helicase.
(I) The reverse transcriptase according to the following (i-1) or (i-2);
(I-1): In the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313 A reverse transcriptase (i-2): (i-1) comprising an amino acid sequence in which at least one amino acid selected from the group consisting of leucine at position 435 and asparagine at position 454 is substituted with a positively charged amino acid; A reverse transcriptase (ii) consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added from the amino acid sequence of the reverse transcriptase, and having reverse transcription activity (ii) The reverse transcription DNA polymerase according to (ii-1) or (ii-2) below;
(Ii-1): In the amino acid sequence of SEQ ID NO: 2, at least one amino acid selected from the group consisting of the 326th, 329th, 384th, 388th, 408th, and 438th amino acids is substituted with alanine Reverse transcription DNA polymerase (ii-2) consisting of the amino acid sequence: (ii-1) In the amino acid sequence of reverse transcription DNA polymerase of (ii-1), one or more amino acids are deleted from the state in which the amino acid substitution is maintained, Helicase according to (iii-1) or (iii-2) below reverse transcription DNA polymerase (iii) consisting of a substituted or added amino acid sequence and having reverse transcription activity;
(Iii-1): Helicase consisting of the amino acid sequence of SEQ ID NO: 3 (iii-2): an amino acid in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the helicase of (iii-1) A helicase comprising a sequence and having helicase activity A method for confirming the presence of a template RNA, comprising a step of performing a nucleic acid amplification reaction on cDNA obtainable by the method according to claim 1. Furthermore, the method of Claim 2 including the detection process of the amplified nucleic acid which can be obtained by the said nucleic acid amplification reaction. The method according to claim 2 or 3, wherein the nucleic acid amplification reaction is RT-PCR or NASBA. A cDNA synthesis kit comprising the following (i) reverse transcriptase, (ii) reverse transcriptase DNA polymerase, and (iii) helicase.
(I) The reverse transcriptase according to the following (i-1) or (i-2);
(I-1): In the amino acid sequence of SEQ ID NO: 1, glutamic acid at position 69, aspartic acid at position 108, glutamic acid at position 117, aspartic acid at position 124, glutamic acid at position 286, glutamic acid at position 302, tryptophan at position 313 A reverse transcriptase (i-2): (i-1) comprising an amino acid sequence in which at least one amino acid selected from the group consisting of leucine at position 435 and asparagine at position 454 is substituted with a positively charged amino acid; A reverse transcriptase (ii) consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added from the amino acid sequence of the reverse transcriptase, and having reverse transcription activity (ii) The reverse transcription DNA polymerase according to (ii-1) or (ii-2) below;
(Ii-1): In the amino acid sequence of SEQ ID NO: 2, at least one amino acid selected from the group consisting of the 326th, 329th, 384th, 388th, 408th, and 438th amino acids is substituted with alanine Reverse transcription DNA polymerase (ii-2) consisting of the amino acid sequence: (ii-1) In the amino acid sequence of reverse transcription DNA polymerase of (ii-1), one or more amino acids are deleted from the state in which the amino acid substitution is maintained, Helicase according to (iii-1) or (iii-2) below reverse transcription DNA polymerase (iii) consisting of a substituted or added amino acid sequence and having reverse transcription activity;
(Iii-1): Helicase consisting of the amino acid sequence of SEQ ID NO: 3 (iii-2): an amino acid in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the helicase of (iii-1) A helicase comprising a sequence and having helicase activity A mix for amplifying a nucleic acid using a target DNA as a template, comprising reverse transcriptase, RNase H, RNA polymerase, NTP, dNTP, and helicase. A kit for amplifying a nucleic acid using a target DNA as a template, comprising at least one selected from the group consisting of reverse transcriptase, RNase H, RNA polymerase, NTP, and dNTP, and helicase. A method for amplifying a nucleic acid using a target DNA as a template in a solution containing reverse transcriptase, RNase H, RNA polymerase, NTP, dNTP, and helicase. The mix according to claim 6, the kit according to claim 7, or the method according to claim 8, wherein the RNA polymerase is T7 RNA polymerase.